Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

The wolverine is possibly the least known of the northern hemisphere's large carnivores (2). Individuals are solitary, except for mothers with their young, and can occupy enormous home ranges depending on habitat and prey availability. Male's home ranges may encompass those of several females, and the largest have been estimated at around 920 km2 (3). Wolverines tend to alternate periods of activity and sleep throughout the day and night, when awake they are capable of crossing vast distances, climbing trees and swimming rivers (3). Mating occurs from April to August and births take place the following spring, usually within a den or sheltered area appropriated by the mother (4). Litters typically contain two to three cubs, which are born blind and with white fur. Weaned after nine to ten weeks, cubs often stay with their mother for over a year and females are therefore likely to reproduce only every couple of years (4). Wolverines are reputed to have a voracious appetite and are even known as the 'glutton' in some areas (3). They do not hibernate over the cold winter months as some other carnivores do and are opportunistic scavengers, often feeding on carrion (3). The diet varies across their range with wolverines in Scandinavia feeding on wild and domestic reindeer (4), and those in Alaska consuming whale and seal carcases (3). Food may be stored for later consumption but wolverines also actively attack some prey, especially smaller mammals such as domestic sheep (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

Wolverines are widely distributed in the northern reaches of both hemispheres. In North America, they occupy remote habitats from the high mountainous interior of the Rockies to Arctic coastal tundra. They are solitary wanderers who specialize on larger vertebrate prey. They usually feed on small-to-medium size mammals, but have even been known to take down caribou, and will eat carrion. Wolverines use large home ranges of 100 to 600 square km. Males are larger than females, and their ranges are larger; a male will exclude all other males from his range, but his territory may overlap with that of several females.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the wolverine  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:45, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The elusive wolverine has a fearsome reputation - it is the largest member of the weasel family. The remoteness and voracious appetite of these creatures have led to an aggressive reputation. Males are much heavier than females and both have a stocky body and short legs (3). They are well adapted to the cold habitat of their northern range with a thick, bushy coat and broad, hairy paws (3). The glossy coat is dark brown with a paler stripe across the rump and along the sides of the body; some individuals have white throat patches (4). The powerful jaws and large teeth are able to demolish frozen carrion and bone (3). Wolverines carry their head and tail lower than the arched back and their gait appears somewhat humpy and lumbering although they can move very quickly when necessary (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The species has a circumpolar distribution, corresponding with the Boreal zone of the northern hemisphere (Kvam et al. 1988). The range of the wolverine reaches from Scandinavia through the Russian Federation and Siberia to Alaska, Canada and the western lower states of the United States south to California. The range includes territory of the following countries: Canada, China (Heilongiang, Xinjiang, Inner Mongolia), Estonia, Finland, Mongolia, Norway, Russian Federation, Sweden, and United States (Alaska, Wyoming, Idaho, Montana, Washington, Oregon and California) (Whitman 1999).

During the 19th century, wolverines disappeared from the southernmost of these areas in Europe mainly due to persecution, but also due to deforestation and other human developments. In Europe the species is now found in Norway, Sweden, Finland and European part of Russia. Within these countries wolverines are mainly found north of 60ºN. Based on geographic connectivity and genetic surveys the wolverines in Europe likely consist of five populations/occurrences.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Wolverines are found in North America and northern Eurasia, in the boreal zone of the northern hemisphere. They require large expanses of relatively undisturbed, boreal habitat. Wolverines are found in Scandinavia and Russia to 50 degrees North latitude. In North America they are found in Alaska and northern Canada, but can also be found in mountainous regions along the Pacific Coast as far south as the Sierras of California. Historically, wolverines were found in more southerly areas of Europe and North America, but these populations were extirpated mainly due to hunting, clearing of forests, and other human activities. Their distribution once extended as far south as Colorado, Indiana, and Pennsylvania in North America.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • 2007. "Alaska Fish and Wildlife Service" (On-line). Accessed April 10, 2009 at http://www.adfg.state.ak.us/pubs/notebook/furbear/wolverin.php.
  • 2008. "United States Fish and Wildlife Service" (On-line). Accessed April 10, 2009 at http://ecos.fws.gov/speciesProfile/SpeciesReport.do?spcode=A0FA.
  • 2009. "Wolverine" (On-line). Accessed April 11, 2009 at http://www.wolverines-wolverines.com/.
  • Abramov, B., C. Wozencraft. 2008. "International Union for the Conservation of Nature 2008 Red List" (On-line). Accessed April 08, 2009 at http://www.iucnredlist.org/details/9561.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Holarctic; northern Europe, northern Asia, and northern North America (Pasitschniak-Arts and Lariviere 1995, Aubry et al. 2007). The species occupies a wide elevational range; for example, in California, wolverines have been recorded at elevations of 400 to 4,300 meters (average 2425 m) (California DF&G 1990, Wilson 1982).

Historical range in North America: arctic islands to the mountains of California, Colorado, and Utah (Predator Conservation Alliance 2001), and parts of the northcentral and northeastern U.S. (where records are sketchy and scarce). Presently extirpated from most of the southern part of the range, including all of the northcentral and northeastern U.S. and most of southeastern and south-central Canada.

In Canada, the wolverine retains its original distribution in the arctic region and in the western mountain and boreal regions but has disappeared from the prairies and from areas south of the boreal forest in eastern Canada; within the boreal region a large gap distributional has developed southeast of Hudson Bay (Dauphine, 1989 COSEWIC report). There have been no verified reports of wolverines in Quebec since 1978, or in Labrador since 1950, but there are unconfirmed reports almost every year (Environment Canada, Species at Risk website).

Recent surveys in the contiguous United States indicate that wolverines appear to occupy (and are essentially limited to) the montane regions of Idaho, Montana, Wyoming, and Washington (Copeland 1996; Washington Department of Wildlife 1998; Inman et al. 2002; Giddings, pers. comm., 2003 cited by USFWS 2003; Squires, pers. comm., 2003, cited by USFWS 2003). Until recently, there had been no confirmed records of wolverine in California since 1922 (Grinnell et al. 1937); attempts to locate wolverines by means of photographic bait stations during the winters of 1991-1992 and 1992-1993 yielded no records (Barrett et al. 1994). In 2008-2010, a single male wolverine was photographed by camera traps in the central Sierra Nevada of California. However, genetic data indicate that this male is related to wolverines in the northern Rocky Mountains and not a remnant of the native California population. See Predator Conservation Alliance (2001) and Wilson (1982) for a state-by-state review of occurrence in the contiguous United States.

Data on the distribution in Eurasia are sketchy. The range in Scandinavia appears to be concentrated in the mountainous central and northern portions of Norway and Sweden, as well as in Finland (Kvam et al. 1988; Nyholm 1993 and Andersson 1995, cited by Blomqvist 1995). Wolverines also occupy the taiga and northern coniferous forest of the former Soviet Union (M. S. Blinnikov, pers. comm.). [from Petersen 1997]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Wolverines have a circumpolar distribution in the northern hemisphere, and are found from the western United States, Canada, and Alaska to Siberia, Russia, Eastern Europe and Scandinavia (3). Previously their distribution extended further south reaching the Baltic States and southern California respectively, but with human encroachment the range has retreated northwards, leaving remnant populations in pockets of remaining wilderness in sub-arctic regions (3). Populations in North America and Europe are sometimes divided into separate subspecies, known as Gulo gulo luscus and G. g. gulo, respectively (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Wolverines are one of the largest members of the family Mustelidae and are unmistakable in appearance. They are terrestrial mammals with body lengths of 65 to 105 cm, tail lengths of 13 to 26 cm, and shoulder heights of 36 to 45 cm. Wolverines weigh from 9 to 30 kg, females are generally smaller than males by about 10% in linear measurements and 30% in weight. They have short, powerful limbs and 5 toes on each paw. They use a semi-plantigrade form of locomotion, with their weight primarily on their metatarsals. This distributes weight better and can be useful when traveling and hunting in snow. On hard ground, ungulates can outrun wolverines. In snow, wolverines are less likely to sink in and can often catch much larger animals that become immobilized in deep snow. Wolverine fur is usually brown or brownish-black, with a yellow or gold stripe extending from the crown of the head laterally across each shoulder and to the rump, where the stripes join at the tail. Wolverines have a stocky appearance, with a robust body, short, powerful limbs, a large head, and small, rounded ears. They have sharp claws that are semi-retractable and a very powerful bite, with which they crush bone. They are rarely seen by humans because of their low population densities and the remote terrain in which they live.

There are two subspecies of wolverines: North American wolverines (G. gulo luscus) and European wolverines (G. gulo gulo). Differences seem to be mainly genetic and probably as a result of the isolation of these two continental populations. Another possible subspecies on Vancouver Island, Canada: G. gulo vancouverensis. This population has skull morphology differences with those found on the mainland, but their status has yet to be decided.

Range mass: 9 to 30 kg.

Range length: 65 to 105 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 31.765 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males are 25%-30% heavier than females.

Length:
Range: 650-1,050 mm

Weight:
Range: "12.7-14.1 kg males; 8.3-9.9 kg females "
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 100 cm

Weight: 15000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the fisher in having yellowish stripes on the sides. Differs from the badger in having darker overall coloration (badger is yellowish gray), yellowish lateral stripes, and longer limbs; lacks the white stripe that in the badger extends from the snout over the top of the head to at least the neck.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Wolverines inhabit a variety of habitats in the alpine, tundra, taiga, and boreal forest zones. They are found in coniferous, mixed, and deciduous woodlands, bogs, and open mountain as well as tundra habitats (Mitchell-Jones et al. 1999). Snow is generally regarded as an important component of the wolverine's seasonal habitat requirements (Banci 1987, Hatler 1989). Wolverine habitat selection is negatively affected by human activity, including roads, infrastructure, and backcountry recreation (May et al. 2006; Krebs et al. 2007). The wolverine has vast home-ranges (Landa et al. 1998), vary from 100 to 500 km2 for males and 100 to 200 km2 for female, and good dispersal abilities. Faecal DNA sampling has detected dispersal distances of more than 500 kilometres (Flagstad 2005, Flagstad et al. 2006). Hornocker et al. (1983) consider this species as solitary, which influences the large home ranges and extensive seasonal movements.This species is nocturnal with some daylight activity and it is considered as opportunistic feeder. Wolverines prey on hares, rodents and occasionally animals as large as moose given certain snow conditions. They can also prey heavily on domestic sheep and semi-domesticated reindeer.

The wolverine is a nocturnal species (Whitman 1999) with an average life expectancy of 4 to 6 years in the wild, with a maximum of about 13 years (Pasitschniak-Arts and Lariviere 1995). The species reaches its sexual maturity at 2.5 years, breeding occurs in early spring to late fall with litters of 1-5 young (mean litter size is 3 young) born between February and April (Whitman 1999).

Wolverines are thought to have evolved to scavenge from the kills of wild ungulates abandoned by other carnivores such as the lynx and wolf, as well prey animals felled by disease or injury. Wolverines also actively hunt smaller animals such as rodents, hares, musk deer, roe deer and wild sheep; given the appropriate snow conditions they will also hunt larger animals such as moose. Conflicts arise when wolverines prey on domestic livestock such as sheep or semi-domesticated reindeer. Given their dependence on other hunters for much of its scavenged food, wolverines are able to carry and cache large amounts of meat for later consumption.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Wolverines are found in alpine forests, tundra, open grasslands, and boreal shrub transition zones at or above timberline. Generally they live in areas with low human development and need large, undisturbed ranges in order to survive. During the winter, females construct nests to store food and hide young. They construct rough beds of grass or leaves in caves or rock crevices, in burrows made by other animals, or under a fallen tree. They occasionally construct their nests under the snow. Wolverines are found exclusively in areas with cold climates, which may be related to their reliance on scavenging and caching large animal prey. Cold weather helps preserve the meat for later use.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; forest ; mountains

  • 2009. "Encyclopedia Britannica" (On-line). Accessed April 10, 2009 at http://www.britannica.com/EBchecked/topic/646740/wolverine.
  • 2006. "The Wolverine Foundation" (On-line). Accessed April 11, 2009 at http://www.wolverinefoundation.org/specacct.htm.
  • Ruggiero, L., K. McKelvey, K. Aubry, J. Copeland, D. Pletscher. 2007. Wolverine Conservation and Management. Journal of Wildlife Management, 71(7): 2145-46. Accessed April 10, 2009 at http://www.bioone.org/doi/abs/10.2193/2007-053.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Alpine and arctic tundra, boreal and mountain forests (primarily coniferous). Limited to mountains in the south, especially large wilderness areas. Usually in areas with snow on the ground in winter. Riparian areas may be important winter habitat. May disperse through atypical habitat. When inactive, occupies den in cave, rock crevice, under fallen tree, in thicket, or similar site. Terrestrial and may climb trees.

Young are born in a den among rocks or tree roots, in hollow log, under fallen tree, or in dense vegetation, including sites under snow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in alpine, tundra and northern taiga habitats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Tends to occupy higher elevations in summer, lower elevations in winter (Hornocker and Hash 1981, Whitman et al. 1986).

Male home ranges large: up to 1,000 square kilometers (RIC 1999); averaging 422 square kilometers in Montana (Hornocker and Hash 1981) and 535 square kilometers in Alaska (Whitman et al. 1986). Home ranges of females with young much smaller, ranging from 73 to 416 square kilometers (Hornocker and Hash 1981, Gardner 1985, Magoun 1985, Whitman et al. 1986, Banci 1987, Copeland 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The wolverine diet can include anything from small eggs to large ungulates. They are capable of bringing down prey that is five times bigger than themselves, but generally only under conditions that leave large ungulate prey stranded in deep snow. They have large claws with pads on the feet that allow them to chase down prey in deep snow. Large ungulate prey species include reindeer, roe deer, wild sheep, elk or red deer, maral and moose. Wolverines can be very swift when on the attack, reaching speeds of over 48 km an hour. Large prey are killed by biting the back or front of the neck, severing neck tendons or crushing the trachea. Wolverines are opportunistic and their diet vary with season and location. They are also specialized for scavenging and will readily take over carcasses that have been killed by other large predators. Wolverines are extremely strong and aggressive for their size, they have been reported to drive bears, cougars, and even packs of wolves from their kills in order to take the carcass. They have also been reported scavenging whale, walrus, and seal carcasses. Female wolverines may hunt more small to medium-sized animals such as rabbits and hares, ground squirrels, marmots, and lemmings, when they are rearing young. The amount of food available to females may be key in determining population size; more food leads to greater reproductive success. The scientific name Gulo gulo comes from the latin word for glutton. Like other mustelids, they can be somewhat driven to kill when given the opportunity, resulting in them killing more prey than they can eat or cache. Wolverines have been known to kill large numbers of captive reindeer in deep snow, simply because the reindeer cannot escape.

Animal Foods: birds; mammals; eggs; carrion

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates, Scavenger ); omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic. Feeds on a wide variety of roots, berries, small mammmals, birds' eggs and young, fledglings, and fish (Hatler 1989). May attack moose, caribou, and deer hampered by deep snow. Small and medium size rodents and carrion (especially ungulate carcasses) often make up a large percentage of the diet. Prey are captured by pursuit, ambush, digging out dens (Biosystems Analysis 1989), or climbing into trees. May cache prey in fork of tree branches or under snow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Wolverines are scavengers, using the kills of larger predators, such as bear and wolves. Wolverines have few (if any) natural predators, and prey on large game and smaller animals. Wolverines are reliant on other large predators for food when snow conditions don't make it possible for them to hunt large prey themselves. The presence of wolverine urine discourages presence and feeding of black-tailed deer (Odocoileus hemionus columbianus) and snowshoe hares (Lepus americanus). Wolverines are parasitized by many kinds of endo and ectoparasites, including flukes (Opisthorchis felineus), tapeworms (Bothriocephalus, Taenia twitchelli, Mesocestoides kirbyi), roundworms (Dioctophyme renale, Soboliphyme baturini), trematodes (Alaria), nematodes (Trichinella spiralis, Molineus patens, Ascaris devosi, Physaloptera torquata, Physaloptera sibrica), ticks (Dermacentor variabilis), fleas (Oropsylla alaskensis, and ear canker mites (Otodectes cynotis).

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Wolverines have few, if any, natural predators. They are fierce and aggressive, able to defend themselves against animals several times their size, such as wolves and mountain lions. However, wolves, mountain lions, black bears, brown bears, and golden eagles can be threats to young or inexperienced wolverines. Wolves are the dominant predator of wolverines, but generally only under circumstances where the wolverine cannot escape by climbing a tree. Wolverines use scents from their anal gland and urine to scent-mark food caches, discouraging other predators.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Gulo gulo preys on:
Geomyidae
Marmota
Cervus elaphus
Odocoileus hemionus
Ovis canadensis
Arvicolinae
Spermophilus
Marmota broweri
Castor canadensis

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Comments: Number of occurrences is unknown but there are many in North America and Eurasia. However, occurrences must be defined on a very large scale, so the number of distinct occurrences in a large region will be one or a few at most.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but probably is at least in the hundreds of thousands. Substantial populations occur in northern Canada and Alaska. Estimates reported in 2003 put the total population in western Canada at 15,000-19,000 individuals (Environment Canada, Species at Risk website).

Outside of Alaska, Montana and Idaho likely have the largest populations in the United States (perhaps a few hundred individuals in each state). Acknowledging a lack of substantial data, Predator Conservation alliance (2001) stated that extrapolation of the best available information indicates an estimated population of fewer than 750 wolverines in the contiguous United States, including an estimated 400-600 in the U.S. northern Rocky Mountains, and perhaps 100 across the Northwest and Sierra Nevada.

In North America, population density estimates range from one wolverine per 65 sq km in Montana (Hornocker and Hash 1981) to less than one per 200 sq km in northern British Columbia (Quick 1953), Alaska (Becker and Gardner 1992), and the Northwest Territories (Lee and Niptanatiak 1993). [from Petersen 1997]

In Eurasia, data on current populations are scarce. In Norway, the population was estimated to be 120 to 180 individuals (Kvam et al. 1988), in Sweden less than 100 individuals (Andersson 1995, cited by Blomqvist 1995), and in Finland approximately 90 individuals (Nyholm 1993, cited by Blomqvist 1995). In the conservation parks of Russia, the average number of encounters with wolverine tracks along 10 km transects ranged from 0.03 to 1.8 (Russian Research Center 1992). [from Petersen 1997]

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary and wide ranging. Occurs at relatively low population densities (e.g., 1 per 65 sq km in one area in Montana).

Males in some areas apparently are territorial, but in Montana there was extensive overlap of the ranges of both the same and opposite sexes. Apparently territory/range size depends on availability of denning sites and food supply (see Wilson 1982). Some individuals travel regularly over the same route (Wilson 1982).

There are no important predators other than humans. See Whitman et al. (1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most mustelids, wolverines have anal scent glands which are used to mark territories and food caches. Due to their scavenging lifestyle, they have an advanced sense of smell. Wolverines also have good hearing, but likely have poor vision. Wolverines are rarely vocal, except for occasional grunts and growls when irritated.

Communication Channels: acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active throughout the year. Active both day and night but primarily nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild, wolverines generally live for 5 to 7 years but some can live up to 13 years. Females in captivity have bred up to 10 years old and live up to 17 years. The main causes of death are starvation, being killed by competitors (such as wolves), and trapping.

Range lifespan

Status: wild:
13 (high) years.

Range lifespan

Status: captivity:
17 (high) years.

Typical lifespan

Status: wild:
5 to 7 years.

Average lifespan

Status: captivity:
18.0 years.

Average lifespan

Status: captivity:
17.3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19.5 years (captivity) Observations: These animals feature delayed implantation (Ronald Nowak 1999). Depending on how long the implantation takes to occur, the total gestation time can take from 120 to 272 days, even though the active developmental time is about 35 days (Virginia Hayssen et al. 1993).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Wolverines are generally solitary animals. Males and females come together only briefly for mating, from May to August. Males have large home ranges, encompassing the home ranges of several females. Males may mate with each female in their home range and sometimes those in overlapping ranges. Males and females remain together for several days. Females may also mate with members of different home ranges, but litters are usually fathered by one male. Males fiercely defend their territory by marking it with scent from their anal gland.

Mating System: polygynous

Female wolverines mate every other year. Mating occurs from May to August, with most females being in heat from June to August. Males remain near females during the breeding season, but females initiate copulation. Like many other mustelids, ovulation is believed to be induced by copulation and the embryo is not implanted immediately, but rather waits in diapause for about 6 months. After implantation, gestation takes only another 30 to 50 days. With delayed implantation, pregnancy can last from 120 to 272 days depending on when the embryo is fertilized and when it implants. Females build snow-dens in which they give birth and nurse. The litter is usually born between January and April and averages 3 kits, weighing 85 g each. Weaning is complete at 3 months and the young begin foraging on their own at 5 to 7 months, when they become independent. Adult size is attained at around 1 year and sexual maturity at 2 to 3 years old. Wolverines require snow cover that persists through spring so that food can be cached until the kits are large enough to being foraging on their own.

Breeding interval: Females give birth in alternate years.

Breeding season: Breeding occurs from May to August.

Range number of offspring: 1 to 5.

Range gestation period: 120 to 272 days.

Average birth mass: 84 g.

Average weaning age: 3 months.

Average time to independence: 1 years.

Average age at sexual or reproductive maturity (female): 710 days.

Average age at sexual or reproductive maturity (male): 776 days.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 95 g.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
776 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
710 days.

Females give birth to a litter of around 3 kits in a snow den. After females give birth they hide with their young. The mother defends her territory and intruders are not tolerated. This territorial behavior continues until the young are ready to hunt on their own. Young remain with their mother until the fall of the year they were born, when they disperse. Females mate again in the following year, giving birth to young in the second year after the previous litter. Females may help to train their young in hunting techniques before they disperse.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1999. Walker's Mammals Of The World. Baltimore: Johns Hopkins University Press.
  • Copeland, J. 1996. Biology of the wolverine in central Idaho. MSc Thesis.
  • 2007. "Alaska Fish and Wildlife Service" (On-line). Accessed April 10, 2009 at http://www.adfg.state.ak.us/pubs/notebook/furbear/wolverin.php.
  • 2005. "AnAge: The Animal Aging and Longevity Database" (On-line). Accessed April 09, 2009 at http://genomics.senescence.info/species/entry.php?species=Gulo_gulo.
  • 2009. "Encyclopedia Britannica" (On-line). Accessed April 10, 2009 at http://www.britannica.com/EBchecked/topic/646740/wolverine.
  • 2006. "The Wolverine Foundation" (On-line). Accessed April 11, 2009 at http://www.wolverinefoundation.org/specacct.htm.
  • 2009. "Wolverine" (On-line). Accessed April 11, 2009 at http://www.wolverines-wolverines.com/.
  • Abramov, B., C. Wozencraft. 2008. "International Union for the Conservation of Nature 2008 Red List" (On-line). Accessed April 08, 2009 at http://www.iucnredlist.org/details/9561.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds April-October (but variable), usually in summer. Implantation is delayed generally until winter. Gestation lasts 7-9 months; active gestation 30-40 days. One to six (usually 2-4) young are born January-April, mainly February or March (reportedly April-June in the Pacific states, Ingles 1965). Young are weaned beginning at about 7-8 weeks, separate from the mother in the fall. Sexually mature generally in the second or third year. Males sexually mature sometimes as yearlings (Alaska and Yukon); males over three years old were sexually mature in British Columbia. Some females mature at 12-15 months and produce their first litter when two years old. (Wilson 1982). In some areas, females may produce litters only every 2-3 years. In British Columbia, most mature females were reproductively active. Lives to an age of up to about 10 years, or sometimes 15-18 years or so.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gulo gulo

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0252-06|AY377151|Gulo gulo| AATCGATGATTATTCTCCACTAATCATAAAGACATCGGCACCCTCTATCTTTTATTCGGCGCATGAGCCGGAATAGTAGGTACAGCCCTG---AGCCTATTAATTCGCGCTGAATTGGGACAACCTGGTGCTCTGCTGGGAGAT---GACCAGATTTACAATGTAATTGTGACTGCCCATGCCTTCGTAATAATTTTCTTTATAGTGATACCCATCATGATTGGAGGTTTTGGGAACTGGTTAGTGCCCTTAATA---ATTGGTGCACCTGACATGGCATTCCCACGTATAAACAATATAAGCTTCTGGCTTCTACCCCCCTCCTTCCTTTTACTCTTAGCCTCCTCCATAGTAGAAGCAGGCGCGGGAACAGGATGAACTGTGTACCCTCCTCTAGCAGGAAATCTGGCACACGCAGGAGCATCTGTGGACCTA---ACAATCTTTTCCTTGCACCTGGCAGGTGTCTCATCCATCCTGGGGGCCATCAACTTTATTACAACTATTATTAACATGAAACCTCCTGCAATGTCACAATATCAAACCCCCCTGTTTGTATGATCCGTATTAATTACGGCCGTACTCTTACTCCTATCCCTACCAGTGCTAGCAGCC---GGCATTACCATATTACTCACGGATCGAAATCTAAACACTACTTTCTTCGACCCTGCCGGAGGAGGAGATCCTATCTTGTACCAACATCTATTCTGATTTTTTGGGCATCCTGAGGTATATATTCTGATTTTACCAGGATTCGGAATTATTTCACACGTCGTAACATATTACTCAGGGAAAAAA---GAACCATTTGGCTACATGGGTATAGTTTGGGCAATAATATCTATCGGATTTTTAGGGTTCATTGTATGAGCCCATCATATGTTTACCGTAGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Gulo gulo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 11
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Abramov, A., Belant, J. & Wozencraft, C.

Reviewer/s
Duckworth , J.W. & Schipper, J.

Contributor/s

Justification
This species is listed as Least Concerned due to its wide distribution and remaining large populations. Wolverine occurs at low density and many Wolverine populations appear to be relatively small and isolated (Ruggiero et al. 2007) and there is evidence of resurgence in some places of its historical distribution (Rowland et al. 2003). Thus although there is an overall continued decline due to human persecution and land-use change, the global decline of this species is not at a rate sufficient to qualify for listing at this time. However, the European Mammal Assessment determined that the European Wolverine is currently Vulnerable (A2c), thus the Least Concern listing is driven by the estimation that some large populations remain in North Asia and North America. Wolverines still face some threats such as over-exploitation through hunting and trapping, predator poisoning programs and habitat resource extraction that caused the contraction of wolverines' historical range. More data on population trends, especially in North Asia, may result in this species being re-assessed as Vulnerable in the near future.

History
  • 2008
    Near Threatened
    (IUCN 2008)
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Wolverines generally occur at relatively low population densities and have vanished from most of their former range in the United States. In Scandinavia, estimates vary from one individual per 200 to 500 sq km. Encroaching human populations alter the abundance and habits of large ungulates, eliminate large predator populations, or kill wolverines directly. Numbers have declined due to fur trapping and hunting by those believing the wolverine to be a nuisance. In Russia, wolverines are a game species and extensive overhunting has led to population decline. In the United States, wolverines can only be harvested in Montana and Alaska. Wolverines have been nearly eliminated in the United States and have disappeared over most of southeastern and south-central Canada. In Europe, they can only be found now in parts of Scandinavia and northern Russia. Wolverines are listen by the IUCN as Near Threatened. They were previously listed as vulnerable, but have been upgraded to Near Threatened.  Conservation efforts include education, protecting habitat, and eliminating unregulated hunting. In Sweden farmers and herders are compensated for identifying dens and reporting them. Other Scandinavian countries have adopted measures to limit the amount of wolverines in reindeer herding areas through selected hunting.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large range in northern Canada and Alaska, where populations probably are in good condition; occurs also in northern Eurasia; status is not well known in many portions of the range; extirpated from most of range in contiguous United States, with promising signs of semi-recovery in selected western states.

Intrinsic Vulnerability: Highly vulnerable

Comments: Species has a low reproductive output because of poor breeding success, high juvenile mortality, and slow sexual maturity (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
North America: The distribution and abundance of the species has been notably reduced in the 20th century in United States (Pasitschniak-Arts and Larivière 1995) and during the 19th century, wolverines disappeared from the southernmost of its European distribution mainly due to persecution, but also due to deforestation and other human developments. However, although there has been substantial range reduction, there is evidence of resurgence in some places of his historical distribution (Rowland et al. 2003). Throughout their range, wolverines occur at relatively low densities and require large home ranges varying from at least 100 km² to upwards of 600 km² (Whitman 1999). In Europe, the species is relatively rare. Densities of this species are never high, and it has been found to be less abundant than wolves, even in optimal habitats (Pasitschniak-Arts and Lariviere 1995). Densities range from one per 500 km² in Scandinavia to one per 65 km² in Montana, USA (Pasitschniak-Arts and Lariviere 1995).

Substantial populations occur in northern Canada and Alaska. Outside of Alaska, the population in Montana is considered to be the largest and most stable population of wolverines, given its close proximity to healthy populations in Canada (Cegelski et al. 2003). Densities of wolverines are never high (Aubry et al. 2007, Makridin 1964). Many wolverine populations appear to be relatively small and isolated (Ruggiero et al. 2007).

In North America, population density estimates range from one wolverine per 65 km2 in Montana (Hornocker and Hash 1981) to one per 200 km2 in northern British Columbia (Quick 1953), Alaska (Becker and Gardner 1992), and the Northwest Territories (Lee and Niptanatiak 1993). Lofroth and Krebs (2007) estimated densities for wolverines in British Columbia using existing wolverine distribution, wolverine food, ecosystem mapping and human development data. Density estimates range from 6.2 wolverines/1,000 km2 in high-quality habitat to 0.3/1,000 km2 in rare-quality habitat. Their predicted population estimate for British Columbia was 3,530 wolverines.

Europe: The European population of Gulo gulo is currently estimated to be approximately 2,260 individuals: 1,400 in European Russia (Novikov 2005), 150 in Finland, and 1998–2000 were 326 (±45) individuals in Sweden and 269 (±32) individuals in Norway (Sæther et al. 2005). The southern Norwegian population was naturally re-established during the late 1970s and was a result of protective legalisation (Landa and Skogland 1995). To the east, the Eastern Russian wolverine population is believed to comprise more than 18,000 individuals (Novikov, 2005). The species is not abundant in Mongolia, but still relatively widespread: it is only found in northern taiga habitats in Hentii and Hövsgöl mountain ranges (Bannikov 1954, Dulamsteren 1970), northern parts of Hangai Mountain Range and Mongol Altai Mountain Range (Dulamtseren et al. 1989).The European distribution is connected to the East Russian population along the Urals. The overall European population forms a relatively continuous distribution with a few geographically and genetically distinct subpopulations and constitutes a smaller fraction of the large Eurasian population.

1. Scandinavian wolverine population: The Scandinavian wolverine has shown a low genetic variability and subdivision among populations indicating that the wolverine in Scandinavia has lost variation due to a previous bottleneck event and that the current populations are the result of a recent common genetic background (Walker et al. 2001, Flagstad et al. 2004). The current population estimate is 580 individuals (>1 yrs of age) with approximately 200 in Norway and 380 in Sweden (Larsson 2005, van Dijk et al. 2005). The population has a continuous distribution and is narrowly connected to the Finnish – Western Russian population along the border of Finnmark County in the northernmost parts of its distribution. However, an initial genetic analysis has indicated a clear genetic distinction between these populations (Ø. Flagststad pers. comm.). In its southern distribution, the Scandinavian wolverine population provides as a source for the Southern Norwegian wolverine population (Walker et al. 2001, Flagstad et al. 2004, Flagstad et al. 2006) as well as a source for the Swedish forest wolverine population(s) close to the Gulf of Bothnia in Southern Sweden (Hedmark 2006).

2. Southern Norwegian wolverine population: The southern Norwegian population was naturally reestablished during the late 1970s and was a result of protective legalisation (Landa and Skogland 1995). This population has recently increased in numbers and distribution, but is currently kept at around 100 individuals by various control measurements (Flagstad et al. 2006). Genetic surveys have shown that the Southern Norwegian wolverine population is genetically distinct from the Scandinavian population, but the geographic gap between the southern and the main Scandinavian population to the north and east has decreased from 100-200 km by the early 1990s to virtually connectivity by 2006. However, exchange of individuals still is limited and the Southern Norwegian population seems to form a sink with a few individuals emigrating from the northern continuous population (Landa et al. 2000, Flagstad 2006).

3. Swedish forest wolverine population/occurrence: The Swedish forest wolverine occurrences were naturally established, during the mid 1990s (Hedmark 2006). These new occurrences were likely established by as few as 2 and 2-4 individuals and are currently consisting of 2 and 10 individuals, respectively (Hedmark 2006). Non-invasive genetic surveys has showed that these occurrences have little, if any, contact with the main Scandinavian wolverine population (Hedmark 2006).

4. Finnish – western Russian wolverine population: During the last decades, there has been an increase in population numbers and distribution of wolverines in Finland, but decreasing trends in Russia (Landa et al. 2000a). The western Russian population is estimated to be approximately 1,400 individuals (Novikov 2005). Relationships with other populations: to the west the distribution of the Finnish – Western Russian wolverine population is narrowly connected to the Scandinavian population along common borders with Norway and Sweden. An initial genetic analysis has indicated a clear genetic distinction between the Scandinavian population and the wolverines living in northern parts of Finland (Ø. Flagststad pers. comm.). It is also unclear how the western part of the wolverine distribution within this population (Finland, Kola, Karelia) connects along the narrow isthmus between the White Sea and Lake Onega in Western Russia. This area is judged as an extremely important connection for the northern element of the taiga fauna (Lindén et al. 2000) and these concerns should be further investigated. To the east, the European Russian wolverine population has a wide connection to the much larger East Russian population adjoining along the Urals in western Siberia. The Eastern Russian wolverine population is believed to comprise more than 18,000 individuals (Novikov 2005).

5. Finnish western wolverine population: This population was established by translocating animals from domestic reindeer herding areas in the north during the 1980s-1990s. The population is estimated to consist of about 10-15 individuals and now seems to reproduce naturally (Kojola 2005). The gap between this and the Karelia distribution is about 200-300 km and little is known about exchange between these populations. This population/occurrence should therefore be judged as isolated from other populations until further knowledge is gained.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Environment Canada - Species at Risk website (http://www.speciesatrisk.gc.ca ) reported the following information for the western population:

In the Yukon, populations are healthy and stable in all regions. In the Northwest Territories, densities vary with location; they are highest in the southwest and lowest on the Arctic Islands and on the mainland east of the Thelon Wildlife Sanctuary. In Nunavut, densities are moderate in the west and low on the Arctic Islands and in the east. Populations are believed to be stable over much of British Columbia, but are declining in the southern mountains. A distinct subspecies may no longer be extant on Vancouver Island, where Wolverines have not been seen since 1992; their decline may be related to that of the endangered Vancouver Island marmot, a potential summer food. In Alberta, wolverines are most abundant in the west, but appear to be declining throughout the province. In Saskatchewan, they are common in the north, but are rare and possibly declining in the southern boreal forest. In Manitoba, the highest densities are in the northeast and northwest, while numbers in the north central part of the province are unknown. Wolverines are found in small numbers in northwestern Ontario; they may have increased recently in some areas, but are known to have disappeared from others. Overall numbers for Ontario indicate a decline. Although records exist for their occurrence in the Prairie and Great Lakes Plains ecological areas, wolverine populations may never have been viable in these regions.

See also Dauphine (1989 COSEWIC report) for information on status in Canada.

In Alberta, trapping data suggest that the highest populations are found in the western parts of the province, and that populations have declined in most regions of Alberta in the past two decades (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Within the current range, extensive human activities continue to pressure wolverine populations and habitat (Krebs et al. 2004). Overexploitation through hunting and trapping, as well as predator poisoning programs and resource extraction likely caused wolverine populations to contract in the eastern and south-western portions of their historical range in North America since the early 1900s (Banci 1994).

The wolverine is threatened by fragmented distributions, presumed low genetic diversity, as well as “population control” hunting and conflicts with human settlements resulting from depredation of livestock. While this species inhabits a zone that is particularly affected by climate change (IPCC International Climate Report 2005), habitat change or even loss is not taking place at such a rate to be considered a major threat to the wolverine. Ample forested lands and tundra with suitable prey stocks are available throughout much of its range. The problem is the low rate of human land use expansion into this range, increasing the frequency of interaction with human populations and conflict over livestock depredation. Given the remoteness of these locations, tolerance of wolverines taking livestock is low and in some areas “population control” hunting is used as a proactive means to avoid loss of animals. In Norway, where almost 10,000 sheep are believed to be killed by wolverines each summer, government committees have instituted annual harvest quotas in an effort to control livestock losses; however, these quotas may not be sustainable as they are set very high even in relation to the most liberal estimate of wolverine population size, and it is unclear whether this hunt actually reduces the numbers of sheep and semi-domestic deer lost to predators.

Wolverines are scarce in Europe today. Their continued survival is threatened due to their small and fragmented distribution, and the potential for their future survival may be weakened by the likelihood of low genetic diversity. Habitat loss per se is not a substantial threat to wolverine conservation. Large areas of Norway, Sweden and Finland are still covered by forests and mountains that offer a suitable prey base and habitat for wolverines. The problem is that these are not wilderness areas, and wolverines come into conflict with a low, but crucial, number of human land uses. The fact that there are no large areas within their distribution where there is no conflict potential with sheep or semi domestic reindeer means that human tolerance for wolverines is low. This results in a difficult situation for wildlife managers who are forced to try and balance wolverine conservation with the conflicts they create with livestock. In Norway, farmers no longer use traditional sheep-herding methods that once deterred depredation, so wolverines are often controlled in an effort to protect livestock. Poaching also occurs. In Russia, overharvesting and declines in key prey species are major threats.

1. Scandinavian wolverine population: The species is subject to illegal killings due to depredation conflicts (sheep, domestic reindeer). The scope of this is difficult to quantify. Furthermore wolverines are sensitive to human disturbance (settlements, public and private roads etc.) especially in the vicinity of their denning areas (May et al. 2006).

2. Southern Norwegian wolverine population: The Southern Norwegian wolverine population is subject to illegal killings due to depredation conflicts on sheep. The scope of this is difficult to quantify. Most people in Norway are settled in southern Norway and the wolverines are sensitive to human disturbance (settlements, public and private roads, etc.) especially in the vicinity of their denning areas (May et al. 2006).

3. Swedish forest wolverine population/occurrence: A high degree of genetic similarity among individuals in the two areas indicates inbreeding, possibly including brother-sister matings (Hedmark 2006). Inbreeding depression and demographic stochasticity are therefore likely to be the main threats (Pimm et al. 1988). These forest dwelling wolverines live outside the distribution of “domestic” reindeer, which form the most common prey for wolverines (Landa et al. 1997). Establishment of wolverines in the forest landscape is judged to be a way of reducing conflict with the domestic reindeer industry (Hedmark et al. unpubl. ms, Hedmark 2006).

4. Finnish – Western Russian wolverine population: About half the Finnish wolverine population are living within the reindeer management area in the north (Kojola 2005), thus creating conflict with the domestic reindeer industry (Landa et al. 2000b) with associated illegal killings. The scope of this is unknown. The Russian economic depression during the 1990s is believed to have led to widespread poaching of ungulate game species. Furthermore, it led to a reduction of the domestic reindeer herding industry due to large calf/breeding losses. This is believed to have indirectly negatively affected the wolverine’s populations in the European and most human populated part of Russia. The wolverine's main prey base (wild and domestic reindeer) became less abundant and the population has faced a decrease in numbers and distribution during the last few decades (Landa et al. 1997, Landa et al. 2000a, Novikov 2005). In Russia the wolverine is harvested for fur, and to the best knowledge of the assessors, there are no harvest restrictions. Russia has not yet ratified the Bern Convention.

5. Finnish western wolverine population: It is likely that this small and presumably isolated population will face inbreeding problems (Hedmark 2006) as well as being exposed to demographic stochasticity (Pimm et al. 1988). Inbreeding depression and demographic accidents are therefore main threats. These forest dwelling wolverines live outside the distribution of semi domesticated reindeer, which form the most common prey for wolverines (Landa et al. 1997). Establishment of wolverines in the forest landscape is judged to be a way of reducing conflict with the domestic reindeer industry (Hedmark et al. unpubl. ms, Hedmark 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Decline may have been due primarily to fur trapping. Habitat has been degraded through timber harvesting, ski area construction, road construction, and general human disturbance (Biosystems Analysis 1989). There are conflicts with backcountry trappers.

Excessive hunter harvesting and loss of ungulate wintering areas (Banci 1994), as well as displacement of ungulate populations due to excessive timber harvest and urbanization, may adversely impact wolverines (www.wolverinefoundation.org).

In western Canada, with the extensive human settlement that began in the mid-19th century, the wolverine has undergone range contractions and population reductions. Wolf control programs that were in effect from the 1950s and into the 1990s contributed to this species' decline. The habitat, particularly in the southern part of the range, is subject to loss, degradation, and fragmentation from oil, gas, and mineral exploration and extraction, forestry, roads, agriculture, and urban development. Although Wolverines are known to use snowmobile trails and scavenge from traps, backcountry recreation can lead to habitat alienation for these secretive animals. Increased access of motorized vehicles into remote areas may also increase harvest pressure on the wolverine and on its ungulate prey, particularly the threatened Southern Mountain population of Woodland Caribou. In the arctic tundra, developments frequently attract wolverines, which are then at risk of being killed as nuisance animals. As an economically valuable furbearer, the wolverine is subject to trapping and has been over-harvested in some areas. Declines in the population in eastern Canada are related to a combination of factors: hunting and trapping in the late 19th century, dwindling caribou herds in the early 20th century, human encroachment on habitat, reduction in the number of wolves, and the indiscriminate use of poison baits. [From Environment Canada Species at Risk website. See Dauphine (1989 COSEWIC report) for further information on threats in Canada.]

Among the limiting factors in Alberta are the loss of isolated habitat, a reduction in the availability of large ungulate carrion, and trapping pressure (Petersen 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Wolverines have declined through much of their historic range; they are very sensitive to human disturbance and have retreated to remaining areas of wilderness (4). They continue to be threatened by habitat loss and also by a loss of prey species or even other carnivores (such as wolves) that provide carrion (4). Where they do exist near humans they can come into conflict with farmers from attacking livestock; persecution and poaching are therefore pertinent threats (4). In addition, populations that are protected are slow to recover due to slow reproduction rates caused by the small litter size and the fact that females only reproduce every few years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The wolverine has been petitioned twice for listing under the federal Endangered Species Act in the conterminous United States, but the most recent petition was denied citing lack of information on distribution, habitat requirements, and threats (United States Fish and Wildlife Service 2003). In North America, the eastern wolverine population continues to be Endangered, and the western population remains Special Concern.

The wolverine is recorded from a number of protected areas. However, due to its spatial requirement, very few reserves will contain the full home ranges of more than a small number of individuals (Schreiber et al., 1989).

European range states have different monitoring and management regimes varying from strict protection in Finland and Sweden, licensed harvest and control measurements in Norway to legal harvest year round in Russia.

In North America, wolverine management issues include regulating trapper harvest, preventing human disturbance at denning sites, and mitigating for habitat loss and fragmentation (Krebs et al., 2004).

Key conservation measures that need to be implemented revolve around minimizing conflicts resulting from depredation of livestock, reducing legal and illegal hunting of wolverines, establishing well-planned conservation areas and carrying out surveys to gain a better understanding of the population and ecology of the wolverine.

Farmers and local communities should be educated in and encouraged to adopt husbandry practices that will minimize depredation of livestock thereby reducing conflicts. Economic incentives could encourage farmers to conserve wolverines on their land instead of hunting them. A compensation and education program has been implemented in Sweden with reindeer herders where the herders profit financially from identifying dens on their land and protecting them; similar programs could be applied in more areas of the species range.

Governments and researchers require a more solid knowledge of population dynamics, wolverine-prey relationships, habitat-use and distribution of the wolverine. This information is needed to ensure that legal, government-permitted hunting quotas are appropriate and small, localized, endangered populations are protected. Better enforcement of laws that prohibit hunting of wolverines is required in applicable parts of the species range, with higher penalties to discourage poachers. Governments need also improve coordination between wildlife conservation and agriculture programs to ensure that conservation areas are established in regions with little risk of conflict with farmers and herders.

The wolverine is listed on Appendix II of the Bern Convention and Annex II* and Annex IV of the EU Habitats and Species Directive. European range states have different monitoring and management regimes varying from strict protection in Finland and Sweden, licensed harvest and control measurements in Norway to legal harvest year round in Russia.

1. Scandinavian wolverine population: The Scandinavian wolverine population is covered by both Swedish and Norwegian management regimes, which are quite different. However, both Norwegian and Swedish populations are monitored through annual counting of active natal dens (Landa et al. 1998b) and non-invasive faecal DNA surveys (in southern areas). There is cooperation and data exchange between the two national programmes. The Swedish national interim goal is to reach minimum 90 annual wolverine reproductions (approximately 575 individuals >1 yr of age) (Riksdagen 2000). Sweden has international obligations through the Bern Convention for the conservation of the European wildlife and habitats, the regulation of trade through the European Council Regulation on the protection of species of wild fauna and flora, and the EU habitat directive. The wolverine is in Sweden is officially listed as endangered and is not subject to hunting. However, recently a few family groups have been killed in the purpose of reducing conflict with the domestic reindeer herding industry in northern areas. Norway was recently (2003) divided into 6 different management regions with politically appointed management boards (Miljøverndepartementet 2003). The Norwegian national goal is to control the total population within the limits of 39 yearly active reproductions (21 within the Norwegian part of the Scandinavian wolverine population) (Miljøverndepartementet 2003). The total of 39 breedings equals approximately 250 individuals >1 yr of age. Control measurements, killing of family groups in early spring and licensed harvest is used as a management tool to restrict wolverine distribution and predation on unattended sheep during summer and domestic reindeer all year around. Wolverines in Norway are covered by the Bern Convention (Bern 1979). The wolverines in Norway are officially listed as vulnerable (new official listing is expected by the end of 2006).

2. Southern Norwegian wolverine population: Norway was recently (2003) divided into 6 different management regions. The national goal is to control the Southern Norwegian population (including North Trøndelag County) at maximum 18 yearly active reproductions (approximately 115 individuals >1 yr of age) (Miljøverndepartementet 2003). Control measurements, killing of family groups in early spring and licensed harvest is used as a management tool to restrict wolverine distribution and predation on unattended sheep during summer in southern Norway. Wolverines in Norway are covered by the Bern Convention (Bern 1979). The wolverines in Norway are officially listed as vulnerable (new official listing is expected by the end of 2006).

3. Swedish forest wolverine population/occurrence: Totally protected, also see description for the Scandinavian wolverine population for further details.

4. Finnish – western Russian wolverine population: Management differs in Finland and Russia. In Finland the species is monitored through a national fauna monitoring programme based on tracks crossing fixed 4x4+4 km triangles. Wolverines have been fully protected in Finland since 1982. In Russia the wolverine is monitored via tracking surveys and numbers are estimated based on daily pats and a calculation coefficient (Novikov 1994, Novikov 2005). In Russia wolverines are considered a game/pelt species.

5. Finnish western wolverine population: Wolverines have been fully protected in Finland since 1982. In western Finland, the small introduced subpopulation seems to function without the presence of semi-domesticated reindeer, wolf, or lynx. A research project where nutritional ecology of wolverines within the three areas of wolverine distribution within Finland will be compared has been initiated. A future aim is to develop non-invasive molecular genetic monitoring of the wolverines within Finland similar to the one conducted in Scandinavia (Kojola 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preserve Selection and Design Considerations: Maintaining wilderness and roadless areas is critical. In timber harvest areas, roads should be minimized.

Although wolverines maintain large home ranges, they exhibit fidelity to discrete areas, and populations in scattered sites within areas such as the Northwest Territories (Canada) are genetically independent, suggesting the need to consider preservation of multiple populations if genetic diveristy is to be maintained (Wilson et al. 2000).

Management Requirements: Management programs must be regional, rather than local, for this wide-ranging, low-density species.

Rowland et al. (2003) evaluated performance of landscape models for wolverines within their historical range at 2 scales based on recent observations (n = 421) from Washington, Oregon, Idaho, and Montana. At the subbasin scale, simple overlays of habitat and road-density classes were effective in predicting observations of wolverines. At the watershed scale, they used a Bayesian belief network model to provide spatially explicit estimates of relative habitat capability. The model had 3 inputs: amount of habitat, human population density, and road density. At both scales, the best models revealed strong correspondence between means of predicted counts of wolverines and means of observed counts. Their results can be used to guide regional conservation planning for wolverines.

See Predator Conservation Alliance (2001) for a summary of management needs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected legally in several western states. Occurs in several national parks.

Needs: Kyle and Strobeck (2002) confirmed that high levels of gene flow occur among all the northern wolverine populations sampled. They "also observed progressively increasing genetic structure at the periphery of their southern and eastern distributions, suggesting that these populations may have been partially fragmented from what was once a panmictic unit. Peripheral populations may be more susceptible to extirpation and, therefore, may be the most appropriate targets for concerted conservation efforts to prevent the elimination of wolverines from yet more of their historical range."

Protection of natal denning habitat from human disturbance may be critical. Montane coniferous forests, suitable for winter foraging and summer kit rearing, may only be useful if connected with subalpine cirque habitats required for natal denning, security areas, and summer foraging. In addition, these habitats must be available during the proper season. Subalpine cirque areas, important for natal denning, may be made unavailable by winter recreational activities. Conversely, high road densities, timber sales, or housing developments on the fringes of subalpine habitats may reduce potential for winter foraging and kit rearing, and increase the probability of human-caused wolverine mortality. [from www.wolverinefoundation.org].

See also Predator Conservation Alliance (2001) for a summary of protection needs.

Keep trappers out of known wolverine areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

WWF International launched a Large Carnivore Initiative for Europe (LCIE) in 1995 and under this initiative an Action Plan has been drawn up for the conservation of this species in Europe (6). The wolverine is protected in much of its range but more research into the population dynamics and behaviour of this elusive creature are desperately needed. In Europe especially, where there are fewer areas of true wilderness left, any conservation initiative will have to work closely with local people to combat prejudice (4). In the United States, the wolverine is yet to be listed on the Endangered Species Act due to the paucity of data surrounding this species, highlighting once again the need for further research (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Wolverines live in remote areas where human populations are sparse. Many wolverines are shot due to their habit of preying upon animals that are trapped for fur. They have been extensively hunted in Scandinavia because of its alleged predation on domestic reindeer. It has been considered a nuisance throughout its range because it will eat animals already caught in fur traps and will break into cabins and food caches, eating and spraying the contents with its strong scent. Wolverines can even break into canned goods with their sharp canines. Wolverines are supposedly very difficult to trap; when a wolverine finds a trap, it may spring it by turning it upside down or by dropping a stick into it. Wolverines have also been known to carry traps away and bury them deep in the snow.

Negative Impacts: injures humans; crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Wolverine are sometimes hunted for their fur because it is prized for its frost resistant properties. Native peoples used them to line parkas. However, their skins are no longer used widely in commerce. Wolverines are also important members of the ecosystems in which they live, they are important as top predators and scavengers.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Fur is favorable for trimming parkas, but limited numbers make the wolverine relatively unimportant as a furbearer. In the 1970s, annual harvest was several hundred in Alaska and a few dozen in Montana (Wilson 1982). In the early 1980s, the harvest in Canada, Alaska, and Montana was 1377 (Nowak 1991).

Sometimes regarded as a nuisance; may rob traplines or destroy human food caches. Was intensively hunted in Scandinavia because of alleged predation on domestic reindeer (Nowak 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wolverine

The wolverine, pronounced /ˈwʊlvərn/, Gulo gulo (Gulo is Latin for "glutton"), also referred to as glutton, carcajou, skunk bear, or quickhatch, is the largest land-dwelling species of the family Mustelidae (weasels). It is a stocky and muscular carnivore, more closely resembling a small bear than other mustelids. The wolverine has a reputation for ferocity and strength out of proportion to its size, with the documented ability to kill prey many times its size.

The wolverine can be found primarily in remote reaches of the Northern boreal forests and subarctic and alpine tundra of the Northern hemisphere, with the greatest numbers in northern Canada, the U.S. state of Alaska, the Nordic countries of Europe, and throughout western Russia and Siberia. Their populations have experienced a steady decline since the 19th century in the face of trapping, range reduction and habitat fragmentation, such that they are essentially absent in the southern end of their European range. It is, however, estimated that large populations remain in North America and northern Asia. Wolverines are solitary animals.[2]

Contents

Taxonomy

Genetic evidence suggests that the wolverine is most closely related to the tayra and martens (scientific names Eira and Martes respectively), all of which shared a Eurasian ancestor.[3]

Within the Gulo genus, there is a clear separation between two subspecies: the Old World form Gulo gulo gulo and the New World form G. g. luscus. Some authors had described as many as four additional North American subspecies, including ones limited to Vancouver Island (G. g. vancouverensis) and the Kenai Peninsula in Alaska (G. g. katschemakensis). However, the most currently accepted taxonomy recognizes either the two continental subspecies or recognize G. gulo as a single Holarctic taxon.[4]

Recently compiled genetic evidence suggests that most of North America's wolverines are descended from a single source, likely originating from Beringia during the last glaciation and rapidly expanding thereafter, though there is considerable uncertainty to this conclusion due to the difficulty of collecting samples in the extremely depleted southern extent of the range.[4]

Physical characteristics

Wolverine skull from the Pleistocene at the Museum für Naturkunde, Berlin

Anatomically, the wolverine is a stocky and muscular animal. With short legs, broad and rounded head, and small eyes with short rounded ears, it resembles a bear more than other mustelids.Though its legs are short, its large five-toed paws and plantigrade posture facilitate movement through deep snow.[5]

The adult wolverine is about the size of a medium dog, with a length usually ranging from 65–107 cm (26–42 in), a tail of 17–26 cm (6.7–10 in), and a weight of 9–25 kg (20–55 lb), though exceptionally large males can weigh up to 32 kg (71 lb).[6][7][8] The males are as much as 30% larger than the females and can be twice the female's weight. Shoulder height is reported from 30 to 45 cm (12 to 18 in).[9] It is the largest of terrestrial mustelids; only the marine-dwelling sea otter and giant otter of the Amazon basin are larger.

Wolverines have thick, dark, oily fur which is highly hydrophobic, making it resistant to frost. This has led to its traditional popularity among hunters and trappers as a lining in jackets and parkas in Arctic conditions. A light silvery facial mask is distinct in some individuals, and a pale buff stripe runs laterally from the shoulders along the side and crossing the rump just above a 25–35 cm (9.8–14 in) bushy tail. Some individuals display prominent white hair patches on the throat or chest.[5]

Like many other mustelids, it has potent anal scent glands used for marking territory and sexual signaling. The pungent odor has given rise to the nicknames "skunk bear" and "nasty cat." Wolverines, like other mustelids, possess a special upper molar in the back of the mouth that is rotated 90 degrees, towards the inside of the mouth. This special characteristic allows wolverines to tear off meat from prey or carrion that has been frozen solid.[10][11]

Behavior

Wolverine pelts from Siberia (left) and Alaska (right)

The wolverine is a powerful and versatile predator and scavenger. Prey mainly consists of small to large-sized mammals and the wolverine has been recorded killing prey such as adult deer that are many times larger than itself. Prey species include porcupine, squirrel, beaver, marmot, rabbit, vole, mice, shrew, lemming, caribou, roe deer, white-tailed deer, mule deer, sheep, moose, and elk.[12] Smaller predators are occasionally preyed on, including martens, mink, foxes, canada lynx, weasels, Eurasian lynx,[13] and coyote and wolf pups. Wolverines often pursue live prey that is relatively easy to obtain, including animals caught in traps, newborn mammals and deer (including adult moose and elk) when they're weakened by winter or immobilized by heavy snow. The diet is sometimes supplemented by bird's eggs, birds (especially geese), roots, seeds, insect larvae and berries. A majority of the wolverine's sustenance is derived from carrion, which they depend on almost exclusively in winter and early spring. Wolverines may find carrion themselves, feed on it after the predator is done feeding (especially wolf packs) or simply take it from another predator. Whether eating live prey or carrion, the wolverine's feeding style appears voracious, leading to the nickname of "glutton" (also the basis of the scientific name). However, this feeding style is believed to be an adaptation to food that is scarcely encountered, especially in the winter.[14]

Armed with powerful jaws, sharp claws, and a thick hide,[15] wolverines, like most mustelids, are remarkably strong for their size. They may defend kills against larger or more numerous predators. There is at least one published account of a 12 pounds (5.4 kg) wolverine's apparent attempt to steal a kill from a black bear (adult males weigh 400 to 500 pounds (180 to 230 kg). Unfortunately for the mustelid, the bear won what was ultimately a fatal contest.[16] Another account placed a polar bear of unknown age and weight together with a similar wolverine where the smaller, tenacious predator came out the victor.[17][18] Interestingly, while wolverines have dominated wolves in competitions over a carcass, some wolves become habituated to predating wolverines and, in such cases, wolves may lead to a complete absence of wolverines in a given area.[8]

Wolverines inhabiting the Old World (specifically, Fennoscandia) are more active hunters than their North American cousins.[19] This may be because competing predator populations in Eurasia are not as dense, making it more practical for the wolverine to hunt for itself than to wait for another animal to make a kill and then try to snatch it. They often feed on carrion left by wolves, so changes in the population of wolves may affect the population of wolverines.[20] Wolverines are also known on occasion to eat plant material.[21]

Successful males will form lifetime relationships with 2–3 females which they will visit occasionally, while other males are left without a mate.[22] Mating season is in the summer, but the actual implantation of the embryo (blastocyst) in the uterus is stayed until early winter, delaying the development of the fetus. Females will often not produce young if food is scarce. The wolverine gestation period is 30–50 days. Litters of typically two or three young ("kits") are born in the spring. Kits develop rapidly, reaching adult size within the first year of a lifespan that may reach anywhere from five to (in exceptional individuals) thirteen years.[citation needed] Fathers make visits to their offspring until they are weaned at 10 weeks of age; also, once the young are about 6 months old, some reconnect with their fathers and travel together for a time.[22]

Range

Wolverine on rocky terrain

Wolverines live primarily in isolated northern areas, for example the arctic and alpine regions of northern Canada, Alaska, Siberia, and Scandinavia; they are also native to Russia, the Baltic countries, and Northern China and Mongolia. In 2008 and 2009, wolverines were sighted as far south as the Sierra Nevada, near Lake Tahoe, for the first time since 1922.[23][24][25] They are also found in low numbers in the Rocky Mountains and northern Cascades of the United States, and have been sighted as far south and east as Michigan.[26] However, most New World wolverines live in Canada.[21]

The world's total wolverine population is unknown. The animal exhibits a low population density and requires a very large home range.[20] The range of a male wolverine can be more than 620 km2 (240 sq mi), encompassing the ranges of several females which have smaller home ranges of roughly 130–260 km2 (50–100 sq mi). Adult wolverines try for the most part to keep non-overlapping ranges with adults of the same sex.[11] Radio tracking suggests an animal can range hundreds of miles in a few months.

Female wolverines burrow into snow in February to create a den, which is used until weaning in mid-May. Areas inhabited nonseasonally by wolverines are thus restricted to zones with late-spring snowmelts. This fact has led to concern that global warming will shrink the ranges of wolverine populations.[22]

The Wildlife Conservation Society reported in June 2009 that a wolverine researchers had been tracking for almost three months had crossed into northern Colorado. Society officials had tagged the young male wolverine in Wyoming near Grand Teton National Park and it had traveled southward for approximately 500 miles. It was the first wolverine seen in Colorado since 1919, and its appearance was also confirmed by the Colorado Division of Wildlife.[21]

CountryPopulationAreaYearState of population
Sweden265+[5]Norrbotten[5]1995–97[5]Stable[5]
Norway150+[5]Snøhetta plateau and North[5]1995–97[5]Decline[5]
Finland155–170[5]Karelia and North[5]2008[5]Stable[5]
Russia1500[5]Taiga[5]1970, 1990,[5]Decline[5]
Russia – Komi885[5]1990[5]
Russia – Archangelsk Oblast410[5]Nenetsky Autonomous Area[5]1990[5]Limited[5]
Russia – Kola Peninsula160[5]Hunting Districts[5]1990[5]Decline[5]
United States – Alaska[27]Unknown[27]Kobuk Valley National Park,[27] Selawik National Wildlife Refuge[27]1998[27]Decline[27]
United States – Alaska[28]3.0 (± 0.4 SE) wolverines/1,000 km2[28]Turnagain Arm and the Kenai Mountains[28]2004[28][28]
United States – Rocky Mountains[29]28–52[29]Montana, Idaho, Wyoming[29]1989–2007[29]Unknown[29]
United States – California[20]1[20]Tahoe National Forest[20]2008[20]Unknown[20]
Canada – Yukon9.7 (± 0.6 SE) wolverines/1,000 km2[28]Old Crow Flats[28]2004[28][28]
Canada – Ontario[30]Unclear[30]Red Lake – Sioux Lookout to Fort Severn – Peawanuck[30]2004[30]Stable to expanding[30]
Canada – Overall[31]15000–19000[31]Overall[31][31]Stable[31]

This requirement for large territories brings wolverines into conflict with human development, and hunting and trapping further reduce their numbers, causing them to disappear from large parts of their former range; attempts to have them declared an endangered species have met with little success.[20]

In captivity

Captive at the Kristiansand Zoo, Norway

Around a hundred wolverines are held in zoos across North America and Europe, and they have been successfully bred in captivity, but only with difficulty and high infant mortality.[32]

Name

The wolverine's questionable reputation as an insatiable glutton (reflected in the Latin genus name Gulo) may be in part due to a false etymology. The animal's name in Old Swedish, fjellfräs, meaning "mountain cat", worked its way into German as Vielfraß, which means roughly "devours much". Its name in other West Germanic languages is similar (e.g. Dutch: veelvraat).

The Finnish name is ahma, derived from ahmatti, which is translated as "glutton". Similarly, the Estonian name is ahm, with the equivalent meaning to the Finnish name. In Lithuanian is ernis, in Latviantinis or āmrija.

The Eastern Slavic росомаха (rosomakha) and the Polish and Czech name rosomak seem to be borrowed from the Finnish rasva-maha (fat belly). Similarly, the Hungarian name is rozsomák or torkosborz which means "gluttonous badger".

In French-speaking parts of Canada, the wolverine is referred to as carcajou, borrowed from the Innu-aimun or Montagnais kuàkuàtsheu.[33] However in France, the wolverine's name is Glouton (glutton).

Purported gluttony is reflected neither in English nor in North Germanic languages. The English word wolverine (alteration of the earlier form wolvering of uncertain origin) probably implies "a little wolf". The name in Proto-Norse, erafaz and Old Norse, jarfr, lives on in the regular Icelandic name jarfi, regular Norwegian name jerv, regular Swedish name järv and regular Danish name jærv.

In culture

The Wolverine pendant of Les Eyzies, about 10,500 BC, when wolverines were still found in southern France

Many cities, teams, and organizations use the wolverine as a mascot. For example, the U.S. state of Michigan is, by tradition, known as "The Wolverine State", and the University of Michigan takes the wolverine as its mascot. The association is well and long established: for example, many Detroiters volunteered to fight during the American Civil War and George Armstrong Custer, who led the Michigan Brigade, called them the "Wolverines". The origins of this association are obscure; it may derive from a busy trade in wolverine furs in Sault Ste. Marie in the 18th century or may recall a disparagement intended to compare early settlers in Michigan with the vicious mammal. Wolverines are, however, extremely rare in Michigan. A sighting in February 2004 near Ubly was the first confirmed sighting in Michigan in 200 years.[34] The animal was found dead in 2010.[35]

The wolverine figures prominently in the mythology of the Innu people of eastern Québec and Labrador. In at least one Innu myth, it is the creator of the world.[36]

Wolverine is the name of a popular fictional character by Marvel Comics—named for his highly individualistic and aggressive behavior, as well his great ferocity despite his small stature.

Film

The 91-minute 1994 motion picture Running Free (also known as One Paw) is about a young boy and his friendship with an Alaskan wolverine. The wolverines seen in the film were born in captivity and directed by U.S.D.A.-licensed filmmaker, Steve Kroschel. Many of the wolverine scenes are documentary footage of trained wolverines that are being filmed in their natural habitat. The movie was screened on October 5, 1994. The American Humane Society was involved before the start of filming and during some of the filming.[37]

The first full length nature documentary about wild wolverines Wolverines - Hyenas of the North was produced 2006 by German wildlife film company Gulo Film Productions for German Television (NDR) and has been broadcasted in many countries - also under the titles Wolverine X or Wolverine Revealed[38] (in the U.S. by Animal Planet as an episode of Mutual of Ohama's Wild Kingdom): The film by German director Oliver Goetzl shows many different social behaviour aspects of wild wolverines at the Finnish / Russian border area - some of them previously unknown - and has won more than 30 international festival awards and nominations, incl. at Jackson Hole Wildlife Film Festival, Wildscreen Film Festival, IWFF Missoula, Animal Behavior Society Film Festival and Banff World Television Awards.

The PBS series Nature released a documentary, "Wolverine: Chasing the Phantom" as episode #166 on 14 November 2010.[39] This 53 minute documentary [40] focuses on the efforts of a number of naturalists in the United States to track wolverines, collect genetic data, and learn more about wolverine populations, individual behavior and social behavior. It also tracks the raising of two male wolverines in captivity at an Alaska nature reserve from birth to maturity, and profiles the naturalists making these efforts.

Gallery

References

  1. ^ Wozencraft, W. Christopher (16 November 2005). "Order Carnivora (pp. 532-628)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14001166. 
  2. ^ a b Abramov, A., Belant, J. & Wozencraft, C. (2009). "Gulo gulo". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/9561. Retrieved 2010-01-25. 
  3. ^ Koepfli, Klaus-Peter; Deere, KA; Slater, GJ; Begg, C; Begg, K; Grassman, L; Lucherini, M; Veron, G et al (February 2008). "Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation". BMC Biology 6: 10. doi:10.1186/1741-7007-6-10. PMC 2276185. PMID 18275614. http://www.biomedcentral.com/1741-7007/6/10. 
  4. ^ a b Eric Tomasik and Joseph A. Cook (2005). "Mitochondrial phylogeography and conservation genetics of wolverine (gulo gulo) of Northwestern North America". Journal of Mammalogy 86 (2): 386–396. doi:10.1644/BER-121.1. http://www.bioone.org/doi/abs/10.1644/BER-121.1. 
  5. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab Arild Landa, Mats Lindén and Ilpo Kojola (2000). "Action Plan for the conservation of Wolverines (Gulo gulo) in Europe" (PDF). Nature and environment, No. 115. Convention on the Conservation of European Wildlife and Natural Habitats (Bern Convention). http://www.lcie.org/docs/COE/COE%20NE%20115%20Action%20plan%20for%20wolverines%202000.pdf. Retrieved 2008-01-25. 
  6. ^ "wolverine (mammal) – Britannica Online Encyclopedia". Britannica.com. http://www.britannica.com/EBchecked/topic/646740/wolverine. Retrieved 2010-10-04. 
  7. ^ Maurice Burton; Robert Burton (1970). The international wildlife encyclopedia. Marshall Cavendish. pp. 2959–. ISBN 978-0-7614-7266-7. http://books.google.com/books?id=SOuIwf9ctK0C&pg=PA2959. Retrieved 16 September 2011. 
  8. ^ a b "Gulo gulo – The American Society of Mammalogists". smith.edu. http://www.science.smith.edu/msi/pdf/i0076-3519-499-01-0001.pdf. Retrieved 2011-09-23. 
  9. ^ Wolverine: Chasing the Phantom. Wolverine Facts. pbs.org
  10. ^ Pratt, Philip. "Dentition of the Wolverine". The Wolverine Foundation, Inc.. http://www.wolverinefoundation.org/dentition.htm. Retrieved 2007-07-01. 
  11. ^ a b Taylor, Ken (1994). "Wolverine". Wildlife Notebook Series. Alaska Department of Fish & Game. http://www.adfg.state.ak.us/pubs/notebook/furbear/wolverin.php. Retrieved 2007-01-21. 
  12. ^ Gulo gulo (wolverine) . Animal Diversity Web
  13. ^ V.G. Heptner and A.A. Sludskii. Mammals of the Soviet Union. Volume II Part 2 Carnivora: Hyenas and Cats. 1992. New Delhi: Amerind Publishing, p. 625
  14. ^ Wolverine Gulo gulo. enature.com
  15. ^ "World Biomes: Wolverine". Blueplanetbiomes.org. http://www.blueplanetbiomes.org/wolverine.htm. Retrieved 2010-10-04. 
  16. ^ "When Predators Attack (Each Other): Researchers Document First-known Killing Of A Wolverine By A Black Bear In Yellowstone" (Press release). Science Daily. 2003-05-06. http://www.sciencedaily.com/releases/2003/05/030506073236.htm. Retrieved 2007-01-16. 
  17. ^ Mark Allardyce (2000-09-30). Wolverine – A Look Into the Devils Eyes. pp. 20, 165. ISBN 978-1-905361-00-7. http://books.google.com/?id=27ULgtTrfs4C&pg=PA20&dq=wolverines+killing+polar+bears&q=polar%20bear%20. Retrieved 8 August 2010. 
  18. ^ Phelps, Gilbert (1989). Between man and beast: true tales & observations of the animal kingdom. Random House Value Publishing. p. 73. ISBN 0-517-69038-1. 
  19. ^ World Wildlife Fund–Sweden: 1st International Symposium on Wolverine Research and Management (PDF)
  20. ^ a b c d e f g h "Wolverine wonder", Grist.org, March 4, 2008; also US Forest Service (2008-03-06). "Camera Spots Wolverine in Sierra Nevada". physorg.com. http://www.physorg.com/news124013684.html. Retrieved 2010-02-21. 
  21. ^ a b c Rickert, Eve (June 28, 2007). "The perils of secrecy". High Country News. http://www.hcn.org/servlets/hcn.Article?article_id=17093. 
  22. ^ a b c Raloff, Janet (2010-10-21). "Wolverine: Climate warming threatens comeback". Science News (Society for Science & the Public) 178. http://sciencenews.org/view/generic/id/64508/description/Wolverine_Climate_warming_threatens_comeback. Retrieved 2010-10-31. 
  23. ^ Knudson, Tom (April 5, 2008). "Sighting prompts California to expand search for elusive wolverine". Sacramento Bee. http://www.sacbee.com/101/story/838651.html. [dead link]
  24. ^ Griffith, Martin (March 22, 2009). "A year later, wolverine spotted again in Sierra". San Francisco Chronicle. http://www.sfgate.com/cgi-bin/article.cgi?f=/n/a/2009/03/22/state/n121949D73.DTL. 
  25. ^ Wolverine Sighting on SPI Land near Truckee Mar 18, 2009
  26. ^ Runk, David. (2004-02-25) First Michigan wolverine spotted in 200 years – Technology & science – Science – msnbc.com. MSNBC. Retrieved on 2011-09-16.
  27. ^ a b c d e f Brad Shults, Gene Peltola, Jerrold Belant and Kyran Kunkel (1998-12-17). "population ecology of wolverines within Kobuk valley national park and Selawik national wildlife refuge". Rocky Mountain Research Station, US Department of Agriculture – Forest Service. http://www.wolverinefoundation.org/research/kobuk.htm. Retrieved 2008-01-26. 
  28. ^ a b c d e f g h i Howard N. Goldena, J. David Henryb, Earl Beckera, Michael I. Goldsteinc, John M. Mortond, Dennis Frost, and Aaron J. Poef (1998-12-17). "Estimating wolverine Gulo gulo population size using quadrat sampling of tracks in snow". Alaska Department of Fish and Game, Division of Wildlife Conservation; Parks Canada – Kluane National Park; US Forest Service – Alaska Regional Office; United States Fish and Wildlife Service, Kenai National Wildlife Refuge; North Yukon Renewable Resources Council; United States Forest Service, Chugach National Forest;. http://www.bioone.org/perlserv/?request=get-document&doi=10.2981%2F0909-6396(2007)13%5B52%3AEWGGPS%5D2.0.CO%3B2&ct=1. Retrieved 2007. 
  29. ^ a b c d e Michael K. Schwartz, Jeffrey P. Copeland, Neil J. Anderson, John R. Squires, Robert M. Inman, Kevin S. McKelvey, Kristy L. Pilgrim, Lisette P. Waits, and Samuel A. Cushman (2010). "Wolverine gene flow across a narrow climatic niche" (PDF). Ecology 90:3222–3232. Ecological Society of America. http://www.fs.fed.us/rm/pubs_other/rmrs_2009_schwartz_m001.pdf. Retrieved 2010-10-14. 
  30. ^ a b c d e Dr. Audrey Magoun, Neil Dawson, Dr. Geoff Lipsett-Moore, Dr. Justina C. Ray (2004). "Boreal Wolverine: A Focal Species for Land Use planning in Ontario's Northern Boreal Forest – Project Report" (PDF). The Wolverine Foundation, Inc., Ontario Ministry of Natural Resources, Ontario Parks, Wildlife Conservation Society (WCS)/University of Toronto. http://www.wolverinefoundation.org/research/Ontario%20Wolverine%20Project%20Report_July_04.pdf. Retrieved 2008-01-26. 
  31. ^ a b c d e Brian Slough et al. (May 2003). "COSEWIC Assessment and Update Status Report on the Wolverine (Gulo gulo) – Eastern Population Western Population in Canada" (PDF). COSEWIC (committee on the status of endangered wildlife in Canada) 2003. COSEWIC assessment and update status report on the wolverine Gulo gulo in Canada. Committee on the Status of Endangered Wildlife in Canada. Ottawa. vi + 41 pp.. http://dsp-psd.pwgsc.gc.ca/Collection/CW69-14-329-2003E.pdf. Retrieved 2008-01-26. 
  32. ^ "Gulo gulo – Wolverine". International Species Identification System. May 2010. http://app.isis.org/abstracts/Abs75307.asp. Retrieved 2010-05-09. 
  33. ^ "The Free Dictionary". The Free Dictionary. http://www.thefreedictionary.com/carcajou. Retrieved 2010-10-04. 
  34. ^ Runk, David (25 Feb 2004). "First Michigan wolverine spotted in 200 years". Associated Press. http://www.msnbc.msn.com/id/4374309/. Retrieved 23 Dec 2008. 
  35. ^ Bell, Dawson (2010-03-15). "Only known wolverine in the Michigan wild dies". Detroit Free Press. http://www.freep.com/article/20100315/NEWS06/100315027/1318/Only-wolverine-in-Mich.-wild-dies. 
  36. ^ Armitage, Peter (1992). "Religious ideology among the Innu of eastern Quebec and Labrador" (PDF). Religiologiques 6. Archived from the original on January 1, 2007. http://web.archive.org/web/20070101115643/http://www.er.uqam.ca/nobel/religio/no6/armit.pdf. Retrieved 2007-06-29.  (PDF)
  37. ^ Synertech International Corp. (1994-10-05). "American Humane Society Film Review". Ahafilm.info. http://www.ahafilm.info/movies/moviereviews.phtml?fid=7069. Retrieved 2010-10-04. 
  38. ^ http://animal.discovery.com/fansites/wildkingdom/wolverine/wolverine.html
  39. ^ Wolverine: Chasing the Phantom. IMDB.com
  40. ^ Wolverine: Chasing the Phantom | Nature | PBS Video. Video.pbs.org (2010-11-14). Retrieved on 2011-09-16.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Some authors (e.g., Hall 1981) have regarded the North American wolverine as a species (Gulo luscus) distinct from the Eurasian wolverine (Gulo gulo). Most recent accounts (e.g., Jones et al. 1992; Wozencraft, in Wilson and Reeder 1993, 2005; Pasitschniak-Arts and Lariviere 1995) treat luscus as a subspecies of Gulo gulo, following Degerbol (1935) and Kurten and Rausch (1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!