Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

River Otters can be thought of - and in a very real sense are - semi-aquatic weasels. Like fishers, martens, and mink, they have long, slender bodies, short limbs, and a short face, plus a set of adaptations for their aquatic lifestyle: an oily, waterproof coat, webbed toes, and small external ears. River Otters are good swimmers and divers, able to stay underwater for up to eight minutes. They feed on crayfish, crabs, fish, birds, small mammals, and some aquatic plants. They once lived in streams, rivers, lakes, swamps, and coastal areas throughout Canada and the United States. Now they are gone from the central and eastern United States, and extinct or rare in Arizona, Colorado, Indiana, Iowa, Kansas, Kentucky, Nebraska, New Mexico, North Dakota, Ohio, Oklahoma, South Dakota, Tennessee, Utah, and West Virginia. Scientific studies have shown them to be sensitive to pollution. Still these animals are commercially harvested: 20,000 - 30,000 are taken annually for their lustrous fur.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: "Schreber, J.C.D., 1777.  in Schreber's Die Säugthiere in Abbildungen nach der Natur mit Beschreibungen, Wolfgang Walther, Erlangen, 7 volumes, 1774-1846; 3(18):pl. 126.B[1776], text: 3(26):457, 588(index)[1777]."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Distribution

North America (Alaska west across northern Canada and the US to Nova Scotia)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

L. canadensis currently occurs throughout the United States of America and Canada. Originally this species is thought to have ranged from 250-700 N latitude and from 530 to 1660W longitude. In the USA, this species is present in states bordering the Great Lakes, Atlantic ocean and Gulf of Mexico, and in the forested regions of the Pacific coast in North America (Lariviere and Walton 1998). It is also present throughout Alaska, including the Aleutian Islands and the north slope of the Brooks Range (Magoun and Valkenburg 1977). Urbanization and pollution caused reductions in range area and are now absent or rare in Arizona, Hawaii, Indiana, Iowa, Kansas, Kentucky, Nebraska, New Mexico, North Dakota, Ohio, Oklahoma, South Dakota, Tennessee, and West Virginia (Melquist and Dronkert 1987; Park 1971; Polechla 1990). Reintroductions have expanded the distribution of this species in recent years, especially in the Midwestern United States (Melquist and Dronkert 1987). In Canada, North American river otters occupy all provinces and territories, except for Prince Edward Island (Melquist and Dronkert 1987).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North American river otters occur throughout Canada and the United States, except for areas of southern California, New Mexico, and Texas, and the Mohave desert of Nevada and Colorado. In Mexico they are found in the delta areas of the Rio Grande and Colorado river. Otters were locally extirpated from portions of their range but reintroduction and conservation efforts have helped stabilize populations.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The northern river otter historically occurred over much of the North American
continent. Present distribution of the northern river otter extends from 25
degrees N. in Florida to beyond 70 degrees N. in Alaska, and from
eastern Newfoundland to the Aleutian Islands [4]. Northern river otters have
been extirpated or are rare in Arizona, Colorado, Indiana, Iowa, Kansas,
Kentucky, Nebraska, New Mexico, North Dakota, Ohio, Oklahoma, South
Dakota, Tennessee, Utah, and West Virginia. They are still relatively
abundant along the coasts of the Atlantic Ocean and the Gulf of Mexico,
throughout the Pacific Northwest and Great Lakes states, and across most
of Canada and Alaska. Populations are listed as stable or increasing in
Alabama, Alaska, Arkansas, Connecticut, Delaware, Florida, Georgia,
Idaho, Louisiana, Maryland, Massachusetts, Michigan, Minnesota,
Mississippi, Montana, New Hampshire, New York, North Carolina, Oregon,
Rhode Island, Texas, Vermont, Washington, and Wisconsin [4].
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

1 Northern Pacific Border
2 Cascade Mountains
3 Southern Pacific Border
4 Sierra Mountains
5 Columbia Plateau
6 Upper Basin and Range
7 Lower Basin and Range
8 Northern Rocky Mountains
9 Middle Rocky Mountains
10 Wyoming Basin
11 Southern Rocky Mountains
12 Colorado Plateau
13 Rocky Mountain Piedmont
14 Great Plains
15 Black Hills Uplift
16 Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Occurrence in North America

AL AK AZ AR CA CO CT DE FL GA
ID IL IN IA KS KY LA ME MD MA
MI MN MS MO MT NE NV NH NJ NM
NY NC ND OH OK OR PA RI SC SD
TN TX UT VT VA WA WV WI WY
AB BC MB NB NF NT NS ON PE PQ
SK YK

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North American river otters occur throughout Canada and the United States, except for areas of southern California, New Mexico, and Texas, and the Mohave desert of Nevada and Colorado. In Mexico they are found in the delta areas of the Rio Grande and Colorado river. Otters were locally extirpated from portions of their range but reintroduction and conservation efforts have helped stabilize populations.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Throughout most of North America north of Mexico, except the extreme southwestern U.S. Extirpated from large areas of the interior U.S. following European colonization. Has been reintroduced in some parts of the range (e.g., Colorado, Virginia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historically, river otters ranged over the most of the United States and Canada, but became rare, or were extirpated during the fur trading period. Presently, they are distributed from approximately 25? N latitude in Florida through the Gulf of Mexico, to 70? N latitude in Alaska; and from eastern Newfoundland west throughout Canada, Alaska and the Aleutian Islands (Chapman and Feldhamer 1982). River otters occur throughout the Indian River Lagoon system.
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

North American river otters are semi-aquatic mammals, with long, streamlined bodies, thick tapered tails, and short legs. They have wide, rounded heads, small ears, and nostrils that can be closed underwater. Their whiskers are long and thick. The fur is dark brown to almost black above and a lighter color ventrally. The throat and cheeks are usually a golden brown. The fur is dense and soft, effectively insulating these animals in water. The feet have claws and are completely webbed. Body length ranges from 889 to 1300 mm and tail length from 300 to 507 mm. Weight ranges from 5 to 14 kg. Males average larger than females in all measurements.

Range mass: 5 to 14 kg.

Range length: 889 to 1300 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

North American river otters are semi-aquatic mammals, with long, streamlined bodies, thick tapered tails, and short legs. They have wide, rounded heads, small ears, and nostrils that can be closed underwater. The vibrissae are long and thick, reflecting their importance in sensory perception. The fur is dark brown to almost black above and a lighter color ventrally. The throat and cheeks are usually a golden brown. The fur is dense and soft, effectively insulating these animals in water. The feet have claws and are completely webbed. Body length ranges from 889 to 1300 mm and tail length from 300 to 507 mm. Weight ranges from 5 to 14 kg. Males average larger than females in all measurements.

Range mass: 5 to 14 kg.

Range length: 889 to 1300 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 131 cm

Weight: 13600 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Captive otters have been documented to live 16 years or more (Banfield 1974). Body size of adults is generally 1 m (3 feet) or more in length, including the tail. The tail measures as much as 31-46 cm (12 - 18 inches). Adults can weigh from 3-15 kg (7-35 pounds), with males typically outweighing females.
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 889-1,300 mm

Weight:
Range: 5-14 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: long streamlined animals with a thick tapered tail and short legs, wide, rounded head, small ears, and nostrils that can be closed underwater. long thick whiskers. they are dark brown to black above a ligther color ventrally. throat and cheeks are usually a golden. The feet have claws and are completely webbed.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Riparian zones, usually no more than a few hundred meters from water unless they are moving between rivers or lakes. River otters can tolerate a variety of environments including very cold and hot areas, high elevations, and coastal waters (rarely).
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Historical records indicate that river otters were well established throughout most major drainages in the continental United States and Canada prior to European settlement (Hall 1981). The continent’s largest otter populations occurred in areas with an abundance and diversity of aquatic habitats such as coastal marshes, the Great Lakes region, and glaciated areas of New England (Nilsson 1980; Toweill and Tabor 1982; Melquist and Dronkert 1987). In addition, riverine habitats in interior regions supported smaller, but viable, otter populations (Nilsson 1980).

North American river otters prefer bog lakes with banked shores containing semi-aquatic mammal burrows and lakes with beaver (Castor canadensis) lodges, and they avoid water bodies with gradually sloping shorelines of sand or gravel (Reid et al. 1994b). In Maine, use of watersheds by river otters is negatively associated with the proportion of mixed hardwood-softwood stands in forested areas adjacent to waterways and positively associated with the number of beaver flowages, watershed length, and average shoreline diversity (Dubuc et al. 1990). In Idaho, river otters prefer valley over mountain habitats, and they select valley streams over valley lakes, reservoirs, and ponds (Melquist and Hornocker 1983). Logjams are used intensively where present (Melquist and Hornocker 1983). In Florida, abundance of North American river otters is lowest in freshwater marshes, intermediate in salt marshes, and highest in swamp forest. During the dry season, L. canadensis will retreat from marshland and move to permanent ponds where water is available and food is more concentrated (Humphrey and Zinn 1982). In Idaho and Massachusetts, habitat features preferred for latrine sites include large conifers, points of land, beaver bank dens and lodges, isthmuses, mouths of permanent streams, or any object that protrudes from the water (Melquist and Hornocker 1983; Newman and Griffin 1994).

The diet of the North American river otter is comprised mostly of fish that are abundant, midsized, and close to shore (Larsen 1984; Stenson et al. 1984), as well as amphibians (mostly frogs) and crustaceans (mainly crayfish) (Knudsen and Hale 1968; Reid et al. 1994a; Sheldon and Toll 1964). Small mammals, mollusks, reptiles, birds, and fruits are consumed opportunistically (Gilbert and Nancekivell 1982; Greer 1955; Hamilton 1961; Morejohn 1969; Verbeek and Morgan 1978; Wilson 1954). North American river otters have few natural predators in the water: alligators (Alligator mississippiensis), American crocodiles (Crocodylus acutus), and killer whales (Orcinus orca). They are considerably more vulnerable on land or ice where bobcats (Lynx rufus), cougars (Felis concolor), coyotes (Canis latrans), dogs (Canis familiaris) and wolves (Canis lupus) can kill adults (Melquist and Dronkert 1987; Melquist and Hornocker 1983; Route and Peterson 1991; Toweill and Tabor 1982). Most mortality, however, is human-related and includes trapping, illegal shooting, road kills, and accidental captures in fish nets or set lines (Jackson 1961; Melquist and Hornocker 1983).

North American river otters can reach 13 years of age in the wild and up to 25 years of age in captivity (Melquist and Dronkert 1987; Stephenson 1977). Females usually do not reproduce until 2 years of age, although yearlings occasionally produce young (Docktor et al. 1987; Hamilton and Eadie 1964). Males are sexually mature at 2 years of age (Hamilton and Eadie 1964). North American river otters usually breed from December to April (Hamilton and Eadie 1964; Liers 1951), gestation lasts 61-63 days, and young are born between February and April (Hamilton and Eadie 1964; Melquist and Hornocker 1983). Litter size may reach five (Park 1971) but usually ranges from one to three (Docktor et al. 1987; Hamilton and Eadie 1964; Tabor and Wight 1977).

Systems
  • Terrestrial
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North American river otters are found anywhere there is a permanent food supply and easy access to water. They can live in freshwater and coastal marine habitats, including rivers, lakes, marshes, swamps, and estuaries. River otters can tolerate a variety of environments, including cold and warmer latitudes and high elevations. North American river otters seem to be sensitive to pollution and disappear from areas with polluted waters.

North American river otters build dens in the burrows of other mammals, in natural hollows, such as under a log, or in river banks. Dens have underwater entrances and a tunnel leading to a nest chamber that is lined with leaves, grass, moss, bark, and hair.

Habitat Regions: temperate ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, natural

Northern river otter habitat must provide adequate escape cover, rest sites, and
den sites. Rather than excavate their own dens, northern river otters use dens
dug by other animals, or natural shelters. They commonly use hollow
trunks of large trees, beaver (Castor canadensis) or nutria (Myocastor
coypus) dens, hollow logs, log jams, drift piles, jumbles of loose
rocks, abandoned or unused boathouses, and duck blinds [4].
Occasionally northern river otters occupy large, bulky, open nests of grasses in
marshes or riverbank thickets [1]. Understory bank cover is also
important to northern river otters. In a study of northern river otter habitat in
northwestern Montana, areas with less than 25 percent understory bank
cover were used significantly less than expected based on availability
[6]. Stream habitats generally provide more adequate escape cover and
shelter and less human disturbance than pond, lake, and reservoir
habitats [16].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 6. Dronkert-Egnew, Ana E. 1991. River otter population status and habitat use in northwestern Montana. Missoula, MT: Univeristy of Montana. 112 p. Thesis. [20339]
  • 16. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the term: tundra

Northern river otters are adapted to a variety of aquatic habitats from marine
environments to high-elevation mountain lakes. Optimum habitat for
northern river otters includes slow-moving water with deep pools, abundant
riparian vegetation, and plentiful fish [6]. Northern river otters are generally
most abundant along food-rich coastal areas, such as the lower portions
of streams and rivers and in estuaries, and in areas having extensive
nonpolluted waterways [4]. In Canada, they occur north beyond the tree
line in tundra lakes and streams [1].

Melquist and Hornocker [14] found that in west-central Idaho, river
otters prefer valley habitats to mountain habitats, and prefer
streamassociated habitats to lake, reservoir, and pond habitats.
Mountain lakes and streams were used most often during the fall. Most
northern river otters lived entirely in the valleys, and no otters lived solely
in the mountains. The use of lakes, reservoirs, and ponds was greatest
during the winter. Mudflats and associated open marshes, swamps, and
backwater sloughs were used most often in summer [14].

Northern river otter habitat is generally limited to open water during the
winter months. Outflows from lakes are favored habitat at this time.
In late winter, water levels usually drop below ice levels in rivers and
lakes, leaving a layer of air that allows northern river otters to travel and
hunt under the ice [16].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 6. Dronkert-Egnew, Ana E. 1991. River otter population status and habitat use in northwestern Montana. Missoula, MT: Univeristy of Montana. 112 p. Thesis. [20339]
  • 14. Melquist, Wayne E.; Hornocker, Maurice G. 1983. Ecology of river otters in west central Idaho. Wildlife Monographs. 83: 1-60. [19356]
  • 16. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

More info for the term: bog

K005 Mixed conifer forest
K011 Western ponderosa forest
K012 Douglas-fir forest
K015 Western spruce - fir forest
K020 Spruce - fir - Douglas-fir forest
K021 Southwestern spruce - fir forest
K025 Alder - ash forest
K026 Oregon oakwoods
K028 Mosaic of K002 and K026
K030 California oakwoods
K047 Fescue - oatgrass
K049 Tule marshes
K050 Fescue - wheatgrass
K051 Wheatgrass - bluegrass
K063 Foothills prairie
K073 Northern cordgrass prairie
K078 Southern cordgrass prairie
K080 Marl - everglades
K092 Everglades
K093 Great Lakes spruce - fir forest
K094 Conifer bog
K095 Great Lakes pine forest
K096 Northeastern spruce - fir forest
K097 Southeastern spruce - fir forest
K098 Northern floodplain forest
K101 Elm - ash forest
K106 Northern hardwoods
K107 Northern hardwoods - fir forest
K108 Northern hardwoods - spruce forest

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES11 Spruce-fir
FRES17 Elm-ash-cottonwood
FRES18 Maple-beech-birch
FRES19 Aspen-birch
FRES20 Douglas-fir
FRES21 Ponderosa pine
FRES22 Western white pine
FRES23 Fir-spruce
FRES28 Western hardwoods
FRES36 Mountain grasslands
FRES37 Mountain meadows
FRES41 Wet grasslands

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

Northern river otters inhabit a variety of riparian plant communities. These
communities are often dominated by willows (Salix spp.), cottonwoods
(Populus spp.), birches (Betula spp.), and spruce (Picea spp.). Other
vegetation common in northern river otter habitats includes cattails (Typha
spp.), red-osier dogwood (Cornus sericea), black hawthorn (Crataegus
douglassi), common snowberry (Symphoricarpos albus), grasses, horsetails
(Equisetum spp.), bulrushes (Scirpus spp.), and sedges (Carex spp.)
[3,6,19].
  • 3. Chabreck, Robert H. 1971. Ponds and lakes of the Louisiana coastal marshes and their value to fish and wildlife. Proceedings, 25th Annual Conference of Southeastern Association of Game and Fish Commissioners: 206-215. [14961]
  • 6. Dronkert-Egnew, Ana E. 1991. River otter population status and habitat use in northwestern Montana. Missoula, MT: Univeristy of Montana. 112 p. Thesis. [20339]
  • 19. Waller, Amy Johnston. 1992. Seasonal habitat use of river otters in northwestern Montana. Missoula, MT: University of Montana. 75 p. Thesis. [20659]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

16 Aspen
18 Paper birch
19 Gray birch - red maple
20 White pine - northern red oak - red maple
24 Hemlock - yellow birch
25 Sugar maple - beech - yellow birch
30 Red spruce - yellow birch
31 Red spruce - sugar maple - beech
35 Paper birch - red spruce - balsam fir
39 Black ash - American elm - red maple
51 White pine - chestnut oak
62 Silver maple - American elm
93 Sugarberry - American elm - green ash
95 Black willow
202 White spruce - paper birch
204 Black spruce
203 Balsam poplar
210 Interior Douglas-fir
212 Western larch
217 Aspen
222 Black cottonwood - willow
235 Cottonwood - willow
241 Western live oak
244 Pacific ponderosa pine - Douglas-fir
245 Pacific ponderosa pine
246 California black oak
249 Canyon live oak
252 Paper birch
255 California coast live oak

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North American river otters are found anywhere there is a permanent food supply and easy access to water. They can live in freshwater and coastal marine habitats, including rivers, lakes, marshes, swamps, and estuaries. River otters can tolerate a variety of environments, including cold and warmer latitudes and high elevations. North American river otters seem to be sensitive to pollution and disappear from areas with polluted waters.

North American river otters build dens in the burrows of other mammals, in natural hollows, such as under a log, or in river banks. Dens have underwater entrances and a tunnel leading to a nest chamber that is lined with leaves, grass, moss, bark, and hair.

Habitat Regions: temperate ; terrestrial

Aquatic Biomes: lakes and ponds; rivers and streams; coastal

Wetlands: marsh ; swamp ; bog

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 75 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0 - 0
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Streams, lakes, ponds, swamps, marshes, estuaries (in some areas), beaver flowages, exposed outer coast (Pacific Northwest, Alaska). When inactive, occupies hollow log, space under roots, log, or overhang, abandoned beaver lodge, dense thicket near water, or burrow of other animal; such sites also are used for rearing young. Highly associated with beaver on Mount Desert Island, Maine (Dubuc et al. 1990). Uses traditional haul-out sites along the banks of aquatic habitats. May travel long distances overland, particularly in snow.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

North American river otters eat mainly aquatic organisms such as amphibians, fish, turtles, crayfish, crabs, and other invertebrates. Birds, their eggs, and small terrestrial mammals are also eaten on occasion. They sometimes eat aquatic plants.

Prey is captured with the mouth, and mainly slow, non-game fish species are taken, e.g., suckers. The otter's long whiskers are used to detect organisms in the substrate and the dark water. Prey is eaten immediately after capture, usually in the water, although larger prey is eaten on land.

Animal Foods: birds; mammals; amphibians; fish; eggs; insects; terrestrial non-insect arthropods; aquatic crustaceans

Plant Foods: leaves; roots and tubers; macroalgae

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

The typical diet of northern river otters consists primarily of fish, but also
includes crustaceans (primarily crayfish), amphibians, insects, birds,
mammals, and plants [4,5,13]. Although a wide variety of fish species
are eaten by northern river otters, some species of fish are more vulnerable to
northern river otter predation. Slow-swimming fish species are generally
selected by northern river otters more often than fast-swimming fishes. Also
important are fish species that are abundant and found in large schools
[4]. Fishes often eaten by northern river otters include suckers (Catostomus
spp.), redhorses (Moxostoma spp.), carp (Cyprinus spp.), chubs
(Semotilus spp.), daces (Phinichthys spp.), shiners (Notropis spp.),
squawfish (Ptychocheilus spp.), bullheads and catfish (Ictalurus spp.),
sunfish (Lepomis spp.), darters (Etheostoma spp.), and perch (Perca
spp.). Crayfish (Cambarus spp., Pacifasticus spp., and others) also
comprise a major portion of the northern river otter's diet [1,4].

Waterfowl and rails comprise an important part of the northern river otter diet
in the Pacific Coast states and in many other regions. Freshwater
mussels (Anodonta californiensia), freshwater periwinkles (Oxytrema
silicula), and unidentified clams and snails have been reported in the
northern river otter's diet but are not important food items [4]. Northern river otters
may kill young beavers found alone in a lodge [1].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 5. Davis, Harry G.; Aulerich, Richard J.; Bursian, Steven J.; [and others]
  • 13. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

North American river otters eat mainly aquatic organisms such as amphibians, fish, turtles, crayfish, crabs, and other invertebrates. Birds, their eggs, and small terrestrial mammals are also eaten on occasion. They sometimes eat aquatic plants.

Prey is captured with the mouth, and mainly slow, non-game fish species are taken, e.g., suckers. The otter's long whiskers are used to detect organisms in the substrate and the dark water. Prey is eaten immediately after capture, usually in the water, although larger prey is eaten on land.

Animal Foods: birds; mammals; amphibians; fish; eggs; insects; terrestrial non-insect arthropods; aquatic crustaceans

Plant Foods: leaves; roots and tubers; macroalgae

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on aquatic animals, particularly fishes (mostly slow-moving, mid-size species), frogs, crayfish, turtles, insects, etc., sometimes birds and small mammals. In coastal waters eats marine species (Bowyer et al. 1995). Commonly preys on nesting seabirds in some areas (e.g., Alaska islands). See Toweill and Tabor 1982 for many further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the absence of large mammalian predators such as wolves and bears, river otters are top predators in some of the ecosystems where they occur, including the Indian River Lagoon. Though often blamed for damaging or depleting commercial fish stocks, the bulk of the diet consists of slow moving or schooling non-game fish species (Chapman 1982). Common prey types include: cyprinids, suckers (Catostomus spp.), chubs (Semotilus spp.), shiners (Notropis spp.), catfish (Ictalurus spp.), and perch (Perca spp.) (Banfield 1974; Chapman 1982).Besides non-game fish, river otters also consume crustaceans (primarily crayfish), amphibians, insects, small birds and waterfowl, mammals and plants (Meehan 1974; Chapman 1982; Davis et al. 1992).Competitors: River otters practice mutual avoidance behaviors in order to reduce intraspecific competition. Melquist and Hornocker (1983) observed otters to practice "personal space dispersion" whereby individuals defended territories based on their current location, rather than upon fixed environmental parameters. They postulated that this behavior probably had the effect of reducing direct competition for resources. Mutual avoidance is practiced primarily through vocalization and scent marking rather than by direct confrontation.Predators: River otters have few natural predators other than man; however, young otters are placed at risk for predation from foxes, bobcats, wolves, coyotes and snapping turtles when they leave water to traverse land areas.Habitats: River otters have somewhat large home ranges of approximately 8-78 square km. They utilize a wide variety of riparian communities including cattails (Typha spp), sedges (Carex spp.) and grasslands (Chabreck 1971; Dronkert-Egnew 1991; Waller 1992).Lontra canadensis is well adapted to aquatic habitats from marine to fresh water. Optimum otter habitat, according to Chapman (1982) is in highly vegetated areas having slow moving waters with deep pools, and abundant fish. Otters tend to be most abundant in coastal areas, or in the lower portions of rivers and estuaries. The total habitat area must provide otters with escape cover, den sites, and resting sites.Otters do not dig their own dens; rather, they rely on those dug by other animals, or on natural shelters such as the hollows of trees, tall marsh grasses, or riverbank thickets (Banfield 1974; Chapman 1982).Activity Time: Lontra canadensis is primarily nocturnal. However, it is also highly active in the early morning and in late afternoon (Banfield 1974).
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

North American river otters are important predators of fish and aquatic invertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

North American river otters are sometimes taken by bobcats, coyotes, birds of prey, alligators, and other large predators. They mainly escape predation through their agility in the water and on land, their vigilance, and their ability to fiercely defend themselves and their young.

Known Predators:

  • bobcats (Lynx_rufus)
  • coyotes (Canis_latrans)
  • birds of prey (Falconiformes)
  • American alligators (Alligator_mississipiensis)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predators

Although essentially safe from predators while in water, northern river otters
are considerably more vulnerable when they travel overland between
lakes, ponds, and steams [14]. Bobcats (Felis rufus), dogs (Canis
familiaris), coyotes (C. lutrans), foxes, gray wolves (C. lupus), and
American alligators (Alligator mississippiensis) have all been reported
to kill northern river otters [4,14,15]. In addition, it is likely that other
predators, including cougars (F. concolor), black bears (Ursus
americanus), American crocodiles (Crocodylus acutus), and some large
raptors, also kill northern river otters on occasion. No predator has been shown
to have a serious impact on northern river otter populations, and most predation
is probably directed toward young northern river otters [4].
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 14. Melquist, Wayne E.; Hornocker, Maurice G. 1983. Ecology of river otters in west central Idaho. Wildlife Monographs. 83: 1-60. [19356]
  • 15. Route, William T.; Peterson, Rolf O. 1991. An incident of wolf, Canis lupus, predation on a river otter, Lutra canadensis, in Minnesota. Canadian Field-Naturalist. 105(4): 567-568. [19821]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

North American river otters are important predators of fish and aquatic invertebrates.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

North American river otters are sometimes taken by bobcats, coyotes, birds of prey, alligators, and other large predators. They mainly escape predation through their agility in the water and on land, their vigilance, and their ability to fiercely defend themselves and their young.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Lontra canadensis is prey of:
Lynx rufus
Canis latrans
Alligator mississippiensis
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: The large range likely is divisible into at least 100 element occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population size is unknown but may exceed 10,000 individuals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chapman and Feldhamer (1982) suggested that otter populations in many areas are apparently stable and may be slowly increasing. Large populations of river otter exist in many states throughout the northern U.S. (including Alaska) and Canada where the river otter is still trapped for its fur. In Florida, however, river otters are not considered abundant in the Indian River Lagoon area. Intense pressure from coastal development and resulting loss of habitat have caused otter populations in this area to decline. There are apparently several population strongholds including the Merritt Island National Wildlife Refuge -Canaveral National Seashore complex, as well as other relatively undeveloped areas (Ehrhart 1995).Locomotion: Lontra canadensis actively swims, and crawls. They are capable of achieving running speeds of 29 km/hr (18 miles/hr), and have been observed to remain submerged for as long as 8 minutes.
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, short-term effects

The short-term effects of a riparian fire may affect the northern river otter's
food supply. Removal of streamside vegetation increases the risk of
streambank erosion and raises stream temperatures, both of which could
potentially reduce fish populations in the stream. However, the
long-term effect of fire on fish populations could be benefical. Fire
thins and removes conifers along streams, stimulates growth of deciduous
vegetation. This provides cover and shading, and fosters development of
terrestrial insects important in the diet of fishes [20].

Additionally, fire occurring in riparian areas indirectly benefits river
otters by benefiting beavers [11]. As stated in MANAGEMENT
CONSIDERATIONS, beaver activities help create suitable habitat for river
otters.
  • 11. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Yukon Wildlife Branch: 1-36. [14071]
  • 20. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the term: litter

Breeding - Northern river otters breed in late winter or early spring; the
breeding season is spread over a period of 3 months or longer [1,4].

Gestation period and litter size - There is much discrepancy in the
literature regarding the length of gestation in the northern river otter.
Gestation periods of 288 to 375 days have been reported. The extreme
length of gestation is due to a process called "delayed implantation",
wherein the development of the blastocyst is arrested for a period of
time before it implants into the uterine wall. Litters are generally
born from November through May. In northwestern North America, river
otters generally give birth from March through May following an average
delay of 9 months and an actual gestation of about 62 days [6]. Litter
size ranges from one to six, with two to four young most common [4].

Pup development - Northern river otter pups are born helpless. They begin to
open their eyes by age 21 to 35 days; by 25 to 42 days pups begin
playing. Northern river otter pups are introduced to water by age 48 days and
may venture out of the den on their own by the age of 59 to 70 days.
Weaning occurs at about 91 days of age [4].

Age at sexual maturity - Female northern river otters normally become sexually
mature when they are about 2 years old, but may or may not breed at that
time. Female northern river otters may not breed every year [6,14]. Although
male northern river otters also become sexually mature at about 2 years of age,
they may not become successful breeders until they reach 5 to 7 years
[4].

Life span - Northern river otters have lived at least 16 years in captivity [1].

Northern river otters are primarily nocturnal, but may be active in the early
morning and late afternoon in remote areas. They are active all winter
except during the most severe periods, when they take shelter for a few
days [1].
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 6. Dronkert-Egnew, Ana E. 1991. River otter population status and habitat use in northwestern Montana. Missoula, MT: Univeristy of Montana. 112 p. Thesis. [20339]
  • 14. Melquist, Wayne E.; Hornocker, Maurice G. 1983. Ecology of river otters in west central Idaho. Wildlife Monographs. 83: 1-60. [19356]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Home range typically is linear; 20-30 miles for a pair or male; less for females with young (Jackson 1961). May hunt over as much as 80-100 km of stream during the course of one year. In coastal Alaska, summer home range size averaged around 20 km of shoreline in males, 10 km in females, with ranges twice as large in oiled areas (Bowyer et al. 1995).

Population density of one per 2.2 miles has been recorded (Baker 1983). Density was estimated at one otter per 86 ha of coastal marsh in Louisiana (Shirley et al. 1988). In Idaho, density was one family group and 1-3 subadults or nonbreeding adults per 15 km of waterway, plus one breeding adult male for each 20-30 km of waterway (see Toweill and Tabor 1982). Density in coastal areas of the Gulf of Alaska was 0.30-0.85 otters/km of shoreline (Testa et al. 1994, Bowyer et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Amphibians, fish, crayfish, and other invertebrates. Birds and small terrestrial mammals are also eaten on occation.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

North American river otters communicate in a variety of ways. They vocalize with whistles, growls, chuckles, and screams. They also scent mark using paired scent glands near the base of their tails or by urinating/defecating on vegetation within their home range. These glands produce a very strong, musky odor. They also use touch and communicate through posture and other body signals.

North American river otters perceive their environment through vision, touch, smell, and hearing. Their large and abundant whiskers are very sensitive and are important in tactile sensation. These whiskers are used extensively in hunting, as smell, vision, and hearing are diminished in the water.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

North American river otters communicate in a variety of ways. They vocalize with whistles, growls, chuckles, and screams. They also scent mark using paired scent glands near the base of their tails or by urinating/defecating on vegetation within their home range. These glands produce a very strong, musky odor. They also use touch and communicate through posture and other body signals.

North American river otters perceive their environment through vision, touch, smell, and hearing. Their large and abundant whiskers are very sensitive and are important in tactile sensation. These whiskers are used extensively in hunting, as smell, vision, and hearing are diminished in the water.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active in winter, even in fresh deep snow. May be active at any time of day. In Idaho, most active from dawn to midmorning and in the evening (see Toweill and Tabor 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

North American river otters can live up to 21 years in captivity. They normally live about 8 to 9 years in the wild.

Range lifespan

Status: captivity:
21 (high) years.

Typical lifespan

Status: wild:
8 to 9 years.

Average lifespan

Status: wild:
8-9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

North American river otters can live up to 21 years in captivity. They normally live about 8 to 9 years in the wild.

Range lifespan

Status: captivity:
21 (high) years.

Typical lifespan

Status: wild:
8 to 9 years.

Average lifespan

Status: wild:
8-9 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: There is a delayed implantation and thus the total gestation time varies from 290 to 380 days. The actual embryonic development takes about 60-63 days (Ronald Nowak 2003). One wild born female was as old as 27 when she died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males and females only come together during the mating season. Males usually mate with several females that live in or near their own territory.

Mating System: polygynous

Males and females come together to breed in late winter or early spring. Pregnancy lasts two months, but the young may be born up to a year after mating because these otters delay the implantation of the fertilized egg. Births occur from November to May, with a peak in March and April. Females give birth to from 1 to 6 young per litter, with an average of 2 to 3, in a den near the water. They are born with fur, but are otherwise helpless. They open their eyes at one month of age and are weaned at about 3 months old. They begin to leave their mother's home range at from 6 months to a year old. Sexual maturity is reached at 2 to 3 years of age.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs in late winter and early spring.

Range number of offspring: 1 to 6.

Average number of offspring: 2-3.

Average gestation period: 2 months.

Average weaning age: 3 months.

Range time to independence: 6 to 12 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 140 g.

Average gestation period: 62 days.

Average number of offspring: 2.5.

Females give birth to, nurse, and care for their young in a den near the water. The young are weaned at about 3 months old and begin to leave their mother at 6 months old.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males and females do not associate except during the mating season. Males often breed with several females, probably those whose home ranges overlap with their own.

Mating System: polygynous

Males and females come together to breed in late winter or early spring. Gestation lasts two months, but the young may be born up to a year after mating because these otters employ delayed implantation of the fertilized egg in the uterus. Births occur from November to May, with a peak in March and April. Females give birth to from 1 to 6 young per litter, with an average of 2 to 3, in a den near the water. They are born with fur, but are otherwise helpless. They open their eyes at one month of age and are weaned at about 3 months old. They begin to leave their natal range at from 6 months to a year old. Sexual maturity is reached at 2 to 3 years of age.

Breeding interval: Breeding occurs once yearly.

Breeding season: Mating occurs in late winter and early spring.

Range number of offspring: 1 to 6.

Average number of offspring: 2-3.

Average gestation period: 2 months.

Average weaning age: 3 months.

Range time to independence: 6 to 12 months.

Range age at sexual or reproductive maturity (female): 2 to 3 years.

Range age at sexual or reproductive maturity (male): 2 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous ; delayed implantation

Average birth mass: 140 g.

Average gestation period: 62 days.

Average number of offspring: 2.5.

Females give birth to, nurse, and care for their young in a den near the water. The young are weaned at about 3 months old and begin to leave their mother at 6 months old.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Implantation is delayed 8 months or more. Gestation, including delayed implantation, lasts 9-12 months. In many areas, births peak in late winter-early spring; parturition dates may not be closely synchronized within a given population. Litter size is 1-6 (average 2-3); 1 litter per year. Young may first enter water at about 7 weeks, are weaned at about 3 months, stay with mother for about a year. Male may rejoin family after young leave den. Females breed for the first time at 2 years. Males become sexually mature at 2 years, but may not breed successfully until 5-7 years old. Females evidently breed in alternate years in some areas (e.g., Alabama, Georgia), every year in Oregon (see Toweill and Tabor 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs in late winter and early spring (Banfield 1974; Chapman and Feldhamer 1982). Females are considered sexually mature at 2 years of age, but do not necessarily breed upon first reaching maturity. Some evidence suggests that females do not breed every year (Melquist and Hornocker 1983; Dronkert-Egnew 1991). Males mature at approximately 2 years of age, but may not successfully breed until they are 5-7 years old (Chapman and Feldhamer 1982). Copulation occurs in water.
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

There is much discrepancy in the scientific literature regarding the length of river otter gestation periods, with reports ranging from 288 - 375 days (Chapman 1974; Wren 1991). This extreme difference has been attributed to a process known as delayed implantation, in which young are born following a period of arrested development. In this process, fertilized eggs develop to the blastocyst stage, and then remain floating in the uterus for a variable period of time before implanting into the uterine wall. Litters are born nearly a year following conception, generally from November to May; though in the Pacific northwest, pups are delivered from March through May. The actual gestation period following implantation is estimated to be 60-62 days (Chapman and Feldhamer 1982; Dronkert-Egnew 1991; Nebraska Game and Parks Commission 2001).Litter size ranges from 1- 6 pups per litter, with 2-4 being most common (Chapman 1982). Pups open their eyes at 21-35 days. At 25-42 days, they begin to play. Parents introduce pups to water at 48 days, and they begin to venture outside the den alone at 59-70 days. Pups are fully weaned by 91 days, and will leave parents at approximately 1 year old (Chapman 1982).
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lontra canadensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGGTTATTCTCTACAAATCACAAAGATATTGGCACCTTGTACCTTTTATTCGGTGCGTGAGCTGGAATGGTAGGAACTGCTCTTAGCCTACTAATCCGAGCCGAATTAGGTCAACCTGGCGCTTTGCTAGGGGAC---GACCAGATTTATAATGTTATCGTCACCGCCCACGCATTCGTAATGATTTTCTTCATGGTCATACCAATTATAATCGGGGGATTCGGAAACTGGCTAGTGCCCCTTATAATTGGTGCACCCGACATGGCATTTCCCCGAATAAACAACATAAGCTTTTGGCTTCTGCCTCCTTCATTCCTTCTTCTCTTGGCCTCATCCATGGTAGAATCGGGTGCGGGAACAGGATGAACCGTATACCCCCCTTTAGCTGGAAATCTGGCACATGCAGGAGCATCAGTAGACCTGACAATTTTTTCCCTACACCTGGCAGGTGTTTCGTCCATCCTAGGGGCCATTAACTTCATTACCACTATTATTAACATAAAACCACCCGCAATGTCACAATACCAGACCCCTCTATTTGTGTGATCTGTACTGATCACGGCTGTGCTCCTACTACTATCTCTGCCCGTACTAGCAGCTGGTATTACCATATTGCTTACAGACCGAAATCTCAATACTACTTTCTTCGACCCCGCCGGAGGAGGAGACCCCATCCTGTACCAACACCTATTCTGATTTTTCGGGCACCCGGAGGTATACATCCTAATTCTACCAGGGTTTGGGATTATTTCACACGTCGTAACGTATTATTCAGGAAAGAAAGAACCATTTGGTTACATAGGAATGGTCTGAGCAATAATATCAATTGGTTTTCTGGGGTTTATCGTGTGAGCCCATCACATATTTACCGTAGGCATGGACGTCGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lontra canadensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Serfass, T. & Polechla, P.

Reviewer/s
Hussain, S.A. & Conroy, J. (Otter Red List Authority)

Contributor/s

Justification
This species is considered to be Least Concern as it is not currently declining at a rate sufficient for a threat category. By the early 1900s, river otters had declined throughout large portions of their historic range in North America. However, improvements in water quality (through enactment of clean water regulations) and furbearer management techniques have enabled river otters to reclaim portions of their range in many areas. Reintroduction projects have been particularly valuable in restoring otter populations in many areas of the United States. However, river otters remain rare or absent in the southwestern United States and water quality and development limit recovery of populations in some areas. The species is widely distributed throughout its range. In many places the populations have re-established themselves because of conservation initiatives (Polechla 1990). There is an ongoing discussion about the problem of reintroduction of river otters. In recent years it is feared that it may contaminate the genetic structure of the native population.

History
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern river otters are listed in Appendix II of CITES. Populations were once eliminated through many parts of their range, especially around heavily populated areas in the midwestern and eastern United States. Population trends have stabilized in recent years and reintroduction and conservation efforts have resulted in recolonization of areas where they were previously extirpated. Northern river otter populations are still considered vulnerable or imperiled throughout much of their range in midwestern United States and the Appalachian mountains. They may be eliminated in New Mexico and population status in South Carolina and Florida has not yet been reviewed.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Information on state- and province-level protection status of animals in the
United States and Canada is available at NatureServe, although recent
changes in status may not be included.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S. Federal Legal Status

Not listed

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern river otters are listed in Appendix II of CITES. Populations were once extirpated through many parts of their range, especially around heavily populated areas in the midwestern and eastern United States. Population trends have stabilized in recent years and reintroduction and conservation efforts have resulted in recolonization of areas where they were previously extirpated. Northern river otter populations are still considered vulnerable or imperiled throughout much of their range in midwestern United States and the Appalachian mountains. They are presumed extirpated in New Mexico and population status in South Carolina and Florida has not yet been reviewed.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range in much of North America north of Mexico; population trend probably is relatively stable; recent reintroduction and management efforts have improved conservation status.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
By the early 1900’s, unregulated trapping, water pollution, and other degradations of aquatic and riparian habitats had caused otter populations to decline throughout most of their historic range (Nilsson 1980; Toweill and Tabor 1982; Melquist and Dronkert 1987). Improvements in water quality and furbearer management strategies, including implementation of reintroduction projects, have enabled the reestablishment of otter populations to various aquatic habitats in portions of their former range. Reintroduction projects have been especially useful in restoring otter populations to riverine habitats in interior regions.

Methods for determining relative abundance of North American river otters include track counts in the snow (Reid et al. 1987; St-Georges et al. 1995), radioactive isotopes (Knaus et al. 1983; Testa et al. 1994), catch/unit effort (Chilelli et al. 1996), and scent-station surveys (Humphrey and Zinn 1982). Density estimates of river otters range from 1 otter/1.25-3.60 km of coastline in Alaska (Testa et al. 1994) to 1 otter/3.9 km of waterway in Idaho (Melquist and Hornocker 1983).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Population trend probably is relatively stable overall.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats to otter populations in North America vary among regions and are influenced by type, distribution, and density of aquatic habitats and characteristics of human activities. Prior to settlement of North America by Europeans, otters were widespread among aquatic habitats throughout most of the continent (Hall 1981). Unregulated trapping and loss or degradation of aquatic habitats through filling of wetlands and development of coal, oil, gas, tanning, timber, and other industries resulted in extirpations or declines in otter populations in many areas (Toweill and Tabor 1982, Melquist and Dronkert 1987). Nilsson (1980) reviewed the status of otters in the United States and determined that populations were extirpated in 11 states and had experienced severe declines in 9 other states. The most severe population declines occurred in interior regions where fewer aquatic habitats supported smaller fewer otter populations. Although the distribution of otters became reduced in some regions of southern Canada, the only province-wide extirpation occurred on Prince Edward Island (Polechla 1990).

During the 1970’s, improvements in natural resource management techniques coincided with increased concern about otter declines in North America (Endangered Species Scientific Authority 1978). Consequently, many wildlife management agencies developed strategies to restore or enhance otter populations, including the use of reintroduction projects (Ralls 1990; Serfass et al. 1993). Since 1976 over 4,000 otters have been reintroduced among 21 states. Also, 29 states and all Canadian provinces except Prince Edward Island have viable populations that sustain annual harvests. Annual harvest numbers of Northern river otters are similar for Canada and the United States (Obbard 1987), with most pelts being used in the garment industry (Toweill and Tabor, 1982). In the late 1970s, annual harvest in North America reached ca. 50,000 pelts, for a value of U.S. $3 million (Melquist and Dronkert, 1987). Otters are incidentally harvested by traps set for beavers (Toweill and Tabor, 1982), and therefore management plans should consider both species simultaneously (Polechla, 1990). While current harvest strategies do not pose a threat to maintaining otter populations, harvest may limit expansion of otter populations in some areas (Lariviere and Walton 1998).

Oil spills present a localized threat to otter populations, especially in coastal areas. Water pollution and other degradation of aquatic and wetland habitats may limit distribution of otters and pose long-term threats if enforcement of water quality standards are not maintained and enforced. Acid drainage from coal mines is a persistent water quality problem in some areas that eliminates otter prey prevents thereby inhibits recolonization or expansion of otter populations. Recently, there has been discussion of the long-term genetic consequences of reintroduction projects on remnant otter populations (Serfass et al. 1998). Similarly, many perceived threats to otters such as pollution and habitat alterations have not been rigorously evaluated.
The threat of disease to wild otter populations is poorly understood and has received little study (Serfass et al. 1995). Lontra canadensis may be victim of canine distemper (Harris 1968; Park 1971), rabies (Serfass et al. 1995), respiratory tract disease, and urinary infection (Hoover et al. 1984; Route and Peterson 1991). In addition, North American river otters can contract jaundice, hepatitis, feline panleucopenia, and pneumonia (Harris, 1968). North American river otters host numerous endoparasites such as nematodes (Hoberg et al. 1997), cestodes (Greer 1955), trematodes (Hoover et al. 1984), the sporozoan Isopora (Hoover et al. 1984), and acanthocephalans (Hoberg et al. 1997; Hoover et al. 1984). Ectoparasites include ticks (Eley 1977; Serfass et al. 1992), sucking lice Latagophthirus rauschi (Kim and Emerson 1974), and the flea Oropsylla arctomys (Serfass et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Comments: Local/regional declines were caused by unregulated trapping and degradation of riverine/riparian habitat. Oil contamination resulted in reduced habitat availability in Alaska (Bowyer et al. 1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included in CITES Appendix II. Additional research is needed to clearly delineate the impact that various forms of water pollution, agricultural and other development along riparian habitats, industrial and housing development in coastal areas, cumulative impacts related to loss or alterations of wetlands, large flood control structures, and interactions that these and other factors have on otter populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: cover, marsh

When burning marshes, partial burns are more desirable than complete
burns. The unburned portions of the marsh provide cover for river
otters [20].
  • 20. Wright, Henry A.; Bailey, Arthur W. 1982. Fire ecology: United States and southern Canada. New York: John Wiley & Sons. 501 p. [2620]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

Northern river otters have often been blamed for serious depredation of game
fish, particularly trout. Food habit studies, however, have all
indicated that the bulk of the northern river otter diet consists of nongame fish
species. In many circumstances, northern river otters are beneficial to game
fish populations because they remove nongame fish that would otherwise
compete with game fish for food [4]. Northern river otters, however, may
occasionally cause severe depredation in fish hatcheries [1,4].

Northern river otters have been extirpated or reduced in many areas due to human
encroachment, habitat destruction, and overharvest [8]. Northern river otters
are relatively abundant in major nonpolluted river systems and in the
lakes and tributaries that feed them. They are scarce, however, in
heavily settled areas, particularly if the waterways are polluted. In
Maryland, no northern river otters occur in waters altered by acidic mine
drainages. The disappearance of northern river otters from West Virginia and
parts of Tennessee and Kentucky has been attributed to increased acidity
of ground water due to mining operations [4]. Little research has been
done in evaluating the range of water quality that otters will tolerate
[4]

The most readily apparent human impact on northern river otters results from
trappers harvesting otters for their fur. The northern river otter has been an
economically important furbearing species since Europeans first arrived
in North America [4]. Habitat destruction has also resulted in a
decline in northern river otter populations. Some causes of northern river otter habitat
destruction include the development of waterways for economic or
recreational purposes, destruction of riparian habitat for homesites or
farmland, and a decline in water quality because of increased siltation
and/or pesticide residues in runoff [4,6,16]. Pesticide residues
including mercury, DDT and its metabolites, and Mirex have been reported
in northern river otter tissues [4].

Roads and railroad tracks that parallel or cross streams are probably
responsible for a considerable number of northern river otter deaths each year.
This is an important consideration in mountainous states where roads are
constructed along stream courses [14].

Several researchers have associated good northern river otter habitat with the
activities of beavers. Northern river otter population dynamics may be
influenced not only by beaver trapping but also by wide fluctuations in
beaver numbers and subsequent habitat changes. In the western United
States, with its widely separated waterways and large variations in
flow, beaver-created habitat may be critical to northern river otter denning and
foraging [6].

A variety of internal parasites affect northern river otters. Of these, two
roundworms (Stronguloides lutrae and Gnathostoma miyazakii) may cause
serious pathological damage. Northern river otters are also susceptible to
canine distemper, jaundice, hepatitis, and feline panleucopenia [4].

In recent years several states have transplanted northern river otters in an
attempt to establish or reestablish breeding populations [17].
  • 8. Finch, Deborah M. 1992. Threatened, endangered, and vulnerable species of terrestrial vertebrates in the Rocky Mountain Region. Gen. Tech. Rep. RM-215. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 38 p. [18440]
  • 1. Banfield, A. W. F. 1974. The mammals of Canada. Toronto, ON: University of Toronto Press. 438 p. [21084]
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 6. Dronkert-Egnew, Ana E. 1991. River otter population status and habitat use in northwestern Montana. Missoula, MT: Univeristy of Montana. 112 p. Thesis. [20339]
  • 14. Melquist, Wayne E.; Hornocker, Maurice G. 1983. Ecology of river otters in west central Idaho. Wildlife Monographs. 83: 1-60. [19356]
  • 16. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 17. Tango, Peter J.; Michael, Edwin D.; Cromer, Jack I. 1991. Mating and first-season births in interstate transplanted river otters, Lutra canadensis (Carnivora: Mustelidae). Brimleyana. 17: 53-55. [20686]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Suseptible to overharvest (Toweill and Tabor 1982).

See Berg (1982) for information on reintroduction. See Tango et al. (1991) for a review of information on reproduction by reintroduced otters. Sources of otters for reintroductions should be based on documented patterns of genetic variation, which do not concur very well with nominal subspecies delineations (Serfass et al. 1998).

Management Research Needs: Refine techniques for successful reintroduction (e.g., reducing dispersal from reintroduction area).

Biological Research Needs: See element stewardship (ES) files.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected in several national and state parks and refuges.

Needs: Maintain productive aquatic habitats. Prevent excessive harvest. Support reintroduction and habitat restoration efforts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

North American river otters generally do not have adverse affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

North American river otters are important parts of healthy, aquatic ecosystems.

North American river otters have been hunted for many years for their attractive and durable fur. In the 1983-84 hunting season, 33,135 otters were taken with an average selling price of $18.71 per pelt. Otters are stll an important source of income for many people in Canada and the western United States. River otters also eat "trash fish" that compete with more economically desirable game fish.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

North American river otters generally do not have adverse affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

North American river otters are important parts of healthy, aquatic ecosystems.

North American river otters have been hunted for many years for their attractive and durable fur. In the 1983-84 hunting season, 33,135 otters were taken with an average selling price of $18.71 per pelt. Otters are stll an important source of income for many people in Canada and the western United States. River otters also eat "trash fish" that compete with more economically desirable game fish.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested for fur. In the early to mid-1970s, U.S. harvest was about 11,000-19,000, Canadian harvest was about 15,000-18,000 (Toweill and Tabor 1982). U.S. harvest recently has been largest in Louisiana (about 7500 pelts annually in the 1970s and early 1980s) (Shirley et al. 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lontra canadensis is a top predator in the Indian River Lagoon system.Benefit in IRL: Their aesthetic value aside, river otters may help reduce direct competition between commercially valuable fish species and other fishes. Otters have historically been blamed for depleting game fish stocks; however, they may actually be of benefit to commercial species due to their preference for slow moving, non-game species of fishes. Through removal of non-game fishes, commercial species thus enjoy reduced competition for food (Davis et al. 1992).River otter fur is still highly prized today in the fur trade and nearly all U.S. states allow the export of otter pelts, subject to regulation by state wildlife authorities. In some states, river otter populations are low enough to have gained them threatened or endangered status. They are thus protected and managed for in these areas. However, in all Canadian provinces, Alaska, and approximately half of the remaining U.S. states otters are still trapped seasonally under highly regulated conditions. Perhaps surprisingly, Louisiana generally has the highest harvest of river otters in the U.S., with annual totals sometimes exceeding 10,000 animals (Nebraska Game and Parks Commission 2001). River otter pelts in 2001 were valued at an average of $48.00 USD (North American Fur Auctions 2001).
  • Banfield, A.W.F. 1974. The mammals of Canada. University of Toronto Press, Toronto, Canada. 438 pp.Beckel, A.L. 1990. Foraging success rates of North American river otters, Lutra canadensis, hunting alone and hunting in pairs. Canadian Field-Naturalist.104(4):586-588.
  • Ben-David, M., R.T. Bowyer, and J.B. Faro. 1995. Niche separation by minkand river otters: coexistence in a marine environment. Oikos. 75:41-48.
  • Chabreck, R.H. 1971. Ponds and lakes of the Louisiana coastal marshes andtheir value to fish and wildlife. Proceedings, 25th annual conference ofSoutheastern Association of Game and Fish Commissioners. pp. 206-215.
  • Chapman, J.A., and G.A. Feldhamer, eds. 1982. Wild mammals of NorthAmerica. The Johns Hopkins University Press, Baltimore MD. 1147 pp.
  • Davis, H.G., R.J. Aulerich, S.J. Bursian, et al. 1992. Feed consumption and foodtransit time in northern river otters (Lutra canadensis). Journal of Zoo andWildlife Medicine. 23(2): 241-244.
  • Dronkert-Egnew, A.E. 1991. River otter population status and habitat use innorthwestern Montana. University of Montana, Missoula, MT. 112 pp. Thesis
  • Duffy, D.C. 1995. Apparent river otter predation at an Aleutian tern colony.Colonial Waterbirds. 18(1):91-92.
  • Ehrhart, L. 1995. Mammals of Indian River marshes and maritime hammocks:status and threats. Bull. Mar. Sci. 57(1): 280-285.
  • Halbrook, R.S., J.H. Jenkins, P.B. Bush and N.D. Seabolt. 1994. Sublethalconcentrations of mercury in river otters: monitoring environmentalcontamination. Archives of Environmental Contamination and Toxicology.27:306-310.
  • Humphrey, S.R. and T.L. Zinn. 1982. Seasonal habitat use by river otters andEverglades mink in Florida. Journal of Wildlife Management. 46(2): 375-381.
  • Jenkins, J.H. 1983. The status and management of the river otter (Lutracanadensis) in North America. Acta Zool. Fennica 174:233-235.
  • McCall, R. 1995. A novel foraging association between southern river ottersLutra longicaudis and great egrets Casmerodius albus. Bull B.O.C.116(3): 199-200.
  • Meehan, W.R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlifehabitats. U.S. Department of Agriculture, Forest Service, Pacific NorthwestForest and Range Experiment Station. Gen. Tech. Rep. PNW-16. Portland,OR. 32 pp.
  • Melquist, W.E. and M.G. Hornocker. 1983. Ecology of river otters in westcentral Idaho. Wildlife Monographs 83:1-60.
  • Nebraska Game and Parks Commission. 2001. The river otter. Online wildlifepublication: www.ngpc.state.ne.us/wildlife/otters.html.
  • Newman, D.G., and C.R. Griffith. 1994. Wetland use by river otters in Massachusetts. Journal of Wildlife Management. 58(1):18-23.
  • North America Fur Auctions. 2001. Online Auction sales results, September 5and 6, 2001. Toronto, Ontario, Canada. Online publication: www.nafa.ca/sales/results_sept2001.asp.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994a. Food habits of theriver otter in a boreal ecosystem. Canadian Journal of Zoology.72:1306-1313.
  • Reid, D.G., T.E. Code, A.C. Reid, and S.M. Herrero. 1994b. Spacing,movements and habitat selection of the river otter in boreal Alberta. Canadian Journal of Zoology. 72:1314-1324.
  • Rock, K.R., E.S. Rock, R.T. Bowyer and J.B. Faro. 1994. Degree ofassociation and use of a helper by coastal river otters, Lutra canadensis, in Prince William Sound, Alaska. Canadian Field-Naturalist. 08(3):367-369.
  • Serfass, T.L. 1995. Cooperative foraging by north American river otters, Lutracanadensis. The Canadian Field-Naturalist. 109: 458-459.
  • Shirley, M.G., R.G. Linscombe, N.W. Kinler, et al. 1988. Population estimatesof river otters in a Louisiana coastal marshland. Journal of WildlifeManagement. 52(3):512-515.
  • St.-Georges, M., S. Nadeau, D. Lambert and R. Decarie. 1995. Winter habitatuse by ptarmigan, snowshoe hares, red foxes, and river otters in the borealforest - tundra transition zone of western Quebec. Canadian Journal ofZoology. 73:755-764.
  • Stenson, G.B., G.A. Badgero, and H.D. Fisher. 1984. Food habits of the riverotter Lutra canadensis in the marine environment of British Columbia.Canadian Journal of Zoology. 62:88-91.
  • Stoskopf, M.K., L.H. Spelman, P.W. Sumner, et al. 1997. The impact of watertemperature on core body temperature of north American river otters (Lutracanadensis) during simulated oil spill recovery washing protocols. Journal ofZoo and Wildlife Medicine. 28(4):407-412.
  • Tumlison, R. and M. Karnes. 1987. Seasonal changes in food habits of riverotters in southwestern Arkansas beaver swamps. Mammalia. 51(2):225-231.
  • Waller, A.J. 1992. Seasonal habitat use of river otters in northwestern Montana.University of Montana, Missoula, MT. 75 pp. Thesis.
  • Wren, C.D. and K.L. Fischer. 1986. Mercury levels in Ontario mink and otterrelative to food levels and environmental acidification. Canadian Journal of Zoology. 64:2854-2859.
  • Wren, C.D. 1991. Cause-effect linkages between chemicals and populations ofmink (Mustela vison) and otter (Lutra canadensis) in the Great Lakes Basin.Journal of Toxicology and Environmental Health. 33:549-585.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

North American river otter

The North American river otter (Lontra canadensis), also known as the northern river otter or the common otter, is a semiaquatic mammal endemic to the North American continent found in and along its waterways and coasts. An adult river otter can weigh between 5.0 and 14 kg (11.0 and 30.9 lb). The river otter is protected and insulated by a thick, water-repellent coat of fur.

The river otter, a member of the weasel family, is equally versatile in the water and on land. It establishes a burrow close to the water's edge in river, lake, swamp, coastal shoreline, tidal flat, or estuary ecosystems. The den typically has many tunnel openings, one of which generally allows the otter to enter and exit the body of water. Female otters give birth in these underground burrows, producing litters of one to six young.

North American river otters, like most predators, prey upon the most readily accessible species. Fish is a favored food among the otters, but they also consume various amphibians (such as frogs[2]), turtles, and crayfish. Instances of river otters eating small mammals and occasionally birds have been reported as well.

The range of the North American river otter has been significantly reduced by habitat loss, beginning with the European colonization of North America. In some regions, though, their population is controlled to allow the trapping and harvesting of otters for their pelts. River otters are very susceptible to environmental pollution, which is a likely factor in the continued decline of their numbers. A number of reintroduction projects have been initiated to help stabilize the reduction in the overall population.

Taxonomy and evolution[edit]

The North American river otter was first described by German naturalist Johann Christian Daniel von Schreber in 1777.[3] The mammal was identified as a species of otter and has a variety of common names, including North American river otter, northern river otter, common otter and, simply, river otter.[3] Other documented common names are American otter, Canada otter, Canadian otter, fish otter, land otter, nearctic river otter, and Prince of Wales otter.[4]

The river otter was first classified in the genus Lutra; Lutra was the early European name. The species name was Lutra canadensis.[3] The species epithet canadensis means "of Canada".[5]

In a new classification, the species is called Lontra canadensis, where the genus Lontra includes all the New World river otters.[6] Molecular biological techniques have been used to determine when the river otter and the giant otter diverged. These analyses suggest they diverged in the Miocene epoch 23.03 to 5.33 million years ago (Mya), which is "much earlier" than indicated in the fossil record.[7] Fossils of a giant river otter dating back 3.5 Mya have been found in the US Midwest, however fossils of the modern river otter did not appear in North America until about 1.9 Mya.[8] The earliest known fossil of Lontra canadensis, found in the US Midwest, is from the Irvingtonian stage (1,800,000 to 300,000 years ago).[9] The oldest fossil record of an Old World river otter comes from the late Pliocene epoch (3.6 to 1.8 Mya).[10] The New World river otters originated from the Old World river otters after a migration across the Bering Land Bridge, which existed off and on between 1.8 million and 10,000 years ago. The otters migrated to North America and southwards again across the Panamanian Land Bridge, which formed 3 Mya.[4]

Subspecies[edit]

Listed alphabetically[11]

  • L. c. canadensis (Schreber, 1777) – (eastern Canada, USA, Newfoundland)
  • L. c. kodiacensis (Goldman, 1935) – (Kodiak Islands, Alaska)
  • L. c. lataxina (Cuvier, 1823) – (USA)
  • L. c. mira (Goldman, 1935) – (Alaska, British Columbia)
  • L. c. pacifica (J. A. Allen, 1898) – (Alaska, Canada, northern USA, south to central California, northern Nevada, and northeastern Utah)
  • L. c. periclyzomae (Elliot, 1905) – (British Columbia)
  • L. c. sonora (Rhoads, 1898) – (USA, Mexico)

Physical characteristics[edit]

Skull
The river otter's streamlined shape allows it to glide through the water.

The North American river otter is a stocky animal of 5 to 14 kilograms (11 to 31 lb), with short legs, a muscular neck no smaller than the head, and an elongated body that is broadest at the hips.[9] An average adult male weighs about 11.3 kilograms (25 lb) against the female's average of 8.3 kilograms (18 lb). Its body length ranges from 66 to 107 centimetres (26 to 42 in).[12] About one-third of the animal's total length consists of a long, tapered tail.[9] Tail lengths range from 30 to 50 centimetres (12 to 20 in).[12] Large male North American river otters can exceed a weight of 15 kilograms (33 lb).[13] It differs from the European otter by its longer neck, narrower visage, the smaller space between the ears and its shorter tail.[14]

A broad muzzle is found on the river otter's flat head, and the ears are round and inconspicuous. The rhinarium is bare, with an obtuse, triangular projection. Eyes of the animal are small and placed anteriorly. A short, broad rostrum for exhaling and a long, broad cranium define the relatively flat skull.[9] The river otter's nostrils and ears close during submersion, inhibiting water from entering them.[9] Its vibrissae (whiskers) are long and thick, enhancing sensory perception underwater and on land.[9]

The fur of the species is short (guard hairs average 23.8 mm (0.94 in)), with a density of about 57,800 hairs/cm2 (373,000 hairs/in2) in the midback section. The pelage has a high luster and varies from light brown to black. The throat, chin, and lips are grayer than the rest of the body. Fur of senescent river otters may become white-tipped, and rare albinos may occur.[9]

Sexual dimorphism exists among the river otters.[15] Males are, on average, 5% larger than females. In Idaho, juvenile, yearling, and adult males averaged 8, 11, and 17% heavier, respectively, than females of the same age. A clinical reduction in size may exist from north to south along the Pacific coast, but not from east to west.[9]

North American river otters live an average of 21 years of age in captivity,[15] but they can reach 25 years of age.[9] However, they normally live about 8 to 9 years in the wild,[15] but are capable of living up to 13 years of age.[9]

Form and function[edit]

The river otter's sensitive whiskers allow it to detect prey in murky water. Note the inconspicuous ears.

The river otter is physically well-equipped for aquatic life. The ears are short, the neck is the same diameter as the head, the legs are short and powerful, the toes are fully webbed, and the tail (one-third of body length) is tapered. These qualities give the river otter a streamlined profile in water, but reduce agility on land. The smell and hearing abilities of the river otter are acute. The otter has a delicate sense of touch in the paws in addition to great dexterity.[9] River otters characteristically approach within a few feet of a boat or a person on shore because they're near-sighted, a consequence of vision adapted for underwater sight. River otters have transparent nictitating membranes to protect their eyes while swimming.[4][16][17]

The right lung of the river otter is larger than the left, having four lobes compared with two for the left. Reduced lobulation of the lungs is presumed to be adaptive for underwater swimming. In addition, the length of the trachea of the river otter is intermediate between that of terrestrial carnivores and marine mammals. The mean tracheal length of the river otter is 15.3 cm (6.0 in), or 23.2% of the body length. A shorter trachea may improve air exchange and increase lung ventilation in diving mammals.[9]

Most mustelids, including otters, have specialized teeth, including sharp canines and carnassials that inflict lethal bites to prey. Also, river otters have large molars used for crushing hard objects, such as the shells of molluscs.[18] An adult river otter has a total of 36 teeth. Additional premolars may be present.[9] The dental formula is 3.1.4.13.1.3.2.

Behavior[edit]

River otters are active year-round, and are most active at night and during crepuscular hours. They become much more nocturnal in the spring, summer, and fall seasons, and more diurnal during winter. They may migrate as a result of food shortages or environmental conditions, but they do not migrate annually.[9]

Movement[edit]

Otters swim by quadrupedal paddling, forelimb paddling, alternate hind-limb paddling, simultaneous hind-limb paddling, or body and tail dorsoventral undulation. The tail, which is stout and larger in surface area than the limbs, is used for stability while swimming and for short bursts of rapid propulsion. While swimming at the surface, the dorsal portion of the river otter's head, including nostrils, ears, and eyes, is exposed above water. It must remain in motion to maintain its position at the surface.[9]

Sliding across ice is an efficient means of travel. Note the long, tapered tail.

On land, the river otter can walk, run, bound, or slide. Foot falls during walking and running follow the sequence of left limb, right limb, right limb, left limb. During walking, the limbs are moved in a plane parallel to the long axis of the body. Bounding is the result of simultaneous lifting of the limbs off the ground. As the front feet make contact with the ground, the back feet are lifted and land where the front paws first contacted the ground, producing a pattern of tracks in pairs typical of most mustelids. Sliding occurs mostly on even surfaces of snow or ice, but can also occur on grassy slopes and muddy banks. Sliding across snow and ice is a rapid and efficient means of travel, and otters traveling over mountain passes, between drainages, or descending from mountain lakes often slide continuously for several hundred meters. Rear leg paddling enables continuous sliding where gravity is an insufficient or an opposing force.[19] During winter, the river otters heavily use openings in the ice, and may excavate passages in beaver dams for accessing open water.[9]

Tracks in the snow

North American river otters are highly mobile and have the capacity of traveling up to 42 km (26 mi) in one day. Daily movements of yearling males and females in Idaho averaged 4.7 and 2.4 km (2.9 and 1.5 mi) in spring, 5.1 and 4.0 km (3.2 and 2.5 mi) in summer, and 5.0 and 3.3 km (3.1 and 2.1 mi) in autumn, respectively. Daily movements of family groups averaged 4.7, 4.4, and 2.4 km (2.9, 2.7, and 1.5 mi) in spring, summer, and winter, respectively. Both males and family groups travel drastically less during winter.[9]

Playing[edit]

River otters are renowned for their sense of play. Otter play mostly consists of wrestling with conspecifics. Chasing is also a common game. River otters rely upon play to learn survival skills such as fighting and hunting. However, playful behavior was found in only 6% of 294 observations in a study in Idaho, and was limited mostly to immature otters.[9]

Hunting[edit]

Raft of L. c. pacifica surfacing to eat fish, Ganges Harbour, Saltspring Island, British Columbia

Prey is captured with a quick lunge from ambush, or more rarely, after a sustained chase. River otters can remain underwater for nearly 4 minutes, swim at speeds approaching 11 km/h (6.8 mph), dive to depths nearing 20 m (22 yd), and travel up to 400 m (440 yd) while underwater. Several river otters may even cooperate while fishing. Small fish are eaten at the surface, but larger ones are taken to the shore to be consumed. Live fish are typically eaten from the head.

River otters dry themselves and uphold the insulative quality of their fur by frequent rubbing and rolling on grass, bare ground, and logs.

A highly active predator, the river otter has adapted to hunting in water, and eats aquatic and semiaquatic animals. The vulnerability and seasonal availability of prey animals mainly governs its food habits and prey choices.[20] This availability is influenced by the following factors: detectability and mobility of the prey, habitat availability for the various prey species, environmental factors, such as water depth and temperature, and seasonal changes in prey supply and distribution in correspondence with otter foraging habitat.[21][22]

The diet of the river otter can be deduced by analyzing either scat obtained in the field,[23] or gut contents removed from trapped otters.[24] Fish are the primary component of the river otter's diet throughout the year.[25] Every study done on the food habits of the river otter has identified varying fish species as being the primary component of its diet. For instance, an Alberta, Canada study involved the collection and analysis of 1,191 samples of river otter scats collected during each season.[26] Fish remnants were found present in 91.9% of the scat samples. Moreover, a western Oregon study revealed fish remains were present in 80% of the 103 digestive tracts examined.[25] Crustaceans (crayfish), where regionally available, are the second-most important prey for otters. Crustaceans may even be consumed more than fish. For example, a study conducted in a central California marshland indicated crayfish formed nearly 100% of the river otter's diet at certain times of the year.[27] However, river otters, as foragers, will immediately take advantage of other prey when readily obtainable.[28] Other prey consumed by river otters includes fruits,[29] reptiles, amphibians, birds, aquatic insects, small mammals, and mollusks.[20] River otters are not scavengers; they avoid consuming carrion.[22]

Otters do not dramatically reduce prey populations in the wild, generally speaking. When a copious supply of food dwindles or other prey becomes available, otters either transfer to a new location or convert their dietary choices to the most adequate prey.[18] When left unchecked, though, otter depredations can be quite significant under certain circumstances (e.g. in hatcheries or other fish culture facilities). Likewise, the potential predatory impact of otters may be considerable whenever fish are physically confined (most commonly in smaller ponds offering sparse cover or other escape options). Resolution of such conflicts will usually require removal and/or relocation of nuisance otters. Even in larger bodies of water, they may take disproportional advantage of any seasonal concentrations of fish when and where only very limited areas of suitable spawning, low-flow, or over-wintering habitat may exist. Even such fast-swimming species as trout become lethargic in extremely cold water, with a commensurate increase in their vulnerability to predation. As such, careful consideration of any threatened, endangered, or fish species of special interest is warranted prior to reintroduction of otters to a watershed. Although other prey species are of temporary significance to the river otter, the deciding factor whether the river otter can establish itself as a permanent resident of one location is the year-round availability of fish.[18]

There are reports of photographs of retrieving otters that were used by hunters near Butte, Nebraska.[citation needed]

Social structure[edit]

Pair of North American river otters in captivity in Phillips Park Zoo in Aurora, Illinois

The North American river otter is more social than most mustelids. In all habitats, their basic social group is the family, consisting of an adult female and her progeny. Adult males also commonly establish enduring social groupings, some documented to comprise as many as 17 individuals. In coastal areas, males may remain gregarious even during the estrous period of females. Family groups may include helpers, which can be made up of unrelated adults, yearlings, or juveniles.[9] Male otters disperse from such family groups more often than females. When females leave, they tend to move much further away (60–90 km or 37–56 mi) than males (up to 30 km or 19 mi), which tend to move shorter distances. Male river otters do not seem to be territorial, and newly dispersing males may join established male groups.[30] On occasion, groups of unrelated juveniles are observed. River otters living in groups hunt and travel together, use the same dens, resting sites, and latrines, and perform allogrooming. In freshwater systems, groups occur most often in autumn and during early winter. From mid-winter through the breeding season, adult females move and den alone. River otters are not territorial, but individual otters of different groups portray mutual avoidance. Home ranges of males are larger than those of females, and both sexes exhibit intra- and intersexual overlap of their domains.[9]

Communication[edit]

Communication among North American river otters is accomplished mainly by olfactory and auditory signals. Scent marking is imperative for intergroup communication. The river otter scent-marks with feces, urine, and possibly anal sac secretions. Musk from the scent glands may also be secreted when otters are frightened or angry.[9]

River otters can produce a snarling growl or hissing bark when bothered, and a shrill whistle when in pain. When at play or traveling, they sometimes give off low, purring grunts. The alarm call, given when shocked or distressed by potential danger, is an explosive snort, made by expelling air through the nostrils. River otters also may use a birdlike chirp for communication over longer distances, but the most common sound heard among a group of otters is low-frequency chuckling.[9]

Reproduction and life cycle[edit]

North American river otters are polygynous.[9] Females usually do not reproduce until two years of age, although yearlings produce offspring on occasion. Males are sexually mature at two years of age.[1] The number of corpora lutea increases directly with age.[9]

River otters typically breed from December to April. Copulation lasts from 16–73 minutes and may occur in water or on land. During the breeding, the male grabs the female by the neck with his teeth. Copulation is vigorous, and is interrupted by periods of rest. Females may caterwaul during or shortly after mating. Female estrus lasts about a month per year,[31] and true gestation lasts 61–63 days. Because the otters delay implantation for at least eight months, the interval between copulation and parturition can reach 10–12 months.[9] Delayed implantation distinguishes the species from the European otter, which lacks this feature.[32] Young are born between February and April,[1] and parturition lasts three to eight hours.[9]

In early spring, expectant mothers begin to look for a den where they can give birth. The female otters do not dig their own dens; instead, they rely on other animals, such as beavers, to provide suitable environments to raise their offspring. When the mothers have established their domains, they give birth to several kits.[12] Litter size can reach five, but usually ranges from one to three.[9] Each otter pup weighs approximately five ounces.[12] At birth, the river otters are fully furred, blind, and toothless. The claws are well-formed and facial vibrissae (about 5 mm (0.20 in) long) are present. The kits open their eyes after 30–38 days. The newborns start playing at five to six weeks, and begin consuming solid food at 9–10 weeks. Weaning occurs at 12 weeks, and females provide solid food for their progeny until 37–38 weeks have transpired. The maximum weight and length of both sexes are attained at three to four years of age.[9]

The mothers raise their young without aid from adult males. When the pups are about two months old and their coats grow in, their mother introduces them to the water. Otters are natural swimmers and, with parental supervision, they acquire the skills necessary to swim.[12] The otters may leave the den by eight weeks and are capable of sustaining themselves upon the arrival of fall, but they usually stay with their families, which sometimes include the father, until the following spring. Prior to the arrival of the next litter, the otter yearlings venture out in search of their own home ranges.[33]

Geographic range[edit]

The species inhabits coastal areas, such as marshland.

The Northern American river otter is found throughout North America, inhabiting inland waterways and coastal areas in Canada, the Pacific Northwest, the Atlantic states, and the Gulf of Mexico. River otters also currently inhabit coastal regions throughout the United States and Canada. North American river otters also inhabit the forested regions of the Pacific coast in North America. The species is also present throughout Alaska, including the Aleutian Islands, and the north slope of the Brooks Range.

However, urbanization and pollution instigated reductions in range area.[1] They are now absent or rare in Arizona, Hawaii, Indiana, Kansas, Kentucky, Nebraska, New Mexico, North Dakota, Ohio, Oklahoma, South Dakota, Tennessee, and West Virginia. Reintroduction projects have expanded their distribution in recent years, especially in the Midwestern United States. In 2010, the Colorado Department of Wildlife reported the species, reintroduced in the 1980s, was "thriving" and recommended its protection status be reconsidered.[34] In late 2012, a river otter nicknamed Sutro Sam took up residence around the former site of the Sutro Baths in San Francisco, the first river otter sighting in that city in more than half a century.[35] In Canada, North American river otters occupy all provinces and territories, except for Prince Edward Island.[1]

Historical records indicate river otters were once populous throughout most major drainages in the continental United States and Canada prior to European settlement. North America’s largest otter populations were found in areas with an abundance and diversity of aquatic habitats, such as coastal marshes, the Great Lakes region, and glaciated areas of New England. In addition, riverine habitats in interior regions supported smaller, but practical, otter populations.[1] The otter existed on all parts of the Pacific Coast, including the seashore and inlands streams and lakes.[36] However, large populations never occurred in areas of Southern California such as the chaparral and oak woodlands and Mojave Desert seasonal waterway regions, or in the xeric shrubland regions in New Mexico, Texas, Nevada, and Colorado. In Mexico, the otters lived in the Rio Grande and Colorado River Deltas.[15]

Habitat[edit]

Although commonly called a "river otter", the North American river otter is found in a wide variety of aquatic habitats, both freshwater and coastal marine, including lakes, rivers, inland wetlands, coastal shorelines and marshes, and estuaries. It can tolerate a great range of temperature and elevations. A river otter's main requirements are a steady food supply and easy access to a body of water. However, it is sensitive to pollution, and will disappear from tainted areas.[15]

Like other otters, the North American river otter lives in a holt, or den, constructed in the burrows of other animals, or in natural hollows, such as under a log or in river banks. An entrance, which may be under water or above ground, leads to a nest chamber lined with leaves, grass, moss, bark, and hair.[15] Den sites include burrows dug by woodchucks (Marmota monax), red foxes (Vulpes vulpes), nutria (Myocastor coypus), or beavers, or beaver and muskrat (Ondatra zibethicus) lodges. River otters also may use hollow trees or logs, undercut banks, rock formations, backwater sloughs, and flood debris. The use of den and resting sites is chiefly opportunistic, although locations that provide protection and seclusion are preferred.[9]

Population localization[edit]

Aquatic life ties North American river otters almost exclusively to permanent watersheds.[9] The river otters favor bog lakes with banked shores containing semiaquatic mammal burrows and lakes with beaver lodges. The otters avoid water bodies with gradually sloping shorelines of sand or gravel. In Maine, use of watersheds by river otters is negatively associated with the proportion of mixed hardwood-softwood stands in forested areas adjacent to waterways. However, it is positively associated with the number of beaver flowages, watershed length, and average shoreline diversity. In Idaho, river otters prefer valley habitats over mountainous terrain, and they select valley streams over valley lakes, reservoirs, and ponds. Log jams are heavily used when present. In Florida, inhabitation of North American river otters is lowest in freshwater marshes, intermediate in salt marshes, and highest in swamp forests. During the dry season, they will recede from the marshland and move to permanent ponds, where water is available and food is in greater supply. In Idaho and Massachusetts, ecological elements preferred for latrine sites include large conifers, points of land, beaver bank dens and lodges, isthmuses, mouths of permanent streams, or any object that protrudes from the water.[1]

River otters often reside in beaver ponds. Encounters between otters and beavers are not necessarily hostile. In Idaho, otters and beavers were recorded in the same beaver lodge simultaneously on three separate occasions. The otters may compete with the American mink (Mustela vison) for resources. In Alaska, the two species living in marine environments indicate niche separation through resource partitioning, probably related to the swimming abilities of these mustelids.[9]

Fish[edit]

River otters consume an extensive assortment of fish species ranging in size from 2 to 50 centimeters (0.79 to 19.69 in) that impart sufficient caloric intake for a minute amount of energy expenditure.[22] River otters generally feed on prey that is in larger supply and easier to catch. As a result, slow-swimming fish are consumed more often than game fishes when both are equally available.[24][28] Slow-moving species include suckers (Catostomidae), sunfish and bass (Centrarchidae); and daces, carp, and shiners (Cyprinidae).[21] For instance, Catostomidae are the primary dietary component of river otters in Colorado's Upper Colorado River Basin.[37] Likewise, the common carp (Cyprinus carpio) is a preferred fish species for the otter in other regions of Colorado.[37] Fish species frequently found in the diets of the North American river otters include: Catostomidae, which consists of suckers (Catostomus spp.) and redhorses (Moxostoma spp.); Cyprinidae, made up of carp (Cyprinus spp.), chubs (Semotilus spp.), daces (Rhinichthys spp.), shiners (Notropis and Richardsonius spp.), and squawfishes (Ptychocheilus spp.); and Ictaluridae, which consists of bullheads and catfish (Ictalurus spp.).[18] Other fish an integral part of the river otters' diets are those that are often plentiful and found in large schools: sunfish (Lepomis spp.); darters (Etheostoma spp.); and perches (Perca spp.).[18][24][25] Bottom-dwelling species, which have the tendency to remain immobile until a predator is very close, are susceptible to river otters. These include mudminnows (Umbra limi) and sculpins (Cottus spp.).[18][24][25] Game fish, such as trout (Salmonidae) and pike (Esocidae), are not a significant component of their diets.[22][24] They are less likely to be prey for the North American river otters since they are fast-swimming and can find good escape cover.[22] However, river otters will prey on trout, pike, walleye (Sander vitreus vitreus), salmon (Oncorhynchus spp.), and other game fish during spawning.[25]

Adult river otters are capable of consuming 1 to 1.5 kilograms (2.2 to 3.3 lb) of fish per day.[28] A study conducted on captive otters revealed they preferred larger fish, ranging from 15 to 17 centimeters (5.9 to 6.7 in), more than smaller fish, ranging from 8 to 10 centimeters (3.1 to 3.9 in), and they had difficulty catching fish species less than 10 centimeters (3.9 in) or larger than 17 centimeters (6.7 in).[20] Otters are known to take larger fish on land to eat, whereas smaller fish are consumed in the water.[28]

Crustaceans[edit]

Otters may prefer to feed on crustaceans, especially crayfish (Cambarus, Pacifasticus, and others) more than fish where they are locally and seasonally plentiful.[21] In Georgia, crayfish accounted for two-thirds of the prey in the summer diet, and their remnants were present in 98% of the summer spraint. In the winter, crayfish made up one-third of the otter's diet.[38] A study conducted on North American river otters in a southwestern Arkansas swamp identified a correlation between crayfish consumption, fish consumption, and water levels.[39]

During the winter and spring, when the water levels were higher, otters had a greater tendency to prey upon crayfish (73% of scats had crayfish remains) rather than fish.[39] However, when water levels are lower, crayfish will seek out shelter while fish become more highly concentrated and susceptible to predation. Therefore, fish are more vulnerable to being preyed upon by otters because the crayfish have become more difficult to obtain.[21]

Reptiles and amphibians[edit]

Amphibians, where regionally accessible, have been found in the river otter's diet during the spring and summer months, as indicated in many of the food habit studies.[24][26] The most common amphibians recognized were frogs (Rana and Hyla).[25] Specific species of reptiles and amphibians prey include: boreal chorus frogs (Pseudacris maculata); Canadian toads (Bufo hemiophrys); wood frogs (Rana sylvatica);[26] bullfrogs (Rana catesbeiana); green frogs (Rana clamitans);[28] northwestern salamanders (Ambystoma gracile); Pacific giant salamander (Dicamptodon ensatus); rough-skinned newt (Taricha granulosa);[25] and garter snakes (Thamnophis).[18][25]

Amphibians and reptiles are more obtainable by the river otter during the spring and summer as a result of breeding activity, appropriate temperatures, and water supply for the prey.[39]

Birds[edit]

Waterfowl, rails, and some colonial nesting birds are preyed upon by otters in various areas.[24][37] Susceptibility of these species is greatest during the summer (when waterfowl broods are vulnerable) and autumn.[24] The otters have also been known to catch and consume moulting American wigeon (Mareca americana) and green-winged teal (Anas crecca).[26] Other species of birds found within their diets include: northern pintail (Anas acuta); mallard (Anas platyrhynchos); canvasback (Aythya valisineria); ruddy duck (Oxyura jamaicensis); and the American coot (Fulica americana).[25]

Although they consume birds, river otters do not feed on bird eggs.[20]

Insects[edit]

Aquatic invertebrates have been recognized as an integral part of the river otter's diet.[18][26][28][37] Otters consume more aquatic insects in the summer as the populations increase and specific life stages heighten their susceptibility.[26] Most aquatic invertebrates preyed upon by the otters are from the families Odonata (dragonfly nymphs), Plecoptera (stonefly nymphs), and Coleoptera (adult beetles).[26][37] Invertebrates discovered within scats or digestive tracts could most likely be a secondary food item, first being consumed by the fish that are subsequently preyed upon by the otters.[23][25]

Mammals[edit]

Mammals are rarely consumed by river otters, and are not a major dietary component.[22][23] Mammals preyed upon by otters are characteristically small or are a type species found in riparian zones.[37] The few occurrences of mammals found in the river otter's diet include: muskrats (Ondatra zibethicus); meadow voles (Microtus pennsylvanicus); eastern cottontails (Sylvilagus floridanus); and snowshoe hares (Lepus americanus).[26][28][40]

Records of otters preying upon beavers (Castor canadensis) vary; it has been reported in the southern boreal forest of Manitoba.[41] Trappers in Alberta, Canada commonly assert otters are major predators of beavers.[26] A 1994 river otter study reported findings of beaver remains in 27 of 1,191 scats analyzed.[26] However, many other studies did not report any findings of beaver remains in the scat sampled.[39][42]

Threats[edit]

The otter has few natural predators when in water. Aquatic predators include the alligator (Alligator mississippiensis), American crocodile (Crocodylus acutus), and killer whale (Orcinus orca), none of which commonly coexist with this otter and thus rarely pose a threat.[9] On land or ice, the river otter is considerably more vulnerable. Terrestrial predators include the bobcat (Lynx rufus), mountain lion (Felis concolor), coyote (Canis latrans), domestic dog (Canis lupus familiaris), gray wolf (Canis lupus), black bear (Ursus americanus) and (in young or small otters) red fox (Vulpes vulpes) .[29] Most river otter mortality is caused by human-related factors, such as trapping, illegal shooting, roadkills, and accidental captures in fish nets or set lines. Accidental deaths may be the result of ice flows or shifting rocks. Starvation may occur due to excessive tooth damage.[9]

Threats to otter populations in North America vary regionally. Otter inhabitation is affected by type, distribution, and density of aquatic habitats and characteristics of human activities. Preceding the settlement of North America by Europeans, otters were prevalent among aquatic habitats throughout most of the continent. Trapping, loss or degradation of aquatic habitats through filling of wetlands, and development of coal, oil, gas, tanning, timber, and other industries, resulted in extirpations, or declines, in otter populations in many areas. In 1980, an examination conducted on U.S. river otter populations determined they were extirpated in 11 states, and had experienced drastic lapses in 9 others. The most severe population declines occurred in interior regions where fewer aquatic habitats supported fewer otter populations. Although the distribution became reduced in some regions of southern Canada, the only province-wide extirpation occurred on Prince Edward Island.[1]

During the 1970s, improvements in natural resource management techniques emerged, along with increased concerns about otter population declines in North America. Consequently, many wildlife management agencies developed strategies to restore or enhance otter populations, including the use of reintroduction projects. Since 1976, over 4,000 otters have been reintroduced in 21 U.S. states. All Canadian provinces except Prince Edward Island and 29 U.S. states have viable populations that sustain annual harvests. Annual harvest numbers of northern river otters are similar for Canada and the United States, with most pelts being used in the garment industry. In the late 1970s, annual harvest in North America reached approximately 50,000 pelts, for a value of US$3 million. Otters are inadvertently harvested by traps set for beavers, and therefore management plans should consider both species simultaneously. While current harvest strategies do not pose a threat to maintaining otter populations, harvest may limit expansion of otter populations in some areas.[1] Otter harvests correlate positively with the beaver harvests and with the average beaver pelt price from the preceding year. Fur of the river otter is thick and lustrous and is the most durable of native American furs. River otter pelts are used as the standard for rating the quality of other pelts.[9]

Oil spills present a localized threat to otter populations, especially in coastal areas. Water pollution and other diminution of aquatic and wetland habitats may limit distribution and pose long-term threats if the enforcement of water quality standards is not upheld. Acid drainage from coal mines is a persistent water quality issue in some areas, as it eliminates otter prey. This dilemma prevents, and consequently inhibits, recolonization or growth of otter populations. Recently, long-term genetic consequences of reintroduction projects on remnant otter populations has been discussed. Similarly, many perceived threats to otters, such as pollution and habitat alterations, have not been rigorously evaluated. Little effort has gone into assessing the threat of disease to wild river otter populations, so it is poorly understood and documented. River otters may be victims of canine distemper, rabies, respiratory tract disease, and urinary infection. In addition, North American river otters can contract jaundice, hepatitis, feline panleucopenia, and pneumonia. They host numerous endoparasites, such as nematodes, cestodes, trematodes, the sporozoan Isopora, and acanthocephalans. Ectoparasites include ticks, sucking lice(Latagophthirus rauschi), and fleas (Oropsylla arctomys).[1]

River otters are hunted and trapped for their valuable fur.

Conservation status[edit]

Lontra canadensis is listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora. They have been virtually eliminated through many parts of their range, especially around heavily populated areas in the midwestern and eastern United States.[43] Appendix II lists species that are not necessarily threatened with extinction currently, but may become so unless trade is closely controlled.[44]

The North American river otter is considered a species of Least Concern according to the IUCN Redlist, as it is not currently declining at a rate sufficient for a threat category. By the early 1900s, river otter populations had declined throughout large portions of their historic range in North America. However, improvements in water quality (through enactment of clean water regulations) and furbearer management techniques have permitted river otters to regain portions of their range in many areas. Reintroduction projects have been particularly valuable in restoring populations in many areas of the United States. However, river otters remain rare or absent in the southwestern United States. Water quality and development inhibit recovery of populations in some areas. The species is widely distributed throughout its range. In many places, the populations have re-established themselves because of conservation initiatives. Reintroduction of river otters may present a problem in that it may contaminate the genetic structure of the native population.[1]

Habitat degradation and pollution are major threats to their conservation; river otters are highly sensitive to pollution[citation needed] and readily accumulate high levels of mercury, organochloride compounds, and other chemical elements. The species is often used as a bioindicator because of its position at the top of the food chain in aquatic ecosystems. Environmental disasters, such as oil spills, may increase levels of blood haptoglobin and interleukin-6 immunoreactive protein, but decrease body mass. Home ranges of river otters increase in size on oiled areas compared to unoiled areas, and individual otters also modify their habitat use. Declines in the richness[clarification needed] and diversity of prey species may explain these changes.[9]

References[edit]

  1. ^ a b c d e f g h i j k Serfass, T.; P. Polechla (2008). "Lontra canadensis". 2008 IUCN Red List of Threatened Species. IUCN 2008. Retrieved 2009-01-15. 
  2. ^ "otter". Encyclopædia Britannica. Encyclopædia Britannica Online. Encyclopædia Britannica Inc., 2014. Web. Retrieved 20 Jan. 2014
  3. ^ a b c "North American Mammals: Lontra canadensis (Lutra canadensis)". National Museum of Natural History. Smithsonian Institution. Retrieved 2009-01-15. 
  4. ^ a b c Feldhamer, George A.; Bruce Carlyle Thompson, Joseph A. Chapman (2003). Wild Mammals of North America: Biology, Management, and Conservation. Johns Hopkins University Press. pp. 348–733. ISBN 0-8018-7416-5. 
  5. ^ "River Otter, Lutra canadensis". Canada's Aquatic Environments (University of Guelph). 2002. Retrieved 2009-01-15. 
  6. ^ Koepfli, Klaus-Peter; Kerry Deere, Graham Slater, Colleen Begg, Keith Begg, Lon Grassman, Mauro Lucherini, Geraldine Veron, and Robert Wayne (2008). "Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation". BMC Biology 6: 10. doi:10.1186/1741-7007-6-10. PMC 2276185. PMID 18275614. 
  7. ^ Koepfli, K.P.; R.K. Wayne (1998). "Phylogenetic relationships of otters (Carnivora: Mustelidae) based on mitochondrial cytochrome b sequences". Journal of Zoology 246 (4): 401–416. doi:10.1111/j.1469-7998.1998.tb00172.x. 
  8. ^ "Otter". National Park Service. 2006-07-26. Retrieved 2009-01-15. 
  9. ^ a b c d e f g h i j k l m n o p q r s t u v w x y z aa ab ac ad ae af ag ah ai Larivière, Serge; Lyle R. Walton (1998). "Lontra canadensis" (PDF). Mammalian Species (587): 1–8. Retrieved 2009-01-15. 
  10. ^ Larivière, Serge (2002). "Lutra maculicollis" (PDF). Mammalian Species (712): 1–6. doi:10.1644/1545-1410(2002)712<0001:LM>2.0.CO;2. Retrieved 2009-01-15. 
  11. ^ Wilson, D. E.; Reeder, D. M., eds. (2005). Mammal Species of the World (3rd ed.). Johns Hopkins University Press. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  12. ^ a b c d e "North American River Otter". National Geographic Society. Retrieved 2008-12-24. 
  13. ^ Hill, Edward P. River Otters. Internet Center for Wildlife Damage Management
  14. ^ American Natural History, by John Davidson Godman, published by Hogan & Thompson, 1836
  15. ^ a b c d e f Dewey, Tanya; E. Ellis (2003). "Lontra canadensis". Animal Diversity Web. Retrieved 2008-11-17. 
  16. ^ "Lontra canadensis". Mammals of Wisconsin Database. uwsp.edu. Retrieved 20 Nov 2013. 
  17. ^ "River Otter - Scientific name Lontra canadensis". Fur Hunting and Trapping in Illinois. dnr.state.il.us. Retrieved 20 Nov 2013. 
  18. ^ a b c d e f g h Melquist, W.E.; M.G. Hornocker (1983). "Ecology of river otters in west central Idaho". Wildlife Monographs 83: 1–60. 
  19. ^ Video on YouTube
  20. ^ a b c d Erlinge, Sam (1968). "Food studies on captive otters Lutra lutra L". Oikos 19 (2): 259–270. doi:10.2307/3565013. JSTOR 3565013. 
  21. ^ a b c d Route, W.T.; Peterson, R.O. (1988). Distribution and abundance of river otter in Voyageurs National Park, Minnesota. Resource Management Report MWR-10. National Park Service. 
  22. ^ a b c d e f Melquist, W.E.; A.E. Dronkert (1987). "River otter". Wild Furbearer Management and Conservation in North America (M. Novak, J.A. Baker, M.E. Obbard, and B. Malloch ed.). Toronto, Canada: Ontario Ministry of Natural Resources. pp. 626–641. 
  23. ^ a b c Larsen, D.N. (1984). "Feeding habits of river otters in coastal southeastern Alaska". Journal of Wildlife Management 48 (4): 1446–1452. doi:10.2307/3801818. 
  24. ^ a b c d e f g h Toweill, D.E.; J.E. Tabor (1982). "The Northern River Otter Lutra canadensis (Schreber)". Wild mammals of North America (J.A. Chapman and G.A. Feldhamer ed.). Baltimore, Maryland: Johns Hopkins University Press. 
  25. ^ a b c d e f g h i j Toweill, D.E. (1974). "Winter food habits of river otters in western Oregon". Journal of Wildlife Management 38 (1): 107–111. doi:10.2307/3800205. 
  26. ^ a b c d e f g h i j Reid, D.G.; T.E. Code, A.C.H. Reid, S.M. Herrero (1994). "Food habits of the river otter in a boreal ecosystem". Canadian Journal of Zoology 72 (7): 1306–1313. doi:10.1139/z94-174. 
  27. ^ Grenfell, William E., Jr. (1974). Food habits of the river otter in Suisun Marsh, Central California (PDF). California State University. Retrieved 2009-01-14. 
  28. ^ a b c d e f g Serfass, T.L.; L.M. Rymon, R.P. Brooks (1990). "Feeding relationships of river otters in northeastern Pennsylvania". Transactions of the Northeast Section of the Wildlife Society (47): 43–53. 
  29. ^ a b Boyle, Steve (2006). North American River Otter (Lontra canadensis): a technical conservation assessment (PDF). USDA Forest Service, Rocky Mountain Region. Retrieved 2009-01-14. 
  30. ^ Hansen, Heidi, et al. "Social Networks and the Formation and Maintenance of River Otter Groups." Ethology 115.4 (2009): 384-396
  31. ^ north american river otter. Conservenature.org. Retrieved on 2013-01-09.
  32. ^ Ware, George W. (2001). Reviews of Environmental Contamination and Toxicology. Springer. ISBN 0-387-95137-7. 
  33. ^ Orr, Eric (2007). "North American River Otter". Chattooga River Conservancy. Retrieved 2008-12-30. 
  34. ^ Colorado Otters May No Longer Need Protection. CBS4denver.com (2010-07-17)
  35. ^ Fimrite, Peter (2013-01-04) S.F.'s only river otter at Sutro Baths. SFGate
  36. ^ John S. Newberry (1857). Reports on the geology, botany, and zoology of northern California and Oregon made to the war Department. Harvard University. p. 43. Retrieved 2010-12-18. 
  37. ^ a b c d e f Berg, Judith (1999). Final report of the river otter research project on the Upper Colorado River Basin in and adjacent to Rocky Mountain National Park, Colorado (PDF). National Park Service: Rocky Mountain National Park, West Unit. Retrieved 2009-01-14. 
  38. ^ Noordhuis, R. (2002). "The river otter (Lontra canadensis) in Clarke County (Georgia, USA): survey, food habits, and environmental factors". IUCN Otter Specialist Group Bulletin 19 (2): 75–86. 
  39. ^ a b c d Tumlison, R.; M. Karnes (1987). "Seasonal changes in food habits of river otters in southwestern Arkansas beaver swamps". Mammalia 51 (2): 225–232. doi:10.1515/mamm.1987.51.2.225. 
  40. ^ Field, R.J. (1970). "Winter habits of the river otter (Lutra canadensis) in Michigan". Michigan Academician (3): 49–58. 
  41. ^ Green, H.U. (1932). "Observations on the occurrence of otter in the Riding Mountain National Park, Manitoba, in relation to beaver life". Canadian Field-Naturalist 46: 204–206. 
  42. ^ Gilbert, F.F.; E.G. Nancekivell (1982). "Food habits of mink (Mustela vison) and otter (Lutra canadensis) in northeastern Alberta". Canadian Journal of Zoology 60. pp. 1282–1288. 
  43. ^ Duplaix, Nicole; Joseph Davis. "Lutra canadensis" (PDF). Management Authority of the United Kingdom. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Retrieved 2008-12-27. 
  44. ^ "The CITES Appendices". Convention on International Trade in Endangered Species of Wild Fauna and Flora. Archived from the original on 2008-12-23. Retrieved 2008-12-27. 

Further reading[edit]

  • Hans Kruuk (2006). Otters: ecology, behaviour and conservation. Oxford: Oxford University Press. ISBN 0-19-856586-0.  Recent monograph on otters in general, with many references to the river otter.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Common Names

northern river otter
river otter
Canadian otter
land otter
fish otter

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The currently accepted scientific name for the northern river otter is Lutra
canadensis Schreber. (Lutrinae). Nineteen subspecies have been
recognized by Hall and Kelson [10] and are listed below:

Lutra canadensis ssp. canadensis Schreber
Lutra canadensis ssp. brevipilosus Grinnell
Lutra canadensis ssp. chimo Anderson
Lutra canadensis ssp. degener Bangs
Lutra canadensis ssp. evexa Goldman
Lutra canadensis ssp. extera Goldman
Lutra canadensis ssp. interior Swenk
Lutra canadensis ssp. kodiacensis Goldman
Lutra canadensis ssp. lataxina F. Cuvier
Lutra canadensis ssp. nexa Goldman
Lutra canadensis ssp. optiva Goldman
Lutra canadensis ssp. pacifica Rhoads
Lutra canadensis ssp. periclyzomae Elliot
Lutra canadensis ssp. preblei Goldman
Lutra canadensis ssp. sonora Rhoads
Lutra canadensis ssp. texensis Goldman
Lutra canadensis ssp. vaga Bangs
Lutra canadensis ssp. vancouverensis Goldman
Lutra canadensis ssp. yukonensis Goldman

A taxonomic revision of the Lutrinae was done by van Zyll de Jong, who
recommended consolidating the above nineteen subspecies and the Prince
of Wales Island form (Lutra mira Goldman) into seven subspecies of Lutra
canadensis, but leaving the southern river otter (Lutra annectens) as a
separate species [4].
  • 4. Chapman, Joseph A.; Feldhamer, George A., eds. 1982. Wild mammals of North America. Baltimore, MD: The Johns Hopkins University Press. 1147 p. [21085]
  • 10. Hall, E. Raymond; Kelson, Keith R. 1959. The mammals of North America, Volume II. New York: The Ronald Press Company. 79 p. [21460]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Formerly included in the genus Lutra. Van Zyll de Jong (1987) used the generic name Lontra for New World otters; this is appropriate if New World otters are more closely related to Aonyx otters of Africa than to Lutra otters of Eurasia and Africa. Jones et al. (1997) and Wozencraft (in Wilson and Reeder 1993, 2005) followed van Zyll de Jong in using Lontra as the generic name. Rice (1998) retained this species in the genus Lutra. Bininda-Emonds et al. 1999) supported the separation of New World otters (except Pteronura) into Lontra.

Patterns of genetic variation do not concur with current subspecific designations (Serfass et al. (1998), and numerous translocations have crossed subspecies' range boundaries; hence the use of subspecific names is not meaningful in many cases.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!