Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

Description

The Sea Otter is the largest member of family Mustelidae, and the smallest marine mammal. Sea Otters are more aquatic even than seals and sea lions, because they mate and give birth in the water. They are tool users, using rocks to pound open hard-shelled prey, such as abalone. Once hunted almost to extinction for their fur, but now protected, they have made a comeback. This has stirred controversy where their predation on abalone, crabs, clams, and sea urchins affects shellfisheries. Ecologists are beginning to understand the larger, long-term role they play in shaping the marine environment, by eating creatures such as sea urchins. Sea urchins feed on and if unchecked, can destroy kelp. Vast underwater kelp forests are at the base of the coastal food web and also provide shelter for countless organisms.

Adaptation: In the sea otter (Enhydra lutris), adaptations to crushing marine invertebrates mark the skull through its powerful chewing muscles, which leave muscles scars in the form of raised ridges of bone and a rough surface texture. Note also the large, flat cheek teeth.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the sea otter  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:45, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Highly aquatic, the sea otter rarely comes ashore, both resting and feeding in coastal waters. Alaskan sea otters are more at home out of the water than their Californian relatives, often hauling out on sandbars and ice (8). Otters have a high metabolic rate (9) and these resourceful, opportunistic predators need to consume 25 percent of their body weight a day (6). Diving to depths of up to 75 metres they retrieve invertebrates such as mussels, snails, crabs and urchins from the seabed (6). Pouches of skin at the armpit of each forelimb can be used to store food whilst it is carried to the surface (6). Otters float on their backs, using their chest as a table whilst they attempt to prize open the shells. Sometimes rocks are used to smash open the hard shells and sea otters are one of the only mammals (apart from primates) to have developed tool use (6). Sea otters are considered a 'keystone species' in some parts of their range, as they appear to be vital in the maintenance of kelp forest ecosystems by suppressing the number of sea urchins that would otherwise overgraze the forests (4). These gregarious creatures can be found in large same-sex groups known as 'rafts'. Rafts in California rarely exceed 50 individuals but in Alaska, where the population density is higher, up to 2,000 otters can gather (2). Sea otters probably spend more time and energy grooming their fur that any other mammal; an important activity required to maintain the insulation of their fur, as it cleans and replenishes air to the under fur (4). Grooming involves rubbing, rolling and blowing air into the fur (4). Trapped air in the under fur is heated by the body to provide insulation and gives otters a silvery appearance underwater (5). Sea otters are polygynous, with adult males generally defending territories that encompass the ranges of several females (2) (4). While mating, the male will grip the female's nose with his teeth and she is often left with a bloody souvenir of their encounter (4). Females usually give birth to a single pup and carry them on their chest, nursing them and grooming them meticulously to ensure the fur remains buoyant and insulated (9). Young pups are left on the surface whilst their mother dives for food, but as they mature they follow her, learning to forage by watching her technique (5). Pups will stay with their mother for around three to six moths (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

Description

The sea otter, the smallest marine mammal in the world, is well adapted for its predominately aquatic lifestyle, possessing a strong, rudder-like tail and large hind-feet that act as flippers (2). Unlike other marine mammals, sea otters do not have blubber and instead rely on their fur to keep warm in the water (4); their reddish-brown coat is the densest of any mammal, consisting of around 100,000 hairs per cm² (2). The natural oils produced by the fur provide a waterproof quality (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Distribution

Sea otters, Enhydra lutris, are found in two geographic regions on the Pacific Coast: along the Kuril and Commander Islands off the coast of Russia, the Aleutian Islands below the Bering Sea, and the coastal waters off the Alaskan Peninsula to Vancouver Island, Canada; and along the central California coast from Ano Nuevo to Point Sur.

Sea ice limits their northern range to below 57 degrees N lattitude, and the distribution of kelp forests limits the southern range to about 22 degrees N lattitude. Hunting during the 18th and 19th centuries greatly reduced the distribution of sea otters.

Three subspecies of E. lutris are recognized today. Enhydra lutris lutris ranges from the Kuril Islands north to the commander islands in the western pacific. Enhydra lutris nereis is found off the coast of central California. Enhydra lutris kenyoni is distributed throughout the Aleutian Islands and southern Alaska, and has been reintroduced to various locations from south of Prince William Sound, Alaska to Oregon.

Biogeographic Regions: nearctic (Native ); pacific ocean (Native )

  • Estes, J. 1980. Enhydra lutris. Mammalian Species, 133: 1-8.
  • Lockwood, S. 2006. Sea Otters. Minnesota: Chanhassen.
  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore and London: John Hopkin's University Press.
  • Wilson, D., M. Bogan, R. Brownell, Jr., A. Burdin, M. Maminov. 1991. Geographic variation in sea otters, Enhydra lutris. Journal of Mammalogy, 72: 22-36.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Historically, Sea Otters occurred across the North Pacific Rim, ranging from Hokkaido, Japan, through the Kuril Islands, the Kamchatka Peninsula, the Commander Islands, the Aleutian Islands, peninsular and south coastal Alaska and south to Baja California, Mexico (Kenyon 1969). In the early 1700s, the worldwide population was estimated to be between 150,000 (Kenyon 1969) and 300,000 individuals (Johnson 1982). Although it appears that harvests periodically led to local reductions of Sea Otters (Simenstad et al. 1978), the species remained abundant throughout its range until the mid-1700s. Following the arrival in Alaska of Russian explorers in 1741, extensive commercial harvest of Sea Otters over the next 150 years resulted in the near extirpation of the species. When Sea Otters were afforded protection by the International Fur Seal Treaty in 1911, probably fewer than 2,000 animals remained in 13 remnant colonies (Kenyon 1969). Remnant populations were located in the Kuril Islands, Kamchatka and in the Commander Islands Russia; five in Southwestern Alaska (the Aleutian Islands, Alaska Peninsula, and Kodiak Island), and one remnant population in each of the following regions; Southcentral Alaska (Prince William Sound), Canada (Queen Charlotte Islands), central California, and Mexico (San Benito Islands) (Estes 1980). However, the Queen Charlotte, Canada and San Benito Island, Mexico remnant Sea Otter populations have presumably died out and likely did not contribute to the recolonization of the species following near extirpation (Kenyon 1969).

In north America, the Sea Ottes range is fairly continuous from the Aleutian Islands to Prince William Sound with population gaps along the Gulf of Alaska until Yakutat (which was a translocated population) with another gap in the population’s distribution until the outer islands of Southeast Alaska (also a translocated population form the Aleutian Islands and Prince William Sound). The next gap in the Sea Otter population distribution is between Southeast Alaska and British Columbia, Canada. Translocation efforts were successful in Washington State but not in Oregon thus there is a large population gap between the small Sea Otter population in Washington and that of central California.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Nearshore waters of the Northern Pacific Ocean. Subspecies lutris: northwestern Pacific, from the Kiritappu Peninsula of eastern Hokkaido Island (formerly) and Kurile Islands to Commander Islands. Subspecies kenyoni: Aleutian Islands, southern Alaska, British Columbia, and Washington; extirpated and later reintroduced in southeastern Alaska, British Columbia, and Washington; extirpated and unsuccessfully reintroduced in the Pribilof Islands and Oregon. Subspecies nereis: California coast, mainly from Santa Cruz to Pismo Beach; formerly south to Morro Hermoso, Baja California, and throughout the Channel Islands; recently reintroduced to San Nicolas Island; see Rodriguez-Jaramillo and Gendron (1996) for an occurrence off southern Baja California. See Gallo-Reynoso and Rathbun (1997) for a discussion of possible occurrences off Baja California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Historically, the sea otter was found in coastal areas throughout the North Pacific (6). Sea otters can still be found in much of this former range although numbers are greatly reduced and populations fragmented (6). Three subspecies are currently recognised: the southern, or California sea otter (Enhydra lutris nereis), occurs from California to Mexico; the northern, or Alaskan sea otter (E. l. kenyoni), is found along the northwest coast of North America and into Alaska; and the Russian sea otter (E. l. lutris) occurs in the western north Pacific (7). Alaska plays host to possibly as much as 90 percent of the world population of this species (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Alaskan sea otters are slightly larger than Californian otters. Adult male Alaskan otters weigh 27 to 39 kg, while females weigh 16 to 27 kg. Adult male California sea otters average 29 kg in mass, while females average 20 kg. Individuals can weigh as much as 45 kg. Males measure 1.2 to 1.5 m in length, while females measure 1 to 1.4 m. The tail comprises less than a third of the body length, measuring 25 to 35 cm.

The pelage is brown or reddish brown. The fur consists of two layers: a dark undercoat and longer, lighter-colored guard hairs, which trap a layer of air next to the skin to keep it dry. Sea otter fur is the densest of all mammals, with about 100,000 hairs per square centimeter. Because sea otters do not have any insulating fat, the fur is responsible for heat maintenance.

Sea otters have circular, furry faces with short noses, rounded eyes and ears, and long whiskers that assist in foraging for food. The hind legs are long and the paws are broad, flat and webbed. The forelimbs are short and have retractable claws, which help with grooming and eating. Sea otters have patches of loose skin under the forearms that they use to help store tools (usually a rock) so they can have free “hands” while eating, and to transport food during diving. Sea otters are the only carnivores with just 4 lower incisors. Females have two mammae.

Range mass: 14 to 45 kg.

Range length: 1 to 1.5 m.

Sexual Dimorphism: male larger

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 98.479 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 150 cm

Weight: 35000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: 1,260-1,450 mm males; 1,070-1,400 mm females

Weight:
Range: 18-45 kg males; 11-33 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from pinnipeds in longer tail and much smaller forelimbs that are not flipperlike. Differs from the river otter in shorter tail and flipperlike hind feet. This is the only carnivore with 2 pairs of lower incisors (all others have 3 pairs).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sea otters inhabit temperate coastal waters with rocky or soft sediment ocean bottom. They live in offshore forests of giant kelp (Macrocystis pyrifera), and spend most of their active time foraging below the canopy. They eat, rest, and groom themselves at the water surface. While sea otters are capable of diving to depths of at least 45 meters, they prefer coastal waters up to 30 meters deep. The shallower the water, the less time is spent diving to reach food.

Range depth: 45 to 0 m.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: coastal

Other Habitat Features: intertidal or littoral

  • Paine, S. 1993. The World of the Sea Otter. San Francisco: Sierra Club.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

Throughout their range, Sea Otters use a variety of near shore marine environments and 84% of foraging occurs in water ≤ 30m in depth (Bodkin et al. 2004) and throughout much of their range, foraging occurs within a kilometer of the shore. Their classic association is with rocky substrates supporting kelp beds, but they also frequent soft-sediment areas where kelp is absent (Riedman and Estes 1990, DeMaster et al. 1996, Burn and Doroff 2005). Kelp canopy is an important habitat component, used for foraging and resting (Riedman and Estes 1990). They are found most often in areas with protection from the most severe ocean winds, such as rocky coastlines, thick kelp forests, and barrier reefs. Although they are most strongly associated with rocky substrates, Sea Otters can also live in areas where the sea floor consists primarily of mud, sand, or silt. Individuals generally occupy a home range a few kilometers long, and remain there year-round. Sea Otters forage in rocky and soft-sediment communities on or near the ocean floor. The maximum confirmed depth of dive was 97 m (Newby 1975); however recent studies using time-depth recorders implanted in Sea Otters indicate average maximum forage depths of 54 m for female and 82m for male Sea Otters (Bodkin et al. 2004).

Sea Otters are weakly territorial (Kenyon 1969) with fighting and aggression rare (Loughlin 1980). Only adult male Sea Otters establish territories. Males patrol territorial boundaries and attempt to exclude other adult males from the area. Females move freely between and among male territories. Groups of male and female Sea Otters generally rest separately. Sea Otter annual home ranges can occupy up to 0.8 km² (80 ha) and extend along 16 km of coastline (Kenyon 1969, Loughlin 1980). Typically, female Sea Otter home ranges are about 1.5–2 times larger than resident adult males during the breeding season; however, females have smaller annual or lifetime home ranges than males (Riedman and Estes 1990). Jameson (1989) found that territorial adult males occupied a mean home range of 40.3 ha during the summer-fall period (when home range size was considered equal to territory size); and mean coastline length was 1.1 km. Winter-spring mean home range size of territorial adult males that remained in female areas was 78.0 ha, with a mean coastline length of 2.16 km.

The diet of Sea Otter consists almost exclusively of marine invertebrates, including sea urchins, a variety of bivalves such as clams and mussels, abalone, other molluscs, crustaceans, and snails. Its prey ranges in size from tiny limpets crabs and giant octopuses (Estes 1980). Sea urchins, abalones and rock crabs are the principal prey of Sea Otters in newly reoccupied habitats of central California (Vandevere, 1969) whereas clams and crab will make up the diet in soft-sediment habitats (Kvitek et al. 1992, Doroff and DeGange 1994). Where prey such as sea urchins, clams, and abalone are present in a range of sizes, Sea Otters tend to select larger items over smaller ones of similar type (Kvitek et al. 1992). In California, it has been noted that Sea Otters ignore Pismo clams smaller than 3 inches (7 cm) across. Only in the Aleutian archipelago were Sea Otters observed to regularly eat fish, which could comprise up to 50% of their diet. The fish species eaten were usually bottom dwelling and sedentary or sluggish forms, such as the Red Irish Lord and Globefish (Estes 1980). They also consume crab, clam, mussels, turban snails, sea cucumbers, squid, octopus, chitons, tubeworms, large barnacles, scallops, and sea stars (Wild and Ames 1974, Riedman and Estes 1990). Bivalve molluscs are excavated by digging in sand or mud bottoms and are the most common prey in soft-sediment communities (Calkins 1978, Kvitek et al. 1992, Doroff and DeGange 1994).

Male Sea Otters reach sexual maturity around age five or six, but probably do not become territorial or reproductively successful for two or three subsequent years (Riedman and Estes 1990). Most female Sea Otters are sexually mature at age four or five (Kenyon 1969, Jameson and Johnson 1993, Monson et al. 2000, Monson and DeGange 1995, von Biela 2007). Sea Otters apparently are polygynous, although the exact nature of the mating system may vary. Females normally give birth to a single pup that weighs 1.4 to 2.3 kg at birth (Riedman and Estes 1990). Twinning has been documented in Sea Otters (Williams et al. 1980); however, litters larger than one are rare, and when they occur, neither pup is likely to survive (Jameson and Bodkin 1986). Pups remain dependent upon their mothers for about six months (Jameson and Johnson 1993). Longevity in Sea Otters is estimated to be 15 to 20 years for females and 10 to 15 years for males (Riedman and Estes 1990).


Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters usually within 2 km of shore, especially shallows with kelp beds and abundant shellfish. In rough weather, takes refuge among kelp, or in coves and inlets. Often comes ashore in Alaska, rarely does so in California. In California, juvenile males spend little time in near-shore kelp beds; often remain far offshore (Siniff and Ralls (1988). In California, young are born in the water or on land; births may usually occur ashore in Alaska.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

shallow, nearshore waters
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2071 specimens in 2 taxa.
Water temperature and chemistry ranges based on 78 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 3.977 - 13.353
  Nitrate (umol/L): 3.951 - 6.975
  Salinity (PPS): 31.536 - 33.310
  Oxygen (ml/l): 6.095 - 7.514
  Phosphate (umol/l): 0.674 - 1.024
  Silicate (umol/l): 5.723 - 20.291

Graphical representation

Temperature range (°C): 3.977 - 13.353

Nitrate (umol/L): 3.951 - 6.975

Salinity (PPS): 31.536 - 33.310

Oxygen (ml/l): 6.095 - 7.514

Phosphate (umol/l): 0.674 - 1.024

Silicate (umol/l): 5.723 - 20.291
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Sea otters inhabit near-shore rocky or soft-bottom coastal waters, and in California are particularly associated with dense kelp forests (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal movements occur among some age-sex classes in certain areas (Riedman and Estes 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Sea otters are carnivorous. They will eat nearly any fish or marine invertebrate they can find in their kelp forest foraging grounds. Their diet consists of marine invertebrate herbivores and filter feeders such as sea urchins (Strongylocentrotus purpuratus and Strongylocentrotus franciscanus), sea stars (Pisaster ochraceus), limpets (Diodora aspera), coast mussels (Mytilus edulis), chitons (Katharina tunicata), and purple-hinged rock scallops (Crassadoma gigantea). Otters also eat crabs, octopus, squid, and fish. Individuals tend to be specialized in their choice of prey; one otter may consume only urchins and crabs while another may eat mostly fish, depending on the abilities of the individual and local food availability. Otters consume 20 to 25% of their body weight each day. They obtain most of their water from prey but also drink seawater to satisfy thirst.

Sea otters commonly feed in small groups. Hunting occurs on the sea floor. They use their sensitive whiskers to locate small creatures in the dense kelp beds and crevices. They use their small, agile forepaws to capture prey and to rub, roll, twist, and pull apart prey. Sea otters collect invertebrates in loose folds of skin under their armpits and eat at the surface. The feeding process, including foraging, eating, and cleaning their fur after a meal, lasts 2 to 3 hours. Sea otters usually eat 3 to 4 times a day.

Sea otters break open prey items with hard shells or exoskeletons with a rock. Some otters hold the rock on their chest and drive the prey into the rocks. Others leave the prey on their chests and hit the prey with the rocks. The same rock is kept for many dives. Otters often wash their prey by holding it against their body and turning in the water. Males steal from females if they get a chance. For this reason, females tend to forage in separate areas.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet varies according to location; often dominated by benthic invertebrates. Sea urchins, crabs, and a variety of molluscs are principal foods, but fish are important food items at high population densities. Forages usually at depths of less than 20 m. Uses rocks or other hard objects as tools to break exoskeletons of invertebrate prey. Diets and patterns of foraging behavior may be highly individualized (Riedman and Estes 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Sea otters are vital to the overall health and diversity of the kelp forest ecosystem. They are considered a keystone species and play a major role in the community by controlling herbivorous invertebrates. Sea otters prey on sea urchins, thereby preventing sea urchins from overgrazing the kelp forest. This allows the kelp forest to thrive and contributes to an increase in marine diversity. The variety in the sea otter diet reduces competition between benthic grazers and supports greater diversity in those species. The presence of sea otters is believed to be important in the evolution of kelp forest ecosystems.

Two apicomplexan protozoan parasites, Sarcosystis neurona and Toxoplasma gondii infect the sea otter causing encephalitis. An acanthocephalen worm (Profilicollis) has also been linked to mortality and decline in the population.

Ecosystem Impact: keystone species

Commensal/Parasitic Species:

  • Estes, J., N. Smith, J. Palmisano. 1978. Sea otter predation and community organization in the western Aleutian Islands, Alaska. Ecology, 59: 822-833.
  • Estes, J., J. Palmisano. 1974. Sea otters: their role in structuring nearshore communities. Science, 185: 1058-1060.
  • Estes, J., D. Duggins. 1995. Sea otters and kelp forests in Alaska: generality and variation in a communtiy ecological paradigm. Ecological Monographs, 65: 75-100.
  • Jessup, D., M. Harris, C. Kreuder, J. Ames, P. Conrad, M. Miller. 2004. Southern Sea Otter as a Sentinel of Marine Ecosystem Health. EcoHealth, 1(3): 239-245.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great white sharks (Carcharodon carcharias) are one of the primary predators of sea otters. Otters are occasionally eaten by coyotes (Canis lantrans) after taking refuge on the sand during stormy weather. Young pups left alone on the surface while their mothers feed beneath the surface are preyed upon by bald eagles (Haliaeetus leucocephalus). It was once thought that killer whales Orcinus orca were responsible for declines in the sea otter population in Alaska, but evidence is inconclusive.

Known Predators:

Anti-predator Adaptations: cryptic

  • Estes, J., M. Tinker, D. Doak. 1998. Killer whale predation on sea otters linking oceanic and nearshore ecosystems. Science, 282: 473-476.
  • Kuker, K., L. Barrett-Lennard. 2010. A re-evaluation of the role of killer whales Orcinus orca in a population decline of sea otters Enhydra lutris in the Aleutian Islands and a review of alternative hypotheses. Mammal Review, 40(2): 103-24.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Enhydra lutris is prey of:
Homo sapiens
Carcharodon carcharias
Haliaeetus leucocephalus
Orcinus orca
Zalophus californianus

Based on studies in:
USA: Alaska, Aleutian Islands (Coastal)

This list may not be complete but is based on published studies.
  • C. A. Simenstad, J. A. Estes, K. W. Kenyon, Aleuts, sea otters, and alternate stable-state communities, Science 200:403-411, from p. 404 (1978).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Enhydra lutris preys on:
Echinoidea
Decapoda
Actinopterygii
Tivela stultorum
Polinices
non-insect arthropods
marine invertebrates
Mollusca
Echinodermata
Crustacea
Castor canadensis

Based on studies in:
USA: Alaska, Aleutian Islands (Coastal)
USA: California (Coastal)

This list may not be complete but is based on published studies.
  • C. A. Simenstad, J. A. Estes, K. W. Kenyon, Aleuts, sea otters, and alternate stable-state communities, Science 200:403-411, from p. 404 (1978).
  • J. W. Nybakken, Marine Biology: An Ecological Approach (Harper and Row, New York, 1982), from p. 242.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Estimates from the mid- to late 1980s suggested populations of 6000-7000 in the Kuril Islands, 2000-2500 in the Commander Islands, and 2500-3000 off Kamchatka, giving a total western Pacific population of 10,500-12,500 (Riedman and Estes 1990, Reeves et al. 1992). In the 1980s, the total population from Prince William Sound to the Kuril Islands was about 150,000 (Riedman 1990). For the Aleutian Islands, the minimal population estimate was 8,742 sea otters in 2000 (Doroff et al. 2003).

Alaska had 100,000-150,000 in the mid- to late 1980s (Reeves et al. 1992), and the current population probably also is in this range (USFWS 1995 stock assessment). Prince William Sound population in late 1980s was about 14,000, of which an estimated 2800 were killed as a result of the Exxon Valdez oil spill (Raloff 1993). From an original 402 individuals translocated in the 1960s, the population in southeastern Alaska increased to more than 3500 in five populations by 1987 (Reeves et al. 1992); 1988 estimate was 4520 (See Riedman and Estes 1990).

In 1984, the population off west coast of Vancouver Island, British Columbia, was 345 (descended from 89 that were translocated from Alaska, 1969-1972) (MacAskie 1986); 1987 count was 380 (see Riedman and Estes 1990). In 1995, the minimum number along the coast of British Columbia was 1522, including 135 near Goose Island (Watson et al. 1997).

Otters were transplanted from Alaska to Washington in 1969 and 1970; population increased from 36 to 94 between 1981 and 1987 (Matthews and Moseley 1990); 211 were counted in Washington in July 1989 (Jameson, in Riedman and Estes 1990, Reeves et al. 1992).

See also record for subspecies nereis of California (about 2,505 individuals in 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Keystone predator; often limits prey populations; predation on herbivores determines structure of off-shore kelp communities (e.g., Estes et al. 1989).

Males defend contiguous territories from which they exclude other males (Riedman and Estes 1990).

Males may move up to 30-60 miles along coast, females generally stay within area 5-10 miles long. Daily movements generally encompass a few kilometers (Riedman and Estes 1990). Ralls et al. (1996) found that otters in California usually were within 1-2 km of their location on the previous day but often stayed in one place for an extended period then suddenly moved a much greater distance; the area used by individual otters during a single 24-hour period was 7-1166 ha.

Undisturbed populations can increase at about 17-20%/year, although the central California population never has increased at more than 5-7%/year (Riedman and Estes 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Sea otters communicate through body contact and vocalizations, although they are not overly vocal. Researchers have recognized nine vocalizations. Pups use squeals to communicate with their mothers. Other calls include coos, whines, distress screams, growls, snarls, and whistles. Scent is important in recognition and surveying physiological states. Each sea otter has its own distinct scent that conveys identity, age, and sex.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Foraging occurs throughout the day and night, with periodic resting in between feeding bouts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The maximum estimated lifespan of sea otters is 23 years in the wild.

Typical lifespan

Status: wild:
23 (high) years.

Average lifespan

Sex: male

Status: captivity:
19.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: There is a delayed implantation and the total gestation time varies from 4 to 12 months. The actual embryonic development takes about 4-5.5 months (Ronald Nowak 2003). It has been suggested that longevity in the wild may be as high as 30 years (Bernhard Grzimek 1990), which is dubious. One wild born female was about 27 years old when she died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Sea otters are polygynous, with males having multiple female partners throughout the year. Many males actively defend territories. Disputes are usually settled with splashing and vocal displays, and fighting is rare. Males mate with females that inhabit their territory. If no territory is established, they seek out females in estrus. When a male sea otter finds a receptive female, the two engage in playful and sometimes aggressive behavior. They bond for the duration of estrus, or 3 days. The male holds the female's head or nose with his jaws during copulation. Visible scars are often present on females from this behavior.

Mating System: polygynous

Sea otters can reproduce year round. There are peaks of birth in May to June in the Aleutian Islands and in January to March in California. Sea otters are one of several species of mammals that undergo delayed implantation in which the embryo does not implant during the immediate period following fertilization, but remains in a state of suspended growth allowing for birth to occur under favorable conditions. Delayed implantation produces varied gestation times, which has been reported as 4 to 12 months. Females usually give birth about once a year, though many females experience longer breeding intervals, giving birth every 2 years. If a pup does not survive, the mother may experience postpartum estrus.

Orientation of the fetus may be either caudal or cephalic, although cephalic orientation is more common near birth. A single pup is born weighing 1.4 to 2.3 kg. Twins occur in 2% of births, but only one pup can be raised successfully. Pups typically remain with their mother for 5 to 6 months after birth. Females reach sexual maturity at 4 years of age. Males reach sexual maturity at 5 to 6 years, but may not mate until much later.

Breeding interval: Sea otters breed once every 1 or 2 years.

Breeding season: Sea otters breed year round.

Range number of offspring: 1 to 2.

Average number of offspring: 1.

Range gestation period: 4 to 12 months.

Average gestation period: 6 months.

Average weaning age: 6 months.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Range age at sexual or reproductive maturity (male): 5 to 8 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous ; delayed implantation ; post-partum estrous

Average birth mass: 1868 g.

Average number of offspring: 1.

Male sea otters do not provide any care to their offspring. Pups are weaned at around 6 months of age but start to eat solid foods shortly after birth. Females carry their pups on their bellies while they nurse. Their milk is 20 to 25% fat. While a mother is foraging, she wraps her pup in kelp at the water surface to keep it from drifting away. At any sign of a predator, the female clamps onto her pup’s neck with her mouth and dives. Females groom their pups extensively for 3 months as their coat develops. A pup’s coat traps air, which keeps the animal afloat. Pups start diving at 2 months of age. The pup remains dependent on the mother for about 6 to 8 months.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents

  • Estes, J. 1980. Enhydra lutris. Mammalian Species, 133: 1-8.
  • McShane, L., J. Estes, M. Riedman, M. Staedler. 1995. Repertiore, structure, and individual variation of vocalizations in the sea otter. Journal of Mammalogy, 76: 414-427.
  • Riedman, M., J. Estes, M. Staedler, A. Giles, D. Carlson. 1994. Breeding Patterns and reproductive success of California sea otters. Journal of Wildlife Management, 58: 391-399.
  • Lockwood, S. 2006. Sea Otters. Minnesota: Chanhassen.
  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore and London: John Hopkin's University Press.
  • OceanLink, 2011. "Sea Otters" (On-line). OceanLink - Marine Sciences Education and Fun. Accessed December 01, 2011 at http://www.oceanlink.info/biodiversity/otter/otter.html.
  • Paine, S. 1993. The World of the Sea Otter. San Francisco: Sierra Club.
  • SeaWorld Parks & Entertainment, 2011. "Otters" (On-line). SeaWorld/Busch Gardens ANIMALS. Accessed November 15, 2011 at http://www.seaworld.org/animal-info/info-books/otters/index.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Strongly polygynous. Reproduction is weakly seasonal. Births in spring and summer with peak in early summer in Alaska (late May in Prince William Sound); peak December-March (generally late winter) in California. Implantation delayed, gestation about 8-9 months in Alaska, about 4-6 months in California. Young dependent on mother for about 6-7 months in California, 76-333 days (average 170) in Prince William Sound, Alaska. In California, adult females generally give birth to 1 pup every year; females in some areas of Alaska give birth every other year. In California, females sexually mature usually in 3-5 years. In Alaska, 30% of females were sexually mature at age 2, 100% by age 5; annual reproductive rates increased from 22% at age 2 to 78% at age 5 and remained relatively stable (75-88%) through age 15 (Bodkin et al. 1993). Commonly lives 10-15 years; maximum known ages are 23 years for females and 18 years for males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Teeth are resilient: sea otter
 

Teeth of sea otters resist damage due to 'stress shielding' by neighbors, prism interweaving (decussation), and self-healing.

     
  "Tooth enamel is inherently weak, with fracture toughness comparable with glass, yet it is remarkably resilient, surviving millions of functional contacts over a lifetime. We propose a microstructural mechanism of damage resistance, based on observations from ex situ loading of human and sea otter molars (teeth with strikingly similar structural features). Section views of the enamel implicate tufts, hypomineralized crack-like defects at the enamel–dentin junction, as primary fracture sources. We report a stabilization in the evolution of these defects, by 'stress shielding' from neighbors, by inhibition of ensuing crack extension from prism interweaving (decussation), and by self-healing. These factors, coupled with the capacity of the tooth configuration to limit the generation of tensile stresses in largely compressive biting, explain how teeth may absorb considerable damage over time without catastrophic failure, an outcome with strong implications concerning the adaptation of animal species to diet." (Chai et al. 2009:7289)

"Teeth are made from an extremely sophisticated composite material which reacts in an extraordinary way under pressure," says Prof. Chai. "Teeth exhibit graded mechanical properties and a cathedral-like geometry, and over time they develop a network of micro-cracks which help diffuse stress. This, and the tooth's built-in ability to heal the micro-cracks over time, prevents it from fracturing into large pieces when we eat hard food, like nuts." (Dr. Herzl Chai, Tel Aviv University's School of Mechanical Engineering)
  Learn more about this functional adaptation.
  • Chai, H; Lee, JJ-W; Constantino, PJ; Lucas, PW; Lawn, BR. 2009. Remarkable resilience of teeth. Proceedings of the National Academy of Sciences. 106(18): 7289-7293.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Enhydra lutris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCCACAAATCACAAAGACATCGGCACCCTTTACCTTTTATTCGGTGCATGAGCCGGAATGGTAGGCACCGCTCTCAGCCTATTAATCCGTGCTGAATTAGGTCAACCTGGCGCTCTATTAGGGGAT---GACCAGATTTATAATGTTATCGTCACCGCCCACGCATTCGTGATAATTTTCTTTATAGTAATACCAATCATGATCGGTGGGTTTGGAAACTGACTAGTACCCCTAATAATTGGTGCGCCTGACATAGCATTTCCACGAATAAACAATATAAGCTTTTGACTCCTACCCCCCTCCTTTCTACTTCTTCTAGCCTCATCTATGGTAGAAGCGGGTGCAGGAACAGGATGAACCGTATACCCCCCTTTAGCAGGTAATCTAGCACATGCAGGAGCATCGGTAGACCTGACAATTTTTTCTCTACACCTGGCAGGTGTATCGTCCATCCTAGGAGCTATCAATTTTATCACCACTATCATTAACATAAAACCCCCCGCAATATCACAATACCAAACTCCCTTATTCGTGTGATCTGTACTAATTACGGCCGTGCTTTTACTCCTATCTCTACCAGTCTTAGCAGCCGGTATTACTATACTACTTACAGACCGGAATCTGAATACCACCTTTTTTGACCCAGCTGGAGGAGGAGACCCTATTCTATACCAACACTTATTCTGATTCTTCGGACACCCAGAAGTATACATTCTAATTCTGCCTGGATTCGGAATTATCTCACACGTCGTTACATACTACTCAGGAAAGAAAGAACCGTTTGGTTATATAGGAATGGTATGGGCAATAATATCAATTGGCTTCCTAGGCTTTATTGTGTGAGCCCACCACATATTTACTGTAGGTATGGATGTCGATACACGAGCATACTTTACATCAGCCACTATAATCATTGCTATCCCTACAGGGGTAAAAGTATTTAGCTGACTGGCTACTCTACACGGAGGA---AAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Enhydra lutris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Sea otters were hunted to near extinction (1000 to 2000 individuals worldwide) at until the turn of the 20th century when the United States, Russia, Japan, and Great Britain reached an agreement in 1911 called the International Fur Seal Treaty, banning the hunting of fur-bearing sea mammals. In 1972, the U.S. Marine Mammal Protection Act offered further protection by banning capture and harassment of sea mammals. The Exxon Valdez oil spill of 1989 had a dramatic effect on the Alaskan sea otter population, killing approximately 5,000 individuals.

Parasites and infectious disease contribute to sea otter mortality, specifically Toxoplasma gondii, which infects domestic cats, and Sarcosystis neurona, which infects opossums. It is postulated that cat and opossum feces travel to storm drains via runoff and disposal in toilets, eventually coming into contact with sea otters. In September 2006, Governor Arnold Schwarzenegger passed a law raising the maximum fine for harming a sea otter to $25,000, and required that all cat litter sold in California display a warning label that advises not to dump cat feces down storm drains or in toilets.

According to the Otter Foundation, the California sea otter population declined from July 2008 to July 2011. Estimates suggest a California population of approximately 2700 individuals. Enhydra lutris was placed under the Endangered Species Act (ESA) in 1973 and is now listed on CITES Appendix I and II. In Canada, sea otters are protected under the Species at Risk Act. As of 2008, E. lutris is considered endangered by the IUCN. Sea otters are vulnerable to large-scale population declines, with oil spills being the greatest anthropogenic threat.

US Federal List: threatened

CITES: appendix i; appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2abe

Version
3.1

Year Assessed
2013

Assessor/s
Doroff, A. & Burdin, A.

Reviewer/s
Hussain, S.A. & Conroy, J.

Contributor/s

Justification

The Sea Otter is considered to be Endangered due its vulnerability to large-scale population declines. The species is believed to have undergone a decline exceeding 50% over the past 30 years (approximately three generations). The world-wide population of Sea Otters decreased to approximately 2,000 animals by the end of the commercial fur trade in 1911 (Kenyon 1969). The population recovered from 11 remnant populations located in Russia (Bering Island, Kamchatka Peninsula, and Kuril Islands) and in the United States (in Alaska (Aleutian Islands, Alaska Peninsula, Kodiak archipelago, and Prince William Sound) and California). The remnant populations were small and widely dispersed, as a result, this species has low genetic diversity (Ralls et al. 1983). Since the 1980s, the species had been recovering in many areas thanks to intensive management and regulatory efforts by several governments. However contemporary issues (oil spills, potential fisheries interactions, predation, and disease events), have either prevented Sea Otter populations from thriving or have caused population declines throughout much of the species range. In the United States, two subspecies of Sea Otters are listed as threatened (E. lutris kenyoni in SW Alaska and E. lutris nereis in California) due to precipitous population declines in Alaska and slow growth (and vulnerability to anthropogenic factors) of a small population in California.

In Alaska, precipitous population declines occurred in the Aleutian Islands beginning in the late 1980s–2005. By 2000, counts of Sea Otters had decreased by 90% with a declining trend through 2005 (Doroff et al. 2003, Estes et al. 2005, Burn et al. 2003). The probable cause of the decline was increased predation by killer whales (Orcinus orca) (Estes et al. 1998). More recent Sea Otters surveys indicate the population trend has increased since 2005, however, counts remain well below carrying capacity for this region (D.M. Burn pers. comm. 2010). Population counts also remain low for the Alaska Peninsula (Burn and Doroff 2005, U.S. Fish and Wildlife Service Stock Assessment Reports). The population in the Kodiak archipelago and lower Cook Inlet appeared stable or increasing during the same period that population declines were documented in the Aleutian Islands and Alaska Peninsula (Kodiak and lower Cook Inlet are part of the Southwest population stock), however, this habitat has not been surveyed since 2004.

Recent studies have found infectious disease to be an important mortality factor in California Sea Otter populations (Conrad et al. 2005, Johnson et al. 2009). Information collected from forensic-level necropsies of dead Sea Otters and sampling of free-ranging Sea Otters indicate a strong link to protozoan parasites, Toxoplasma gondii and Sacrocystis neurona, that are known to breed in cats and opossums (Thomas and Cole 1996, Conrad et al. 2005) thus sources of mortality for the Sea Otter population include land-based factors. Other factors identified as causing significant mortality include acanthocephalan peritonitis, protozoal encephalitis, bacterial and fungal infections (Thomas and Cole 1996).

The situation in the Russian Federation is clearer now. The Sea Otter number on the Commander Islands reached maximum since last 150 years period (A. Burdin and S.V. Zagrebelny pers. comm. 2006). In 2007, the direct count revealed around 8,000 otters in both Bering and Medny Islands. The Commanders Island population of Sea Otter was never so abundant, but in 2008, it was found that the population was on decline. In 2004 the Kuril Islands population of Sea Otter was estimated around 19,000 (Kornev and Korneva 2004), but later count have shown sever decline (up to 40–50% in different locations). Though the causes of such decline are not very clear, the threat due to poaching can’t be ruled out.


History
  • 2008
    Endangered
    (IUCN 2008)
  • 2008
    Endangered
  • 2000
    Endangered
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large range in North Pacific; total population has increased to more than 100,000 (430 in Washington); subject to intensive management; vulnerable to oil spills and conflicts with commercial fisheries.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population

The Sea Otter population thought to have once been 150,000 to 300,000, occurring along the North Pacific from northern Japan to the central Baja Peninsula in Mexico. Its abundance was greatly reduced by human exploitation. Between 1751 and 1911 the distribution was reduced to 13 known remnant populations: two in the Kuril Islands and Kamchatka; one in the Commander Islands; a total of 10 in the following areas: Aleutian Islands (2)and along the Alaska Peninsula (3); Kodiak Island (1), Prince William Sound (1), the Queen Charlotte Islands (1), central California (1), and San Benito Islands (1). However, the Queen Charlotte, Canada and San Benito Island, Mexico remnant Sea Otter populations have died out and likely did not contribute to the recolonization of the species following near extirpation (Kenyon 1969).

Sea Otters currently have established populations in parts of the Russian east coast, Alaska, British Columbia, Washington, and California, and there have been reports of single-animal observations in Mexico and Japan. Population estimates made between 2004 and 2007 give a worldwide total of approximately 106,822 Sea Otters. In Russia, population monitoring has increase for Sea Otters throughout the range and number are about 19,000 are in the Kurils, 2,000 to 3,500 on Kamchatka and another 5,000–5,500 on the Commander Islands. The Sea Otter population in Alaska was estimated at between 100,000 and 125,000 individuals in 1973. By 2006, however, the estimated population had fallen to an estimated 73,000 animals in Alaska. A massive decline in Sea Otter population in the Aleutian Islands accounts for most of the change; the cause of this decline is not known, although orca predation was suspected. The Sea Otter population in Prince William Sound was also hit hard by the Exxon Valdez oil spill, which killed thousands of Sea Otters in 1989. Along the North American coast south of Alaska, the Sea Otter's range is discontinuous. Between 1969 and 1972, 89 Sea Otters were flown or shipped from Alaska to the west coast of Vancouver Island, British Columbia. They established a healthy population, estimated to be over 3,000 as of 2004, and their range is now from Tofino to Cape Scott. In 1989, a separate colony was discovered in the central British Columbia coast. It is not known if this colony, which had a size of about 300 animals in 2004, was founded by transplanted otters or by survivors of the fur trade. In 1969 and 1970, 59 Sea Otters were translocated from Amchitka Island to Washington State. Annual surveys between 2000 and 2004 have recorded between 504 and 743 individuals, and their range is in the Olympic Peninsula from just south of Destruction Island to Pillar Point. California has over 3,000 Sea Otters, descendants of approximately 50 individuals discovered in 1938. The spring 2009 Sea Otter survey counted 2,654 Sea Otters in the central California coast, which is suggestive of a population that is stable or slightly declining; counts are down from an estimated pre-fur trade population of 16,000 (USGS unpublished data). California's Sea Otters are the descendants of a single colony of about 50 southern Sea Otters discovered near Big Sur in 1938; their principal range is now from just south of San Francisco to Santa Barbara County. In the late 1980s, the US Fish and Wildlife Service relocated about 140 California Sea Otters to San Nicolas Island in southern California for establishing a reserve population should the mainland is struck by an oil spill. The San Nicholas population initially shrank as the animals migrated back to the mainland, as of 2005, only 30 Sea Otters remained at San Nicholas, thriving on the abundant prey around the island.


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Washington population started with 59 individuals translocated from Alaska in 1969-1970; increasing--spring 1996 survey yielded 430 individuals (USFWS 1997 draft revised stock assessment).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Oil spills are the greatest anthropogenic threat to Sea Otter (Geraci and Williams 1990). Sea Otters become hypothermic when oiled because oiled Sea Otter fur loses its insulative property and Sea Otters have no blubber layer, oil can be ingested while grooming, leading to gastrointestinal disorders, other ailments and death and volatile components of oil inhaled by Sea Otters can cause lung damage. Estimates of sea otter mortality following the Exxon Valdez spill in Prince William Sound ranged from 2,650 (Garrott et al. 1993) to 3,905 (DeGange et al. 1994).

Significant numbers of Sea Otters drowned in gill and trammel nets in California from the mid-1970s to the early 1980s (Estes 1990). Recent population declines in California’s Sea Otters may be incidental to summer commercial fisheries. Estes et al. (2003) found that Sea Otter mortality was elevated in the summer months and that commercial fin fish landings in the coastal live trap fishery increased. Recent analyses indicated annual Sea Otter carcass recoveries and reported fishery landings were significantly correlated.

Thomas and Cole (1996) found 10% of southern Sea Otters they examined to be emaciated without specific cause of mortality. Severe weather and periodic climatic events such as El Niño can disrupt foraging behaviour and food availability, and increase pup loss. Under these circumstances, Sea Otters may find it difficult to meet their high metabolic needs, leading to malnutrition or starvation. Serious tooth wear in older Sea Otters may also contribute to mortality (Riedman and Estes 1990). Recent studies have found infectious disease to be an important mortality factor in California Sea Otter populations. Around 280 Sea Otters found dead have been linked “to a pair of protozoan parasites, Toxoplasma gondii and Sacrocystis neurona, that are known to breed in cats and opossums (Conrad et al. 2005, Johnson et al. 2009). In Alaska, Streptococcal endocarditis, encephalitis and/or septicemia, referred to as Strep. syndrome has been identified in forensic-level necropies of northern sea otters (Unusual mortality event working group) as well as trauma from boat strikes. Goldstein et al. (2009) found northern sea otters from the Alaska Peninsula, Kodiak and Kachemak Bay area infected with phocine distemper.

Killer Whales (Orcinus orca), Great White Sharks (Carcharodon carcharias), Bald Eagles (Haliaeetus leucocephalus), Coyotes (Canis latrans), and Brown Bears (Ursus arctos) have been documented as predators of Sea Otters (Riedman and Estes 1990). Predation by Killer Whales is one factor that is believed to have caused Sea Otter population declines across the Western Gulf of Alaska and Aleutian Islands (Doroff et al. 2003, Estes et al. 1998, Hatfield et al. 1998). Significant declines in preferred prey species populations - Northern Fur Seals (Callorhinus ursinus), Harbour Seals (Phoca vitulina), and Steller Sea Lions (Eumetopias jubatus) are believed to have caused Killer Whales to prey switch and consume Sea Otters (Estes et al. 1998).

Studies in Alaska and Washington and elsewhere have shown that Sea Otter predation on sea urchins may indirectly enhance the growth of kelp and kelp-associated communities. Shellfish are important to commercial, recreational, and tribal fisheries throughout the species range and predation by Sea Otters can be significant and result in localized fisheries and economic issues.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: In various parts of the range, conflicts with commercial fisheries (gill and trammel nets, crab traps) and activities associated with oil and gas exploration, development, and transportation may be the greatest threats. Commercial fisheries are not a threat in Alaska (USFWS 1995 stock assessment). Brody et al. (1996) determined that an oil spill of Exxon Valdez size, occurring at the Monterey Peninsula, California, would kill at least 50% of the total California sea otter population.

In the Aleutian Islands in recent decades, the population declined to a uniformly low density in the archipelago, suggesting a common and geographically widespread cause. These data are in general agreement with the hypothesis of increased predation on sea otters (Doroff et al. 2003). Killer whales presumably shifted their diet to include sea otters after populations of their preferred prey, harbor seals (Phoca vitulina) and Steller sea lions (Eumetopias jubatus), declined.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Since the 1700s, prior to the commercial fur trade, native peoples throughout the otter's range harvested sea otters for their pelts (2). An intensive commercial fur trade, from 1740 until about 1900, resulted in the sea otter being harvested almost to extinction, and by 1900, the sea otter was so rare that commercial harvesting was forced to cease (6). Sea otters were protected by an international treaty in 1911. Since then, numbers have recovered to an extent, but human activities, especially coastal development and marine pollution, now pose a threat to the sea otter (6). In 1989, hundreds, and possibly thousands, of sea otters were killed as a direct result of the Exxon Valdez oil spill in Prince William Sound in Alaska (4). The possibility of another major oil spill poses a continual threat to the sea otter, and could have devastating consequences. Additional threats include entanglement in fishing gear, particularly gill nets, and competition with commercial fisheries for food (6). In the central Aleutian Islands, Alaska, sea otters have declined by as much as 90 percent (4). Evidence indicates that this drastic decline is the result of increased predation by killer whales, which have switched to consuming more sea otters following the collapse of Steller's sea lion and harbour seal populations in the region (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Enhydra lutris nereis is listed on CITES Appendix I. All other populations are included in CITES Appendix II. In Canada, Sea Otters are protected and managed under the Species at Risk Act. In the United States, Sea Otters are protected by the Marine Mammal Protection Act of 1972 (MMPA) and in Southwest Alaska and California, the Endangered Species Act of 1973 (ESA). The US Fish and Wildlife Service (Service) is the federal agency responsible for their conservation and management. The ESA also makes it illegal to buy, sell or possess any part of endangered species or items made from them. However, both the ESA and the Act allow for coastal Native people in Alaska to harvest Sea Otters for personal use, trade, barter, and the development of cottage industry. Native subsistence harvest of Sea Otters is monitored by the Service through a Marking, Tagging and Reporting program. The Service and Native organizations conduct joint population surveys and dialog on important conservations issues. The MMPA also mandates that efforts must be made to recover the species, which means creating and implementing a plan for returning them to healthy population levels.

Despite protection and various conservation measures, the southern Sea Otter population has been slow to recover. In 1994, the Service developed a Conservation Plan for northern Sea Otters in Alaska with the aim of managing human activities that hinder Sea Otter population recovery or sustainability. When a significant portion of the species range is stable and healthy, this will facilitate removing the species from the List of Endangered and Threatened Wildlife. Many of the conservation actions in the 1994 Plan have been completed, however, the population declines in the Aleutian Islands were unanticipated and new health risks are being identified that may limit population recovery. There have been several successful reintroduction attempts along the west coast of North America, restoring this highly appealing animal to much of its former range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Restoration Potential: Recovery potential is high if environmental conditions are favorable. In Alaska, otters at the leading edge of an expanding population in an area with abundant food resources and protected water exhibited high adult survival rate, high reproductive rate, and high preweaning survival (Monson and DeGange 1995). Human harvest was the primary source of known mortality of adults.

Management Requirements: See the 1996 Endangered Species Update 13(12) for 20 articles dealing with sea otter conservation and management.

Brody et al. (1996) reviewed the EXXON VALDEZ oil spill and concluded that efforts to rehabilitate otters should be discontinued 20-30 days after a spill.

Draft revised recovery plan for California populations was available in February 2000 (contact U.S. Fish and Wildlife Service, Ventura, California).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Needs: See the 1996 Endangered Species Update 13(12) for 20 articles dealing with sea otter conservation and management.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The sea otter is legally protected in the United States under the Marine Mammal Protection Act and in Canada sea otters are protected under the Species at Risk Act (10). Despite protection and various conservation measures, the Californian population has been slow to recover; a new Recovery Plan by the U.S. Fish and Wildlife Service was currently being developed with the aim of managing damaging human activities to enable the population to recover to a point where it can be removed from the List of Endangered and Threatened Wildlife (11). There have been several successful reintroduction attempts along the west coast of North America, restoring this highly appealing animal to much of its former range (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Sea otters feed on shellfish, sea urchins, and crabs, competing with commercial fisheries.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The fur of sea otters was of great importance in the fur trade from the mid 1700s to 1911. Their fur was coveted due to its extreme density and insulating quality. Pelts sold for as much as $1,125 each and were fashioned into hats, coats, and other garments sold in Russia, Canada, and the United States.

Positive Impacts: body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Negatively impacts shellfisheries, though the degree of impact is controversial.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

Stewardship Overview: See 1995 draft recovery plan for the California population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sea otter

Not to be confused with Marine otter. "Enhydra" redirects here. For the free server software, see Enhydra Server. For other uses, see Sea otter (disambiguation).

The sea otter (Enhydra lutris) is a marine mammal native to the coasts of the northern and eastern North Pacific Ocean. Adult sea otters typically weigh between 14 and 45 kg (31 and 99 lb), making them the heaviest members of the weasel family, but among the smallest marine mammals. Unlike most marine mammals, the sea otter's primary form of insulation is an exceptionally thick coat of fur, the densest in the animal kingdom. Although it can walk on land, the sea otter lives mostly in the ocean.

The sea otter inhabits offshore environments, where it dives to the sea floor to forage. It preys mostly on marine invertebrates such as sea urchins, various molluscs and crustaceans, and some species of fish. Its foraging and eating habits are noteworthy in several respects. First, its use of rocks to dislodge prey and to open shells makes it one of the few mammal species to use tools. In most of its range, it is a keystone species, controlling sea urchin populations which would otherwise inflict extensive damage to kelp forest ecosystems. Its diet includes prey species that are also valued by humans as food, leading to conflicts between sea otters and fisheries.

Sea otters, whose numbers were once estimated at 150,000–300,000, were hunted extensively for their fur between 1741 and 1911, and the world population fell to 1,000–2,000 individuals living in a fraction of their historic range.[2] A subsequent international ban on hunting, conservation efforts, and reintroduction programs into previously populated areas have contributed to numbers rebounding, and the species now occupies about two-thirds of its former range. The recovery of the sea otter is considered an important success in marine conservation, although populations in the Aleutian Islands and California have recently declined or have plateaued at depressed levels. For these reasons, the sea otter remains classified as an endangered species.

Taxonomy[edit]

Mother sea otter with rare twin pups, Morro Bay, California. Sea otter twin births are rare, and the high demands on the mother usually result in one pup being abandoned.[3]
Sea otter ln Morro Bay, California.

The first scientific description of the sea otter is contained in the field notes of Georg Steller from 1751, and the species was described by Linnaeus in his Systema Naturae of 1758.[4] Originally named Lutra marina, it underwent numerous name changes before being accepted as Enhydra lutris in 1922.[5] The generic name Enhydra, derives from the Ancient Greek en/εν "in" and hydra/ύδρα "water",[6] meaning "in the water", and the Latin word lutris, meaning "otter".[7]

The sea otter was formerly sometimes referred to as the "sea beaver",[8] being the marine fur-bearer similar in commercial value to the terrestrial beaver. Rodents (of which the beaver is one) are not closely related to otters, which are carnivores. It is not to be confused with the marine otter, a rare otter species native to the southern west coast of South America. A number of other otter species, while predominantly living in fresh water, are commonly found in marine coastal habitats. The extinct sea mink of northeast North America is another mustelid that had adapted to a marine environment.

Evolution[edit]

The sea otter is the heaviest (the giant otter is longer, but significantly slimmer) member of the family Mustelidae,[9] a diverse group that includes the 13 otter species and terrestrial animals such as weasels, badgers, and minks. It is unique among the mustelids in not making dens or burrows, in having no functional anal scent glands,[10] and in being able to live its entire life without leaving the water.[11] The only member of the genus Enhydra, the sea otter is so different from other mustelid species that, as recently as 1982, some scientists believed it was more closely related to the earless seals.[12] Genetic analysis indicates the sea otter and its closest extant relatives, which include the African speckle-throated otter, European otter, African clawless otter and oriental small-clawed otter, shared an ancestor approximately 5 million years ago (Mya).[13]

Fossil evidence indicates the Enhydra lineage became isolated in the North Pacific approximately 2 Mya, giving rise to the now-extinct Enhydra macrodonta and the modern sea otter, Enhydra lutris.[5] The sea otter evolved initially in northern Hokkaidō and Russia, and then spread east to the Aleutian Islands, mainland Alaska, and down the North American coast.[14] In comparison to cetaceans, sirenians, and pinnipeds, which entered the water approximately 50, 40, and 20 Mya, respectively, the sea otter is a relative newcomer to a marine existence.[15] In some respects, though, the sea otter is more fully adapted to water than pinnipeds, which must haul out on land or ice to give birth.[16]

One related species has been described, Enhydra reevei, from the Pleistocene of East Anglia. The holotype, a lower carnassial, was in the Norwich Castle Museum but seems to be lost. Only one more specimen, an extremely worn lower carnassial, is known.[17]

Subspecies[edit]

The three recognized subspecies, which vary in body size and in some skull and dental characteristics, are:[9][18]

SubspeciesTrinomial authorityCommon namesDescriptionRangeSynonyms
E. l. lutris

(Nominate subspecies)

Linnaeus, 1758Common sea otter[19]

Asian sea otter[19]
Commander sea otter[20]
Kuril sea otter[20]

The largest subspecies, with a wide skull and short nasal bones[19]Kuril Islands to the Commander Islands in the western Pacific Ocean[9]gracilis (Bechstein, 1800)

kamtschatica (Dybowski, 1922)
marina (Erxleben, 1777)
orientalis (Oken, 1816)
stelleri (Lesson, 1827)

E. l. nereis

Sea-otter-morro-bay 13.jpg

Merriam, 1904Southern sea otter[19]

California sea otter[19]

Has a narrower skull with a long rostrum and small teeth[19]Coast of central California[9]
E. l. kenyoni[21]

Otter3.jpg

Wilson, 1991Northern sea otter
Alaska and the Pacific west coast from the Aleutian islands to British Columbia, Washington, and northern Oregon,[19] after being extirpated from southern British Columbia due to overhunting, it has since been reintroduced off Vancouver Island and the Olympic Peninsula.[9]

The reintroduction effort off the Oregon coast was not successful. However, reintroductions in 1969 and 1970 off the Washington coast were very successful and sea otters have been expanding their range since. They have now entered the Strait of Juan de Fuca and can be found almost as far east as Pillar Point. Individuals have even been seen in the San Juan Islands and northern Puget Sound.

Physical characteristics[edit]

A sea otter's thick fur makes its body appear much plumper on land than in the water.

The sea otter is one of the smallest marine mammal species, but it is the heaviest mustelid.[11] Male sea otters usually weigh 22 to 45 kg (49 to 99 lb) and are 1.2 to 1.5 m (3 ft 11 in to 4 ft 11 in) in length, though specimens to 54 kg (119 lb) have been recorded.[22] Females are smaller, weighing 14 to 33 kg (31 to 73 lb) and measuring 1.0 to 1.4 m (3 ft 3 in to 4 ft 7 in) in length.[23] Its baculum (penis bone) is, for the male otter's size, very large, massive and bent upwards, measuring 150 mm (5.9 in) in length and 15 mm (0.59 in) at the base.[24]

Unlike most other marine mammals, the sea otter has no blubber and relies on its exceptionally thick fur to keep warm.[25] With up to 150,000 strands of hair per square centimeter (nearly one million per sq in), its fur is the densest of any animal.[26] The fur consists of long, waterproof guard hairs and short underfur; the guard hairs keep the dense underfur layer dry. Cold water is thus kept completely away from the skin and heat loss is limited.[23] The fur is thick year-round, as it is shed and replaced gradually rather than in a distinct molting season.[27] As the ability of the guard hairs to repel water depends on utmost cleanliness, the sea otter has the ability to reach and groom the fur on any part of its body, taking advantage of its loose skin and an unusually supple skeleton.[28] The coloration of the pelage is usually deep brown with silver-gray speckles, but it can range from yellowish or grayish brown to almost black.[29] In adults, the head, throat, and chest are lighter in color than the rest of the body.[29]

The sea otter displays numerous adaptations to its marine environment. The nostrils and small ears can close.[30] The hind feet, which provide most of its propulsion in swimming, are long, broadly flattened, and fully webbed.[31] The fifth digit on each hind foot is longest, facilitating swimming while on its back, but making walking difficult.[32] The tail is fairly short, thick, slightly flattened, and muscular. The front paws are short with retractable claws, with tough pads on the palms that enable gripping slippery prey.[33]

Skull, as illustrated by N. N. Kondakov.

The sea otter propels itself underwater by moving the rear end of its body, including its tail and hind feet, up and down,[31] and is capable of speeds of up to 9 km/h (5.6 mph).[9] When underwater, its body is long and streamlined, with the short forelimbs pressed closely against the chest.[34] When at the surface, it usually floats on its back and moves by sculling its feet and tail from side to side.[35] At rest, all four limbs can be folded onto the torso to conserve heat, whereas on particularly hot days, the hind feet may be held underwater for cooling.[36] The sea otter's body is highly buoyant because of its large lung capacity – about 2.5 times greater than that of similar-sized land mammals[37] – and the air trapped in its fur. The sea otter walks with a clumsy, rolling gait on land, and can run in a bounding motion.[32]

Long, highly sensitive whiskers and front paws help the sea otter find prey by touch when waters are dark or murky.[11] Researchers have noted when they approach in plain view, sea otters react more rapidly when the wind is blowing towards the animals, indicating the sense of smell is more important than sight as a warning sense.[38] Other observations indicate the sea otter's sense of sight is useful above and below the water, although not as good as that of seals.[39] Its hearing is neither particularly acute nor poor.[40]

An adult's 32 teeth, particularly the molars, are flattened and rounded, designed to crush rather than cut food.[41] Seals and sea otters are the only carnivores with two pairs of lower incisor teeth rather than three;[42] the adult dental formula is 3.1.3.12.1.3.2 [43]

The sea otter has a metabolic rate two or three times that of comparatively sized terrestrial mammals. It must eat an estimated 25 to 38% of its own body weight in food each day to burn the calories necessary to counteract the loss of heat due to the cold water environment.[44][45] Its digestive efficiency is estimated at 80 to 85%,[46] and food is digested and passed in as little as three hours.[25] Most of its need for water is met through food, although, in contrast to most other marine mammals, it also drinks seawater. Its relatively large kidneys enable it to derive fresh water from sea water and excrete concentrated urine.[47]

Behavior[edit]

Sensitive vibrissae and forepaws enable sea otters to find prey using their sense of touch.

The sea otter is diurnal. It has a period of foraging and eating in the morning, starting about an hour before sunrise, then rests or sleeps in mid-day.[48] Foraging resumes for a few hours in the afternoon and subsides before sunset, and a third foraging period may occur around midnight.[48] Females with pups appear to be more inclined to feed at night.[48] Observations of the amount of time a sea otter must spend each day foraging range from 24 to 60%, apparently depending on the availability of food in the area.[49]

Sea otters spend much of their time grooming, which consists of cleaning the fur, untangling knots, removing loose fur, rubbing the fur to squeeze out water and introduce air, and blowing air into the fur. To casual observers, it appears as if the animals are scratching, but they are not known to have lice or other parasites in the fur.[50] When eating, sea otters roll in the water frequently, apparently to wash food scraps from their fur.[51]

Foraging[edit]

The sea otter hunts in short dives, often to the sea floor. Although it can hold its breath for up to five minutes,[30] its dives typically last about one minute and no more than four.[23] It is the only marine animal capable of lifting and turning over rocks, which it often does with its front paws when searching for prey.[51] The sea otter may also pluck snails and other organisms from kelp and dig deep into underwater mud for clams.[51] It is the only marine mammal that catches fish with its forepaws rather than with its teeth.[25]

Under each foreleg, the sea otter has a loose pouch of skin that extends across the chest. In this pouch (preferentially the left one), the animal stores collected food to bring to the surface. This pouch also holds a rock, unique to the otter, that is used to break open shellfish and clams.[52] There, the sea otter eats while floating on its back, using its forepaws to tear food apart and bring it to its mouth. It can chew and swallow small mussels with their shells, whereas large mussel shells may be twisted apart.[53] It uses its lower incisor teeth to access the meat in shellfish.[54] To eat large sea urchins, which are mostly covered with spines, the sea otter bites through the underside where the spines are shortest, and licks the soft contents out of the urchin's shell.[53]

The sea otter's use of rocks when hunting and feeding makes it one of the few mammal species to use tools.[55] To open hard shells, it may pound its prey with both paws against a rock on its chest. To pry an abalone off its rock, it hammers the abalone shell using a large stone, with observed rates of 45 blows in 15 seconds.[23] Releasing an abalone, which can cling to rock with a force equal to 4,000 times its own body weight, requires multiple dives.[23]

Social structure[edit]

Sleeping sea otters holding paws, photographed at the Vancouver Aquarium, Vancouver, British Columbia, Canada.[56] Note the high buoyancy of the animals' bodies.

Although each adult and independent juvenile forages alone, sea otters tend to rest together in single-sex groups called rafts. A raft typically contains 10 to 100 animals, with male rafts being larger than female ones.[57] The largest raft ever seen contained over 2000 sea otters. To keep from drifting out to sea when resting and eating, sea otters may wrap themselves in kelp.[58]

A male sea otter is most likely to mate if he maintains a breeding territory in an area that is also favored by females.[59] As autumn is the peak breeding season in most areas, males typically defend their territory only from spring to autumn.[59] During this time, males patrol the boundaries of their territories to exclude other males,[59] although actual fighting is rare.[57] Adult females move freely between male territories, where they outnumber adult males by an average of five to one.[59] Males that do not have territories tend to congregate in large, male-only groups,[59] and swim through female areas when searching for a mate.[60]

The species exhibits a variety of vocal behaviors. The cry of a pup is often compared to that of a seagull.[61] Females coo when they are apparently content; males may grunt instead.[62] Distressed or frightened adults may whistle, hiss, or in extreme circumstances, scream.[61]

Although sea otters can be playful and sociable, they are not considered to be truly social animals.[63] They spend much time alone, and each adult can meet its own needs in terms of hunting, grooming, and defense.[63]

Reproduction and lifecycle[edit]

During mating, the male bites the nose of the female, often bloodying and scarring it.

Sea otters are polygynous: males have multiple female partners. However, temporary pair-bonding occurs for a few days between a female in estrus and her mate.[51] Mating takes place in the water and can be rough, the male biting the female on the muzzle – which often leaves scars on the nose – and sometimes holding her head under water.[9][64]

Births occur year-round, with peaks between May and June in northern populations and between January and March in southern populations.[65] Gestation appears to vary from four to twelve months, as the species is capable of delayed implantation followed by four months of pregnancy.[65] In California, sea otters usually breed every year, about twice as often as those in Alaska.[66]

Birth usually takes place in the water and typically produces a single pup weighing 1.4 to 2.3 kg (3 to 5 lb).[67] Twins occur in 2% of births; however, usually only one pup survives.[9] At birth, the eyes are open, ten teeth are visible, and the pup has a thick coat of baby fur.[68] Mothers have been observed to lick and fluff a newborn for hours; after grooming, the pup's fur retains so much air, the pup floats like a cork and cannot dive.[69] The fluffy baby fur is replaced by adult fur after about 13 weeks.[4]

A mother floats with her pup on her chest. Georg Steller wrote, "They embrace their young with an affection that is scarcely credible."[70]

Nursing lasts six to eight months in Californian populations and four to twelve months in Alaska, with the mother beginning to offer bits of prey at one to two months.[71] The milk from a sea otter's two abdominal nipples is rich in fat and more similar to the milk of other marine mammals than to that of other mustelids.[72] A pup, with guidance from its mother, practices swimming and diving for several weeks before it is able to reach the sea floor. Initially, the objects it retrieves are of little food value, such as brightly colored starfish and pebbles.[52] Juveniles are typically independent at six to eight months, but a mother may be forced to abandon a pup if she cannot find enough food for it;[73] at the other extreme, a pup may nurse until it is almost adult size.[67] Pup mortality is high, particularly during an individual's first winter – by one estimate, only 25% of pups survive their first year.[73] Pups born to experienced mothers have the highest survival rates.[74]

Females perform all tasks of feeding and raising offspring, and have occasionally been observed caring for orphaned pups.[75] Much has been written about the level of devotion of sea otter mothers for their pups – a mother gives her infant almost constant attention, cradling it on her chest away from the cold water and attentively grooming its fur.[76] When foraging, she leaves her pup floating on the water, sometimes wrapped in kelp to keep it from floating away;[77] if the pup is not sleeping, it cries loudly until she returns.[78] Mothers have been known to carry their pups for days after the pups' deaths.[70]

Females become sexually mature at around three or four years of age and males at around five; however, males often do not successfully breed until a few years later.[79] A captive male sired offspring at age 19.[67] In the wild, sea otters live to a maximum age of 23 years,[23] with average lifespans of 10–15 years for males and 15–20 years for females.[80] Several captive individuals have lived past 20 years, and a female at the Seattle Aquarium died at the age of 28 years.[81] Sea otters in the wild often develop worn teeth, which may account for their apparently shorter lifespans.[82]

There are several documented cases in which male sea otters have forcibly copulated with juvenile Harbor Seals, sometimes resulting in death.[83]

Population and distribution[edit]

Sea otter floating in Morro Bay, California

Sea otters live in coastal waters 15 to 23 meters (50 to 75 ft) deep,[84] and usually stay within a kilometer (⅔ mi) of the shore.[85] They are found most often in areas with protection from the most severe ocean winds, such as rocky coastlines, thick kelp forests, and barrier reefs.[86] Although they are most strongly associated with rocky substrates, sea otters can also live in areas where the sea floor consists primarily of mud, sand, or silt.[87] Their northern range is limited by ice, as sea otters can survive amidst drift ice but not land-fast ice.[88] Individuals generally occupy a home range a few kilometers long, and remain there year-round.[89]

The sea otter population is thought to have once been 150,000 to 300,000,[8] stretching in an arc across the North Pacific from northern Japan to the central Baja California Peninsula in Mexico. The fur trade that began in the 1740s reduced the sea otter's numbers to an estimated 1,000 to 2,000 members in 13 colonies. In about two-thirds of its former range, the species is at varying levels of recovery, with high population densities in some areas and threatened populations in others. Sea otters currently have stable populations in parts of the Russian east coast, Alaska, British Columbia, Washington, and California, with reports of recolonizations in Mexico and Japan.[90] Population estimates made between 2004 and 2007 give a worldwide total of approximately 107,000 sea otters.[4][91][92][93][94]

Russia[edit]

Currently, the most stable and secure part of the sea otter's range is Russia.[95] Before the 19th century, around 20,000 to 25,000 sea otters lived near the Kuril Islands, with more near Kamchatka and the Commander Islands. After the years of the Great Hunt, the population in these areas, currently part of Russia, was only 750.[91] As of 2004, sea otters have repopulated all of their former habitat in these areas, with an estimated total population of about 27,000. Of these, about 19,000 are at the Kurils, 2,000 to 3,500 at Kamchatka and another 5,000 to 5,500 at the Commander Islands.[91] Growth has slowed slightly, suggesting the numbers are reaching carrying capacity.[91]

Sea Otter, Kenai Fjords National Park, Alaska

Alaska[edit]

Alaska is the heartland of the sea otter's range. In 1973, the population in Alaska was estimated at between 100,000 and 125,000 animals.[96] By 2006, though, the Alaska population had fallen to an estimated 73,000 animals.[92] A massive decline in sea otter populations in the Aleutian Islands accounts for most of the change; the cause of this decline is not known, although orca predation is suspected.[97] The sea otter population in Prince William Sound was also hit hard by the Exxon Valdez oil spill, which killed thousands of sea otters in 1989.[51]

British Columbia[edit]

Along the North American coast south of Alaska, the sea otter's range is discontinuous. A remnant population survived off Vancouver Island into the 20th century, but it died out despite the 1911 international protection treaty, with the last sea otter taken near Kyuquot in 1929. From 1969 to 1972, 89 sea otters were flown or shipped from Alaska to the west coast of Vancouver Island.

John Webber's Sea Otter, circa 1788

This population expanded to over 3,200 as of 2004, and their range on the island's west coast expanded from Cape Scott in the north to Barkley Sound to the south.[98] In 1989, a separate colony was discovered in the central British Columbia coast. It is not known if this colony, which numbered about 300 animals in 2004, was founded by transplanted otters or by survivors of the fur trade.[93]

The status of the sea otters has improved since 2004 with a report of 4,700 in 2008 that improved their status to "special concern" in Canada.[99] They currently occupy much of the exposed west coast of Vancouver Island and parts of the central mainland BC coast. [100]

Washington[edit]

In 1969 and 1970, 59 sea otters were translocated from Amchitka Island to Washington. Annual surveys between 2000 and 2004 have recorded between 504 and 743 individuals, and their range is in the Olympic Peninsula from just south of Destruction Island to Pillar Point.[4] In Washington, sea otters are found almost exclusively on the outer coasts. They can swim as close as six feet off shore along the Olympic coast. Reported sightings of sea otters in the San Juan Islands and Puget Sound almost always turn out to be North American river otters, which are commonly seen along the seashore. However, biologists have confirmed isolated sightings of sea otters in these areas since the mid-1990s.[4]

California[edit]

Sea otter nursing pup. California has almost 3,000 sea otters, descendants of about 50 individuals discovered in 1938.

The 2013 United States Geological Survey (USGS) found 2,941 California sea otters, a slight increase from 2012 but a portion of the increase is artificial because the count includes, for the first time, the San Nicolas Island population which has recovered to 59 individuals.[101] The California sea otter census in 2012 was 2,792, down from the peak spring 2007 census of 3,026 sea otters, but up from the recent low of 2,711 in 2010.[94][102][103] The historic population is estimated at 16,000 before the fur trade began. California's sea otters are the descendants of a single colony of about 50 southern sea otters discovered near Bixby Bridge in Big Sur in 1938.[104] Their principal range has gradually expanded and extends from Pigeon Point in San Mateo County to Santa Barbara County.[103] In the late 1980s, the U.S. Fish and Wildlife Service (USFWS) relocated about 140 Californian sea otters to San Nicolas Island in southern California, in the hope of establishing a reserve population should the mainland be struck by an oil spill. To the surprise of biologists, the San Nicolas sea otters mostly swam back to the mainland.[105] As of 2005, only 30 sea otters remained at San Nicolas,[106] although they are slowly increasing as they thrive on the abundant prey around the island.[105] The plan that authorized the translocation program had predicted the carrying capacity would be reached within five to 10 years. However, as of 2012 the San Nicolas Island population had increased only to about 50 individuals.[107]

When the FWS implemented the translocation program, it also attempted to implement "zonal management" of the Californian population. To manage the competition between sea otters and fisheries, it declared an "otter-free zone" stretching from Point Conception to the Mexican border. In this zone, only San Nicolas Island was designated as sea otter habitat, and sea otters found elsewhere in the area were supposed to be captured and relocated. These plans were abandoned after many translocated otters died and also as it proved impractical to capture the hundreds of otters which ignored regulations and swam into the zone.[108] However, after engaging in a period of public commentary in 2005, the Fish and Wildlife Service failed to release a formal decision on the issue.[106] Then, in response to lawsuits filed by lthe Santa Barbara-based Environmental Defense Center and the Otter Project, on December 19, 2012 the USFWS declared that the "no otter zone" experiment was a failure, and will protect the otters re-colonizing the coast south of Point Conception as threatened species.[109]

Sea otters were once numerous in San Francisco Bay.[110] Historical records revealed the Russian-American Company sneaked Aleuts into San Francisco Bay multiple times, despite the Spanish capturing or shooting them while hunting sea otters in the estuaries of San Jose, San Mateo, San Bruno and around Angel Island.[111] The founder of Fort Ross, Ivan Kuskov, finding otters scarce on his second voyage to Bodega Bay in 1812, sent a party of Aleuts to San Francisco Bay, where they met another Russian party and an American party, and caught 1,160 sea otters in three months.[112] By 1817, sea otters in the area were practically eliminated and the Russians sought permission from the Spanish and the Mexican governments to hunt further and further south of San Francisco.[113] Remnant sea otter populations may have survived in the bay until 1840, when the Rancho Punta de Quentin was granted to Captain John B. R. Cooper, a sea captain from Boston, by Mexican Governor Juan Bautista Alvarado along with a license to hunt sea otters, reportedly then prevalent at the mouth of Corte Madera Creek.[114]

Although the southern sea otter's range has continuously expanded from the remnant population of about 50 individuals in Big Sur since protection in 1911, however from 2007 to 2010, the otter population and its range contracted and since 2010 are only slowly recovering.[101][115] As of spring 2010, the northern boundary has moved from about Tunitas Creek to a point 2 km southeast of Pigeon Point, and the southern boundary has moved from approximately Coal Oil Point to Gaviota State Park.[116] Recently, a toxin called microcystin, produced by a type of cyanobacteria (Microcystis), seems to be concentrated in the shellfish the otters eat, poisoning them. Cyanobacteria are found in stagnant freshwater enriched with nitrogen and phosphorus from septic tank and agricultural fertilizer runoff, and may be flushed into the ocean when streamflows are high in the rainy season.[117][118] A record number of sea otter carcasses were found on California's coastline in 2010, with increased shark attacks an increasing component of the mortality.[119] Great white sharks (Carcharodon carcharias) do not consume relatively fat-poor sea otters but shark-bitten carcasses have increased from 8% in the 1980s to 15% in the 1990s and to 30% in 2010 and 2011.[120]

Otters were observed twice in Southern California in 2011, once near Laguna Beach and once at Zuniga Point Jetty, near San Diego. These are the first documented sightings of otters this far south in 30 years.[121]

Oregon[edit]

The last native sea otter in Oregon was probably shot and killed in 1906. In 1970 and 1971, a total of 95 sea otters were transplanted from Amchitka Island, Alaska to the Southern Oregon coast. However, this translocation effort failed and otters soon again disappeared from the state.[122]

In 2004, a lone male sea otter took up residence at Simpson Reef off of Cape Arago for six months. This male is thought to have originated from a colony in Washington, but disappeared after a coastal storm.[123]

The most recent sighting of a sea otter off the Oregon coast took place on 18 February 2009, in Depoe Bay, Oregon. The lone male sea otter could have traveled from either California or Washington.[124]

Ecology[edit]

Diet[edit]

Sea otters keep kelp forests healthy by eating animals that graze on kelp.

Sea otters consume over 100 different prey species.[125] In most of its range, the sea otter's diet consists almost exclusively of marine invertebrates, including sea urchins, a variety of bivalves such as clams and mussels, abalone, other mollusks, crustaceans, and snails.[125] Its prey ranges in size from tiny limpets and crabs to giant octopuses.[125] Where prey such as sea urchins, clams, and abalone are present in a range of sizes, sea otters tend to select larger items over smaller ones of similar type.[125] In California, they have been noted to ignore Pismo clams smaller than 3 inches (7 cm) across.[126]

In a few northern areas, fish are also eaten. In studies performed at Amchitka Island in the 1960s, where the sea otter population was at carrying capacity, 50% of food found in sea otter stomachs was fish.[127] The fish species were usually bottom-dwelling and sedentary or sluggish forms, such as Hemilepidotus hemilepidotus and family Tetraodontidae.[127] However, south of Alaska on the North American coast, fish are a negligible or extremely minor part of the sea otter's diet.[4][128] Contrary to popular depictions, sea otters rarely eat starfish, and any kelp that is consumed apparently passes through the sea otter's system undigested.[129]

The individuals within a particular area often differ in their foraging methods and prey types, and tend to follow the same patterns as their mothers.[130] The diet of local populations also changes over time, as sea otters can significantly deplete populations of highly preferred prey such as large sea urchins, and prey availability is also affected by other factors such as fishing by humans.[4] Sea otters can thoroughly remove abalone from an area except for specimens in deep rock crevices,[131] however, they never completely wipe out a prey species from an area.[132] A 2007 Californian study demonstrated, in areas where food was relatively scarce, a wider variety of prey was consumed. Surprisingly, though, the diets of individuals were more specialized in these areas than in areas where food was plentiful.[105]

As a keystone species[edit]

Sea otters are a classic example of a keystone species; their presence affects the ecosystem more profoundly than their size and numbers would suggest. They keep the population of certain benthic (sea floor) herbivores, particularly sea urchins, in check. Sea urchins graze on the lower stems of kelp, causing the kelp to drift away and die. Loss of the habitat and nutrients provided by kelp forests leads to profound cascade effects on the marine ecosystem. North Pacific areas that do not have sea otters often turn into urchin barrens, with abundant sea urchins and no kelp forest.[9]

Remote areas of coastline, such as this area in California, sheltered the few remaining colonies of sea otters that survived the fur trade.

Reintroduction of sea otters to British Columbia has led to a dramatic improvement in the health of coastal ecosystems,[133] and similar changes have been observed as sea otter populations recovered in the Aleutian and Commander Islands and the Big Sur coast of California[134] However, some kelp forest ecosystems in California have also thrived without sea otters, with sea urchin populations apparently controlled by other factors.[134] The role of sea otters in maintaining kelp forests has been observed to be more important in areas of open coast than in more protected bays and estuaries.[134]

In addition to promoting growth of kelp forests, sea otters can also have a profound effect in rocky areas that tend to be dominated by mussel beds. They remove mussels from rocks, liberating space for competitive species and thereby increasing the diversity of species in the area.[134]

Predators[edit]

Predation of sea otters does occur, although it is not common. Many predators find the otter, with their pungent scent glands, distasteful. Young predators may kill an otter and not eat it. Leading mammalian predators of this species include killer whales and sea lions; bald eagles also prey on pups by snatching them from the water surface.[55] On land, young sea otters may face attack from bears and coyotes. In California, bites from sharks, particularly great white sharks, have been estimated to cause 10% of sea otter deaths and are one of the reasons the population has not expanded further north.[135] The great white shark is believed to be their primary predator, and dead sea otters have been found with injuries from shark bites, although there is no evidence that sharks actually eat them.[135] An exhibit at the San Diego Natural History Museum states that cat feces from urban runoff carry parasites to the ocean and kill sea otters.[citation needed]

Relationship with humans[edit]

Fur trade[edit]

Aleut men in Unalaska in 1896 used waterproof kayak gear and garments to hunt sea otters.

Sea otters have the thickest fur of any mammal. Their beautiful fur is a main target for many hunters. Archaeological evidence indicates that for thousands of years, indigenous peoples have hunted sea otters for food and fur.[8] Large-scale hunting, part of the Maritime Fur Trade, which would eventually kill approximately one million sea otters, began in the 18th century when hunters and traders began to arrive from all over the world to meet foreign demand for otter pelts, which were one of the world's most valuable types of fur.[8]

In the early 18th century, Russians began to hunt sea otters in the Kuril Islands[8] and sold them to the Chinese at Kyakhta. Russia was also exploring the far northern Pacific at this time, and sent Vitus Bering to map the Arctic coast and find routes from Siberia to North America.[136] In 1741, on his second North Pacific voyage, Bering was shipwrecked off Bering Island in the Commander Islands, where he and many of his crew died.[136] The surviving crew members, which included naturalist Georg Steller, discovered sea otters on the beaches of the island and spent the winter hunting sea otters and gambling with otter pelts.[136] They returned to Siberia, having killed nearly 1,000 sea otters, and were able to command high prices for the pelts.[136] Thus began what is sometimes called the "Great Hunt", which would continue for another hundred years. The Russians found the sea otter far more valuable than the sable skins that had driven and paid for most of their expansion across Siberia. If the sea otter pelts brought back by Bering's survivors had been sold at Kyakhta prices they would have paid for one tenth the cost of Bering's expedition.[137] In 1775 at Okhotsk, sea otter pelts were worth 50–80 rubles as opposed to 2.5 rubles for sable.

Pelt sales (in thousands) in the London fur market – the drop beginning in the 1880s reflects dwindling sea otter populations.[138]

Russian fur-hunting expeditions soon depleted the sea otter populations in the Commander Islands, and by 1745, they began to move on to the Aleutian Islands. The Russians initially traded with the Aleuts inhabitants of these islands for otter pelts, but later enslaved the Aleuts, taking women and children hostage and torturing and killing Aleut men to force them to hunt. Many Aleuts were either murdered by the Russians or died from diseases the hunters had introduced.[139] The Aleut population was reduced, by the Russians' own estimate, from 20,000 to 2,000.[140] By the 1760s, the Russians had reached Alaska. In 1799, Emperor Paul I consolidated the rival fur-hunting companies into the Russian-American Company, granting it an imperial charter and protection, and a monopoly over trade rights and territorial acquisition. Under Aleksandr I, the administration of the merchant-controlled company was transferred to the Imperial Navy, largely due to the alarming reports by naval officers of native abuse; in 1818, the indigenous peoples of Alaska were granted civil rights equivalent to a townsman status in the Russian Empire.[141]

Other nations joined in the hunt in the south. Along the coasts of what is now Mexico and California, Spanish explorers bought sea otter pelts from Native Americans and sold them in Asia.[139] In 1778, British explorer Captain James Cook reached Vancouver Island and bought sea otter furs from the First Nations people.[142] When Cook's ship later stopped at a Chinese port, the pelts rapidly sold at high prices, and were soon known as "soft gold". As word spread, people from all over Europe and North America began to arrive in the Pacific Northwest to trade for sea otter furs.[142]

Russian hunting expanded to the south, initiated by American ship captains, who subcontracted Russian supervisors and Aleut hunters [143] in what are now Washington, Oregon, and California. Between 1803 and 1846, 72 American ships were involved in the otter hunt in California, harvesting an estimated 40,000 skins and tails, compared to only 13 ships of the Russian-American Company, which reported 5,696 otter skins taken between 1806 and 1846.[144] In 1812, the Russians founded an agricultural settlement at what is now Fort Ross in northern California, as their southern headquarters.[142] Eventually, sea otter populations became so depleted, commercial hunting was no longer viable. It had stopped the Aleutian Islands, by 1808, as a conservation measure imposed by the Russian-American Company.[145] Further restrictions were ordered by the Company in 1834.[145] When Russia sold Alaska to the United States in 1867, the Alaska population had recovered to over 100,000, but Americans resumed hunting and quickly extirpated the sea otter again.[146] Prices rose as the species became rare. During the 1880s, a pelt brought $105 to $165 in the London market, but by 1903, a pelt could be worth as much as $1,125.[67] In 1911, Russia, Japan, Great Britain (for Canada) and the United States signed the Treaty for the Preservation and Protection of Fur Seals, imposing a moratorium on the harvesting of sea otters.[147] So few remained, perhaps only 1,000–2,000 individuals in the wild, that many believed the species would become extinct.[4]

Recovery and conservation[edit]

In the wake of the Exxon Valdez oil spill, heavy sheens of oil covered large areas of Prince William Sound.

During the 20th century, sea otter numbers rebounded in about two-thirds of their historic range, a recovery that is considered one of the greatest successes in marine conservation.[148] However, the IUCN still lists the sea otter as an endangered species, and describes the significant threats to sea otters as oil pollution, predation by killer whales, poaching, and conflicts with fisheries – sea otters can drown if entangled in fishing gear.[1] The hunting of sea otters is no longer legal except for limited harvests by indigenous peoples in the United States.[149] Poaching was a serious concern in the Russian Far East immediately after the collapse of the Soviet Union in 1991; however, it has declined significantly with stricter law enforcement and better economic conditions.[95]

The most significant threat to sea otters is oil spills.[55] They are particularly vulnerable, as they rely on their fur to keep warm. When their fur is soaked with oil, it loses its ability to retain air, and the animals can quickly die from hypothermia.[55] The liver, kidneys, and lungs of sea otters also become damaged after they inhale oil or ingest it when grooming.[55] The Exxon Valdez oil spill of 24 March 1989 killed thousands of sea otters in Prince William Sound, and as of 2006, the lingering oil in the area continues to affect the population.[150] Describing the public sympathy for sea otters that developed from media coverage of the event, a U.S. Fish and Wildlife Service spokesperson wrote:

As a playful, photogenic, innocent bystander, the sea otter epitomized the role of victim ... cute and frolicsome sea otters suddenly in distress, oiled, frightened, and dying, in a losing battle with the oil.[4]

The small geographic ranges of the sea otter populations in California, Washington, and British Columbia mean a single major spill could be catastrophic for that state or province.[4][45][51] Prevention of oil spills and preparation for the rescue of otters in the event of one are major areas of focus for conservation efforts. Increasing the size and range of sea otter populations would also reduce the risk of an oil spill wiping out a population.[4] However, because of the species' reputation for depleting shellfish resources, advocates for commercial, recreational, and subsistence shellfish harvesting have often opposed allowing the sea otter's range to increase, and there have even been instances of fishermen and others illegally killing them.[151]

Sea otters in the Olympic Coast National Marine Sanctuary – note the unusual shape of the hind feet, in which the outer toes are longest.

In the Aleutian Islands, a massive and unexpected disappearance of sea otters has occurred in recent decades. In the 1980s, the area was home to an estimated 55,000 to 100,000 sea otters, but the population fell to around 6,000 animals by 2000.[108] The most widely accepted, but still controversial, hypothesis is that killer whales have been eating the otters. The pattern of disappearances is consistent with a rise in predation, but there has been no direct evidence of orcas preying on sea otters to any significant extent.[97]

Another area of concern is California, where recovery began to fluctuate or decline in the late 1990s.[152] Unusually high mortality rates amongst adult and subadult otters, particularly females, have been reported.[94] Necropsies of dead sea otters indicate diseases, particularly Toxoplasma gondii and acanthocephalan parasite infections, are major causes of sea otter mortality in California.[153] The Toxoplasma gondii parasite, which is often fatal to sea otters, is carried by wild and domestic cats and by opossums, and may be transmitted by domestic cat droppings flushed into the ocean via sewage systems.[153][154] Although disease has clearly contributed to the deaths of many of California's sea otters, it is not known why the California population is apparently more affected by disease than populations in other areas.[153]

Sea otter habitat is preserved through several protected areas in the United States, Russia and Canada. In marine protected areas, polluting activities such as dumping of waste and oil drilling are typically prohibited.[155] An estimated 1,200 sea otters live within the Monterey Bay National Marine Sanctuary, and more than 500 live within the Olympic Coast National Marine Sanctuary.[156][157]

Economic impact[edit]

Some of the sea otter's preferred prey species, particularly abalone, clams, and crabs, are also food sources for humans. In some areas, massive declines in shellfish harvests have been blamed on the sea otter, and intense public debate has taken place over how to manage the competition between sea otters and humans for seafood.[158]

Sea otters like this one near Moss Landing are a tourist attraction in the Monterey Bay area in California.

The debate is complicated because sea otters have sometimes been held responsible for declines of shellfish stocks that were more likely caused by overfishing, disease, pollution, and seismic activity.[51][159] Shellfish declines have also occurred in many parts of the North American Pacific coast that do not have sea otters, and conservationists sometimes note the existence of large concentrations of shellfish on the coast is a recent development resulting from the fur trade's near-extirpation of the sea otter.[159] Although many factors affect shellfish stocks, sea otter predation can deplete a fishery to the point where it is no longer commercially viable.[158] Scientists agree that sea otters and abalone fisheries cannot exist in the same area,[158] and the same is likely true for certain other types of shellfish, as well.[108]

Many facets of the interaction between sea otters and the human economy are not as immediately felt. Sea otters have been credited with contributing to the kelp harvesting industry via their well-known role in controlling sea urchin populations; kelp is used in the production of diverse food and pharmaceutical products.[160] Although human divers harvest red sea urchins both for food and to protect the kelp, sea otters hunt more sea urchin species and are more consistently effective in controlling these populations.[161] The health of the kelp forest ecosystem is significant in nurturing populations of fish, including commercially important fish species.[160] In some areas, sea otters are popular tourist attractions, bringing visitors to local hotels, restaurants, and sea otter-watching expeditions.[160]

Role in human cultures[edit]

AleutKalan1.jpg
Aleut carving of a sea otter hunt

Left: Aleut sea otter amulet in the form of a mother with pup. Above: Aleut carving of a sea otter hunt on a whalebone spear. Both items are on display at the Peter the Great Museum of Anthropology and Ethnography in St. Petersburg. Articles depicting sea otters were considered to have magical properties.[162]

For many maritime indigenous cultures throughout the North Pacific, especially the Ainu in the Kuril Islands, the Koryaks and Itelmen of Kamchatka, the Aleut in the Aleutian Islands, the Haida of Haida Gwaii[163] and a host of tribes on the Pacific coast of North America, the sea otter has played an important role as a cultural, as well as material, resource. In these cultures, many of which have strongly animist traditions full of legends and stories in which many aspects of the natural world are associated with spirits, the sea otter was considered particularly kin to humans. The Nuu-chah-nulth, Haida, and other First Nations of coastal British Columbia used the warm and luxurious pelts as chiefs' regalia. Sea otter pelts were given in potlatches to mark coming-of-age ceremonies, weddings, and funerals.[56] The Aleuts carved sea otter bones for use as ornaments and in games, and used powdered sea otter baculum as a medicine for fever.[164]

Sea otters at the Lisbon Oceanarium show their flexibility when grooming

Among the Ainu, the otter is portrayed as an occasional messenger between humans and the creator.[165] The sea otter is a recurring figure in Ainu folklore. A major Ainu epic, the Kutune Shirka, tells the tale of wars and struggles over a golden sea otter. Versions of a widespread Aleut legend tell of lovers or despairing women who plunge into the sea and become otters.[166] These links have been associated with the many human-like behavioral features of the sea otter, including apparent playfulness, strong mother-pup bonds and tool use, yielding to ready anthropomorphism.[167] The beginning of commercial exploitation had a great impact on the human, as well as animal, populations  the Ainu and Aleuts have been displaced or their numbers are dwindling, while the coastal tribes of North America, where the otter is in any case greatly depleted, no longer rely as intimately on sea mammals for survival.[168]

Since the mid-1970s, the beauty and charisma of the species have gained wide appreciation, and the sea otter has become an icon of environmental conservation.[152] The round, expressive face and soft, furry body of the sea otter are depicted in a wide variety of souvenirs, postcards, clothing, and stuffed toys.[169]

H1N1 host[edit]

According to the U.S. Geological Survey and the CDC, northern sea otters, off the coast of Washington state, are infected with the H1N1 flu virus and "may be a newly identified animal host of influenza viruses".[170]

Aquariums and zoos[edit]

Sea otters can do well in captivity, and are featured in over 40 public aquariums and zoos.[171] The Seattle Aquarium became the first institution to raise sea otters from conception to adulthood with the birth of Tichuk in 1979, followed by three more pups in the early 1980s.[172] In 2007, a YouTube video of two sea otters holding paws drew 1.5 million viewers in two weeks, and currently has over 17 million views.[173] Filmed five years previously at the Vancouver Aquarium, it was YouTube's most popular animal video at the time, although it has since been surpassed. The lighter-colored otter in the video is Nyac, a survivor of the 1989 Exxon Valdez oil spill.[174] Nyac died in September 2008, at the age of 20.[175]

See also[edit]

Notes[edit]

  1. ^ a b Doroff, A. & Burdin, A. (2011). "Enhydra lutris". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 18 January 2012. 
  2. ^ Riedman, M.L. and J.A. Estes (1990). "The sea otter (Enhydra lutris): behavior, ecology, and natural history". U.S. Fish and Wildlife Service Biological Report (Washington, D.C.): 126. http://www.fort.usgs.gov/Products/Publications/pub_abstract.asp?PubID=2183. Retrieved 2010-09-27.
  3. ^ Tiny Sea Otter Siblings Fight the Odds, Wired Science, June 28, 2013
  4. ^ a b c d e f g h i j k "Final Washington State Sea Otter Recovery Plan". Washington Department of Fish and Wildlife. Archived from the original on October 18, 2007. Retrieved 2007-11-29. 
  5. ^ a b Love, p. 9
  6. ^ Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. OCLC 17396377. 
  7. ^ Nickerson, p. 19
  8. ^ a b c d e Silverstein, p. 34
  9. ^ a b c d e f g h i "Enhydra Lutis". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 2007-11-24. 
  10. ^ Kenyon, p. 4
  11. ^ a b c VanBlaricom, p. 11
  12. ^ Koepfli, K.-P; Wayne, R.K. (December 1998). "Phylogenetic relationships of otters (Carnivora: Mustelidae) based on mitochondrial cytochrome b sequences". Journal of Zoology 246 (4): 401–416. doi:10.1111/j.1469-7998.1998.tb00172.x. 
  13. ^ Koepfli KP, Deere KA, Slater GJ et al. (2008). "Multigene phylogeny of the Mustelidae: resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation". BMC Biology 6: 10. doi:10.1186/1741-7007-6-10. PMC 2276185. PMID 18275614. 
  14. ^ Love, pp. 15–16
  15. ^ Love, pp. 4–6
  16. ^ Love, p. 6
  17. ^ Willemsen GF (1992). "A revision of the Pliocene and Quaternary Lutrinae from Europe". Scripta Geologica 101: 1–115. 
  18. ^ "Enhydra lutris". Integrated Taxonomic Information System. Retrieved 18 March 2006. 
  19. ^ a b c d e f g Wilson, Don. E. et al. (February 1991). "Geographic Variation in Sea Otters, Enhydra lutris". Journal of Mammalogy 72 (1): 22–36. doi:10.2307/1381977. JSTOR 1381977. 
  20. ^ a b Heptner & Sludskii 2002, p. 1349
  21. ^ Sea otter researcher Karl W. Kenyon, after whom the subspecies is named, was never convinced that E. l. kenyoni was a distinct subspecies."Soundings: The Newsletter of the Monterey Bay Chapter of ACS" (PDF). American Cetacean Society Monterey Bay Chapter. June 2007. Retrieved 2008-01-22. 
  22. ^ The Wildlife Year. The Reader's Digest Association, Inc. (1991). ISBN 0-276-42012-8.
  23. ^ a b c d e f "Sea Otter, Enhydra lutris at MarineBio.org". Retrieved 2007-11-23. 
  24. ^ Heptner & Sludskii 2002, p. 1342
  25. ^ a b c Nickerson, p. 21
  26. ^ Silverstein, p. 14
  27. ^ Kenyon, pp. 37–39
  28. ^ Love, p. 21 and 28
  29. ^ a b Love, p. 27
  30. ^ a b Silverstein, p. 13
  31. ^ a b Love, p. 21
  32. ^ a b Kenyon, p. 70
  33. ^ Silverstein, p. 11
  34. ^ Kenyon, p. 62
  35. ^ Love, p. 22
  36. ^ VanBlaricom, p. 64
  37. ^ "USFWS Species Profile: Southern sea otter (Enhydra lutris nereis)". Retrieved 2008-02-23. 
  38. ^ Kenyon, p. 55
  39. ^ Love, p. 23
  40. ^ Kenyon, p. 56
  41. ^ Kenyon, p. 43
  42. ^ Love, p. 74
  43. ^ Kenyon, p. 47
  44. ^ VanBlaricom, p. 17
  45. ^ a b "Sea Otter" (PDF). British Columbia Ministry of Environment, Lands and Parks. October 1993. Archived from the original on February 16, 2008. Retrieved 2007-12-13. 
  46. ^ Love, p.24
  47. ^ Ortiz RM (June 2001). "Osmoregulation in marine mammals". The Journal of Experimental Biology 204 (11): 1831–44. PMID 11441026. 
  48. ^ a b c Love, pp. 69–70
  49. ^ Love, pp. 70–71
  50. ^ Kenyon, p. 76
  51. ^ a b c d e f g Reitherman, Bruce (Producer and photographer) (1993). Waddlers and Paddlers: A Sea Otter Story–Warm Hearts & Cold Water (Documentary). U.S.A.: PBS. 
  52. ^ a b Haley, D. (ed.) (1986). "Sea Otter". Marine Mammals of Eastern North Pacific and Arctic Waters (2nd ed.). Seattle, Washington: Pacific Search Press. ISBN 0-931397-14-6. OCLC 13760343. 
  53. ^ a b VanBlaricom, p. 22
  54. ^ "Sea otter". BBC. Retrieved 2007-12-31. 
  55. ^ a b c d e "Sea otter AquaFact file". Vancouver Aquarium Marine Science Centre. Retrieved 2007-12-05. 
  56. ^ a b Okerlund, Lana (4 October 2007). "Too Many Sea Otters?". Retrieved 2007-01-15. 
  57. ^ a b Love, p. 49
  58. ^ VanBlaricom, p. 45
  59. ^ a b c d e VanBlaricom, pp. 42–45
  60. ^ Love, p. 50
  61. ^ a b Kenyon, p. 77
  62. ^ Kenyon, pp. 78–79
  63. ^ a b Silverstein, p. 61
  64. ^ At least one female is known to have died from an infected nose. (Love, p. 52)
  65. ^ a b Love, p. 54
  66. ^ Silverstein, p. 30
  67. ^ a b c d Nowak, Roland M. (1991). Walker's Mammals of the World Volume II (Fifth ed.). Baltimore and London: The Johns Hopkins University Press. pp. 1141–1143. ISBN 0-8018-3970-X. 
  68. ^ Kenyon, p.44
  69. ^ Love, pp. 56–61
  70. ^ a b Love, p. 58
  71. ^ Silverstein, pp. 31–32
  72. ^ Love, p. 61
  73. ^ a b Love, p. 63
  74. ^ Love, p. 62
  75. ^ Love, p. 59
  76. ^ Kenyon, p. 89
  77. ^ Silverstein, p. 31
  78. ^ Silverstein, p. 28
  79. ^ Love, p. 53
  80. ^ VanBlaricom, p. 71
  81. ^ VanBlaricom, pp. 40–41
  82. ^ VanBlaricom, p. 41
  83. ^ Heather S. Harris et al. Lesions and Behavior Associated with Forced Copulation of Juvenile Pacific Harbor Seals (Phoca vitulina richardsi) by Southern Sea Otters (Enhydra lutris nereis) In: Aquatic Mammals 2010, 36(4), 331-341, DOI 10.1578/AM.36.4.2010.331
  84. ^ Silverstein, p. 17
  85. ^ Nickerson, p. 49
  86. ^ Silverstein, p. 19
  87. ^ VanBlaricom, p. 14
  88. ^ Kenyon, p. 133
  89. ^ Love, pp. 67–69
  90. ^ VanBlaricom, p. 54
  91. ^ a b c d Kornev S.I., Korneva S.M. (2004) Population dynamics and present status of sea otters (Enhydra lutris) of the Kuril Islands and southern Kamchatka. Marine Mammals of the Holarctic, Proceedings of 2004 conference. p. 273–278.
  92. ^ a b "Sea Otters – Southwest Alaska Sea Otter Recovery Team (SWAKSORT)". U.S. Fish and Wildlife Service – Alaska. Retrieved 2008-01-15. 
  93. ^ a b Barrett-Lennard, Lance (20 October 2004). "British Columbia: Sea Otter Research Expedition". Vancouver Aquarium. Retrieved 2007-12-11. 
  94. ^ a b c Leff, Lisa (15 June 2007). "California otters rebound, but remain at risk". Associated Press. Retrieved 2007-12-25. 
  95. ^ a b VanBlaricom, p. 62
  96. ^ Nickerson, p. 46
  97. ^ a b Schrope M (February 2007). "Food chains: killer in the kelp". Nature 445 (7129): 703–5. doi:10.1038/445703a. PMID 17301765. 
  98. ^ "Sea Otter Recovery on Vancouver Island's West Coast". Bamfield Marine Sciences Centre Public Education Programme. Retrieved 2011-08-22. 
  99. ^ Sea Otter, Species at Risk Public Registry
  100. ^ Sea Otters, Fisheries and Oceans Canada
  101. ^ a b For southern sea otters to be considered for removal from threatened species listing, the population would have to exceed 3,090 for three consecutive years.</ref name=USGS> "California’s Sea Otter Numbers Continue Slow Climb". USGS. 2013-09-12. Retrieved 2013-10-20. 
  102. ^ Brian Hatfield, Tim Tinker (2012-08-12). Spring 2012 Mainland California Sea Otter Census Results (Report). USGS Western Ecological Research Center.
  103. ^ a b "Spring 2007 Mainland California Sea Otter Survey Results". U.S. Geological Survey. 30 May 2007. Retrieved 2008-02-23. 
  104. ^ Silverstein, p. 41
  105. ^ a b c University of California — Santa Cruz (18 January 2008). "Sea Otter Show Striking Variability In Diets And Feeding Strategies". ScienceDaily. Retrieved 2008-01-20. 
  106. ^ a b "U.S. Fish and Wildlife Service Proposes that Southern Sea Otter Translocation Program be Terminated" (PDF). U.S. Fish and Wildlife Service. 5 October 2005. Retrieved 2008-04-10. 
  107. ^ "Service Proposes to End Southern Sea Otter Translocation Program". USFWS Pacific Southwest Region. 2011-08-17. Retrieved 2012-12-21. 
  108. ^ a b c "Balance sought in sea otter conflict". CNN. March 24, 1999. Retrieved 2008-01-25. 
  109. ^ Kenneth R. Weiss (2012-12-20). "U.S. will let otters roam along Southern California coastline". Los Angeles Times. Retrieved 2012-12-21. 
  110. ^ Southern Sea Otters. nrdc.org
  111. ^ Adele Ogden (1975). The California sea otter trade, 1784–1848. Berkeley, California: University of California Press. p. 54. ISBN 978-0-520-02806-7. Retrieved 2010-07-03. 
  112. ^ Hubert Howe Bancroft, Alfred Bates, Ivan Petroff, William Nemos (1887). History of Alaska: 1730–1885. San Francisco, California: A. L. Bancroft & company. p. 482. Retrieved 2010-09-26. 
  113. ^ Suzanne Stewart and Adrian Praetzellis (November 2003). Archeological Research Issues for the Point Reyes National Seashore – Golden Gate National Recreation Area (Report). Anthropological Studies Center, Sonoma State University. p. 335. http://www.sonoma.edu/asc/projects/pointreyes/overview4.pdf. Retrieved 2010-09-26.
  114. ^ Bob Battersby, Preston Maginis, Susan Nielsen, Gary Scales, Richard Torney, and Ed Wynne (May 2008). Ross, California – The people, the places, the history. Ross Historical Society. Retrieved 2010-11-03. 
  115. ^ Ben Young Landis (2010-08-03). "California Sea Otter Numbers Drop Again". U. S. Geological Survey. Retrieved 2011-01-23. 
  116. ^ "Spring 2010 Mainland California Sea Otter Survey Results". USGS Western Ecological Research Center. Retrieved 2010-09-26. 
  117. ^ Kenneth R. Weiss (2010-09-23). "Another deadly challenge for the sea otter". Los Angeles Times. Retrieved 2010-11-10. 
  118. ^ Miller MA, Kudela RM, Mekebri A, Crane D, Oates SC et al. (2010-09-10). Thompson, Ross, ed. "Evidence for a Novel Marine Harmful Algal Bloom: Cyanotoxin (Microcystin) Transfer from Land to Sea Otters". PLoS ONE 5 (9): e12576. doi:10.1371/journal.pone.0012576. PMC 2936937. PMID 20844747. Retrieved 2010-11-10. 
  119. ^ Victoria Colliver (2011-01-23). "Sea otter deaths jump in 2010". San Francisco Chronicle. Retrieved 2011-01-23. 
  120. ^ USGS (April 2012). "Number of dead California sea otters a record high in 2011". Marine Pollution Bulletin 64. doi:10.1016/j.marpolbul.2012.03.002. Retrieved 2012-12-22. 
  121. ^ "Rare sighting of sea otter off Laguna Beach". KABC-TV/DT. 2011-12-07. 
  122. ^ Jameson, Ronald James (1975). An Evaluation of Attempts to Reestablish the Sea Otter in Oregon (M.Sc. thesis). Oregon State University. OCLC 9653603. Retrieved 2009-12-30. 
  123. ^ Quinn, Beth (2004-10-17). "Sea otter's stay raises scientists' hopes". Oregonlive. Retrieved 2009-12-30. 
  124. ^ "Rare sea otter confirmed at Depoe Bay". Oregonlive. February 20, 2009. Retrieved 2009-02-27. 
  125. ^ a b c d VanBlaricom pp. 18–29
  126. ^ Love, p. 96
  127. ^ a b Kenyon, p. 121
  128. ^ Love, p. 76
  129. ^ Kenyon, p. 119
  130. ^ VanBlaricom, p. 29
  131. ^ VanBlaricom, p. 30
  132. ^ Nickerson, p. 57
  133. ^ "Aquatic Species at Risk – Species Profile – Sea Otter". Fisheries and Oceans Canada. Archived from the original on November 23, 2007. Retrieved 2007-11-29. 
  134. ^ a b c d VanBlaricom, p. 33
  135. ^ a b Nickerson, P. "Sea Otter Frequently Asked Questions". Defenders of Wildlife. p. 65. Archived from the original on 9 July 2011. Retrieved 31 August 2011. 
  136. ^ a b c d Silverstein, p. 35
  137. ^ James R Gibson, "Feeding the Russian Fur Trade",1969, page 17
  138. ^ Brass E. (1911) Aus dem Reiche der Pelze, Bd III, Berlin
  139. ^ a b Silverstein, p. 37
  140. ^ Gedney, Larry (6 May 1983). "The Aleut and the Otter". Retrieved 2008-02-23. 
  141. ^ Middleton, pg.8,
  142. ^ a b c Silverstein, p. 38
  143. ^ Farris, pg.21,
  144. ^ Mathes, pg.326,
  145. ^ a b Middleton, pg.4
  146. ^ Silverstein, p. 40
  147. ^ VanBlaricom, p. 50
  148. ^ VanBlaricom, p. 53
  149. ^ VanBlaricom, p. 65
  150. ^ Weise, Elizabeth (31 January 2007). "Damage of Exxon Valdez endures". USA Today. Associated Press. Retrieved 2001-12-25. 
  151. ^ Nickerson, pp. 47–48
  152. ^ a b "Sea Otters: Species Description". Alaska SeaLife Center. Retrieved 2007-01-15. 
  153. ^ a b c Kreuder C, Miller MA, Jessup DA et al. (July 2003). "Patterns of mortality in southern sea otters (Enhydra lutris nereis) from 1998–2001". Journal of Wildlife Diseases 39 (3): 495–509. doi:10.7589/0090-3558-39.3.495. PMID 14567210. 
  154. ^ "Parasite in cats killing sea otters". NOAA magazine (National Oceanic and Atmospheric Administration). 21 January 2003. Retrieved 2007-11-24. 
  155. ^ "National Marine Sanctuaries Regulations". NOAA. Retrieved 2008-03-19. 
  156. ^ "Monterey Bay National Marine Sanctuary". City of Monterey. Archived from the original on 2008-01-11. Retrieved 2008-03-19. 
  157. ^ "Olympic Coast National Marine Sanctuary History". NOAA. Retrieved 2008-03-19. 
  158. ^ a b c VanBlaricom, p. 34
  159. ^ a b Love, pp. 93–98
  160. ^ a b c Silverstein, p. 49
  161. ^ Nickerson, p. 70
  162. ^ Lyapunova R.G. (1963) Museum materials on the Aleuts. Catalog of the Museum of anthropology and ethnography. Academy of Sciences, USSR, vol. XXI.
  163. ^ Szpak, Paul; Orchard, Trevor J.; McKechnie, Iain; Gröcke, Darren R. (2012). "Historical Ecology of Late Holocene Sea Otters (Enhydra lutris) from Northern British Columbia: Isotopic and Zooarchaeological Perspectives". Journal of Archaeological Science 39 (5): 1553–1571. doi:10.1016/j.jas.2011.12.006. 
  164. ^ Love, pp 34–35
  165. ^ Chamberlain, B. (1888). Aino Folk Tales. London,: The folk-lore society, private printing. 
  166. ^ F. A. Golder. (1905) Aleutian Stories. The Journal of American Folklore, Vol. 18, No. 70. (July–September), pp. 215–222.
  167. ^ N. I. Barabash-Nikiforov (1947) Калан (Enhydra lutris L.) его биология и вопросы хозяйства (The sea otter (Engydra lutris L): biology and management), Published by: Natural Preservation Ministry of the RSFSR, Moscow.
  168. ^ Hatch, David R. (2002) Elakha: Sea Otters, Native People, and European Colonization in the North Pacific. In Changing Landscapes: Proceedings of the 5th and 6th Annual Coquille Cultural Preservation Conferences. Donald B. Ivy and R. Scott Byram, eds. Pp. 79–88. North Bend, OR: Coquille Indian Tribe.
  169. ^ Love, p. 97
  170. ^ Rogall, Gail Moede (2014-04-08). "Sea Otters Can Get the Flu, Too". U.S. Department of the Interior, U.S. Geological Survey. Retrieved 11 April 2014. 
  171. ^ VanBlaricom p. 69
  172. ^ "Seattle Aquarium's Youngest Sea Otter Lootas Becomes a Mom". Business Wire. April 19, 2000. Retrieved 2007-03-09. 
  173. ^ cynthiaholmes (2007-03-19). "Otters holding hands". YouTube. Retrieved 2008-03-24. 
  174. ^ "Vancouver sea otters a hit on YouTube". CBC News. 3 April 2007. Retrieved 2007-01-15. [dead link]
  175. ^ "Vancouver Aquarium's oldest sea otter, Nyac, passes". Vancouver Aquarium. September 23, 2008. Retrieved 2008-10-28. 

References[edit]

  • Heptner, V. G.; Sludskii, A. A. (2002). Mammals of the Soviet Union. Vol. II, part 1b, Carnivores (Mustelidae and Procyonidae). Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation. ISBN 90-04-08876-8. 
  • Kenyon, Karl W. (1969). The Sea Otter in the Eastern Pacific Ocean. Washington, D.C.: U.S. Bureau of Sport Fisheries and Wildlife. ISBN 0-486-21346-3. 
  • Love, John A. (1992). Sea Otters. Golden, Colorado: Fulcrum Publishing. ISBN 1-55591-123-4. OCLC 25747993. 
  • Nickerson, Roy (1989). Sea Otters, a Natural History and Guide. San Francisco, CA: Chronicle Books. ISBN 0-87701-567-8. OCLC 18414247. 
  • Silverstein, Alvin; Silverstein, Virginia and Robert (1995). The Sea Otter. Brookfield, Connecticut: The Millbrook Press, Inc. ISBN 1-56294-418-5. OCLC 30436543. 
  • Middleton, John (2001). California Academy of Science's Member Newsletter October/November 2001 Maritime Activities And Their Perception Today. San Francisco,California: California Academy of Science. ISSN 1531-2224. 
  • Farris, Glenn (2007). Mains'l Haul, a Journal of Pacific Maritime History, Vol 43. San Diego, California: Maritime Museum of San Diego. ISSN 1540-3386. 
  • Mathes, Michael (2008). The Russian-Mexican Frontier. Jenner, California: Fort Ross Interpretive Association, Inc. ISBN 978-1-60643-951-7. 
  • VanBlaricom, Glenn R. (2001). Sea Otters. Stillwater, MN: Voyageur Press Inc. ISBN 0-89658-562-X. OCLC 46393741. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: There has been some disagreement as to whether the recognition of subspecies is warranted (see reviews by Wilson et al. 1991 and Bodkin and Kenyon 2003). A recent range-wide review of geographic variation of skull characters concluded that three subspecies should be recognized: E. lutris lutris from Asia to the Commander Islands, E. l. nereis in California, and E. l. kenyoni in Alaska (Wilson et al. 1991). The subspecific taxonomy suggested by morphological analyses is largely but not completely supported by subsequent molecular genetic data. Analysis of mitochondrial DNA (mtDNA) variation among eight geographically isolated populations identified four major groups (Cronin et al. 1996, Scribner et al. 1997). The haplotype frequency in the Commander Island population of E. l. lutris is more similar to that observed in the Aleutian-Kodiak grouping, E .l. kenyoni, than to the Asian populations of subspecies E. l. lutris, with which it was aligned by skull morphology. Additionally, the Prince William Sound population differs from the other Alaska populations in haplotype frequency. Subspecies nereis appears to have monophyletic mtDNA, but lutris and kenyoni do not (Cronin et al. 1996). The low level of divergence of sequences of haplotypes on mtDNA suggests that there are no major phylogenetic breaks or long-term barriers to gene flow among sea otter populations (Cronin et al. 1996).

Lidicker and McCollum (1997) examined allozyme variation and found that despite historical population depletion, otters from California have suffered only a small loss in genetic variability. MtDNA data also indiciate that population bottlenecks probably did not result in major losses of genetic variation in individual populations or the species as a whole (Cronin et al. 1996). However, based on microstatellite DNA and mtDNA, Larson et al. (2002) reported that the levels of genetic diversity observed within sea otter populations were relatively low when compared with other mammals and may be the result of fur trade exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!