Articles on this page are available in 2 other languages: Spanish (3), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

The wolverine is possibly the least known of the northern hemisphere's large carnivores (2). Individuals are solitary, except for mothers with their young, and can occupy enormous home ranges depending on habitat and prey availability. Male's home ranges may encompass those of several females, and the largest have been estimated at around 920 km2 (3). Wolverines tend to alternate periods of activity and sleep throughout the day and night, when awake they are capable of crossing vast distances, climbing trees and swimming rivers (3). Mating occurs from April to August and births take place the following spring, usually within a den or sheltered area appropriated by the mother (4). Litters typically contain two to three cubs, which are born blind and with white fur. Weaned after nine to ten weeks, cubs often stay with their mother for over a year and females are therefore likely to reproduce only every couple of years (4). Wolverines are reputed to have a voracious appetite and are even known as the 'glutton' in some areas (3). They do not hibernate over the cold winter months as some other carnivores do and are opportunistic scavengers, often feeding on carrion (3). The diet varies across their range with wolverines in Scandinavia feeding on wild and domestic reindeer (4), and those in Alaska consuming whale and seal carcases (3). Food may be stored for later consumption but wolverines also actively attack some prey, especially smaller mammals such as domestic sheep (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Wolverines are widely distributed in the northern reaches of both hemispheres. In North America, they occupy remote habitats from the high mountainous interior of the Rockies to Arctic coastal tundra. They are solitary wanderers who specialize on larger vertebrate prey. They usually feed on small-to-medium size mammals, but have even been known to take down caribou, and will eat carrion. Wolverines use large home ranges of 100 to 600 square km. Males are larger than females, and their ranges are larger; a male will exclude all other males from his range, but his territory may overlap with that of several females.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the wolverine  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:45, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The elusive wolverine has a fearsome reputation - it is the largest member of the weasel family. The remoteness and voracious appetite of these creatures have led to an aggressive reputation. Males are much heavier than females and both have a stocky body and short legs (3). They are well adapted to the cold habitat of their northern range with a thick, bushy coat and broad, hairy paws (3). The glossy coat is dark brown with a paler stripe across the rump and along the sides of the body; some individuals have white throat patches (4). The powerful jaws and large teeth are able to demolish frozen carrion and bone (3). Wolverines carry their head and tail lower than the arched back and their gait appears somewhat humpy and lumbering although they can move very quickly when necessary (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic; northern Europe, northern Asia, and northern North America (Pasitschniak-Arts and Lariviere 1995, Aubry et al. 2007). The species occupies a wide elevational range; for example, in California, wolverines have been recorded at elevations of 400 to 4,300 meters (average 2425 m) (California DF&G 1990, Wilson 1982).

Historical range in North America: arctic islands to the mountains of California, Colorado, and Utah (Predator Conservation Alliance 2001), and parts of the northcentral and northeastern U.S. (where records are sketchy and scarce). Presently extirpated from most of the southern part of the range, including all of the northcentral and northeastern U.S. and most of southeastern and south-central Canada.

In Canada, the wolverine retains its original distribution in the arctic region and in the western mountain and boreal regions but has disappeared from the prairies and from areas south of the boreal forest in eastern Canada; within the boreal region a large gap distributional has developed southeast of Hudson Bay (Dauphine, 1989 COSEWIC report). There have been no verified reports of wolverines in Quebec since 1978, or in Labrador since 1950, but there are unconfirmed reports almost every year (Environment Canada, Species at Risk website).

Recent surveys in the contiguous United States indicate that wolverines appear to occupy (and are essentially limited to) the montane regions of Idaho, Montana, Wyoming, and Washington (Copeland 1996; Washington Department of Wildlife 1998; Inman et al. 2002; Giddings, pers. comm., 2003 cited by USFWS 2003; Squires, pers. comm., 2003, cited by USFWS 2003). Until recently, there had been no confirmed records of wolverine in California since 1922 (Grinnell et al. 1937); attempts to locate wolverines by means of photographic bait stations during the winters of 1991-1992 and 1992-1993 yielded no records (Barrett et al. 1994). In 2008-2010, a single male wolverine was photographed by camera traps in the central Sierra Nevada of California. However, genetic data indicate that this male is related to wolverines in the northern Rocky Mountains and not a remnant of the native California population. See Predator Conservation Alliance (2001) and Wilson (1982) for a state-by-state review of occurrence in the contiguous United States.

Data on the distribution in Eurasia are sketchy. The range in Scandinavia appears to be concentrated in the mountainous central and northern portions of Norway and Sweden, as well as in Finland (Kvam et al. 1988; Nyholm 1993 and Andersson 1995, cited by Blomqvist 1995). Wolverines also occupy the taiga and northern coniferous forest of the former Soviet Union (M. S. Blinnikov, pers. comm.). [from Petersen 1997]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The species has a circumpolar distribution, corresponding with the Boreal zone of the northern hemisphere (Kvam et al. 1988). The range of the wolverine reaches from Scandinavia through the Russian Federation and Siberia to Alaska, Canada and the western lower states of the United States south to California. The range includes territory of the following countries: Canada, China (Heilongiang, Xinjiang, Inner Mongolia), Estonia, Finland, Mongolia, Norway, Russian Federation, Sweden, and United States (Alaska, Wyoming, Idaho, Montana, Washington, Oregon and California) (Whitman 1999).

During the 19th century, wolverines disappeared from the southernmost of these areas in Europe mainly due to persecution, but also due to deforestation and other human developments. In Europe the species is now found in Norway, Sweden, Finland and European part of Russia. Within these countries wolverines are mainly found north of 60ºN. Based on geographic connectivity and genetic surveys the wolverines in Europe likely consist of five populations/occurrences.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: tundra

The wolverine is a circumpolar species occurring primarily in boreal and tundra ecosystems of North America, Europe, and Asia. In North America, the distribution extends from the Aleutian Islands of Alaska east through Canada and south to the northern Rocky Mountains. Verifiable sightings within the United States since 1985 occurred in Montana, Idaho, Washington, Oregon, Wyoming [5,31], and Alaska [42,75]. Based on genetic records, a wolverine sighted in California in 2008 migrated from Idaho [109]. Thus, it is likely a transient individual rather than from a naturalized California population. The status of other populations within the United States are either imperiled or presumed extirpated [5,83]. NatureServe provides a distributional map of wolverine.
  • 5. Aubry, Keith B.; McKelvey, Kevin S.; Copeland, Jeffrey P. 2007. Distribution and broadscale habitat relations of the wolverine in the contiguous United States. The Journal of Wildlife Management. 71(7): 2147-2158. [68156]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 42. Golden, Howard N.; Route, William T.; Becker, Earl F. 1993. Wolverine demography and ecology in southcentral Alaska: Project outline and phase I progress report: Cooperative research project. [Juneau, AK]: [Alaska Department of Fish and Game, Division of Wildlife Conservation]; [Copper Center, AK]: [U.S. Department of the Interior, National Park Service, Wrangell-St. Elias National Park and Preserve]. 27 p. [68227]
  • 83. NatureServe. 2007. Comprehensive report: Gulo gulo--wolverine, [Online]. In: NatureServe Explorer: An online encyclopedia of life. Version 6.3. Arlington, VA: NatureServe (Producer). Available: http://www.natureserve.org/explorer/servlet/NatureServe?sourceTemplate=tabular_report.wmt&loadTemplate=species_RptComprehensive.wmt&selectedReport=RptComprehensive.wmt&summaryView=tabular_report.wmt&elKey=103092&paging=home&save=true&startIndex=1&nextStar [2009, September 28]. [69432]
  • 109. U.S. Department of Agriculture, Forest Service, Tahoe National Forest. 2008. Preliminary DNA analysis completed on California wolverine, [Online]. Nevada City, CA: U.S. Department of Agriculture, Forest Service, Tahoe National Forest (Producer). Available: http://www.fs.fed.us/r5/tahoe/news/08_news_releases/08_apr_10_wolverine_dna.shtml [2008, May 19]. [70312]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Wolverines are found in North America and northern Eurasia, in the boreal zone of the northern hemisphere. They require large expanses of relatively undisturbed, boreal habitat. Wolverines are found in Scandinavia and Russia to 50 degrees North latitude. In North America they are found in Alaska and northern Canada, but can also be found in mountainous regions along the Pacific Coast as far south as the Sierras of California. Historically, wolverines were found in more southerly areas of Europe and North America, but these populations were extirpated mainly due to hunting, clearing of forests, and other human activities. Their distribution once extended as far south as Colorado, Indiana, and Pennsylvania in North America.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Wolverines have a circumpolar distribution in the northern hemisphere, and are found from the western United States, Canada, and Alaska to Siberia, Russia, Eastern Europe and Scandinavia (3). Previously their distribution extended further south reaching the Baltic States and southern California respectively, but with human encroachment the range has retreated northwards, leaving remnant populations in pockets of remaining wilderness in sub-arctic regions (3). Populations in North America and Europe are sometimes divided into separate subspecies, known as Gulo gulo luscus and G. g. gulo, respectively (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Wolverines are one of the largest members of the family Mustelidae and are unmistakable in appearance. They are terrestrial mammals with body lengths of 65 to 105 cm, tail lengths of 13 to 26 cm, and shoulder heights of 36 to 45 cm. Wolverines weigh from 9 to 30 kg, females are generally smaller than males by about 10% in linear measurements and 30% in weight. They have short, powerful limbs and 5 toes on each paw. They use a semi-plantigrade form of locomotion, with their weight primarily on their metatarsals. This distributes weight better and can be useful when traveling and hunting in snow. On hard ground, ungulates can outrun wolverines. In snow, wolverines are less likely to sink in and can often catch much larger animals that become immobilized in deep snow. Wolverine fur is usually brown or brownish-black, with a yellow or gold stripe extending from the crown of the head laterally across each shoulder and to the rump, where the stripes join at the tail. Wolverines have a stocky appearance, with a robust body, short, powerful limbs, a large head, and small, rounded ears. They have sharp claws that are semi-retractable and a very powerful bite, with which they crush bone. They are rarely seen by humans because of their low population densities and the remote terrain in which they live.

There are two subspecies of wolverines: North American wolverines (G. gulo luscus) and European wolverines (G. gulo gulo). Differences seem to be mainly genetic and probably as a result of the isolation of these two continental populations. Another possible subspecies on Vancouver Island, Canada: G. gulo vancouverensis. This population has skull morphology differences with those found on the mainland, but their status has yet to be decided.

Range mass: 9 to 30 kg.

Range length: 65 to 105 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 31.765 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 100 cm

Weight: 15000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 25%-30% heavier than females.

Length:
Range: 650-1,050 mm

Weight:
Range: "12.7-14.1 kg males; 8.3-9.9 kg females "
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from the fisher in having yellowish stripes on the sides. Differs from the badger in having darker overall coloration (badger is yellowish gray), yellowish lateral stripes, and longer limbs; lacks the white stripe that in the badger extends from the snout over the top of the head to at least the neck.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Alpine and arctic tundra, boreal and mountain forests (primarily coniferous). Limited to mountains in the south, especially large wilderness areas. Usually in areas with snow on the ground in winter. Riparian areas may be important winter habitat. May disperse through atypical habitat. When inactive, occupies den in cave, rock crevice, under fallen tree, in thicket, or similar site. Terrestrial and may climb trees.

Young are born in a den among rocks or tree roots, in hollow log, under fallen tree, or in dense vegetation, including sites under snow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Wolverines inhabit a variety of habitats in the alpine, tundra, taiga, and boreal forest zones. They are found in coniferous, mixed, and deciduous woodlands, bogs, and open mountain as well as tundra habitats (Mitchell-Jones et al. 1999). Snow is generally regarded as an important component of the wolverine's seasonal habitat requirements (Banci 1987, Hatler 1989). Wolverine habitat selection is negatively affected by human activity, including roads, infrastructure, and backcountry recreation (May et al. 2006; Krebs et al. 2007). The wolverine has vast home-ranges (Landa et al. 1998), vary from 100 to 500 km2 for males and 100 to 200 km2 for female, and good dispersal abilities. Faecal DNA sampling has detected dispersal distances of more than 500 kilometres (Flagstad 2005, Flagstad et al. 2006). Hornocker et al. (1983) consider this species as solitary, which influences the large home ranges and extensive seasonal movements.This species is nocturnal with some daylight activity and it is considered as opportunistic feeder. Wolverines prey on hares, rodents and occasionally animals as large as moose given certain snow conditions. They can also prey heavily on domestic sheep and semi-domesticated reindeer.

The wolverine is a nocturnal species (Whitman 1999) with an average life expectancy of 4 to 6 years in the wild, with a maximum of about 13 years (Pasitschniak-Arts and Lariviere 1995). The species reaches its sexual maturity at 2.5 years, breeding occurs in early spring to late fall with litters of 1-5 young (mean litter size is 3 young) born between February and April (Whitman 1999).

Wolverines are thought to have evolved to scavenge from the kills of wild ungulates abandoned by other carnivores such as the lynx and wolf, as well prey animals felled by disease or injury. Wolverines also actively hunt smaller animals such as rodents, hares, musk deer, roe deer and wild sheep; given the appropriate snow conditions they will also hunt larger animals such as moose. Conflicts arise when wolverines prey on domestic livestock such as sheep or semi-domesticated reindeer. Given their dependence on other hunters for much of its scavenged food, wolverines are able to carry and cache large amounts of meat for later consumption.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat: Elevation

Elevational and vegetation use varies by season [115]. In Norway, wolverines selected habitats at significantly higher elevations in summer than in winter (P<0.001) [65]. Average elevations used by wolverines in northwestern Montana are 4,500 feet (1,371 m) in winter, 5,500 feet (1,676 m) in spring, 6,300 feet (1,920 m) in summer and 6,200 feet (1,889 m) in fall [54]. Winter populations in Idaho ranged from 5,800 to 7,800 feet (1,800-2,400 m) [7]. In southern Alaska, wolverines are widespread above and below treeline [101]. Wolverine tracks in British Columbia and Alberta were found only in upland habitats [123]. Significantly (P<0.05) higher elevations were used during winter (3,130 feet (954 m)) than in summer (2,870 feet (874 m)) in Alaska [115]. On average, wolverines were found at 2,000 to 3,900 feet (600-1,200 m) [116], with a range of 1,000 to 5,900 feet (300-1,800 m) [42,115,116]. Elevations of 4,000 to 5,000 feet (1,219-1,523 m) were significantly avoided (P<0.05) in Alaska [115]. Movements to lower elevations during winter in Idaho may be correlated to an increase in carrion abundance attributed to big game hunting seasons [31].
  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 65. Landa, Arild; Strand, Olav; Linnell, John D. C.; Skogland, Terje. 1998. Home-range sizes and altitude selection for arctic foxes and wolverines in an alpine environment. Canadian Journal of Zoology. 76(3): 448-457. [68255]
  • 101. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 116. Whitman, Jackson S.; Ballard, Warren B.; Gardner, Craig L. 1986. Home range and habitat use by wolverines in southcentral Alaska. The Journal of Wildlife Management. 50(3): 460-463. [70386]
  • 123. Wright, Jonathan D.; Ernst, Jessica. 2004. Wolverine, Gulo gulo luscus, resting sites and caching behavior in the boreal forest. The Canadian Field-Naturalist. 118(1): 61-64. [68290]
  • 42. Golden, Howard N.; Route, William T.; Becker, Earl F. 1993. Wolverine demography and ecology in southcentral Alaska: Project outline and phase I progress report: Cooperative research project. [Juneau, AK]: [Alaska Department of Fish and Game, Division of Wildlife Conservation]; [Copper Center, AK]: [U.S. Department of the Interior, National Park Service, Wrangell-St. Elias National Park and Preserve]. 27 p. [68227]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Seasonal Variation

More info for the terms: climax, cover, selection, shrub, tundra

In general, wolverines prefer high-elevation habitats in summer and low-elevation habitats in winter [46,115]. Selection may be influenced by seasonal variation in prey selection or abundance, human disturbance, or denning requirements [31,61]. Habitat use for males in winter was negatively associated with helicopter skiing. Females were negatively associated with helicopter and backcountry skiing in winter. Overall, wolverines appear to avoid areas that are heavily utilized by people [61].

  • Winter: Suitable winter range appears to overlap with forested areas and deep spring snow cover [5,32]. Forested, birch-willow-alder (Betula spp.-Salix spp.-Alnus spp.), and rock-ice habitat types are used in south-central Alaska [116]. In Idaho, low-elevation Douglas-fir and lodgepole pine habitats are utilized [32]. Wolverines in Sweden spent their time on low mountains or in coniferous forests bordering high mountains [46]. Lowland coniferous forests are utilized in British Columbia [36]. In mid-winter, wolverines in British Columbia and Alberta appear to prefer dense climax forest with lower snow depth over stands with high snow depth [122]. Montane coniferous forests in Idaho were preferred over other habitat types, but the difference was not significant (P>0.05). Rock habitats were avoided during winter in Idaho [31]. Wolverines in Idaho were associated with streams in winter, possibly because they provided travel corridors at that time of year, which were unnecessary in summer [32]. At least one wolverine in Idaho may have been following elk downstream [7]. The habitats preferred by females in the Yukon Territory were alpine talus, subalpine conifer, and boreal conifer [10]. Wolverines traveled in areas with significantly lower snow depth than random areas (P<0.01) [122].
  • Summer: In general, wolverines use more open areas in summer than in winter. In summer, wolverines in Idaho utilized high-elevation whitebark pine habitat [32] and showed a significant preference (P<0.05) for rock cover [31]. In south-central Alaska, tundra, birch-willow-alder, and rock-ice habitat types are utilized [116]. In the Yukon Territory, the most preferred habitats were alpine shrub, subalpine shrub, subalpine grass, subalpine conifer, and boreal conifer forest [10]. Females were positively associated with alpine and avalanche habitats with abundant hoary marmots (Marmota caligata) and Columbia ground squirrels (Spermophilus columbianus) [61]. In British Columbia, wolverines occupy alpine meadows [36]. Females avoided roads and recently logged areas in British Columbia [61].
  • 5. Aubry, Keith B.; McKelvey, Kevin S.; Copeland, Jeffrey P. 2007. Distribution and broadscale habitat relations of the wolverine in the contiguous United States. The Journal of Wildlife Management. 71(7): 2147-2158. [68156]
  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 32. Copeland, Jeffrey P.; Peek, James M.; Groves, Craig R.; Melquist, Wayne E.; McKelvey, Kevin S.; McDaniel, Gregory W.; Long, Clinton D.; Harris, Charles E. 2007. Seasonal habitat associations of the wolverine in central Idaho. The Journal of Wildlife Management. 71(7): 2201-2212. [70451]
  • 36. Edwards, R. Y. 1954. Fire and the decline of a mountain caribou herd. The Journal of Wildlife Management. 18(4): 521-526. [8394]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 61. Krebs, John; Lofroth, Eric C.; Parfitt, Ian. 2007. Multiscale habitat use by wolverines in British Columbia, Canada. The Journal of Wildlife Management. 71(7): 2180-2192. [69748]
  • 116. Whitman, Jackson S.; Ballard, Warren B.; Gardner, Craig L. 1986. Home range and habitat use by wolverines in southcentral Alaska. The Journal of Wildlife Management. 50(3): 460-463. [70386]
  • 122. Wright, Jonathan D.; Ernst, Jessica. 2004. Effects of mid-winter snow depth on stand selection by wolverines, Gulo gulo luscus, in the boreal forest. The Canadian Field-Naturalist. 118(1): 56-60. [68291]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

More info for the terms: cover, density, presence, shrub, tundra

Wolverines appear to have few specific habitat requirements aside from extensive wilderness dominated by coniferous forest of sufficient size to support wide-ranging, solitary individuals [2,30,104]. In the continental United States, wolverines are primarily found in stands dominated by fir (Abies spp.), spruce (Picea spp.), hemlock (Tsuga spp.), Douglas-fir, or lodgepole pine [41,54,55]. In Oregon, source habitats include alpine tundra and all subalpine and montane forests. Within these habitats, all structural stages except the stem exclusion stage act as source habitats [119].

Wolverines are positively associated with snags, downed logs, large hollow trees, talus [29,120], remote undisturbed wilderness or wilderness with minimal motorized access [29,54], numerous denning sites, and abundant prey [29]. Denning sites may be a critical and limiting resource in wolverine habitats [31]. Other habitat attributes for wolverines in the northern Rocky Mountains and southwestern Canada include significant (P≤0.05) preferences for high elevations, topographic complexity, high annual snowfall, cirque denning habitat, and low human population density. A distribution model indicates a positive relationship with snowfall, cirque habitat, and forest edge, suggesting that alpine and subalpine habitats are important for the wolverine. Another interpretation for the model suggests that wolverines are limited to regions of low human activity rather than by vegetation structure and type [26]. Road densities of ≤0.44 km/km² were most likely to benefit wolverines in the interior Pacific Northwest, according to another habitat model. In the same model, low human population density was also a reliable predictor of wolverine presence [94].

Numerous forest cover types and open habitats are utilized by wolverines. Individuals in Idaho traveled through cover types ranging from dense timber to open ridgetops. Specific examples include low-elevation forested drainages to high-elevation cirque basins with low overstory cover [30]. A wolverine in British Columbia or Alberta traveled through a burned upland area dominated by second-growth lodgepole pine, which formed a low dense canopy [122]. Dense, homogenous black spruce stands in British Columbia and Alberta were used for traveling [123]. Summer and winter habitat use for males in British Columbia was positively correlated with moose winter range, bottomland forests, and avalanche chutes [61]. In northwestern Montana, 70% of all radio-collared wolverine relocations were in large areas of low- to medium-density, mature forest habitat. The other 30% of relocation sites were in ecotonal areas, small forested pockets, or rocky forested benches. Wet and dry forest were used 23% and 31% of the time, respectively. Alpine areas were utilized 16% of the time. On rare occasions, wolverines were relocated in burned or wet meadow areas. Dense, young forest was used less than all other habitat types [54]. Preferred habitats in the Yukon Territory were subalpine coniferous forest, boreal coniferous forest, and subalpine shrub. Other habitats favored by females include alpine shrub, subalpine mixed forest, and boreal mixed forest [10]. Males showed a strong preference for subalpine coniferous forest and subalpine shrubland in the Yukon Territory [10,12]. Riparian habitat was utilized in proportion to its availability in the Yukon Territory [12]. In south-central Alaska, use of tundra was lower than expected in winter, and use of forests was lower in summer [116].

Preferences for other habitat attributes are highly variable. Preferences for cover, aspect, slope, and elevation varied widely by individual in the Yukon Territory [10,12]. Northerly aspects were used significantly more (P<0.05) than other aspects in Idaho [31,32]. In northwestern Montana, basins, eastern and southern aspects, and edge habitats were preferred. Slopes were used 36%, basins 22%, wide river bottoms 14%, and ridge tops 8% of the time [54].

Wolverines crossed clear-cuts and recent burns in northwestern Montana but appeared to move through them quickly. Wolverines were located within 0.6 to 1.7 miles (1-3 km) of clear-cuts and active roads 12 times during the northwestern Montana study [54]. Roads, which were generally in low-lying areas, were avoided in Idaho. Wolverines were not associated with maintained trail systems or elk winter range [32].

  • 2. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 12. Banci, Vivian; Harestad, Alton S. 1990. Home range and habitat use of wolverines Gulo gulo in Yukon, Canada. Holarctic Ecology. 13(3): 195-200. [13992]
  • 26. Carroll, Carlos; Noss, Reed F.; Paquet, Paul C. 2001. Carnivores as focal species for conservation planning in the Rocky Mountain region. Ecological Applications. 11(4): 961-980. [66450]
  • 29. Conard, Benjamin R. 2000. Status and management of forest carnivores on the Beaverhead-Deerlodge National Forest. Missoula, MT: University of Montana. 81 p. Thesis. [68236]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 32. Copeland, Jeffrey P.; Peek, James M.; Groves, Craig R.; Melquist, Wayne E.; McKelvey, Kevin S.; McDaniel, Gregory W.; Long, Clinton D.; Harris, Charles E. 2007. Seasonal habitat associations of the wolverine in central Idaho. The Journal of Wildlife Management. 71(7): 2201-2212. [70451]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 61. Krebs, John; Lofroth, Eric C.; Parfitt, Ian. 2007. Multiscale habitat use by wolverines in British Columbia, Canada. The Journal of Wildlife Management. 71(7): 2180-2192. [69748]
  • 94. Rowland, Mary M.; Wisdom, Michael J.; Johnson, Douglas H.; Wales, Barbara C.; Copeland, Jeffrey P.; Edelmann, Frank B. 2003. Evaluation of landscape models for wolverines in the interior Northwest, United States of America. Journal of Mammalogy. 84(1): 92-105. [68141]
  • 104. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 41. Garrison, George A.; Bjugstad, Ardell J.; Duncan, Don A.; Lewis, Mont E.; Smith, Dixie R. 1977. No. 23--The fir-spruce ecosystem. In: Vegetation and environmental features of forest and range ecosystems. Agric. Handb. 475. Washington, DC: U.S. Department of Agriculture, Forest Service: 24-27. [68107]
  • 116. Whitman, Jackson S.; Ballard, Warren B.; Gardner, Craig L. 1986. Home range and habitat use by wolverines in southcentral Alaska. The Journal of Wildlife Management. 50(3): 460-463. [70386]
  • 120. Wisdom, Michael J.; Holthausen, Richard S.; Wales, Barbara C.; Hargis, Christina D.; Saab, Victoria A.; Lee, Danny C.; Hann, Wendel J.; Rich, Terrell D.; Rowland, Mary M.; Murphy, Wally J.; Eames, Michelle R. 2000. Source habitats for terrestrial vertebrates of focus in the interior Columbia basin: broad-scale trends and management implications. Volume 3--appendices. In: Quigley, Thomas M., ed. Interior Columbia Basin Ecosystem Management Project: scientific assessment. Gen. Tech. Rep. PNW-GTR-485. Vol. 3. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 435-529. [66652]
  • 122. Wright, Jonathan D.; Ernst, Jessica. 2004. Effects of mid-winter snow depth on stand selection by wolverines, Gulo gulo luscus, in the boreal forest. The Canadian Field-Naturalist. 118(1): 56-60. [68291]
  • 123. Wright, Jonathan D.; Ernst, Jessica. 2004. Wolverine, Gulo gulo luscus, resting sites and caching behavior in the boreal forest. The Canadian Field-Naturalist. 118(1): 61-64. [68290]
  • 30. Copeland, Jeff; Groves, Craig. 1992. Progress report: Wolverine ecology and habitat use in central Idaho. [Project No. ID W-160-R-20/Job 1/Study]. Boise, ID: Idaho Department of Fish and Game, Cooperative Wildlife Research Project. 26 p. [68235]
  • 119. Wisdom, Michael J.; Holthausen, Richard S.; Wales, Barbara C.; Hargis, Christina D.; Saab, Victoria A.; Lee, Danny C.; Hann, Wendel J.; Rich, Terrell D.; Rowland, Mary M.; Murphy, Wally J.; Eames, Michelle R. 2000. Source habitats for terrestrial vertebrates of focus in the interior Columbia basin: broad-scale trends and management implications. Volume 2--group level results. In: Quigley, Thomas M., ed. Interior Columbia Basin Ecosystem Management Project: scientific assessment. Gen. Tech. Rep. PNW-GTR-485. Vol. 2. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 157-434. [3 volumes]. [66653]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wolverines are found in alpine forests, tundra, open grasslands, and boreal shrub transition zones at or above timberline. Generally they live in areas with low human development and need large, undisturbed ranges in order to survive. During the winter, females construct nests to store food and hide young. They construct rough beds of grass or leaves in caves or rock crevices, in burrows made by other animals, or under a fallen tree. They occasionally construct their nests under the snow. Wolverines are found exclusively in areas with cold climates, which may be related to their reliance on scavenging and caching large animal prey. Cold weather helps preserve the meat for later use.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Found in alpine, tundra and northern taiga habitats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Tends to occupy higher elevations in summer, lower elevations in winter (Hornocker and Hash 1981, Whitman et al. 1986).

Male home ranges large: up to 1,000 square kilometers (RIC 1999); averaging 422 square kilometers in Montana (Hornocker and Hash 1981) and 535 square kilometers in Alaska (Whitman et al. 1986). Home ranges of females with young much smaller, ranging from 73 to 416 square kilometers (Hornocker and Hash 1981, Gardner 1985, Magoun 1985, Whitman et al. 1986, Banci 1987, Copeland 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic. Feeds on a wide variety of roots, berries, small mammmals, birds' eggs and young, fledglings, and fish (Hatler 1989). May attack moose, caribou, and deer hampered by deep snow. Small and medium size rodents and carrion (especially ungulate carcasses) often make up a large percentage of the diet. Prey are captured by pursuit, ambush, digging out dens (Biosystems Analysis 1989), or climbing into trees. May cache prey in fork of tree branches or under snow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diet Selection

More info for the terms: bog, taiga, tundra

Ungulates are generally the most important foods for the wolverine. Moose, elk, caribou, deer, and other large animals are typically taken as carrion [46,54,76,90,92,104]. Carrion is usually abundant in late winter and early spring [46,55,69]. In a 12-study synthesis, Krebs and others [62] concluded that the primary food sources for wolverines in Idaho, Montana, and Wyoming were white-tailed deer (Odocoileus virginiana), mule deer (Odocoileus hemionus), and moose. In north-central British Columbia, primary foods were moose and caribou, while in southeastern British Columbia, moose, caribou, mountain goats (Oreamnos americanus), and elk (Cervus elaphus) were most commonly eaten [62]. Moose and caribou are common in wolverine diets in Alaska [24,75,91,92]. In the Yukon Territory, ungulates consumed in winter include elk, mule deer, caribou, moose, Dall's sheep (Ovis dalli stonei and Ovis dalli dalli), and mountain goat [10]. Caribou carcasses are likely critical to the survival of wolverines in northwestern Alaska during winter [76] and possibly elsewhere if herds are present. Wolverines in Labrador declined at the same time that the woodland caribou population in the area declined [15], suggesting that wolverines are dependent on caribou as a food source in some areas.

A variety of small- to medium-sized mammals are captured by wolverines [10,75,76,92,104,115]. North American porcupines (Erethizon dorsatum) appear to be consumed regularly where they are locally abundant [10,91,92]. Quills often puncture digestive tracts and other tissues, causing infections [91] or death (review by [14]), and making the North American porcupine a particularly dangerous prey animal. Snowshoe hares are captured primarily in winter [10,46,54,80,91,104,115]. Wolverine populations were not correlated with snowshoe hare populations in the Yukon Territory [20], suggesting that snowshoe hares are not an important food source for wolverines in that area. Hoary marmots, arctic ground squirrels (Spermophilus parryii), Columbian ground squirrels (S. columbianus), and other squirrels (Sciuridae) are important summer foods where abundant [10,62,75,76,91,92,115].

Voles and lemmings are also prominent in wolverine diets [10,46,75,76,91]. Common species include northern red-backed voles (Myodes rutilis), tundra voles (Microtus oeconomus), taiga voles (Microtus xanthognathus), singing voles (Microtus miurus), western heather voles (Phenacomys intermedius), Peary Land collared lemmings (Dicrostonyx groenlandicus), and Nearctic brown lemmings (Lemmus trimucronatus) [10,75,76,92]. Mice and rats (Cricetidae), shrews (Sorex spp.), pocket gophers (Geomyidae), and other small mammals are hunted less frequently [10,46,54,75,76,80]. Voles, lemmings, ground squirrels, and other small mammals are typically captured in summer and cached for use in winter [75]. In winter, cached arctic ground squirrels can provide a steady diet of carrion for wolverines in arctic Alaska [76]. Other small mammals and birds that sustain wolverines during winter in Alaska and the Yukon Territory may be captured and cached in summer as well.

Wolverines feed on other animals if there is opportunity. Small to medium sized mammals, including carnivores, are hunted or scavenged. Prey items in winter in the Yukon Territory include American pikas (Ochotona princeps), American beavers (Castor canadensis), American martens (Martes americana), American mink (Mustela vison), short-tailed weasels (Mustela erminea), wolverines, coyotes (Canis latrans), gray wolves (Canis lupus), and Canada lynx (Lynx canadensis) [10]. In northwestern Montana, wolverine diets consisted of American beavers, weasels (Mustela spp.), and other wolverines [54]. Red fox (Vulpes vulpes) carcasses were found in dens in Finland [90]. On the Alaskan coast, wolverines feed on whale (Cetacea), walrus (Odobenus rosmarus), and seal (Otariidae or Phocidae) carcasses that wash up on shore [91].

Birds, bird eggs, fish, and insects are consumed when available [10,11,46,54,75,76,80,91,92,104,115]. Ptarmigan (Lagopus spp.) are the most commonly captured birds [19,75,76,90]. Winter foods in Alaska include European magpie (Pica pica), hawks, others birds, and fish [92]. Wolverines consume salmon in southeast Alaska, but it is unclear whether they catch salmon directly or scavenge for leftover carcasses [117]. Wolverines prey on bald eagle (Haliaeetus leucocephalus) and northern goshawk (Accipiter gentilis) chicks, corvids (Corvidae), owls (Strigidae), gulls and terns (Laridae), grouse (Tetraonidae), and fish in the Yukon Territory [10,35]. A great horned owl (Bubo virginianus) nest may have been raided by a wolverine in the Yukon Territory as well [35]. Wolverines in Nunavut killed Ross's geese (Chen rossii), lesser snow geese (Chen caerulescens caerulescens), and their eggs. The geese and most of the eggs were cached for later use. Wolverines in Nunavut also stole geese carcasses from arctic foxes (Alopex lagopus) [95]. When opportunities arise, wolverines forage on insects and bird eggs [10,75,80].

Vegetation, including seeds, mountain cranberries, bog blueberries (Vaccinium uliginosum), kinnikinnick (Arctostaphylos uva-ursi) berries, and other fruits, is consumed seasonally [10,46,55,91,104].

Coyotes, bobcats, mountain lions, and fishers compete directly with wolverines for food [55]. Wolverines also raid caches created by red foxes and grizzly bears [75]. Wolverines commonly raid baited traps and kill trapped furbearers [54]. In an account recorded by Grinnell [44], a native hunter in Alaska observed a wolverine defending a caribou carcass from a bear (Ursus spp.). During the fight, the bear was mortally wounded and found dead 200 to 300 yards (180-270 m) from the caribou. The bear had been disembowelled by the wolverine [44], but it is unclear whether this occurred during the fight or after the bear was already dead.

In an exceptional circumstance, the remains of 5 wolverines and 2 American martens were discovered in a dry wooden water tank within an Engelmann spruce-subalpine fir forest in Banff National Park, Alberta. Only 1 wolverine carcass remained intact when observed on May 26, 1963. The observers presumed that dead or dying individuals trapped in the tank were cannibalized as new individuals became trapped until only the single female wolverine remained. The last female apparently starved to death after the other individuals had been consumed [38].

  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 14. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 15. Banfield, A. W. F.; Tener, J. S. 1958. A preliminary study of the Ungava caribou. Journal of Mammalogy. 39(4): 560-573. [12994]
  • 19. Boles, Bruce K. 1977. Predation by wolves on wolverines. The Canadian Field-Naturalist. 91(1): 68-69. [68403]
  • 24. Burkholder, Bob L. 1962. Observations concerning wolverine. Journal of Mammalogy. 43(2): 263-264. [69202]
  • 35. Doyle, F. I. 1995. Bald eagle, Haliaeetus leucocephalus, and northern goshawk, Accipiter gentilis, nests apparently preyed upon by a wolverine(s), Gulo gulo, in the southwestern Yukon Territory. The Canadian Field-Naturalist. 109(1): 115-116. [68364]
  • 38. Flook, Donald R.; Rimmer, James. 1965. Cannibalism in starving wolverines and sex identification from skulls. The Canadian Field-Naturalist. 79(3): 171-173. [68370]
  • 44. Grinnell, George Bird. 1926. Some habits of the wolverine. Journal of Mammalogy. 7(1): 30-34. [70385]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 62. Krebs, John; Lofroth, Eric; Copeland, Jeffrey; Banci, Vivian; Cooley, Dorothy; Golden, Howard; Magoun, Audrey; Mulders, Robert; Shults, Brad. 2004. Synthesis of survival rates and causes of mortality in North American wolverines. The Journal of Wildlife Management. 68(3): 493-502. [68148]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 76. Magoun, Audrey J. 1987. Summer and winter diets of wolverines, Gulo gulo, in arctic Alaska. The Canadian Field-Naturalist. 101(3): 392-397. [68390]
  • 90. Pulliainen, Erkki. 1968. Breeding biology of the wolverine (Gulo gulo L.) in Finland. Annales Zoologica Fennica. Helsinki: Finnish Zoological and Botanical Publishing Board. 5: 268-270. [69482]
  • 91. Rausch, R. A.; Pearson, A. M. 1972. Notes on the wolverine in Alaska and the Yukon Territory. The Journal of Wildlife Management. 36(2): 249-268. [68151]
  • 92. Rausch, Robert. 1959. Studies on the helminth fauna of Alaska. XXXVI. Parasites of the wolverine, Gulo gulo L., with observations on the biology of Taenia twitchelli Schwartz, 1924. The Journal of Parasitology. 45: 465-484. [69988]
  • 95. Samelius, Gustaf; Alisauskas, Ray T.; Lariviere, Serge; Bergman, Christoffer; Hendrickson, Christopher J.; Phipps, Kimberly; Wood, Credence. 2002. Foraging behaviours of wolverines at a large arctic goose colony. Arctic. 55(2): 148-150. [68292]
  • 104. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allen Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 80. Martin, Alexander C.; Zim, Herbert S.; Nelson, Arnold L. 1951. American wildlife and plants. New York: McGraw-Hill. 500 p. [4021]
  • 117. Willson, Mary F.; Halupka, Karl C. 1995. Anadromous fish as keystone species in vertebrate communities. Conservation Biology. 9(3): 489-497. [30313]
  • 20. Boutin, Stan; Krebs, C. J.; Boonstra, R.; Dale, M. R. T.; Hannon, S. J.; Martin, K.; Sinclair, A. R. E.; Smith, J. N. M.; Turkington, R.; Blower, M.; Byrom, A.; Doyle, F. I.; Doyle, C.; Hik, D.; Hofer, L.; Hubbs, A.; Karels, T.; [and others]. 1995. Population changes of the vertebrate community during a snowshoe hare cycle in Canada's boreal forest. Oikos. 74(1): 69-80. [66463]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The wolverine diet can include anything from small eggs to large ungulates. They are capable of bringing down prey that is five times bigger than themselves, but generally only under conditions that leave large ungulate prey stranded in deep snow. They have large claws with pads on the feet that allow them to chase down prey in deep snow. Large ungulate prey species include reindeer, roe deer, wild sheep, elk or red deer, maral and moose. Wolverines can be very swift when on the attack, reaching speeds of over 48 km an hour. Large prey are killed by biting the back or front of the neck, severing neck tendons or crushing the trachea. Wolverines are opportunistic and their diet vary with season and location. They are also specialized for scavenging and will readily take over carcasses that have been killed by other large predators. Wolverines are extremely strong and aggressive for their size, they have been reported to drive bears, cougars, and even packs of wolves from their kills in order to take the carcass. They have also been reported scavenging whale, walrus, and seal carcasses. Female wolverines may hunt more small to medium-sized animals such as rabbits and hares, ground squirrels, marmots, and lemmings, when they are rearing young. The amount of food available to females may be key in determining population size; more food leads to greater reproductive success. The scientific name Gulo gulo comes from the latin word for glutton. Like other mustelids, they can be somewhat driven to kill when given the opportunity, resulting in them killing more prey than they can eat or cache. Wolverines have been known to kill large numbers of captive reindeer in deep snow, simply because the reindeer cannot escape.

Animal Foods: birds; mammals; eggs; carrion

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates, Scavenger ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Predators

More info for the term: tree

Gray wolves are the primary predators of wolverine adults and kits [19,24,114]. An adult male in Idaho was killed by a mountain lion [31]. American black bears, grizzly bears, mountain lions, and golden eagles prey upon young, inexperienced wolverines [54]. Wolverines seek safety in trees when threatened [44] and are most vulnerable to predation when unable to climb a tree or when caught in traps [19,24]. Deep, complex den systems dug into snow offer protection to wolverine kits because predators have difficulty accessing the dens [77].

According to a review, wolverines are highly aggressive, and males occasionally kill other males [11].

  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 19. Boles, Bruce K. 1977. Predation by wolves on wolverines. The Canadian Field-Naturalist. 91(1): 68-69. [68403]
  • 24. Burkholder, Bob L. 1962. Observations concerning wolverine. Journal of Mammalogy. 43(2): 263-264. [69202]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 44. Grinnell, George Bird. 1926. Some habits of the wolverine. Journal of Mammalogy. 7(1): 30-34. [70385]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 77. Magoun, Audrey J.; Copeland, Jeffrey P. 1998. Characteristics of wolverine reproductive den sites. The Journal of Wildlife Management. 62(4): 1313-1320. [68150]
  • 114. White, Kevin S.; Golden, Howard N.; Hundertmark, Kris J.; Lee, Gerald R. 2002. Predation by wolves, Canis lupus, on wolverines, Gulo gulo, and an American marten, Martes americana, in Alaska. The Canadian Field-Naturalist. 116(1): 132-134. [68386]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Wolverines are scavengers, using the kills of larger predators, such as bear and wolves. Wolverines have few (if any) natural predators, and prey on large game and smaller animals. Wolverines are reliant on other large predators for food when snow conditions don't make it possible for them to hunt large prey themselves. The presence of wolverine urine discourages presence and feeding of black-tailed deer (Odocoileus hemionus columbianus) and snowshoe hares (Lepus americanus). Wolverines are parasitized by many kinds of endo and ectoparasites, including flukes (Opisthorchis felineus), tapeworms (Bothriocephalus, Taenia twitchelli, Mesocestoides kirbyi), roundworms (Dioctophyme renale, Soboliphyme baturini), trematodes (Alaria), nematodes (Trichinella spiralis, Molineus patens, Ascaris devosi, Physaloptera torquata, Physaloptera sibrica), ticks (Dermacentor variabilis), fleas (Oropsylla alaskensis, and ear canker mites (Otodectes cynotis).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Wolverines have few, if any, natural predators. They are fierce and aggressive, able to defend themselves against animals several times their size, such as wolves and mountain lions. However, wolves, mountain lions, black bears, brown bears, and golden eagles can be threats to young or inexperienced wolverines. Wolves are the dominant predator of wolverines, but generally only under circumstances where the wolverine cannot escape by climbing a tree. Wolverines use scents from their anal gland and urine to scent-mark food caches, discouraging other predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Gulo gulo preys on:
Geomyidae
Marmota
Cervus elaphus
Odocoileus hemionus
Ovis canadensis
Arvicolinae
Spermophilus
Marmota broweri
Castor canadensis

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Comments: Number of occurrences is unknown but there are many in North America and Eurasia. However, occurrences must be defined on a very large scale, so the number of distinct occurrences in a large region will be one or a few at most.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but probably is at least in the hundreds of thousands. Substantial populations occur in northern Canada and Alaska. Estimates reported in 2003 put the total population in western Canada at 15,000-19,000 individuals (Environment Canada, Species at Risk website).

Outside of Alaska, Montana and Idaho likely have the largest populations in the United States (perhaps a few hundred individuals in each state). Acknowledging a lack of substantial data, Predator Conservation alliance (2001) stated that extrapolation of the best available information indicates an estimated population of fewer than 750 wolverines in the contiguous United States, including an estimated 400-600 in the U.S. northern Rocky Mountains, and perhaps 100 across the Northwest and Sierra Nevada.

In North America, population density estimates range from one wolverine per 65 sq km in Montana (Hornocker and Hash 1981) to less than one per 200 sq km in northern British Columbia (Quick 1953), Alaska (Becker and Gardner 1992), and the Northwest Territories (Lee and Niptanatiak 1993). [from Petersen 1997]

In Eurasia, data on current populations are scarce. In Norway, the population was estimated to be 120 to 180 individuals (Kvam et al. 1988), in Sweden less than 100 individuals (Andersson 1995, cited by Blomqvist 1995), and in Finland approximately 90 individuals (Nyholm 1993, cited by Blomqvist 1995). In the conservation parks of Russia, the average number of encounters with wolverine tracks along 10 km transects ranged from 0.03 to 1.8 (Russian Research Center 1992). [from Petersen 1997]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Density

More info for the term: density

Wolverine densities are typically very low. An average density of 1 wolverine/65 km² was recorded for northwestern Montana [54]. Density estimates in Alaska ranged from 1 wolverine/48 km² to 1 wolverine/193 km² [17,75]. In the Yukon Territory estimates ranged from 1 individual/37 km² to 1 individual/778 km² [10,12]. Wolverine density in the Northwest Territories was estimated at 1 wolverine/136 km² to 1 wolverine/226 km² [69]. In British Columbia, wolverine density in high-quality habitats averaged 1 individual/161 km², in moderate-quality habitats 1 individual/244 km², and in low-quality habitats 1 individual/500 km² [73].
  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 12. Banci, Vivian; Harestad, Alton S. 1990. Home range and habitat use of wolverines Gulo gulo in Yukon, Canada. Holarctic Ecology. 13(3): 195-200. [13992]
  • 17. Becker, Earl F. 1991. A terrestrial furbearer estimator based on probability sampling. The Journal of Wildlife Management. 55(4): 730-737. [68155]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 73. Lofroth, Eric C.; Krebs, John. 2007. The abundance and distribution of wolverines in British Columbia, Canada. The Journal of Wildlife Management. 71(7): 2159-2169. [70450]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Solitary and wide ranging. Occurs at relatively low population densities (e.g., 1 per 65 sq km in one area in Montana).

Males in some areas apparently are territorial, but in Montana there was extensive overlap of the ranges of both the same and opposite sexes. Apparently territory/range size depends on availability of denning sites and food supply (see Wilson 1982). Some individuals travel regularly over the same route (Wilson 1982).

There are no important predators other than humans. See Whitman et al. (1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fire Management Considerations

More info for the terms: climax, cover, fire-return interval, stem exclusion stage

Forests in a stem exclusion stage are limiting to wolverines [119], so a fire that reduces canopy cover in these forests may improve habitat conditions for the wolverine. Conard [29] speculated that fire in western Montana would increase the structural diversity of forested stands, which would improve wolverine habitat.

Major prey species, including moose, white-tailed deer, mule deer, and elk, prefer habitats and browse species that are widely available following fire. For elk, fire-return intervals of 5 to 15 years may maintain adequate forage (see habitat related fire effects for elk). Moose populations peak 20 to 30 years after fire [72,113]. Fire may help reestablish moose populations when they begin to decline. Fire-return intervals required to maintain deer browse depend on the plant community. Appropriate fire-return intervals for white-tailed deer range from 3 to 5 years in southern pine forests [48] to 40 to 80 years in aspen stands in the interior western United States [34]. For more information, see habitat related fire effects for white-tailed deer. Mule deer in bunchgrass communities benefit from fire every 4 to 6 years [58], while populations in climax chaparral communities benefit from a fire-return interval of approximately 30 years [18]. For more information, see habitat related fire effects for mule deer.

Since major prey species require habitats at different successional stages, a mosaic of successional stages across a large landscape that support each species may provide consistent food sources for wolverines. If a limited number of prey species are present within wolverine habitat, however, then promoting successional stages that would be beneficial to those species could be more beneficial for wolverines.

  • 29. Conard, Benjamin R. 2000. Status and management of forest carnivores on the Beaverhead-Deerlodge National Forest. Missoula, MT: University of Montana. 81 p. Thesis. [68236]
  • 18. Biswell, Harold H. 1989. Prescribed burning in California wildlands vegetation management. Berkeley, CA: University of California Press. 255 p. [63320]
  • 48. Halls, Lowell K. 1978. White-tailed deer. In: Schmidt, John L.; Gilbert, Douglas L., eds. Big game of North America. Harrisburg, PA: Stackpole Books: 43-65. [14311]
  • 58. Johnson, Craig A. 1989. Early spring prescribed burning of big game winter range in the Snake River Canyon of westcentral Idaho. In: Baumgartner, David M.; Breuer, David W.; Zamora, Benjamin A.; Neuenschwander, Leon F.; Wakimoto, Ronald H., comps. Prescribed fire in the Intermountain region: Forest site preparation and range improvement: Symposium proceedings; 1986 March 3-5; Spokane, WA. Pullman, WA: Washington State University, Department of Natural Resources, Cooperative Extension: 151-155. [11263]
  • 72. LeResche, R. E.; Bishop, R. H.; Coady, J. W. 1974. Distribution and habitats of moose in Alaska. Le Naturaliste Canadien. 101: 143-178. [15190]
  • 34. DeByle, Norbert V. 1985. Managing wildlife habitat with fire in the aspen ecosystem. In: Lotan, James E.; Brown, James K., compilers. Fire's effects on wildlife habitat--symposium proceedings; 1984 March 21; Missoula, MT. Gen. Tech. Rep. INT-186. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 73-82. [8336]
  • 113. Weixelman, David A.; Bowyer, R. Terry; Van Ballenberghe, Victor. 1998. Diet selection by Alaskan moose during winter: effects of fire and forest succession. In: Ballard, W. B.; Rodgers, A. R. J., eds. Proceedings, 33rd North American moose conference and workshop/4th international moose symposium; 1997 May 17-23; Fairbanks, AK. In: Alces. 34(1): 213-238. [30325]
  • 119. Wisdom, Michael J.; Holthausen, Richard S.; Wales, Barbara C.; Hargis, Christina D.; Saab, Victoria A.; Lee, Danny C.; Hann, Wendel J.; Rich, Terrell D.; Rowland, Mary M.; Murphy, Wally J.; Eames, Michelle R. 2000. Source habitats for terrestrial vertebrates of focus in the interior Columbia basin: broad-scale trends and management implications. Volume 2--group level results. In: Quigley, Thomas M., ed. Interior Columbia Basin Ecosystem Management Project: scientific assessment. Gen. Tech. Rep. PNW-GTR-485. Vol. 2. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station: 157-434. [3 volumes]. [66653]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat-related Fire Effects

More info for the terms: climax, cover, density, fire regime, high-severity fire, lichen, lichens, low-severity fire, mesic, natural, short-term effects, succession, tundra, wildfire

Postfire habitat is less suitable for wolverines than unburned habitats [51]. Fire temporarily displaces wolverines, which depend on late successional habitats [43]. Wildfires in western Montana have removed climax coniferous forests from some areas, which were replaced by stands of seral or intermediate species [54]. In the Yukon Territory, wolverines occupied an area characterized by regenerating lodgepole pine, white spruce, quaking aspen, subalpine fir, and willow with remnant patches of mature forest and alpine tundra, 28 to 36 years after fire [102]. A wolverine in British Columbia or Alberta traveled through a burned upland area dominated by second-growth lodgepole pine, which formed a low, dense canopy [122]. Lowlands in northeastern British Columbia and northwestern Alberta had reached early- to mid-seral growth dominated by quaking aspen or pine (Pinus spp.) approximately 50 years after fire. Wolverines avoided these lowland areas in favor of uplands with continuous coniferous forest cover that did not burn in the fire [123].

Wolverine use of a western redcedar-western hemlock-Engelmann spruce-subalpine fir lowland forest in British Columbia was reduced following a fire that denuded most of the forest in the lowland areas. The 1926 fire spread with "explosive intensity", completely burning boles of mature trees and affecting approximately 200 mi² (520 km²) of the lowland forest. The fire had a minimal effect on the subalpine forests on higher slopes. By postfire year 27, 60% of the burned area below 4,000 feet (1,200 m) had recovered to an early-seral stage dominated by willow, quaking aspen, and birch [36].

Fire Effects on Predators and Prey: Wolverines depend on other predators, such as the gray wolf, to provide deer, elk, moose, and caribou carrion [11,46]. Thus, it is reasonable to expect that the effects of fire on wolverines would partially depend on the effects of fire on gray wolves and prey species.

  • Gray Wolf: According to a review, gray wolves avoid burned and harvested stands immediately following disturbance. Gray wolves typically are not abundant throughout early succession, although they may recolonize these areas to some extent shortly after disturbance [37]. A mosaic of postfire or postlogging successional stages within a pack's territory is necessary to sustain healthy populations of prey species [53].

    Gray wolf populations were monitored following 2 wildfires on the Kenai Peninsula, Alaska [89,98]. The populations were observed in postfire years 9 to 19 on the first site (fire occurred in 1969) and postfire years 31 to 41 on the second site (fire occurred in 1947). Gray wolves were absent from the Kenai Peninsula at the time of the fire in 1947 and reestablished in the area sometime later [98]. Gray wolves may have been attracted to the area after an increase in moose populations following the 1947 fire. Gray wolf density was high (11.1-19.5 gray wolves/1,000 km²) following the 2 wildfires [89,98]. Density estimates were not significantly different between the 2 areas [98].

    A mixed-severity wildfire in northwestern Alaska, which occurred June 15 to mid-August 1988, burned 210,000 acres (85,000 ha) of white spruce-black spruce boreal forest. Many white spruce and black spruce trees were killed. In some areas, the fire burned down to mineral soil, especially where reburning occurred. The fire had no apparent negative short-term effects on 2 gray wolf packs in the area. A year before the wildfire, the pre-burn area was used by the first pack more than expected based on availability during summer, winter, and annually (P<0.001). The same area was also used disproportionally more during the fire and in the year the fire occurred compared to areas that did not burn (P<0.001). The burned area was utilized as expected based on availability (P=1.0) during winter. The pack used the burned area proportionally less during summer (P=0.04), winter (P=0.09), and annually (P=0.03) in 1988 to 1989 than before the burn (1987-1988). One to 2 years after the fire (1989 to 1990), the pack utilized the burned area more than expected in summer (P=0.01) and annually (P<0.001), but in proportion to availability in winter (P=0.18). The burned area was used less in the second year after fire than before the fire (P≤0.02) [9].

    After 1990, the entire pack was killed by hunting or disease. Shortly afterwards, a second pack moved into the area. They initially used the burned area in proportion to its availability in winter (P=0.30) but less than expected during summer (P=0.01) and annually (P<0.001). During 1991 to 1992 (3-4 years after fire) the burn was used more than expected in summer (P<0.001) and annually (P=0.005) and in proportion to availability in winter (P=0.67). Overall, the 2 gray wolf packs showed a general preference for areas within the fire boundary than outside of it both before and after the fire [9].

    During the first 2 winters following the fire, the gray wolves used the burned area less than they had before the fire. This shift in habitat use may have reflected a shift in caribou use of the area rather than a negative effect of the fire on the gray wolf packs. By the third year, gray wolf use of the area in winter had returned to prefire levels [9].

    In summer, caribou and moose were the predominant food items for the gray wolf packs following the 1988 wildfire in northwest Alaska [103]. Thus, these prey items were evidently present in sufficient numbers during summer to support gray wolves and any potential carrion scavengers, such as the wolverine.


  • Caribou: Caribou typically have a negative response to fire because lichen forage is often destroyed [37]. Lichen forage recovers slowly following fire, forcing many caribou herds to find new feeding areas after fire. Often lichens require at least 50 years to recover before the supply is sufficient to support a caribou herd [99,107]. Thus, any wolverine populations that depend largely on caribou as a major prey species would likely suffer for decades following a fire.

    In the same northwestern Alaska wildfire mentioned for the gray wolf, sheathed cottonsedge (Eriophorum vaginatum) quality and availability had increased by 1990. It created attractive feeding sites for caribou in late winter [97], which may have provided a larger prey base for gray wolves and wolverines in the area. The improved forage quality was likely short-lived and the overall availability of food for caribou was most likely reduced several years after the fire [97].


  • Elk: In a review, Kramp and others [60] stated that clearings of 1.2 to 8.6 acres (0.5-3.5 ha) were optimal for elk. Following fall burns, the availability of spring and summer grasses, often favored by elk, increased. Regenerating quaking aspen was a highly favored browse species as well [60]. Elk use of burned units in Glacier National Park, Montana was influenced by vegetation type rather than stand age [100].

    Elk use of an area burned by wildfire in west-central Alberta increased steadily during the first 3 years after fire. As a whole, the fire was characterized as a high-severity fire. Overall use of the burned sites by elk for the first 3 postfire years peaked in July, with general use highest in May to October. Based on radio telemetry, elk showed a preference for burned-only sites but generally avoided salvage-logged and cut-and-burned sites after the wildfire. Pellet counts for elk were lowest in salvage-logged areas compared to burned-only and cut-and-burned treatments (P<0.10). Pellet counts indicated that elk use of cut-and-burned sites was significantly higher (P<0.10) than in salvage-logged or burned-only sites. Elk may have avoided salvage-logged sites because of an increase in predation risk, especially from gray wolf packs, compared to burned-only and cut-and-burned sites that provided additional cover and less coarse woody debris [52].


  • Moose: Moose generally respond favorably to fire. In a review, Fisher and Wilkinson [37] asserted that moose colonize newly burned areas to take advantage of abundant regeneration of quaking aspen and other browse species. Wolf and Zasada [121] reported that quaking aspen stands provided the most browse 1 to 5 years after fire, while birch and willow stands provided the most browse 10 to 16 years after fire. In a review of Alaskan populations, LeResche and others [72] suggested that moose densities peak 20 to 25 years after fire, with the positive effects of fire on habitat becoming negligible after 50 years. In the Kenai Peninsula, winter browse was most abundant 20 to 30 years after fire. Moderate levels of browse were available 7 to 10 years after fire, while browse availability was lowest 70 to 80 years after fire [113].

    Deciduous trees that sprout prolifically after fire, such as aspen, birch, willow, maple, and pin cherry, are heavily utilized by moose [63,86]. Browse critical for moose is characteristic of secondary stages of forest succession [71]. Unless snow packs are deep, moose may take advantage of regenerating forage within large recent burns. Recent burns may provide an area for dispersal of yearling moose. In mid-winter following a fire in Minnesota, moose moved away from the burn to nearby evergreen forest where snow cover was lower allowing access to browse [86].

    Moose densities decline following a reduction in early-seral browse species. Moose densities on the Kenai Peninsula were high 9 to 19 years after fire (3.3-3.7 moose/km²) in response to high quality habitat. On a nearby burned site, moose were at a moderate density (1.3 moose/km²) around 31 years after fire. Moose on the second site declined 41 years after fire (0.3 moose/km²) [98]. Winter moose densities following the wildfires on the Kenai Peninsula were highest 17 to 26 years (2.0-3.6 moose/km²) after a fire in 1947. Thirteen to 21 years after a 1969 fire, winter moose densities increased (3.6-4.4 moose/km²). In older forests, winter moose densities were much lower at 0.1 to 0.8 moose/km² [74].


  • White-tailed deer/ Mule deer: According to a review by Kramp and others [60], low-severity fire that creates small forest openings up to 1.2 acre (0.50 ha) is preferred by white-tailed and mule deer. Larger openings allow for greater snow accumulation, which impedes movements and feeding ability while increasing the risk of predation [60].

    In areas with deep snow cover, forage plants are often completely covered by snow in winter, preventing white-tailed deer from foraging [86]. White-tailed deer in Idaho preferred bluebunch wheatgrass/Sandberg bluegrass (Agropyron spicatum/Poa sandbergii) habitats in February because they were the only habitats at that time of year that were snow-free. By March, snow began to melt within forested habitats freeing up forage that was previously unavailable. Mule deer in the Idaho study showed a preference for burned Douglas-fir/ninebark (Physocarpus malvaceus) and burned ponderosa pine/bluebunch wheatgrass habitats throughout winter. Snow-free bluebunch wheatgrass/Sandberg bluegrass habitats were not as important for mule deer as they were for white-tailed deer [59].

    In a wildfire study from west-central Alberta (details discussed in elk subsection), deer pellet abundance was higher in burned-only and cut-and-burned sites than in salvage-logged sites (P<0.10). Deer may also have avoided salvage-logged sites due to increased risks for predation [52].

The following table provides fire regime information that may be relevant to wolverine.

Fire regime information on vegetation communities in which wolverine may occur. For each community, fire regime characteristics are taken from the LANDFIRE Rapid Assessment Vegetation Models [67]. These vegetation models were developed by local experts using available literature, local data, and/or expert opinion as documented in the PDF file linked from the name of each Potential Natural Vegetation Group listed below. Cells are blank where information is not available in the Rapid Assessment Vegetation Model.
Pacific Northwest California

Northern Rockies

Pacific Northwest
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northwest Woodland
Pine savannah (ultramafic) Replacement 7% 200 100 300
Surface or low 93% 15 10 20
Subalpine woodland Replacement 21% 300 200 400
Mixed 79% 80 35 120
Northwest Forested
Douglas-fir-western hemlock (dry mesic) Replacement 25% 300 250 500
Mixed 75% 100 50 150
Douglas-fir-western hemlock (wet mesic) Replacement 71% 400    
Mixed 29% >1,000    
Mixed conifer (southwestern Oregon) Replacement 4% 400    
Mixed 29% 50    
Surface or low 67% 22    
California mixed evergreen (northern California) Replacement 6% 150 100 200
Mixed 29% 33 15 50
Surface or low 64% 15 5 30
Mountain hemlock Replacement 93% 750 500 >1,000
Mixed 7% >1,000    
Pacific silver fir (low elevation) Replacement 46% 350 100 800
Mixed 54% 300 100 400
Pacific silver fir (high elevation) Replacement 69% 500    
Mixed 31% >1,000    
Subalpine fir Replacement 81% 185 150 300
Mixed 19% 800 500 >1,000
Mixed conifer (eastside mesic) Replacement 35% 200    
Mixed 47% 150    
Surface or low 18% 400    
Red fir Replacement 20% 400 150 400
Mixed 80% 100 80 130
Spruce-fir Replacement 84% 135 80 270
Mixed 16% 700 285 >1,000
California
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
California Forested
California mixed evergreen Replacement 10% 140 65 700
Mixed 58% 25 10 33
Surface or low 32% 45 7  
Jeffrey pine Replacement 9% 250    
Mixed 17% 130    
Surface or low 74% 30    
Interior white fir (northeastern California) Replacement 47% 145    
Mixed 32% 210    
Surface or low 21% 325    
Red fir-white fir Replacement 13% 200 125 500
Mixed 36% 70    
Surface or low 51% 50 15 50
Red fir-western white pine Replacement 16% 250    
Mixed 65% 60 25 80
Surface or low 19% 200    
Sierra Nevada lodgepole pine (cold wet upper montane) Replacement 23% 150 37 764
Mixed 70% 50    
Surface or low 7% 500    
Sierra Nevada lodgepole pine (dry subalpine) Replacement 11% 250 31 500
Mixed 45% 60 31 350
Surface or low 45% 60 9 350
Northern Rockies
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Rockies Forested
Western redcedar Replacement 87% 385 75 >1,000
Mixed 13% >1,000 25  
Douglas-fir (warm mesic interior) Replacement 28% 170 80 400
Mixed 72% 65 50 250
Mixed conifer-upland western redcedar-western hemlock Replacement 67% 225 150 300
Mixed 33% 450 35 500
Western larch-lodgepole pine-Douglas-fir Replacement 33% 200 50 250
Mixed 67% 100 20 140
Grand fir-lodgepole pine-larch-Douglas-fir Replacement 31% 220 50 250
Mixed 69% 100 35 150
Persistent lodgepole pine Replacement 89% 450 300 600
Mixed 11% >1,000    
Whitebark pine-lodgepole pine (upper subalpine, Northern and Central Rockies) Replacement 38% 360    
Mixed 62% 225    
Lower subalpine lodgepole pine Replacement 73% 170 50 200
Mixed 27% 450 40 500
Lower subalpine (Wyoming and Central Rockies) Replacement 100% 175 30 300
Upper subalpine spruce-fir (Central Rockies) Replacement 100% 300 100 600
*Fire Severities:
Replacement=Any fire that causes greater than 75% top removal of a vegetation-fuel type, resulting in general replacement of existing vegetation; may or may not cause a lethal effect on the plants.
Mixed=Any fire burning more than 5% of an area that does not qualify as a replacement, surface, or low-severity fire; includes mosaic and other fires that are intermediate in effects.
Surface or low: Any fire that causes less than 25% upper layer replacement and/or removal in a vegetation-fuel class but burns 5% or more of the area [49,66].
  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 36. Edwards, R. Y. 1954. Fire and the decline of a mountain caribou herd. The Journal of Wildlife Management. 18(4): 521-526. [8394]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 99. Scotter, George W. 1968. Effects of forest fires on the lichen winter ranges of barren-ground caribou in northern Canada. Logan, UT: Utah State University. 127 p. Dissertation. [65839]
  • 9. Ballard, Warren B.; Krausman, Paul R.; Boe, Sue; Cunningham, Stan; Whitlaw, Heather A. 2000. Short-term response of gray wolves, Canis lupus, to wildfire in northwestern Alaska. The Canadian-Field Naturalist. 114(2): 241-247. [46985]
  • 37. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 43. Greater Yellowstone Coordinating Committee. 1988. Greater Yellowstone Area fire situation, 1988. Final report. Billings, MT: U.S. Department of Agriculture, Forest Service, Custer National Forest. 207 p. [38771]
  • 51. Hayes, G. L. 1970. Impacts of fire use on forest ecosystems. In: The role of fire in the Intermountain West: Symposium proceedings; 1970 October 27-29; Missoula, MT. Missoula, MT: Intermountain Fire Research Council: 99-118. In cooperation with: University of Montana, School of Forestry. [15739]
  • 60. Kramp, Betty A.; Patton, David R.; Brady, Ward W. 1983. The effects of fire on wildlife habitat and species. Wildlife Unit Tech. Rep. RUN WILD: Wildlife/habitat relationships. Albuquerque, NM: U.S. Department of Agriculture, Forest Service, Southwestern Region, Wildlife Unit. 29 p. [152]
  • 63. Krefting, Laurits W. 1951. What is the future of the Isle Royale moose herd? Transactions, 16th North American Wildlife Conference. 16: 461-470. [17043]
  • 71. Leopold, A. Starker; Darling, F. Fraser. 1953. Effects of land use on moose and caribou in Alaska. Transactions, 18th North American Wildlife Conference. 18: 553-562. [17034]
  • 72. LeResche, R. E.; Bishop, R. H.; Coady, J. W. 1974. Distribution and habitats of moose in Alaska. Le Naturaliste Canadien. 101: 143-178. [15190]
  • 74. Loranger, Andre J.; Bailey, Theodore N.; Larned, William W. 1991. Effects of forest succession after fire in moose wintering habitats on the Kenai Peninsula, Alaska. Alces. 27: 100-110. [18423]
  • 86. Peek, James M. 1972. Adaptations to the burn: moose and deer studies. Naturalist. 23(3-4): 8-14. [16747]
  • 89. Peterson, Rolf O.; Woolington, James D.; Bailey, Theodore N. 1984. Wolves of the Kenai Peninsula, Alaska. Wildlife Monographs No. 88. Washington, DC: The Wildlife Society. 52 p. [70445]
  • 97. Saperstein, Lisa Beth. 1993. Winter forage selection by barren-ground caribou: effects of fire and snow. Fairbanks, AK: University of Alaska. 79 p. Thesis. [65836]
  • 98. Schwartz, Charles C.; Franzmann, Albert W. 1989. Bears, wolves, moose, and forest succession, some management considerations on the Kenai Peninsula, Alaska. Alces. 25: 1-10. [67734]
  • 100. Singer, Francis James. 1975. Wildfire and ungulates in the Glacier National Park area, northwestern Montana. Moscow, ID: University of Idaho. 53 p. Thesis. [19355]
  • 103. Spaulding, R. L.; Krausman, Paul R.; Ballard, Warren B. 1998. Summer diet of gray wolves, Canis lupus, in northwestern Alaska. The Canadian Field-Naturalist. 112(2): 262-266. [70439]
  • 53. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3(3): 329-382. [282]
  • 59. Keay, Jeffrey A.; Peek, James M. 1980. Relationships between fires and winter habitat of deer in Idaho. The Journal of Wildlife Management. 44(2): 372-380. [125]
  • 102. Slough, Brian G.; Mowat, Garth. 1996. Lynx population dynamics in an untrapped refugium. The Journal of Wildlife Management. 60(4): 946-961. [66461]
  • 107. Thomas, D. C.; Barry, S. J.; Alaie, G. 1996. Fire - caribou - winter range relationships in northern Canada. Proceedings, 2nd international arctic ungulate conference; August 13-17; Fairbanks, AK. In: Rangifer. 16(2): 57-67. [28961]
  • 113. Weixelman, David A.; Bowyer, R. Terry; Van Ballenberghe, Victor. 1998. Diet selection by Alaskan moose during winter: effects of fire and forest succession. In: Ballard, W. B.; Rodgers, A. R. J., eds. Proceedings, 33rd North American moose conference and workshop/4th international moose symposium; 1997 May 17-23; Fairbanks, AK. In: Alces. 34(1): 213-238. [30325]
  • 121. Wolff, Jerry O.; Zasada, John C. 1979. Moose habitat and forest succession on the Tanana River floodplain and Yukon-Tanana upland. In: Proceedings, 15th North American moose conference and workshop; 1979 March 12-16; Soldotna, AK. Thuderbay, ON: Lakehead University, School of Forestry: 213-244. [6860]
  • 122. Wright, Jonathan D.; Ernst, Jessica. 2004. Effects of mid-winter snow depth on stand selection by wolverines, Gulo gulo luscus, in the boreal forest. The Canadian Field-Naturalist. 118(1): 56-60. [68291]
  • 123. Wright, Jonathan D.; Ernst, Jessica. 2004. Wolverine, Gulo gulo luscus, resting sites and caching behavior in the boreal forest. The Canadian Field-Naturalist. 118(1): 61-64. [68290]
  • 49. Hann, Wendel; Havlina, Doug; Shlisky, Ayn; [and others]. 2005. Interagency fire regime condition class guidebook. Version 1.2, [Online]. In: Interagency fire regime condition class website. U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior; The Nature Conservancy; Systems for Environmental Management (Producer). Variously paginated [+ appendices]. Available: http://www.frcc.gov/docs/1.2.2.2/Complete_Guidebook_V1.2.pdf [2007, May 23]. [66734]
  • 52. Hebblewhite, Mark; Munro, Robin; Merrill, Evelyn. 2006. Effects of post-fire logging on elk habitat during the first 3 years post-fire: a case study of the Dogrib Creek Fire in the eastern slopes of Alberta. Edmonton, AB: University of Alberta, Department of Biological Sciences. 64 p. [Prepared for: Foothills Model Forest, Chisholm-Dogrib Fire Research Initiative]. [65043]
  • 66. LANDFIRE Rapid Assessment. 2005. Reference condition modeling manual (Version 2.1), [Online]. In: LANDFIRE. Cooperative Agreement 04-CA-11132543-189. Boulder, CO: The Nature Conservancy; U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior (Producers). 72 p. Available: http://www.landfire.gov/downloadfile.php?file=RA_Modeling_Manual_v2_1.pdf [2007, May 24]. [66741]
  • 67. LANDFIRE Rapid Assessment. 2007. Rapid assessment reference condition models, [Online]. In: LANDFIRE. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab; U.S. Geological Survey; The Nature Conservancy (Producers). Available: http://www.landfire.gov/models_EW.php [2008, April 18] [66533]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Direct Effects of Fire

More info for the terms: cover, direct effects of fire

As of 2008, the direct effects of fire on wolverines are unknown. Since wolverines are capable of traveling long distances in a short time (see Movements), it is unlikely that many individuals would be trapped by approaching flames or smoke. Additionally, kits are born during periods of heavy snow cover (see Denning) when fire risk is low, thus limiting the potential effects of fire on young.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Resting Sites

More info for the terms: cover, duff

Wolverine resting sites are typically shallow depressions on snow or duff or in open areas, such as hillsides, snow banks, or ridges, which afford views of the surrounding area [31,54,69,123]. Beds are often in stands that afford cover [54]. Resting sites may also be found at the base of trees, within snow dens, hollow logs, on talus, or near prey remains [31]. Wolverines occasionally rest in holes dug under carcasses [46].
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 123. Wright, Jonathan D.; Ernst, Jessica. 2004. Wolverine, Gulo gulo luscus, resting sites and caching behavior in the boreal forest. The Canadian Field-Naturalist. 118(1): 61-64. [68290]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat associations: Denning

More info for the terms: mesic, natural, parturition, peat, shrub, taiga, tree, tundra

Denning: Female wolverines dig snow dens that are used primarily during parturition (natal dens) and lactation (maternal dens) [31,46,77,90]. When creating dens, females tunnel into hardened snowdrifts near talus boulders or large fallen trees covered in deep snow [7,31,46,77,90]. A den in Finland was located inside a decaying, hollow spruce, while others were in deep ravines on fell (high barren field or moor) slopes, at timberline on gentle fell slopes, or in spruce-pine peat bogs [90]. Most dens are located in alpine, subalpine, taiga, or tundra habitat associated with tree roots, boulders, rock ledges, or deep snow, but rarely in lower elevation forest [46,77,90]. Occasionally, dens are located within rockslides below coniferous forests [46].

Natal dens built by wolverines are often located in rocky outcrops or tunneled into snow drifts adjoining rock formations [46]. According to unpublished data from Montana, natal dens are associated with tree roots, log jams, or boulders covered by snow [50]. Natal dens in Idaho were located in subalpine cirque basins above 8,200 feet (2,500 m) and characterized by large boulder (>6 feet (2 m) diameter) talus sites up to 300 feet (100 m) wide surrounded by trees [31,77]. Natal dens in Alaska were complex tunnel systems dug into deep snowdrifts along minor drainages at 1,840 to 2,050
feet (560-625 m) [77].

Previously used natal den in Glacier National Park, Montana.

Natal den use varies by location. In Idaho, natal dens were discovered in mid- to late February. In contrast, natal dens in Alaska were not discovered until early March to late April. Natal dens were abandoned when daily high temperatures were above freezing for several days [77].

Wolverine maternal dens are similar in structure to natal dens. Maternal dens are also constructed by digging snow tunnels leading to natural openings beneath large boulders or to the root masses and boles of fallen trees [31,77]. In Alaska, maternal dens were located either in a snow drift or in a rock cave [77]. A maternal den in the Northwest Territories was located in a large snowdrift on a southeastern facing rock outcrop [70]. Maternal den systems in Finland were 3 to 130 feet (1 to 40 m) in length [90]. Maternal dens in Alaska were located 2.0 to 2.4 miles (3.2-3.8 km) from natal dens [77]. Females in Idaho and Alaska used 4 to 6 maternal dens in a season [31,77]. Both natal and maternal dens are occasionally reused during consecutive years [31,70,77].

Maternal den use varies by location. In Idaho, maternal dens were used mid-March to late April [77]. Maternal dens in northwestern Alaska were abandoned by late April to early May when the snow began to thaw [75,77].

Human disturbance at wolverine den sites may result in den abandonment but not in kit abandonment [31]. Females may or may not move their kits to a new den following a disturbance by humans [31,75,77,90]. However, females periodically move to new dens regardless of whether the old den was disturbed [75].

After dens are no longer used, females leave their kits at rendezvous sites when hunting [31,75]. In northwestern Alaska, rendezvous sites are characterized by remnant snow drifts or tunnels undercut by spring meltwater [75]. Rendezvous sites in Idaho were located on talus slopes or within riparian conifer forest. The talus sites were in subalpine cirque basins characterized by large boulder talus with or without snow. Coniferous riparian forest was characterized by lower slope spruce-fir riparian habitat with mesic, dense shrub and regenerating conifer understory with multiple layered downed woody debris [31].

  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 50. Hash, Howard S. 1987. Wolverine. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch B., eds. Wild furbearer management and conservation in North America. Toronto: Ontario Ministry of Natural Resources: 575-585. [70383]
  • 70. Lee, John; Niptanatiak, Allen. 1996. Observation of repeated use of a wolverine, Gulo gulo, den on the tundra of the Northwest Territories. The Canadian Field-Naturalist. 110(2): 349-350. [68388]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 77. Magoun, Audrey J.; Copeland, Jeffrey P. 1998. Characteristics of wolverine reproductive den sites. The Journal of Wildlife Management. 62(4): 1313-1320. [68150]
  • 90. Pulliainen, Erkki. 1968. Breeding biology of the wolverine (Gulo gulo L.) in Finland. Annales Zoologica Fennica. Helsinki: Finnish Zoological and Botanical Publishing Board. 5: 268-270. [69482]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Movements

More info for the term: presence

Wolverines are capable of traveling long distances within short periods of time. In California, wolverines traveled 15 miles (24 km) or more per day searching for food [16]. Males easily travel over 19 miles (30 km) in a day [31,46,64,75,90]. Daily movements for males were significantly greater (P=0.041) than for females in Idaho [31]. A young male in the Greater Yellowstone Ecosystem traveled an average minimum distance of 12.9 miles (20.8 km) per day over a 42 day period from late March to early May [56]. Maximum daily distances traveled by males in the Yukon Territory were 10.7 miles (17.3 km). Estimated maximum daily distance traveled by females in the Yukon Territory was 7.0 miles (11.3 km) [10]. Daily movements for females in Idaho ranged 0 to 12.3 miles (19.8 km) [31]. Males moved a straight line average of 7.6 miles (12.3 km) per day during summer in northwestern Alaska. The greatest straight line distance covered by females in a single day was 9.7 miles (15.6 km). Males in northwestern Alaska moved up to 6.6 miles (10.6 km) per hour, while females moved up to 5.0 miles (8.0 km) per hour [75]. A young male in the Greater Yellowstone Ecosystem traveled 8.6 miles (13.8 km) in a 2-hour period [56].

Wolverines tend to utilize areas that make traveling easy. Wolverines generally travel along forested ridges and creek bottoms in Oregon [55]. Winter travel for wolverines in British Columbia and Alberta was limited to upland boreal forest [122]. Wolverines utilize trails created by skiers and snowshoers, which make travel easier in deep snow [6]. In Idaho, they commonly travel downstream along small streams in winter. They also travel through riparian areas, meadows and timber stands [7]. Wolverines are adept swimmers [64,93]. Thus, lakes and rivers most likely do not impede movements.

Temporary, long-distance, seasonal movements are common for males and females [12,54,75]. The reason for these extensive movements is largely unknown. These sudden increases in movement may be a response to the presence of other individuals in breeding condition moving into the same area. Another possible explanation is adjacent residents may attempt to occupy a vacated home range following the death or departure of the resident wolverine [75]. Movements in northwestern Montana were most extensive in spring and lowest in winter [54].

Movements by both females and males decline during the breeding season. Movements by males were influenced by breeding behavior from late winter to summer in northwestern Alaska. Raising young restricted the movements of adult females in northwestern Alaska [75].

Both male and female juveniles disperse [75], although some female kits remain in their mothers' home ranges [75,112]. Typically, all males disperse in Scandinavian populations [112]. Juveniles and transient subadults may disperse 19 to 235 miles (30-378 km) from their natal range [39,75,112]. A 2-year-old male traveled 235 miles (378 km) from Alaska (starting late March to mid-April) to the Yukon Territory (late November) [40]. A young tagged female believed to be from northwestern Alaska was trapped 186 miles (300 km) outside the original study area. The identity of the young female could not be verified [75].

  • 6. Austin, Matt. 1998. Wolverine winter travel routes and response to transportation corridors in Kicking Horse Pass between Yoho and Banff National Parks. Calgary, AB: University of Calgary. 40 p. Thesis. [68217]
  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 12. Banci, Vivian; Harestad, Alton S. 1990. Home range and habitat use of wolverines Gulo gulo in Yukon, Canada. Holarctic Ecology. 13(3): 195-200. [13992]
  • 16. Barrett, R. H.; Golightly, R.; Kucera, T. E. 1994. California wolverine. In: Thelander, C. G.; Crabtree, M., eds. Life on the edge: A guide to California's endangered natural resources: wildlife. Volume 1. Santa Cruz, CA: BioSystems Books: 92-94. [68160]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 39. Gardner, Craig L. 1985. The ecology of wolverines in southcentral Alaska. Fairbanks, AK: University of Alaska. 82 p. Thesis. [69201]
  • 40. Gardner, Craig L.; Ballard, Warren B.; Jessup, R. Harvey. 1986. Long distance movement by an adult wolverine. Journal of Mammalogy. 67(3): 603. [68391]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 56. Inman, Robert M.; Wigglesworth, Rachel R.; Inman, Kristine H.; Schwartz, Michael K.; Brock, Brent L.; Rieck, Jon D. 2004. Wolverine makes extensive movements in the Greater Yellowstone Ecosystem. Northwest Science. 78(3): 261-266. [68384]
  • 64. Krott, Peter. 1960. Ways of the wolverine. Natural History. 69: 16-29. [68709]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 90. Pulliainen, Erkki. 1968. Breeding biology of the wolverine (Gulo gulo L.) in Finland. Annales Zoologica Fennica. Helsinki: Finnish Zoological and Botanical Publishing Board. 5: 268-270. [69482]
  • 93. Reed, Edward B. 1956. Notes on some birds and mammals of the Colville River, Alaska. The Canadian Field-Naturalist. 70(3): 130-136. [70384]
  • 112. Vangen, Knut Morten; Persson, Jens; Landa, Arild; Andersen, Roy; Segerstrom, Peter. 2001. Characteristics of dispersal in wolverines. Canadian Journal of Zoology. 79(9): 1641-1649. [68253]
  • 122. Wright, Jonathan D.; Ernst, Jessica. 2004. Effects of mid-winter snow depth on stand selection by wolverines, Gulo gulo luscus, in the boreal forest. The Canadian Field-Naturalist. 118(1): 56-60. [68291]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History

More info for the terms: litter, monoestrous, parturition, polygamous

Wolverines are sexually dimorphic. Adult males average 24 to 61 pounds (10.9-27.5 kg), while adult females average 15 to 41 pounds (7-19 kg) [50,64,69,75,91]. The skull and teeth of wolverines are more robust than those of other carnivores of similar size. Wolverines are capable of eating frozen meat and crushing bones of large prey including deer (Odocoileus spp.), caribou (Rangifer tarandus), and moose (Alces alces) ([46], reviews by [50,85]).

Wolverines are solitary [85]. While they are primarily nocturnal [46,55], they also travel during daylight hours [7,46]. Wolverines are active year round [10,54,64,75,115]. Rather than maintaining territories, wolverines scent mark to advertise their current positions [54]. Individual home ranges may overlap extensively with those of other individuals [10,54].

Males and females reach sexual maturity at 2 to 3 years of age [10,13,91]. Some males reach sexual maturity at 14 to 15 months of age [91]. Occasionally, females produce litters as yearlings [10,13,91]. Most females produce litters every 2 to 3 years [31,54,64]. Physical condition and age may be a factor in whether females reproduce each year [31,87].

Rausch and Pearson [91] speculated that wolverines are polygamous. Observations of the breeding biology of wolverines suggest that females are monoestrous [13,90,91]. The mating season spans April to August, with a peak in late May and June [64,91]. Male breeding condition peaks April to June. Delayed implantation typically occurs in late January or early February [91,124], but may happen anytime from November through March [10,13,91].

Parturition (births) occurred 215 to 272 days after copulation in captive wolverines [81]. Active gestation lasts 30 to 40 days [91]. Births peak February to March [46,77,85,90,91], but may occur at any time from January through April [31,75,90,91]. Wolverine parturition may correspond with periods when carrion is most abundant [91], such as caribou calving season [29].

Litter sizes range from 1 to 6 kits per litter, with an average of 2.2 to 3.0 kits per litter [46,54,90]. Average litter size for females in northwestern Alaska was 1.75 kits after dens were abandoned. This did not include newborn mortality [75].

Kits are weaned by 10 weeks of age [31,64] and remain with their mothers up to 2 years [64,112]. The average dispersal age for males and females in Scandinavia was 13 months [112].

According to a review, average annual survival may range from 0.80 to 0.975 [11]. More recent studies have recorded survival rates that deviate slightly from the range. Average first-year survival for juveniles in Scandinavia was 0.68 [88]. Average annual survival in Idaho and Montana was 0.80 excluding licensed trapping, and 0.57 including licensed trapping [105]. In a 12-study synthesis, overall annual survival for all age and sex classes in untrapped populations was >0.84. Overall annual survival for all age and sex classes in trapped populations was <0.75 [62].

Average life expectancy of wild wolverines in Montana is 4 to 6 years, with few exceeding 8 years of age according to unpublished data by Hash [50]. According to a review, wild wolverines may reach 8 to 10 years old [57]. The oldest wolverine examined by Rausch and Pearson [91] in Alaska and the Yukon Territory was a 13-year-old female.

  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 29. Conard, Benjamin R. 2000. Status and management of forest carnivores on the Beaverhead-Deerlodge National Forest. Missoula, MT: University of Montana. 81 p. Thesis. [68236]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 50. Hash, Howard S. 1987. Wolverine. In: Novak, M.; Baker, J. A.; Obbard, M. E.; Malloch B., eds. Wild furbearer management and conservation in North America. Toronto: Ontario Ministry of Natural Resources: 575-585. [70383]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 62. Krebs, John; Lofroth, Eric; Copeland, Jeffrey; Banci, Vivian; Cooley, Dorothy; Golden, Howard; Magoun, Audrey; Mulders, Robert; Shults, Brad. 2004. Synthesis of survival rates and causes of mortality in North American wolverines. The Journal of Wildlife Management. 68(3): 493-502. [68148]
  • 64. Krott, Peter. 1960. Ways of the wolverine. Natural History. 69: 16-29. [68709]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 77. Magoun, Audrey J.; Copeland, Jeffrey P. 1998. Characteristics of wolverine reproductive den sites. The Journal of Wildlife Management. 62(4): 1313-1320. [68150]
  • 90. Pulliainen, Erkki. 1968. Breeding biology of the wolverine (Gulo gulo L.) in Finland. Annales Zoologica Fennica. Helsinki: Finnish Zoological and Botanical Publishing Board. 5: 268-270. [69482]
  • 91. Rausch, R. A.; Pearson, A. M. 1972. Notes on the wolverine in Alaska and the Yukon Territory. The Journal of Wildlife Management. 36(2): 249-268. [68151]
  • 13. Banci, Vivian; Harestad, Alton. 1988. Reproduction and natality of wolverine (Gulo gulo) in Yukon. Annales Zoologici Fennici. 25(4): 265-270. [68259]
  • 57. Jackson, H. H. T. 1961. Genus Gulo Pallas--Wolverines. In: Mammals of Wisconsin. Madison, WI: University of Wisconsin Press: 357-362. [70434]
  • 81. Mehrer, Clifford F. 1976. Gestation period in the wolverine, Gulo gulo. Journal of Mammalogy. 57(3): 570. [68360]
  • 87. Persson, Jens. 2005. Female wolverine (Gulo gulo) reproduction: reproductive costs and winter food availability. Canadian Journal of Zoology. 83(11): 1453-1459. [68248]
  • 88. Persson, Jens; Willebrand, Toma; Landa, Arild; Andersen, Roy; Segerstrom, Peter. 2003. The role of intraspecific predation in the survival of juvenile wolverines Gulo gulo. Wildlife Biology. 9(1): 21-28. [68252]
  • 105. Squires, John R.; Copeland, Jeffrey P.; Ulizio, Todd J.; Schwartz, Michael K.; Ruggiero, Leonard F. 2007. Sources and patterns of wolverine mortality in western Montana. The Journal of Wildlife Management. 71(7): 2213-2220. [70449]
  • 112. Vangen, Knut Morten; Persson, Jens; Landa, Arild; Andersen, Roy; Segerstrom, Peter. 2001. Characteristics of dispersal in wolverines. Canadian Journal of Zoology. 79(9): 1641-1649. [68253]
  • 124. Wright, Philip L.; Rausch, Robert. 1955. Reproduction in the wolverine, Gulo gulo. Journal of Mammalogy. 36(3): 346-355. [68373]
  • 85. Pasitschniak-Arts, Maria; Lariviere, Serge. 1995. Gulo gulo. Mammalian Species No. 499. [Place of publication unknown]: The American Society of Mammalogists. 10 p. [69107]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Home Range

Home Range: Wolverine home ranges may overlap, and adults do not actively defend territories [10,54]. Home range overlap most often occurs between resident adults and related subadults [31]. Adult females exclude unrelated females from their home ranges but allow offspring to occupy the same area [75]. Males generally tolerate females and juvenile males [31,75] but exclude other adult males from their home ranges [64,75,115]. Home ranges of juveniles and transient adult males may overlap the home ranges of resident males for unknown periods of time. When one male is in the overlapping area, the other male is typically not in the near vicinity [39].

Wolverine home range size can vary widely. The variation may be associated with differences in the abundance or distribution of food ([31], review by [11]). The average annual home ranges for adult males and males of unknown age are 139 to 257 mi² (359-666 km²) [54,75,115]. The average annual home range for female wolverines is 150 mi² (388 km²) in Montana [54]. Annual home ranges for females in Alaska averaged 40 to 41 mi² (103-105 km²) [75,115]. Average summer home range for females in northwestern Alaska was 36 mi² (94 km²). Average summer home range for adult males in northwestern Alaska was 242 mi² (626 km²) [75].

Many wolverines make temporary long-distance excursions [12,54,75]. These excursions can skew home range estimates. As a result, several methods have been developed to estimate the size of the areas primarily used by wolverines. Copeland [31] estimated harmonic mean core home ranges for wolverines in Idaho. Harmonic mean core home range is the area within the home range that is used more than expected based on an assumption of uniform usage [31,96]. Rather than determine the size of the area with the highest concentration of use for wolverines in the Yukon Territory, Banci and Harestad [10,12] estimated a core home range based on the size of the area that circumscribed 90% of the relocations of radio-collared wolverines.

Home ranges for wolverines in Idaho were larger than for other populations in North America. The following home range results from Idaho are based on annual estimates. Average home range for adult females was 148 mi² (384 km²), while the average harmonic mean core home range for adult females was 98 mi² (254 km²) [31]. For subadult females in Idaho, the average home range was 205 mi² (532 km²), with an average harmonic mean core home range of 88 mi² (227 km²). For adult males, average home range was 588 mi² (1,522 km²), and the average harmonic mean core home range for adult males in Idaho was 314 mi² (813 km²). Average home range for subadult males was 426 mi² (1,104 km²), while the average harmonic mean core home range for subadult males in Idaho was 201 mi² (520 km²) [31].

Reproductive activities may also influence wolverine home range size. Spring and summer home ranges tend to be larger for females without young than for females with kits [10,75]. A denning female captured several times from November to January in the Yukon Territory had a 5.4 mi² (14 km²) home range and relied heavily on baited traps [12]. The average March to August home range for lactating females in northwestern Alaska was 27 mi² (70 km²). Adult females without young had an average home range of 37 mi² (97 km²) March to August [75]. Core home ranges in the Yukon Territory were 18 mi² (47 km²) for a female with kits, and 52 mi² (134 km²) and 49 mi² (128 km²) for 2 females without young [10]. Similarly, home range estimates from the Yukon Territory that excluded temporary long-distance movements were 29 mi² (76 km²) (female with kits) and 59 to 61 mi² (153-157 km²) (females without kits) [12]. By comparison, core home ranges in the Yukon Territory were 109 mi² (283 km²) for a subadult male and 73 mi² (188 km²) for an adult male [10].

Total home range size estimates for wolverines in North America
Age/Gender Annual home range (km²)* Spring/Summer home range
(km²)*
Adult or unknown aged male 238-2,400 46-898 [10,12,16,31,54,69,75,115]
Juvenile/subadult male 46-2,940 41-437 [10,31,75]
Adult or unknown aged female (reproductive status unknown) 53-637 38-515 [10,16,31,54,75,115]
Female with young 139 55-293 [10,31,54,75]
Female (postpartum) 72-137 ...** [115]
Female without young 202-343 68-210 [10,12,75]
Juvenile/subadult female 370-646 ... [31]
*Estimated minimum and maximum limits of annual and seasonal home range.
**No data.

  • 10. Banci, Vivian. 1987. Ecology and behaviour of wolverine in Yukon. Burnaby, BC: Simon Fraser University. 178 p. Thesis. [68158]
  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 12. Banci, Vivian; Harestad, Alton S. 1990. Home range and habitat use of wolverines Gulo gulo in Yukon, Canada. Holarctic Ecology. 13(3): 195-200. [13992]
  • 16. Barrett, R. H.; Golightly, R.; Kucera, T. E. 1994. California wolverine. In: Thelander, C. G.; Crabtree, M., eds. Life on the edge: A guide to California's endangered natural resources: wildlife. Volume 1. Santa Cruz, CA: BioSystems Books: 92-94. [68160]
  • 31. Copeland, Jeffrey P. 1996. Biology of wolverines in central Idaho. Moscow, ID: University of Idaho. 178 p. Thesis. [68164]
  • 39. Gardner, Craig L. 1985. The ecology of wolverines in southcentral Alaska. Fairbanks, AK: University of Alaska. 82 p. Thesis. [69201]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 64. Krott, Peter. 1960. Ways of the wolverine. Natural History. 69: 16-29. [68709]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 96. Samuel, M. D.; Pierce, D. J.; Garton, E. O. 1985. Identifying areas of concentrated use within the home range. Journal of Animal Ecology. 54(3): 711-719. [70461]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Foraging behavior

More info for the term: climax

Wolverines are primarily scavengers and depend on gray wolves (Canis lupus) and other predators to provide ungulate carrion [11,46]. They travel long distances searching for carrion and other feeding opportunities [54]. However, they rarely hunt as other predators do [46,54]. Wolverines occasionally hunt large prey such as moose or caribou calves and yearlings [46,91,101]. When hunting, wolverines charge after caribou, moose, and other prey, often giving their potential prey ample time to escape [46,55,64]. The longest chases recorded in Sweden were 0.6 miles (1 km) [46]. Hunts are most successful during early spring when deep, soft snow limits the movement of large ungulates [46,91]. Wolverines may hunt mountain goats, but kills have not been observed [27,45]. Successful hunts for small prey such as hoary marmots, snowshoe hares, deer mice, and red squirrels are more common [54].

Excess food is cached under soil or snow, in water wells, or in trees [46,64]. Less common cache locations include crevices and rock piles [46]. Holes dug 3 to 7 feet (1-2 m) into the snow are used for either food storage or as protected areas for feeding [69]. Cache sites in British Columbia and Alberta were primarily in open areas with views of the surrounding area and were accessed by multiple trails created by the wolverines. Food caches were in climax or "overmature" black spruce or conifer dominated stands of mixed complexity. Cache sites were not located in dense homogeneous black spruce stands. One cache contained moose remains on a linear corridor regenerating to lodgepole pine. Additional caches were created from the carcass remains. A second cache was located near a linear corridor with compacted snow in a climax stand of black spruce with stunted growth. A third cache was found in a highly complex climax stand with a relatively open canopy dominated by conifers [123].

  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 27. Chadwick, Douglas H. 1977. Ecology of the Rocky Mountain goat in Glacier National Park and the Swan Mountains, Montana. Final Report. West Glacier, MT: U.S. Department of the Interior, National Park Service, Glacier National Park. 54 p. [19359]
  • 45. Guiguet, C. J. 1951. An account of wolverine attacking mountain goat. The Canadian Field-Naturalist. 65(5): 187. [68399]
  • 46. Haglund, Bertil. 1966. Winter habits of the lynx (Lynx lynx L.) and wolverine (Gulo gulo L.) as revealed by tracking in the snow. Viltrevy. Stockholm, Sweden: Swedish Sportsmen's Association. 4(3): 81-84; 245-283. [68708]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 64. Krott, Peter. 1960. Ways of the wolverine. Natural History. 69: 16-29. [68709]
  • 69. Lee, John; Niptanatiak, Allen. 1993. Ecology of the wolverine on the Central Arctic barrens progress report: Progress report--Spring 1993. Manuscript Report No. 75. Yellowknife, NT: Department of Renewable Resources. 29 p. [68232]
  • 91. Rausch, R. A.; Pearson, A. M. 1972. Notes on the wolverine in Alaska and the Yukon Territory. The Journal of Wildlife Management. 36(2): 249-268. [68151]
  • 101. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 123. Wright, Jonathan D.; Ernst, Jessica. 2004. Wolverine, Gulo gulo luscus, resting sites and caching behavior in the boreal forest. The Canadian Field-Naturalist. 118(1): 61-64. [68290]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Like most mustelids, wolverines have anal scent glands which are used to mark territories and food caches. Due to their scavenging lifestyle, they have an advanced sense of smell. Wolverines also have good hearing, but likely have poor vision. Wolverines are rarely vocal, except for occasional grunts and growls when irritated.

Communication Channels: acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Active both day and night but primarily nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, wolverines generally live for 5 to 7 years but some can live up to 13 years. Females in captivity have bred up to 10 years old and live up to 17 years. The main causes of death are starvation, being killed by competitors (such as wolves), and trapping.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
17 (high) years.

Typical lifespan

Status: wild:
5 to 7 years.

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: captivity:
17.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.5 years (captivity) Observations: These animals feature delayed implantation (Ronald Nowak 1999). Depending on how long the implantation takes to occur, the total gestation time can take from 120 to 272 days, even though the active developmental time is about 35 days (Virginia Hayssen et al. 1993).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds April-October (but variable), usually in summer. Implantation is delayed generally until winter. Gestation lasts 7-9 months; active gestation 30-40 days. One to six (usually 2-4) young are born January-April, mainly February or March (reportedly April-June in the Pacific states, Ingles 1965). Young are weaned beginning at about 7-8 weeks, separate from the mother in the fall. Sexually mature generally in the second or third year. Males sexually mature sometimes as yearlings (Alaska and Yukon); males over three years old were sexually mature in British Columbia. Some females mature at 12-15 months and produce their first litter when two years old. (Wilson 1982). In some areas, females may produce litters only every 2-3 years. In British Columbia, most mature females were reproductively active. Lives to an age of up to about 10 years, or sometimes 15-18 years or so.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wolverines are generally solitary animals. Males and females come together only briefly for mating, from May to August. Males have large home ranges, encompassing the home ranges of several females. Males may mate with each female in their home range and sometimes those in overlapping ranges. Males and females remain together for several days. Females may also mate with members of different home ranges, but litters are usually fathered by one male. Males fiercely defend their territory by marking it with scent from their anal gland.

Mating System: polygynous

Female wolverines mate every other year. Mating occurs from May to August, with most females being in heat from June to August. Males remain near females during the breeding season, but females initiate copulation. Like many other mustelids, ovulation is believed to be induced by copulation and the embryo is not implanted immediately, but rather waits in diapause for about 6 months. After implantation, gestation takes only another 30 to 50 days. With delayed implantation, pregnancy can last from 120 to 272 days depending on when the embryo is fertilized and when it implants. Females build snow-dens in which they give birth and nurse. The litter is usually born between January and April and averages 3 kits, weighing 85 g each. Weaning is complete at 3 months and the young begin foraging on their own at 5 to 7 months, when they become independent. Adult size is attained at around 1 year and sexual maturity at 2 to 3 years old. Wolverines require snow cover that persists through spring so that food can be cached until the kits are large enough to being foraging on their own.

Breeding interval: Females give birth in alternate years.

Breeding season: Breeding occurs from May to August.

Range number of offspring: 1 to 5.

Range gestation period: 120 to 272 days.

Average birth mass: 84 g.

Average weaning age: 3 months.

Average time to independence: 1 years.

Average age at sexual or reproductive maturity (female): 710 days.

Average age at sexual or reproductive maturity (male): 776 days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 95 g.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
776 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
710 days.

Females give birth to a litter of around 3 kits in a snow den. After females give birth they hide with their young. The mother defends her territory and intruders are not tolerated. This territorial behavior continues until the young are ready to hunt on their own. Young remain with their mother until the fall of the year they were born, when they disperse. Females mate again in the following year, giving birth to young in the second year after the previous litter. Females may help to train their young in hunting techniques before they disperse.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gulo gulo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCCACTAATCATAAAGACATCGGCACCCTCTATCTTTTATTCGGCGCATGAGCCGGAATAGTAGGTACAGCCCTGAGCCTATTAATTCGCGCTGAATTGGGACAACCTGGTGCTCTGCTGGGAGAT---GACCAGATTTACAATGTAATTGTGACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTGATACCCATCATGATTGGAGGTTTTGGGAACTGGTTAGTGCCCTTAATAATTGGTGCACCTGACATGGCATTCCCACGTATAAACAATATAAGCTTCTGGCTTCTACCCCCCTCCTTCCTTTTACTCTTAGCCTCCTCCATAGTAGAAGCAGGCGCGGGAACAGGATGAACTGTGTACCCTCCTCTAGCAGGAAATCTGGCACACGCAGGAGCATCTGTGGACCTAACAATCTTTTCCTTGCACCTGGCAGGTGTCTCATCCATCCTGGGGGCCATCAACTTTATTACAACTATTATTAACATGAAACCTCCTGCAATGTCACAATATCAAACCCCCCTATTTGTATGATCCGTATTAATTACGGCCGTACTCCTACTCCTATCCCTACCAGTGCTAGCAGCCGGCATTACCATATTACTCACGGATCGAAATCTAAACACTACTTTCTTCGACCCTGCCGGAGGAGGAGATCCTATCTTGTACCAACATCTATTCTGATTTTTTGGGCATCCTGAAGTATATATTCTAATTTTACCAGGATTCGGAATTATTTCACACGTCGTAACATATTACTCAGGGAAAAAAGAACCATTTGGCTACATGGGGATAGTTTGGGCAATAATATCTATCGGATTTTTAGGGTTCATTGTATGAGCCCATCATATGTTTACCGTAGGGATGGACGTTGACACACGAGCATATTTCACTTCAGCCACTATAATTATCGCAATCCCGACGGGAGTGAAAGTATTCAGCTGACTAGCCACCCTACATGGAGGA---AAC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gulo gulo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large range in northern Canada and Alaska, where populations probably are in good condition; occurs also in northern Eurasia; status is not well known in many portions of the range; extirpated from most of range in contiguous United States, with promising signs of semi-recovery in selected western states.

Intrinsic Vulnerability: Highly vulnerable

Comments: Species has a low reproductive output because of poor breeding success, high juvenile mortality, and slow sexual maturity (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Abramov, A., Belant, J. & Wozencraft, C.

Reviewer/s
Duckworth , J.W. & Schipper, J.

Contributor/s

Justification
This species is listed as Least Concerned due to its wide distribution and remaining large populations. Wolverine occurs at low density and many Wolverine populations appear to be relatively small and isolated (Ruggiero et al. 2007) and there is evidence of resurgence in some places of its historical distribution (Rowland et al. 2003). Thus although there is an overall continued decline due to human persecution and land-use change, the global decline of this species is not at a rate sufficient to qualify for listing at this time. However, the European Mammal Assessment determined that the European Wolverine is currently Vulnerable (A2c), thus the Least Concern listing is driven by the estimation that some large populations remain in North Asia and North America. Wolverines still face some threats such as over-exploitation through hunting and trapping, predator poisoning programs and habitat resource extraction that caused the contraction of wolverines' historical range. More data on population trends, especially in North Asia, may result in this species being re-assessed as Vulnerable in the near future.

History
  • 2008
    Near Threatened
  • 2008
    Near Threatened
    (IUCN 2008)
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Status

Wolverine populations in the United States and Canada have been reduced from historical population levels [111]. Population estimates for the Sawtooth and Salmon-Challis National Forests in Idaho totaled 6 to 7 individuals as of 1990 [7]. Genetic analysis of a male wolverine sighted on the Tahoe National Forest in February 2008 indicated that the wolverine was genetically linked to populations from Idaho and was not a descendent of original California populations [109]. Original wolverine populations in California may now be extinct [126]. Populations in some parts of the northern Rocky Mountains, Cascade Ranges, and Sierra Nevada were showing signs of increasing as of 1973 [55]. Aubry and others [5] speculated that these increases were related to extreme dispersal events from populations in southwestern Canada and Montana and not from increases in locally established populations. Populations in Alaska were "reasonably secure" as of 1973 [55]. In 2007, Aubry and others [5] speculated that conditions in the Great Lakes region and in other parts of the United States may no longer be suitable for wolverines due to global warming.

As of 1975, wolverine populations in eastern Canada had declined rapidly, while populations in western Canada declined at a slower rate and were showing signs of increasing. Despite the increases, most of these populations were still below historical estimates [111]. The continued existence of the wolverine in Quebec and Labrador was uncertain as of 2003 [28]. Populations in Ontario had declined noticeably as of 1975, while the southern extent of wolverine range in Manitoba had receded northward [111]. Populations in western Canadian provinces were generally stable but potentially declining locally as of 2003 [28]. Larsen [68] speculated that wolverines were common in western Canada as of 1980 because the area also supported large and diverse ungulate populations.

  • 5. Aubry, Keith B.; McKelvey, Kevin S.; Copeland, Jeffrey P. 2007. Distribution and broadscale habitat relations of the wolverine in the contiguous United States. The Journal of Wildlife Management. 71(7): 2147-2158. [68156]
  • 7. Bachman, Dana; Gadwa, Gary; Groves, Craig. 1990. A winter survey for wolverines (Gulo gulo) on the Sawtooth and Challis National Forests, Idaho. In: Cooperative challenge cost share project: Boise, ID: Idaho Department of Fish and Game, Bureau of Wildlife, Nongame and Endangered Wildlife Program, Natural Heritage Section. 29 p. In cooperation with: U.S. Department of Agriculture, Forest Service, Sawtooth National Forest; Challis National Forest. [68389]
  • 28. Committee on the Status of Endangered Widllife in Canada. 2003. COSEWIC assessment and update status report on the wolverine (Gulo gulo) eastern population western population in Canada. Ottawa, ON: Environment Canada, Canadian Wildlife Service, Committee on the Status of Endangered Wildlife in Canada. 41 p. [68159]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 68. Larsen, James A. 1980. The trophic pyramid: animal populations. In: Larsen, James A., ed. The boreal ecosystem. New York: Academic Press: 381-411. [64913]
  • 111. van Zyll de Jong, C. G. 1975. The distribution and abundance of the wolverine (Gulo gulo) in Canada. The Canadian Field-Naturalist. 89(4): 431-437. [68401]
  • 126. Zielinski, William J.; Truex, Richard L.; Schlexer, Fredrick V.; Campbell, Lori A.; Carroll, Carlos. 2005. Historical and contemporary distributions of carnivores in forests of the Sierra Nevada, California, USA. Journal of Biogeography. 32(8): 1385-1407. [64028]
  • 109. U.S. Department of Agriculture, Forest Service, Tahoe National Forest. 2008. Preliminary DNA analysis completed on California wolverine, [Online]. Nevada City, CA: U.S. Department of Agriculture, Forest Service, Tahoe National Forest (Producer). Available: http://www.fs.fed.us/r5/tahoe/news/08_news_releases/08_apr_10_wolverine_dna.shtml [2008, May 19]. [70312]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

U.S. Federal Legal Status

Proposed Threatened [110]
  • 110. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wolverines generally occur at relatively low population densities and have vanished from most of their former range in the United States. In Scandinavia, estimates vary from one individual per 200 to 500 sq km. Encroaching human populations alter the abundance and habits of large ungulates, eliminate large predator populations, or kill wolverines directly. Numbers have declined due to fur trapping and hunting by those believing the wolverine to be a nuisance. In Russia, wolverines are a game species and extensive overhunting has led to population decline. In the United States, wolverines can only be harvested in Montana and Alaska. Wolverines have been nearly eliminated in the United States and have disappeared over most of southeastern and south-central Canada. In Europe, they can only be found now in parts of Scandinavia and northern Russia. Wolverines are listen by the IUCN as Near Threatened. They were previously listed as vulnerable, but have been upgraded to Near Threatened.  Conservation efforts include education, protecting habitat, and eliminating unregulated hunting. In Sweden farmers and herders are compensated for identifying dens and reporting them. Other Scandinavian countries have adopted measures to limit the amount of wolverines in reindeer herding areas through selected hunting.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Environment Canada - Species at Risk website (http://www.speciesatrisk.gc.ca ) reported the following information for the western population:

In the Yukon, populations are healthy and stable in all regions. In the Northwest Territories, densities vary with location; they are highest in the southwest and lowest on the Arctic Islands and on the mainland east of the Thelon Wildlife Sanctuary. In Nunavut, densities are moderate in the west and low on the Arctic Islands and in the east. Populations are believed to be stable over much of British Columbia, but are declining in the southern mountains. A distinct subspecies may no longer be extant on Vancouver Island, where Wolverines have not been seen since 1992; their decline may be related to that of the endangered Vancouver Island marmot, a potential summer food. In Alberta, wolverines are most abundant in the west, but appear to be declining throughout the province. In Saskatchewan, they are common in the north, but are rare and possibly declining in the southern boreal forest. In Manitoba, the highest densities are in the northeast and northwest, while numbers in the north central part of the province are unknown. Wolverines are found in small numbers in northwestern Ontario; they may have increased recently in some areas, but are known to have disappeared from others. Overall numbers for Ontario indicate a decline. Although records exist for their occurrence in the Prairie and Great Lakes Plains ecological areas, wolverine populations may never have been viable in these regions.

See also Dauphine (1989 COSEWIC report) for information on status in Canada.

In Alberta, trapping data suggest that the highest populations are found in the western parts of the province, and that populations have declined in most regions of Alberta in the past two decades (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
North America: The distribution and abundance of the species has been notably reduced in the 20th century in United States (Pasitschniak-Arts and Larivière 1995) and during the 19th century, wolverines disappeared from the southernmost of its European distribution mainly due to persecution, but also due to deforestation and other human developments. However, although there has been substantial range reduction, there is evidence of resurgence in some places of his historical distribution (Rowland et al. 2003). Throughout their range, wolverines occur at relatively low densities and require large home ranges varying from at least 100 km² to upwards of 600 km² (Whitman 1999). In Europe, the species is relatively rare. Densities of this species are never high, and it has been found to be less abundant than wolves, even in optimal habitats (Pasitschniak-Arts and Lariviere 1995). Densities range from one per 500 km² in Scandinavia to one per 65 km² in Montana, USA (Pasitschniak-Arts and Lariviere 1995).

Substantial populations occur in northern Canada and Alaska. Outside of Alaska, the population in Montana is considered to be the largest and most stable population of wolverines, given its close proximity to healthy populations in Canada (Cegelski et al. 2003). Densities of wolverines are never high (Aubry et al. 2007, Makridin 1964). Many wolverine populations appear to be relatively small and isolated (Ruggiero et al. 2007).

In North America, population density estimates range from one wolverine per 65 km2 in Montana (Hornocker and Hash 1981) to one per 200 km2 in northern British Columbia (Quick 1953), Alaska (Becker and Gardner 1992), and the Northwest Territories (Lee and Niptanatiak 1993). Lofroth and Krebs (2007) estimated densities for wolverines in British Columbia using existing wolverine distribution, wolverine food, ecosystem mapping and human development data. Density estimates range from 6.2 wolverines/1,000 km2 in high-quality habitat to 0.3/1,000 km2 in rare-quality habitat. Their predicted population estimate for British Columbia was 3,530 wolverines.

Europe: The European population of Gulo gulo is currently estimated to be approximately 2,260 individuals: 1,400 in European Russia (Novikov 2005), 150 in Finland, and 1998–2000 were 326 (±45) individuals in Sweden and 269 (±32) individuals in Norway (Sæther et al. 2005). The southern Norwegian population was naturally re-established during the late 1970s and was a result of protective legalisation (Landa and Skogland 1995). To the east, the Eastern Russian wolverine population is believed to comprise more than 18,000 individuals (Novikov, 2005). The species is not abundant in Mongolia, but still relatively widespread: it is only found in northern taiga habitats in Hentii and Hövsgöl mountain ranges (Bannikov 1954, Dulamsteren 1970), northern parts of Hangai Mountain Range and Mongol Altai Mountain Range (Dulamtseren et al. 1989).The European distribution is connected to the East Russian population along the Urals. The overall European population forms a relatively continuous distribution with a few geographically and genetically distinct subpopulations and constitutes a smaller fraction of the large Eurasian population.

1. Scandinavian wolverine population: The Scandinavian wolverine has shown a low genetic variability and subdivision among populations indicating that the wolverine in Scandinavia has lost variation due to a previous bottleneck event and that the current populations are the result of a recent common genetic background (Walker et al. 2001, Flagstad et al. 2004). The current population estimate is 580 individuals (>1 yrs of age) with approximately 200 in Norway and 380 in Sweden (Larsson 2005, van Dijk et al. 2005). The population has a continuous distribution and is narrowly connected to the Finnish – Western Russian population along the border of Finnmark County in the northernmost parts of its distribution. However, an initial genetic analysis has indicated a clear genetic distinction between these populations (Ø. Flagststad pers. comm.). In its southern distribution, the Scandinavian wolverine population provides as a source for the Southern Norwegian wolverine population (Walker et al. 2001, Flagstad et al. 2004, Flagstad et al. 2006) as well as a source for the Swedish forest wolverine population(s) close to the Gulf of Bothnia in Southern Sweden (Hedmark 2006).

2. Southern Norwegian wolverine population: The southern Norwegian population was naturally reestablished during the late 1970s and was a result of protective legalisation (Landa and Skogland 1995). This population has recently increased in numbers and distribution, but is currently kept at around 100 individuals by various control measurements (Flagstad et al. 2006). Genetic surveys have shown that the Southern Norwegian wolverine population is genetically distinct from the Scandinavian population, but the geographic gap between the southern and the main Scandinavian population to the north and east has decreased from 100-200 km by the early 1990s to virtually connectivity by 2006. However, exchange of individuals still is limited and the Southern Norwegian population seems to form a sink with a few individuals emigrating from the northern continuous population (Landa et al. 2000, Flagstad 2006).

3. Swedish forest wolverine population/occurrence: The Swedish forest wolverine occurrences were naturally established, during the mid 1990s (Hedmark 2006). These new occurrences were likely established by as few as 2 and 2-4 individuals and are currently consisting of 2 and 10 individuals, respectively (Hedmark 2006). Non-invasive genetic surveys has showed that these occurrences have little, if any, contact with the main Scandinavian wolverine population (Hedmark 2006).

4. Finnish – western Russian wolverine population: During the last decades, there has been an increase in population numbers and distribution of wolverines in Finland, but decreasing trends in Russia (Landa et al. 2000a). The western Russian population is estimated to be approximately 1,400 individuals (Novikov 2005). Relationships with other populations: to the west the distribution of the Finnish – Western Russian wolverine population is narrowly connected to the Scandinavian population along common borders with Norway and Sweden. An initial genetic analysis has indicated a clear genetic distinction between the Scandinavian population and the wolverines living in northern parts of Finland (Ø. Flagststad pers. comm.). It is also unclear how the western part of the wolverine distribution within this population (Finland, Kola, Karelia) connects along the narrow isthmus between the White Sea and Lake Onega in Western Russia. This area is judged as an extremely important connection for the northern element of the taiga fauna (Lindén et al. 2000) and these concerns should be further investigated. To the east, the European Russian wolverine population has a wide connection to the much larger East Russian population adjoining along the Urals in western Siberia. The Eastern Russian wolverine population is believed to comprise more than 18,000 individuals (Novikov 2005).

5. Finnish western wolverine population: This population was established by translocating animals from domestic reindeer herding areas in the north during the 1980s-1990s. The population is estimated to consist of about 10-15 individuals and now seems to reproduce naturally (Kojola 2005). The gap between this and the Karelia distribution is about 200-300 km and little is known about exchange between these populations. This population/occurrence should therefore be judged as isolated from other populations until further knowledge is gained.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Decline may have been due primarily to fur trapping. Habitat has been degraded through timber harvesting, ski area construction, road construction, and general human disturbance (Biosystems Analysis 1989). There are conflicts with backcountry trappers.

Excessive hunter harvesting and loss of ungulate wintering areas (Banci 1994), as well as displacement of ungulate populations due to excessive timber harvest and urbanization, may adversely impact wolverines (www.wolverinefoundation.org).

In western Canada, with the extensive human settlement that began in the mid-19th century, the wolverine has undergone range contractions and population reductions. Wolf control programs that were in effect from the 1950s and into the 1990s contributed to this species' decline. The habitat, particularly in the southern part of the range, is subject to loss, degradation, and fragmentation from oil, gas, and mineral exploration and extraction, forestry, roads, agriculture, and urban development. Although Wolverines are known to use snowmobile trails and scavenge from traps, backcountry recreation can lead to habitat alienation for these secretive animals. Increased access of motorized vehicles into remote areas may also increase harvest pressure on the wolverine and on its ungulate prey, particularly the threatened Southern Mountain population of Woodland Caribou. In the arctic tundra, developments frequently attract wolverines, which are then at risk of being killed as nuisance animals. As an economically valuable furbearer, the wolverine is subject to trapping and has been over-harvested in some areas. Declines in the population in eastern Canada are related to a combination of factors: hunting and trapping in the late 19th century, dwindling caribou herds in the early 20th century, human encroachment on habitat, reduction in the number of wolves, and the indiscriminate use of poison baits. [From Environment Canada Species at Risk website. See Dauphine (1989 COSEWIC report) for further information on threats in Canada.]

Among the limiting factors in Alberta are the loss of isolated habitat, a reduction in the availability of large ungulate carrion, and trapping pressure (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Within the current range, extensive human activities continue to pressure wolverine populations and habitat (Krebs et al. 2004). Overexploitation through hunting and trapping, as well as predator poisoning programs and resource extraction likely caused wolverine populations to contract in the eastern and south-western portions of their historical range in North America since the early 1900s (Banci 1994).

The wolverine is threatened by fragmented distributions, presumed low genetic diversity, as well as “population control” hunting and conflicts with human settlements resulting from depredation of livestock. While this species inhabits a zone that is particularly affected by climate change (IPCC International Climate Report 2005), habitat change or even loss is not taking place at such a rate to be considered a major threat to the wolverine. Ample forested lands and tundra with suitable prey stocks are available throughout much of its range. The problem is the low rate of human land use expansion into this range, increasing the frequency of interaction with human populations and conflict over livestock depredation. Given the remoteness of these locations, tolerance of wolverines taking livestock is low and in some areas “population control” hunting is used as a proactive means to avoid loss of animals. In Norway, where almost 10,000 sheep are believed to be killed by wolverines each summer, government committees have instituted annual harvest quotas in an effort to control livestock losses; however, these quotas may not be sustainable as they are set very high even in relation to the most liberal estimate of wolverine population size, and it is unclear whether this hunt actually reduces the numbers of sheep and semi-domestic deer lost to predators.

Wolverines are scarce in Europe today. Their continued survival is threatened due to their small and fragmented distribution, and the potential for their future survival may be weakened by the likelihood of low genetic diversity. Habitat loss per se is not a substantial threat to wolverine conservation. Large areas of Norway, Sweden and Finland are still covered by forests and mountains that offer a suitable prey base and habitat for wolverines. The problem is that these are not wilderness areas, and wolverines come into conflict with a low, but crucial, number of human land uses. The fact that there are no large areas within their distribution where there is no conflict potential with sheep or semi domestic reindeer means that human tolerance for wolverines is low. This results in a difficult situation for wildlife managers who are forced to try and balance wolverine conservation with the conflicts they create with livestock. In Norway, farmers no longer use traditional sheep-herding methods that once deterred depredation, so wolverines are often controlled in an effort to protect livestock. Poaching also occurs. In Russia, overharvesting and declines in key prey species are major threats.

1. Scandinavian wolverine population: The species is subject to illegal killings due to depredation conflicts (sheep, domestic reindeer). The scope of this is difficult to quantify. Furthermore wolverines are sensitive to human disturbance (settlements, public and private roads etc.) especially in the vicinity of their denning areas (May et al. 2006).

2. Southern Norwegian wolverine population: The Southern Norwegian wolverine population is subject to illegal killings due to depredation conflicts on sheep. The scope of this is difficult to quantify. Most people in Norway are settled in southern Norway and the wolverines are sensitive to human disturbance (settlements, public and private roads, etc.) especially in the vicinity of their denning areas (May et al. 2006).

3. Swedish forest wolverine population/occurrence: A high degree of genetic similarity among individuals in the two areas indicates inbreeding, possibly including brother-sister matings (Hedmark 2006). Inbreeding depression and demographic stochasticity are therefore likely to be the main threats (Pimm et al. 1988). These forest dwelling wolverines live outside the distribution of “domestic” reindeer, which form the most common prey for wolverines (Landa et al. 1997). Establishment of wolverines in the forest landscape is judged to be a way of reducing conflict with the domestic reindeer industry (Hedmark et al. unpubl. ms, Hedmark 2006).

4. Finnish – Western Russian wolverine population: About half the Finnish wolverine population are living within the reindeer management area in the north (Kojola 2005), thus creating conflict with the domestic reindeer industry (Landa et al. 2000b) with associated illegal killings. The scope of this is unknown. The Russian economic depression during the 1990s is believed to have led to widespread poaching of ungulate game species. Furthermore, it led to a reduction of the domestic reindeer herding industry due to large calf/breeding losses. This is believed to have indirectly negatively affected the wolverine’s populations in the European and most human populated part of Russia. The wolverine's main prey base (wild and domestic reindeer) became less abundant and the population has faced a decrease in numbers and distribution during the last few decades (Landa et al. 1997, Landa et al. 2000a, Novikov 2005). In Russia the wolverine is harvested for fur, and to the best knowledge of the assessors, there are no harvest restrictions. Russia has not yet ratified the Bern Convention.

5. Finnish western wolverine population: It is likely that this small and presumably isolated population will face inbreeding problems (Hedmark 2006) as well as being exposed to demographic stochasticity (Pimm et al. 1988). Inbreeding depression and demographic accidents are therefore main threats. These forest dwelling wolverines live outside the distribution of semi domesticated reindeer, which form the most common prey for wolverines (Landa et al. 1997). Establishment of wolverines in the forest landscape is judged to be a way of reducing conflict with the domestic reindeer industry (Hedmark et al. unpubl. ms, Hedmark 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations: Threats

The most common causes of wolverine mortality outlined in a 12-study synthesis were hunting or trapping, starvation, and predation [62]. Overtrapping and habitat loss are the largest threats facing the wolverine [54,108]. Wolverines are highly attracted to traps baited with carrion as well as those that have already trapped another animal [55]. Wolverines are considered a pest by trappers because they mutilate trapped furbearers and destroy traps [11,44,55]. Hunting and trapping may lead to local declines in wolverine populations. Surrounding wolverine populations may recolonize overhunted areas [33]. Many untrapped areas have wolverine populations with positive growth that can act as restocking refugia for neighboring populations experiencing negative growth [62]. Hornocker and Hash [54] concluded that protected wilderness areas along with limited hunting pressure would allow wolverines to persist in northwestern Montana. Thus, it may be possible to establish a balance between maintaining stable wolverine populations and preserving local hunting and trapping traditions in some areas.

Other human activities, such as agriculture, development, and eradication campaigns against other predators, have negative indirect effects on wolverine populations. Large scale poisoning of gray wolves in the 1970s had a negative impact on wolverines in Canada because wolverines rely on carrion from kills by gray wolves for survival [28]. Agriculture, silvicultural practices, and oil, gas, and mineral development can fragment habitats, which could have negative effects on wolverine populations [11]. Large hydroelectric reservoirs may threaten wolverine habitat and prey [115]. The effects of villages on wolverine populations in Alaska were unknown [75]. As stated in a review, populations are likely limited by clear-cut logging, road construction, and snowmobile and other off-road vehicle use that can disturb large wilderness areas [84]. Silvicultural practices that reduce the overstory would be detrimental to wolverine populations in winter [122]. Wolverines cross clear-cuts and burns in western Montana, but they appear to spend as little time within these areas as possible. Males in Montana are found further from active roads, clear-cuts, and burns than females [54].

Roads divide habitats and may impede wolverine movements, isolating populations. Wolverines along the British Columbia-Alberta border avoided areas <330 feet (100 m) off the Trans Canada Highway and showed a preference for areas >3,600 feet (1,100 m) off the highway. They also avoided sections of a ski trail that were within 660 feet (200 m) of the highway and preferred trails >3,600 feet (1,100 m) from the highway. Wolverines crossed the Trans Canada Highway 50% of the time when approached but only where the rights-of-way were shortest. Railway rights-of-way did not impede wolverine crossing when the railways were not associated with the Trans Canada Highway. Wolverines may be more vulnerable to traffic when road rights-of-way are wide. An ideal road design would be straight roads with rights-of-way <160 feet (50 m) [6].

  • 6. Austin, Matt. 1998. Wolverine winter travel routes and response to transportation corridors in Kicking Horse Pass between Yoho and Banff National Parks. Calgary, AB: University of Calgary. 40 p. Thesis. [68217]
  • 11. Banci, Vivian. 1994. Wolverine. In: Ruggiero, Leonard F.; Aubry, Keith B.; Buskirk, Steven W.; Lyon, L. Jack; Zielinski, William J., tech. eds. The scientific basis for conserving carnivores: American marten, fisher, lynx, and wolverine. Gen. Tech. Rep. RM-254. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 99-127. [29934]
  • 28. Committee on the Status of Endangered Widllife in Canada. 2003. COSEWIC assessment and update status report on the wolverine (Gulo gulo) eastern population western population in Canada. Ottawa, ON: Environment Canada, Canadian Wildlife Service, Committee on the Status of Endangered Wildlife in Canada. 41 p. [68159]
  • 44. Grinnell, George Bird. 1926. Some habits of the wolverine. Journal of Mammalogy. 7(1): 30-34. [70385]
  • 54. Hornocker, Maurice G.; Hash, Howard S. 1981. Ecology of the wolverine in northwestern Montana. Canadian Journal of Zoology. 59(7): 1286-1301. [68358]
  • 55. Ingram, Rod. 1973. Wolverine, fisher, and marten in central Oregon. Central Oregon Administrative Report No. 73-2. Salem, OR: Oregon State Game Commission. 41 p. [13472]
  • 62. Krebs, John; Lofroth, Eric; Copeland, Jeffrey; Banci, Vivian; Cooley, Dorothy; Golden, Howard; Magoun, Audrey; Mulders, Robert; Shults, Brad. 2004. Synthesis of survival rates and causes of mortality in North American wolverines. The Journal of Wildlife Management. 68(3): 493-502. [68148]
  • 75. Magoun, Audrey J. 1985. Population characteristics, ecology, and management of wolverines in northwestern Alaska. Fairbanks, AK: University of Alaska Fairbanks. 197 p. Dissertation. [68219]
  • 84. Nowak, Ronald M. 1973. Return of the wolverine. National Parks and Conservation. 47(2): 20-23. [70410]
  • 108. Tomback, Diana F.; Kendell, Katherine C. 2002. Rocky road in the Rockies: challenges to biodiversity. In: Baron, Jill S., ed. Rocky Mountain futures: An ecological perspective. Washington, DC: Island Press: 153-180. [45449]
  • 33. Dauphiné, T. Charles. 1990. Updated status report on the wolverine Gulo gulo in Canada. Ottawa, ON: Committee on the Status of Endangered Wildlife in Canada (COSEWIC). 27 p. [68240]
  • 122. Wright, Jonathan D.; Ernst, Jessica. 2004. Effects of mid-winter snow depth on stand selection by wolverines, Gulo gulo luscus, in the boreal forest. The Canadian Field-Naturalist. 118(1): 56-60. [68291]
  • 115. Whitman, Jackson S.; Ballard, Warren B. 1984. Big game studies. Volume 7. Wolverine. Susitna Hydroelectric Project--Final Report. [Anchorage, AK]: Alaska Department of Fish and Game. 25 p. [68226]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wolverines have declined through much of their historic range; they are very sensitive to human disturbance and have retreated to remaining areas of wilderness (4). They continue to be threatened by habitat loss and also by a loss of prey species or even other carnivores (such as wolves) that provide carrion (4). Where they do exist near humans they can come into conflict with farmers from attacking livestock; persecution and poaching are therefore pertinent threats (4). In addition, populations that are protected are slow to recover due to slow reproduction rates caused by the small litter size and the fact that females only reproduce every few years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Maintaining wilderness and roadless areas is critical. In timber harvest areas, roads should be minimized.

Although wolverines maintain large home ranges, they exhibit fidelity to discrete areas, and populations in scattered sites within areas such as the Northwest Territories (Canada) are genetically independent, suggesting the need to consider preservation of multiple populations if genetic diveristy is to be maintained (Wilson et al. 2000).

Management Requirements: Management programs must be regional, rather than local, for this wide-ranging, low-density species.

Rowland et al. (2003) evaluated performance of landscape models for wolverines within their historical range at 2 scales based on recent observations (n = 421) from Washington, Oregon, Idaho, and Montana. At the subbasin scale, simple overlays of habitat and road-density classes were effective in predicting observations of wolverines. At the watershed scale, they used a Bayesian belief network model to provide spatially explicit estimates of relative habitat capability. The model had 3 inputs: amount of habitat, human population density, and road density. At both scales, the best models revealed strong correspondence between means of predicted counts of wolverines and means of observed counts. Their results can be used to guide regional conservation planning for wolverines.

See Predator Conservation Alliance (2001) for a summary of management needs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected legally in several western states. Occurs in several national parks.

Needs: Kyle and Strobeck (2002) confirmed that high levels of gene flow occur among all the northern wolverine populations sampled. They "also observed progressively increasing genetic structure at the periphery of their southern and eastern distributions, suggesting that these populations may have been partially fragmented from what was once a panmictic unit. Peripheral populations may be more susceptible to extirpation and, therefore, may be the most appropriate targets for concerted conservation efforts to prevent the elimination of wolverines from yet more of their historical range."

Protection of natal denning habitat from human disturbance may be critical. Montane coniferous forests, suitable for winter foraging and summer kit rearing, may only be useful if connected with subalpine cirque habitats required for natal denning, security areas, and summer foraging. In addition, these habitats must be available during the proper season. Subalpine cirque areas, important for natal denning, may be made unavailable by winter recreational activities. Conversely, high road densities, timber sales, or housing developments on the fringes of subalpine habitats may reduce potential for winter foraging and kit rearing, and increase the probability of human-caused wolverine mortality. [from www.wolverinefoundation.org].

See also Predator Conservation Alliance (2001) for a summary of protection needs.

Keep trappers out of known wolverine areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
The wolverine has been petitioned twice for listing under the federal Endangered Species Act in the conterminous United States, but the most recent petition was denied citing lack of information on distribution, habitat requirements, and threats (United States Fish and Wildlife Service 2003). In North America, the eastern wolverine population continues to be Endangered, and the western population remains Special Concern.

The wolverine is recorded from a number of protected areas. However, due to its spatial requirement, very few reserves will contain the full home ranges of more than a small number of individuals (Schreiber et al., 1989).

European range states have different monitoring and management regimes varying from strict protection in Finland and Sweden, licensed harvest and control measurements in Norway to legal harvest year round in Russia.

In North America, wolverine management issues include regulating trapper harvest, preventing human disturbance at denning sites, and mitigating for habitat loss and fragmentation (Krebs et al., 2004).

Key conservation measures that need to be implemented revolve around minimizing conflicts resulting from depredation of livestock, reducing legal and illegal hunting of wolverines, establishing well-planned conservation areas and carrying out surveys to gain a better understanding of the population and ecology of the wolverine.

Farmers and local communities should be educated in and encouraged to adopt husbandry practices that will minimize depredation of livestock thereby reducing conflicts. Economic incentives could encourage farmers to conserve wolverines on their land instead of hunting them. A compensation and education program has been implemented in Sweden with reindeer herders where the herders profit financially from identifying dens on their land and protecting them; similar programs could be applied in more areas of the species range.

Governments and researchers require a more solid knowledge of population dynamics, wolverine-prey relationships, habitat-use and distribution of the wolverine. This information is needed to ensure that legal, government-permitted hunting quotas are appropriate and small, localized, endangered populations are protected. Better enforcement of laws that prohibit hunting of wolverines is required in applicable parts of the species range, with higher penalties to discourage poachers. Governments need also improve coordination between wildlife conservation and agriculture programs to ensure that conservation areas are established in regions with little risk of conflict with farmers and herders.

The wolverine is listed on Appendix II of the Bern Convention and Annex II* and Annex IV of the EU Habitats and Species Directive. European range states have different monitoring and management regimes varying from strict protection in Finland and Sweden, licensed harvest and control measurements in Norway to legal harvest year round in Russia.

1. Scandinavian wolverine population: The Scandinavian wolverine population is covered by both Swedish and Norwegian management regimes, which are quite different. However, both Norwegian and Swedish populations are monitored through annual counting of active natal dens (Landa et al. 1998b) and non-invasive faecal DNA surveys (in southern areas). There is cooperation and data exchange between the two national programmes. The Swedish national interim goal is to reach minimum 90 annual wolverine reproductions (approximately 575 individuals >1 yr of age) (Riksdagen 2000). Sweden has international obligations through the Bern Convention for the conservation of the European wildlife and habitats, the regulation of trade through the European Council Regulation on the protection of species of wild fauna and flora, and the EU habitat directive. The wolverine is in Sweden is officially listed as endangered and is not subject to hunting. However, recently a few family groups have been killed in the purpose of reducing conflict with the domestic reindeer herding industry in northern areas. Norway was recently (2003) divided into 6 different management regions with politically appointed management boards (Miljøverndepartementet 2003). The Norwegian national goal is to control the total population within the limits of 39 yearly active reproductions (21 within the Norwegian part of the Scandinavian wolverine population) (Miljøverndepartementet 2003). The total of 39 breedings equals approximately 250 individuals >1 yr of age. Control measurements, killing of family groups in early spring and licensed harvest is used as a management tool to restrict wolverine distribution and predation on unattended sheep during summer and domestic reindeer all year around. Wolverines in Norway are covered by the Bern Convention (Bern 1979). The wolverines in Norway are officially listed as vulnerable (new official listing is expected by the end of 2006).

2. Southern Norwegian wolverine population: Norway was recently (2003) divided into 6 different management regions. The national goal is to control the Southern Norwegian population (including North Trøndelag County) at maximum 18 yearly active reproductions (approximately 115 individuals >1 yr of age) (Miljøverndepartementet 2003). Control measurements, killing of family groups in early spring and licensed harvest is used as a management tool to restrict wolverine distribution and predation on unattended sheep during summer in southern Norway. Wolverines in Norway are covered by the Bern Convention (Bern 1979). The wolverines in Norway are officially listed as vulnerable (new official listing is expected by the end of 2006).

3. Swedish forest wolverine population/occurrence: Totally protected, also see description for the Scandinavian wolverine population for further details.

4. Finnish – western Russian wolverine population: Management differs in Finland and Russia. In Finland the species is monitored through a national fauna monitoring programme based on tracks crossing fixed 4x4+4 km triangles. Wolverines have been fully protected in Finland since 1982. In Russia the wolverine is monitored via tracking surveys and numbers are estimated based on daily pats and a calculation coefficient (Novikov 1994, Novikov 2005). In Russia wolverines are considered a game/pelt species.

5. Finnish western wolverine population: Wolverines have been fully protected in Finland since 1982. In western Finland, the small introduced subpopulation seems to function without the presence of semi-domesticated reindeer, wolf, or lynx. A research project where nutritional ecology of wolverines within the three areas of wolverine distribution within Finland will be compared has been initiated. A future aim is to develop non-invasive molecular genetic monitoring of the wolverines within Finland similar to the one conducted in Scandinavia (Kojola 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

WWF International launched a Large Carnivore Initiative for Europe (LCIE) in 1995 and under this initiative an Action Plan has been drawn up for the conservation of this species in Europe (6). The wolverine is protected in much of its range but more research into the population dynamics and behaviour of this elusive creature are desperately needed. In Europe especially, where there are fewer areas of true wilderness left, any conservation initiative will have to work closely with local people to combat prejudice (4). In the United States, the wolverine is yet to be listed on the Endangered Species Act due to the paucity of data surrounding this species, highlighting once again the need for further research (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Fur is favorable for trimming parkas, but limited numbers make the wolverine relatively unimportant as a furbearer. In the 1970s, annual harvest was several hundred in Alaska and a few dozen in Montana (Wilson 1982). In the early 1980s, the harvest in Canada, Alaska, and Montana was 1377 (Nowak 1991).

Sometimes regarded as a nuisance; may rob traplines or destroy human food caches. Was intensively hunted in Scandinavia because of alleged predation on domestic reindeer (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Wolverines live in remote areas where human populations are sparse. Many wolverines are shot due to their habit of preying upon animals that are trapped for fur. They have been extensively hunted in Scandinavia because of its alleged predation on domestic reindeer. It has been considered a nuisance throughout its range because it will eat animals already caught in fur traps and will break into cabins and food caches, eating and spraying the contents with its strong scent. Wolverines can even break into canned goods with their sharp canines. Wolverines are supposedly very difficult to trap; when a wolverine finds a trap, it may spring it by turning it upside down or by dropping a stick into it. Wolverines have also been known to carry traps away and bury them deep in the snow.

Negative Impacts: injures humans; crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Wolverine are sometimes hunted for their fur because it is prized for its frost resistant properties. Native peoples used them to line parkas. However, their skins are no longer used widely in commerce. Wolverines are also important members of the ecosystems in which they live, they are important as top predators and scavengers.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Wolverine

"Gulo" redirects here. For the enzyme and gene, see L-gulonolactone oxidase.
This article is about the animal. For other uses, see Wolverine (disambiguation).

The wolverine /ˈwʊlvərn/, Gulo gulo (Gulo is Latin for "glutton"), also referred to as glutton, carcajou, skunk bear, or quickhatch, is the largest land-dwelling species of the family Mustelidae (weasels). It is a stocky and muscular carnivore, more closely resembling a small bear than other mustelids. The wolverine, a solitary animal,[1] has a reputation for ferocity and strength out of proportion to its size, with the documented ability to kill prey many times larger than itself.

The wolverine can be found primarily in remote reaches of the Northern boreal forests and subarctic and alpine tundra of the Northern Hemisphere, with the greatest numbers in northern Canada, the U.S. state of Alaska, the Nordic countries of Europe, and throughout western Russia and Siberia. Their populations have experienced a steady decline since the 19th century in the face of trapping, range reduction and habitat fragmentation, such that they are essentially absent in the southern end of their European range. Large populations are thought to remain in North America and northern Asia. In February 2013, the United States Fish and Wildlife Service proposed giving Endangered Species Act protections to the wolverine largely because global warming is whittling away its wintry habitat in the northern Rockies.[2] In February 2014, a wolverine was seen in Utah, the first confirmed sighting in that state in 30 years.[3]

Taxonomy[edit]

Wolverine skull from the Pleistocene of Germany at the Museum für Naturkunde, Berlin

Genetic evidence suggests that the wolverine is most closely related to the tayra and martens (scientific names Eira and Martes, respectively), all of which shared a Eurasian ancestor.[4]

Within the Gulo genus, a clear separation occurs between two subspecies: the Old World form Gulo gulo gulo and the New World form G. g. luscus. Some authors had described as many as four additional North American subspecies, including ones limited to Vancouver Island (G. g. vancouverensis) and the Kenai Peninsula in Alaska (G. g. katschemakensis). However, the most currently accepted taxonomy recognizes either the two continental subspecies or recognize G. gulo as a single Holarctic taxon.[5]

Hall[who?] regards the North American Wolverine as a species (Gulo luscus) distinct from the Eurasian Wolverine (Gulo gulo).[1][verification needed]

Recently compiled genetic evidence suggests most of North America's wolverines are descended from a single source, likely originating from Beringia during the last glaciation and rapidly expanding thereafter, though considerable uncertainty to this conclusion is due to the difficulty of collecting samples in the extremely depleted southern extent of the range.[5]

Physical characteristics[edit]

Skull, as illustrated by N. N. Kondakov.
Skeleton

Anatomically, the wolverine is a stocky and muscular animal. With short legs, broad and rounded head, small eyes and short rounded ears, it resembles a bear more than other mustelids. Though its legs are short, its large, five-toed paws and plantigrade posture facilitate movement through deep snow.[6]

The adult wolverine is about the size of a medium dog, with a length usually ranging from 65–107 cm (26–42 in), a tail of 17–26 cm (6.7–10.2 in), and a weight of 9–25 kg (20–55 lb), though exceptionally large males can weigh up to 32 kg (71 lb).[7][8][9] The males are as much as 30% larger than the females and can be twice the females' weight. Shoulder height is reported from 30 to 45 cm (12 to 18 in).[10] It is the largest of terrestrial mustelids; only the marine-dwelling sea otter and giant otter of the Amazon basin are larger.

Wolverines have thick, dark, oily fur which is highly hydrophobic, making it resistant to frost. This has led to its traditional popularity among hunters and trappers as a lining in jackets and parkas in Arctic conditions. A light-silvery facial mask is distinct in some individuals, and a pale buff stripe runs laterally from the shoulders along the side and crossing the rump just above a 25–35 cm (9.8–13.8 in) bushy tail. Some individuals display prominent white hair patches on their throats or chests.[6]

Like many other mustelids, it has potent anal scent glands used for marking territory and sexual signaling. The pungent odor has given rise to the nicknames "skunk bear" and "nasty cat." Wolverines, like other mustelids, possess a special upper molar in the back of the mouth that is rotated 90 degrees, towards the inside of the mouth. This special characteristic allows wolverines to tear off meat from prey or carrion that has been frozen solid.[11][12]

Behavior[edit]

The wolverine is a powerful and versatile predator and scavenger. Prey mainly consists of small to medium-sized mammals, but the wolverine has been recorded killing prey such as adult deer that are many times larger than itself. Prey species include porcupines, squirrels, beavers, marmots, rabbits, voles, mice, shrews, lemmings, caribou, roe deer, white-tailed deer, mule deer, sheep, moose, and elk.[13] Smaller predators are occasionally preyed on, including martens, mink, foxes, Canada lynx, weasels, Eurasian lynx,[14] and coyote and wolf pups. Wolverines often pursue live prey that are relatively easy to obtain, including animals caught in traps, newborn mammals, and deer (including adult moose and elk) when they are weakened by winter or immobilized by heavy snow. Their diets are sometimes supplemented by birds' eggs, birds (especially geese), roots, seeds, insect larvae, and berries. A majority of the wolverine's sustenance is derived from carrion, on which they depend almost exclusively in winter and early spring. Wolverines may find carrion themselves, feed on it after the predator is done feeding (especially wolf packs) or simply take it from another predator. Whether eating live prey or carrion, the wolverine's feeding style appears voracious, leading to the nickname of "glutton" (also the basis of the scientific name). However, this feeding style is believed to be an adaptation to food scarcity, especially in winter.[15]

Armed with powerful jaws, sharp claws, and a thick hide,[16] wolverines, like most mustelids, are remarkably strong for their size. They may defend kills against larger or more numerous predators such as wolves or bears.[17] At least one account reported a wolverine's apparent attempt to steal a kill from a black bear, although the bear won what was ultimately a fatal contest.[18] In another account, a wolverine attacked a polar bear and clung to its throat until the bear suffocated.[19][20] While wolverines have dominated wolves in competitions over a carcass, some wolves habitually prey on wolverines and can eradicate them from a given area.[9]

Wolverines inhabiting the Old World (specifically, Fennoscandia) hunt more actively than their North American relatives.[21] This may be because competing predator populations in Eurasia are not as dense, making it more practical for the wolverine to hunt for itself than to wait for another animal to make a kill and then try to snatch it. They often feed on carrion left by wolves, so changes in wolf populations may affect the population of wolverines.[22] They are also known on occasion to eat plant material.[23]

Successful males will form lifetime relationships with two or three females, which they will visit occasionally, while other males are left without a mate.[24] Mating season is in the summer, but the actual implantation of the embryo (blastocyst) in the uterus is stayed until early winter, delaying the development of the fetus. Females will often not produce young if food is scarce. The gestation period is 30–50 days, and litters of typically two or three young ("kits") are born in the spring. Kits develop rapidly, reaching adult size within the first year of a lifespan that may reach anywhere from five to (in exceptional individuals) 13 years.[citation needed] Fathers make visits to their offspring until they are weaned at 10 weeks of age; also, once the young are about six months old, some reconnect with their fathers and travel together for a time.[24]

Range[edit]

Wolverine on rocky terrain

Wolverines live primarily in isolated arctic and alpine regions of northern Canada, Alaska, Siberia, and Scandinavia; they are also native to European Russia, the Baltic countries, the Russian Far East, northeast China and Mongolia. In 2008 and 2009, wolverines were sighted as far south as the Sierra Nevada, near Lake Tahoe, for the first time since 1922.[25][26][27] They are also found in low numbers in the Rocky Mountains and northern Cascades of the United States, and have been sighted as far south and east as Michigan.[28] However, most New World wolverines live in Canada.[23]

The world's total wolverine population is not known. The animal exhibits a low population density and requires a very large home range.[22] The range of a male wolverine can be more than 620 km2 (240 mi2), encompassing the ranges of several females which have smaller home ranges of roughly 130–260 km2 (50–100 mi2). Adult wolverines try for the most part to keep nonoverlapping ranges with adults of the same sex.[12] Radio tracking suggests an animal can range hundreds of miles in a few months.

Female wolverines burrow into snow in February to create a den, which is used until weaning in mid-May. Areas inhabited nonseasonally by wolverines are thus restricted to zones with late-spring snowmelts. This fact has led to concern that global warming will shrink the ranges of wolverine populations.[24]

The Wildlife Conservation Society reported in June 2009 that a wolverine researchers had been tracking for almost three months had crossed into northern Colorado. Society officials had tagged the young male wolverine in Wyoming near Grand Teton National Park and it had traveled southward for about 500 miles. It was the first wolverine seen in Colorado since 1919, and its appearance was also confirmed by the Colorado Division of Wildlife.[23]

This requirement for large territories brings wolverines into conflict with human development, and hunting and trapping further reduce their numbers, causing them to disappear from large parts of their former range; attempts to have them declared an endangered species have met with little success.[22]

CountryPopulationAreaYearState of population
Sweden265+[6]Norrbotten[6]1995–97[6]Stable[6]
Norway150+[6]Snøhetta plateau and North[6]1995–97[6]Decline[6]
Finland155–170[6]Karelia and North[6]2008[6]Stable[6]
Russia1500[6]Taiga[6]1970, 1990,[6]Decline[6]
Russia – Komi885[6]1990[6]
Russia – Archangelsk Oblast410[6]Nenetsky Autonomous Area[6]1990[6]Limited[6]
Russia – Kola Peninsula160[6]Hunting Districts[6]1990[6]Decline[6]
United States – Alaska[29]Unknown[29]Kobuk Valley National Park,[29] Selawik National Wildlife Refuge[29]1998[29]Decline[29]
United States – Alaska[30]3.0 (± 0.4 SE) wolverines/1,000 km2[30]Turnagain Arm and the Kenai Mountains[30]2004[30][30]
United States – Rocky Mountains[31]28–52[31]Montana, Idaho, Wyoming[31]1989–2007[31]Unknown[31]
United States – California[32]3[32]Tahoe National Forest[32]2008[32]Unknown[32]
Canada – Yukon9.7 (± 0.6 SE) wolverines/1,000 km2[30]Old Crow Flats[30]2004[30][30]
Canada – Ontario[33]Unclear[33]Red Lake – Sioux Lookout to Fort Severn – Peawanuck[33]2004[33]Stable to expanding[33]
Canada – Overall[34]15,000–19,000[34]Overall[34][34]Stable[34]

In captivity[edit]

Captive at the Kristiansand Zoo, Norway

Around a hundred wolverines are held in zoos across North America and Europe, and they have been successfully bred in captivity, but only with difficulty and high infant mortality.[35]

Name[edit]

The wolverine's questionable reputation as an insatiable glutton (reflected in the Latin genus name Gulo) may be in part due to a false etymology. The animal's name in Old Swedish, fjellfräs, meaning "mountain cat", worked its way into German as Vielfrass, which means roughly "devours much". Its name in other West Germanic languages is similar (e.g. Dutch: veelvraat).

The Finnish name is ahma, derived from ahmatti, which is translated as "glutton". Similarly, the Estonian name is ahm, with the equivalent meaning to the Finnish name. In Lithuanian is ernis, in Latviantinis or āmrija.

The Eastern Slavic росомаха (rosomakha) and the Polish and Czech name rosomák seem to be borrowed from the Finnish rasva-maha (fat belly). Similarly, the Hungarian name is rozsomák or torkosborz which means "gluttonous badger".

In French-speaking parts of Canada, the wolverine is referred to as carcajou, borrowed from the Innu-aimun or Montagnais kuàkuàtsheu.[36] However in France, the wolverine's name is glouton (glutton).

Purported gluttony is reflected neither in English nor in North Germanic languages. The English word wolverine (alteration of the earlier form wolvering of uncertain origin) probably implies "a little wolf". The name in Proto-Norse, erafaz and Old Norse, jarfr, lives on in the regular Icelandic name jarfi, regular Norwegian name jerv, regular Swedish name järv and regular Danish name jærv.

In culture[edit]

The Wolverine pendant of Les Eyzies, when wolverines were still found in southern France

Many cities, teams, and organizations use the wolverine as a mascot. For example, the US state of Michigan is, by tradition, known as "the Wolverine State", and the University of Michigan takes the wolverine as its mascot. The association is well and long established: for example, many Detroiters volunteered to fight during the American Civil War and George Armstrong Custer, who led the Michigan Brigade, called them the "Wolverines". The origins of this association are obscure; it may derive from a busy trade in wolverine furs in Sault Ste. Marie in the 18th century or may recall a disparagement intended to compare early settlers in Michigan with the vicious mammal. Wolverines are, however, extremely rare in Michigan. A sighting in February 2004 near Ubly was the first confirmed sighting in Michigan in 200 years.[37] The animal was found dead in 2010[38] and the story recounted in the book The Lone Wolverine.[39]

The wolverine figures prominently in the mythology of the Innu people of eastern Québec and Labrador. In at least one Innu myth, it is the creator of the world.[40]

Wolverine is the name of a popular fictional character appearing in X-Men books published by Marvel Comics—named for his highly individualistic and aggressive behavior, as well as his great ferocity despite his small stature.

Film[edit]

The 91-minute 1994 motion picture Running Free (also known as One Paw) is about a young boy and his friendship with an Alaskan wolverine. The wolverines seen in the film were born in captivity and directed by a USDA-licensed filmmaker, Steve Kroschel. Many of the wolverine scenes are documentary footage of trained wolverines being filmed in their natural habitat. The movie was screened on 5 October 1994. The American Humane Society was involved before the start of filming and during some of the filming.[41]

The first full-length nature documentary about wild wolverines, Wolverines – Hyenas of the North, was produced in 2006 by German wildlife film company Gulo Film Productions for German Television (NDR), and has been broadcast in many countries – also under the titles Wolverine X or Wolverine Revealed,[42] and in the US by Animal Planet as an episode of Mutual of Omaha's Wild Kingdom. The film by German director Oliver Goetzl shows many different social behaviour aspects of wild wolverines at the Finnish / Russian border area – some of them previously unknown – and has won more than 30 international festival awards and nominations, including at Jackson Hole Wildlife Film Festival, Wildscreen Film Festival, IWFF Missoula, Animal Behavior Society Film Festival and Banff World Television Awards.

The PBS series Nature released a documentary, "Wolverine: Chasing the Phantom" as episode #166 on 14 November 2010.[43] This 53-minute documentary[44] focuses on the efforts of a number of naturalists in the United States to track wolverines, collect genetic data, and learn more about wolverine populations, individual behavior and social behavior. It also tracks the raising of two male wolverines in captivity at an Alaska nature reserve from birth to maturity, and profiles the naturalists making these efforts.

Gallery[edit]

References[edit]

  1. ^ a b c Abramov, A., Belant, J. & Wozencraft, C. (2009). "Gulo gulo". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 2010-01-25. 
  2. ^ U.S. Proposes to Protect Wolverines February 1, 2013 New York Times
  3. ^ "Wolverine caught on camera in Utah for 1st time". 
  4. ^ Koepfli, Klaus-Peter; Deere, KA; Slater, GJ; Begg, C; Begg, K; Grassman, L; Lucherini, M; Veron, G; Wayne, RK (February 2008). "Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation". BMC Biology 6: 10. doi:10.1186/1741-7007-6-10. PMC 2276185. PMID 18275614. 
  5. ^ a b Eric Tomasik and Joseph A. Cook (2005). "Mitochondrial phylogeography and conservation genetics of wolverine (gulo gulo) of Northwestern North America". Journal of Mammalogy 86 (2): 386–396. doi:10.1644/BER-121.1. 
  6. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab Arild Landa, Mats Lindén and Ilpo Kojola (2000). "Action Plan for the conservation of Wolverines (Gulo gulo) in Europe" (PDF). Nature and environment, No. 115. Convention on the Conservation of European Wildlife and Natural Habitats (Bern Convention). Retrieved 2008-01-25. 
  7. ^ "wolverine (mammal) – Britannica Online Encyclopedia". Britannica.com. Retrieved 2010-10-04. 
  8. ^ Maurice Burton; Robert Burton (1970). The international wildlife encyclopedia. Marshall Cavendish. pp. 2959–. ISBN 978-0-7614-7266-7. Retrieved 16 September 2011. 
  9. ^ a b "Gulo gulo – The American Society of Mammalogists". smith.edu. Retrieved 2011-09-23. 
  10. ^ Wolverine: Chasing the Phantom. Wolverine Facts. pbs.org
  11. ^ Pratt, Philip. "Dentition of the Wolverine". The Wolverine Foundation, Inc. Retrieved 2007-07-01. 
  12. ^ a b Taylor, Ken (1994). "Wolverine". Wildlife Notebook Series. Alaska Department of Fish & Game. Retrieved 2007-01-21. 
  13. ^ Gulo gulo (wolverine), Animal Diversity Web
  14. ^ V.G. Heptner and A.A. Sludskii. Mammals of the Soviet Union. Volume II Part 2 Carnivora: Hyenas and Cats. 1992. New Delhi: Amerind Publishing, p. 625
  15. ^ Wolverine Gulo gulo, eNature.com
  16. ^ "World Biomes: Wolverine". Blueplanetbiomes.org. Retrieved 2010-10-04. 
  17. ^ "Wolverine - Montana Fish, Wildlife & Parks". Montana Outdoors. 
  18. ^ "When Predators Attack (Each Other): Researchers Document First-known Killing of a Wolverine by a Black Bear In Yellowstone" (Press release). Science Daily. 2003-05-06. Retrieved 2007-01-16. 
  19. ^ Mark Allardyce (2000-09-30). Wolverine – A Look Into the Devils Eyes. pp. 20, 165. ISBN 978-1-905361-00-7. Retrieved 8 August 2010. 
  20. ^ Phelps, Gilbert (1989). Between man and beast: true tales & observations of the animal kingdom. Random House Value Publishing. p. 73. ISBN 0-517-69038-1. 
  21. ^ World Wildlife Fund–Sweden: 1st International Symposium on Wolverine Research and Management (PDF)
  22. ^ a b c Glenn Hurowitz (2008-03-05). "First wolverine in 30 years spotted in California ", Grist.org; also US Forest Service (2008-03-06). "Camera Spots Wolverine in Sierra Nevada". physorg.com. Retrieved 2010-02-21. 
  23. ^ a b c Rickert, Eve (28 June 2007). "The perils of secrecy". High Country News. 
  24. ^ a b c Raloff, Janet (2010-10-21). "Wolverine: Climate warming threatens comeback". Science News (Society for Science & the Public) 178. Retrieved 2010-10-31. 
  25. ^ Knudson, Tom (5 April 2008). "Sighting prompts California to expand search for elusive wolverine". Sacramento Bee. [dead link]
  26. ^ Griffith, Martin (22 March 2009). "A year later, wolverine spotted again in Sierra". San Francisco Chronicle. 
  27. ^ Wolverine Sighting on SPI Land near Truckee 18 Mar 2009
  28. ^ Runk, David. (2004-02-25) First Michigan wolverine spotted in 200 years – Technology & science – Science – msnbc.com. MSNBC. Retrieved on 2011-09-16.
  29. ^ a b c d e f Brad Shults, Gene Peltola, Jerrold Belant and Kyran Kunkel (1998-12-17). "population ecology of wolverines within Kobuk valley national park and Selawik national wildlife refuge". Rocky Mountain Research Station, US Department of Agriculture – Forest Service. Retrieved 2008-01-26. 
  30. ^ a b c d e f g h i Howard N. Goldena, J. David Henryb, Earl F. Beckera, Michael I. Goldsteinc, John M. Mortond, Dennis Frost, and Aaron J. Poef (1998-12-17). "Estimating wolverine Gulo gulo population size using quadrat sampling of tracks in snow". Alaska Department of Fish and Game, Division of Wildlife Conservation; Parks Canada – Kluane National Park; US Forest Service – Alaska Regional Office; United States Fish and Wildlife Service, Kenai National Wildlife Refuge; North Yukon Renewable Resources Council; United States Forest Service, Chugach National Forest;. Retrieved 2007. 
  31. ^ a b c d e Michael K. Schwartz, Jeffrey P. Copeland, Neil J. Anderson, John R. Squires, Robert M. Inman, Kevin S. McKelvey, Kristy L. Pilgrim, Lisette P. Waits, and Samuel A. Cushman (2010). "Wolverine gene flow across a narrow climatic niche" (PDF). Ecology 90:3222–3232. Ecological Society of America. Retrieved 2010-10-14. 
  32. ^ a b c d e "Wolverines in California – California Department of Fish and Game". Dfg.ca.gov. Retrieved 2012-09-15. 
  33. ^ a b c d e Dr. Audrey Magoun, Neil Dawson, Dr. Geoff Lipsett-Moore, Dr. Justina C. Ray (2004). "Boreal Wolverine: A Focal Species for Land Use planning in Ontario's Northern Boreal Forest – Project Report" (PDF). The Wolverine Foundation, Inc., Ontario Ministry of Natural Resources, Ontario Parks, Wildlife Conservation Society (WCS)/University of Toronto. Retrieved 2008-01-26. 
  34. ^ a b c d e Brian Slough et al. (May 2003). "COSEWIC Assessment and Update Status Report on the Wolverine (Gulo gulo) – Eastern Population Western Population in Canada" (PDF). COSEWIC (committee on the status of endangered wildlife in Canada) 2003. COSEWIC assessment and update status report on the wolverine Gulo gulo in Canada. Committee on the Status of Endangered Wildlife in Canada. Ottawa. vi + 41 pp. Retrieved 2008-01-26. 
  35. ^ "Gulo gulo – Wolverine". International Species Identification System. May 2010. Retrieved 2010-05-09. 
  36. ^ "The Free Dictionary". The Free Dictionary. Retrieved 2010-10-04. 
  37. ^ Runk, David (25 Feb 2004). "First Michigan wolverine spotted in 200 years". Associated Press. Retrieved 23 Dec 2008. 
  38. ^ Bell, Dawson (2010-03-15). "Only known wolverine in the Michigan wild dies". Detroit Free Press. 
  39. ^ Shaw, Elizabeth Phillips (2012). The Lone Wolverine: Tracking Michigan's Most Elusive Animal. University of Michigan Press. ISBN 978-0472118397. 
  40. ^ Armitage, Peter (1992). "Religious ideology among the Innu of eastern Quebec and Labrador" (PDF). Religiologiques 6. Archived from the original on 1 January 2007. Retrieved 2007-06-29.  (PDF)
  41. ^ Synertech International Corp. (1994-10-05). "American Humane Society Film Review". Ahafilm.info. Retrieved 2010-10-04. 
  42. ^ "Animal Planet :: Wolverine Revealed". Animal.discovery.com. Retrieved 2012-09-15. 
  43. ^ Wolverine: Chasing the Phantom. IMDB.com
  44. ^ Wolverine: Chasing the Phantom | Nature | PBS Video. Video.pbs.org (14 November 2010). Retrieved on 2011-09-16.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors (e.g., Hall 1981) have regarded the North American wolverine as a species (Gulo luscus) distinct from the Eurasian wolverine (Gulo gulo). Most recent accounts (e.g., Jones et al. 1992; Wozencraft, in Wilson and Reeder 1993, 2005; Pasitschniak-Arts and Lariviere 1995) treat luscus as a subspecies of Gulo gulo, following Degerbol (1935) and Kurten and Rausch (1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Synonyms

Gulo luscus L. [47] =

    Gulo gulo luscus (L.)
  • 47. Hall, E. Raymond. 1981. Gulo luscus: Wolverine. In: The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley & Sons: 1007-1009. [54715]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The scientific name of wolverine is Gulo gulo L. It is a member of
the weasel family, Mustelidae [8,85,118]. Subspecies in North America include [47,85,118]:
Gulo gulo katschemakensis Matschie, Kenai wolverine

Gulo gulo luscus (L.), North American wolverine

Gulo gulo luteus Elliot, California wolverine

Gulo gulo vancouverensis Goldman, Vancouver Island wolverine
  • 8. Baker, Robert J.; Bradley, Lisa C.; Bradley, Robert D.; Dragoo, Jerry W.; Engstrom, Mark D.; Hoffmann, Robert S.; Jones, Cheri A.; Reid, Fiona; Rice, Dale W.; Jones, Clyde. 2003. Revised checklist of North American mammals north of Mexico, 2003. Occasional Papers No. 229. Lubbock, TX: Museum of Texas Tech University. 23 p. [50946]
  • 47. Hall, E. Raymond. 1981. Gulo luscus: Wolverine. In: The mammals of North America. 2nd ed. Vol. 2. New York: John Wiley & Sons: 1007-1009. [54715]
  • 118. Wilson, Don E.; Reeder, DeeAnn M., eds. 2005. Mammal species of the world: A taxonomic and geographic reference. 3rd ed. Baltimore, MD: Johns Hopkins University Press. 2142 p. [60623]
  • 85. Pasitschniak-Arts, Maria; Lariviere, Serge. 1995. Gulo gulo. Mammalian Species No. 499. [Place of publication unknown]: The American Society of Mammalogists. 10 p. [69107]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

wolverine

glutton

stink-bear

little bear

carajou

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!