Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Brief Summary

Description

Most Black Bears hibernate for up to seven months, and do not eat, drink, urinate, or exercise the entire time. In the South, where plant food is available all year, not all bears hibernate—but pregnant females do. The female gives birth to 1-6 cubs (usually 2 or 3) in January, while she is deep asleep in her den. The newborn cubs snuggle next to her for warmth and nurse while she fasts. They grow from a birth weight of 200-450 g each (about 7-16 pounds) to the 2-5 kg they will weigh when the family leaves the den in the spring. Black Bears eat a little meat, and some insects, but they rely on fruit, nuts, and vegetation for the bulk of their nutritional needs. They are not all black. Most are, with brown muzzles, but in some western forests they are brown, cinnamon, or blond, and a few, in southern Alaska and British Columbia, are creamy white or bluish-gray.

Adaptation: In the Black Bear, Ursus americanus, the evolution of typically carnivorous, sharp shearing molars into the flat crushing teeth, typical of bears, is evident.

Links:
Mammal Species of the World
  • Original description: Pallas, P. S., 1770-1780.  Spicilegia zoologica, quibus novae imprimus et obscurae animalium species iconibus, descriptionibus atque commentariis illustrantur cura P.S. Pallas. [fasc. 11-12 imprint 1777-78; fasc. 13 imprint 1779; fasc. 14 imprint 1780]. Berolini, prostant apud Gottl. August. Langed, 14 fasc in 2 volumes.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Cultural Associations

The Black Bear is the mascot of the University of Maine.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Ian Cleary

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

American black bears are found through much of Canada, the United States, and the northern half of Mexico. Although they were extirpated from large portions of their historic range because of habitat loss and (mainly intentional) overexploitation, their occupied range has been expanding in recent years (Pelton et al. 1999, Williamson 2002). The species has, nevertheless been extirpated from large parts of its former range, especially in the Midwest of the United States, and in Mexico. American black bears presently occupy all provinces and territories of Canada, except Prince Edward Island (where they were extirpated in 1937), 41 U.S. states (with occasional sightings in at least 3 others), and 8 states of northern Mexico. The species never existed outside of these three countries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Global Range: (100-250 square km (about 40-100 square miles)) Black bears exist throughout most of North America north of central Mexico, except the desert region of the southwestern United States, from north-central Alaska across boreal Canada to Labrador and Newfoundland, and south to central California, northern Nevada, northern Nayarit and southern Tamaulipas (Mexico), and Florida (Wozencraft, in Wilson and Reeder 1993). However, the species has been eliminated from most of the Midwest by intensive agriculture and human settlement. Now it occurs primarily in remaining large forested tracts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

Black bears can be found from northern Alaska east across Canada to Labrador and Newfoundland, and south through much of Alaska, virtually all of Canada, and most of the United States into central Mexico.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Black bears can be found from northern Alaska east across Canada to Labrador and Newfoundland, and south through much of Alaska, virtually all of Canada, and most of the U.S. into central Mexico (Nayarit and Tamaulipas states).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North America

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Black bears are usually black in color, particularly in eastern North America. They usually have a pale muzzle which contrasts with their darker fur and may sometimes have a white chest spot. Western populations are usually lighter in color, being more often brown, cinnamon, or blonde. Some populations in coastal British Columbia and Alaska are creamy white or bluish gray. Total body length in males ranges from 1400 to 2000 mm, and from 1200 to 1600 mm in females. Tail length ranges from 80 to 140 mm. Males weigh between 47 and 409 kg, females weigh between 39 and 236 kg.

Black bears are distinguished from grizzly or brown bears (Ursus_arctos) by their longer, less heavily furred ears, smaller shoulder humps, and a convex, rather than concave, profile.

Range mass: 39.0 to 409.0 kg.

Range length: 1200.0 to 2000.0 mm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Black bears are usually black in color, particularly in eastern North America. They usually have a pale muzzle which contrasts with their darker fur and may sometimes have a white chest spot. Western populations are usually lighter in color, being more often brown, cinnamon, or blonde. Some populations in coastal British Columbia and Alaska are creamy white or bluish gray. Total body length in males ranges from 1400 to 2000 mm, and from 1200 to 1600 mm in females. Tail length ranges from 80 to 140 mm. Males weigh between 47 and 409 kg, females weigh between 39 and 236 kg. The distance between the canine teeth is about 4.5 to 5 cm.

Black bears are distinguished from grizzly or brown bears (Ursus arctos) by their longer, less heavily furred ears, smaller shoulder humps, and a convex, rather than concave, profile.

Range mass: 39.0 to 409.0 kg.

Range length: 1200.0 to 2000.0 mm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 160 cm

Weight: 200000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: The largest males may be nearly twice as heavy as the heaviest females.

Length:
Range: 1,44-2,000 mm males; 1,200-1,600 mm females

Weight:
Average: 120 kg males; 80 kg females
Range: 47-409 kg males; 39-236 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from the grizzly bear in having the claws of the forefeet only a little longer than those on the hind feet (about twice as long in the grizzly), length of second upper molar less than 29.5 mm (in part of range where grizzly occurs), snout profile straight rather than dished, and in lacking a prominent hump at the shoulders; maximum size of black bear is less than that of the grizzly (170-280 cm head and body length) (Nowak 1991, Hall 1981).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Ursus americanus
Catalog Number: USNM 87620
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Keen
Year Collected: 1896
Locality: Massett, Graham Islands, Queen Charlotte Islands, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lectotype for Ursus americanus
Catalog Number: USNM A992
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Clark
Locality: Rio Mimbres, Copper Mines Near, And Near Present Location Of Georgetown, Grant County, New Mexico, United States, North America
  • Lectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Ursus americanus
Catalog Number: USNM A3484
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): G. Wurdemann
Year Collected: 1858
Locality: Key Biscayne, Miami-Dade County, Florida, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Ursus americanus
Catalog Number: USNM 199494
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Cast
Collector(s): S. Rhoads
Year Collected: 1915
Locality: Union County, Pennsylvania, United States, North America
  • Type: Shoemaker, H. W. 1913. Stories Of Great Pennsylvania Hunters. 25.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Ursus americanus
Catalog Number: USNM 116952
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): E. Nelson & E. Goldman
Year Collected: 1902
Locality: Sierra Guadalupe, Coahuila, Mexico, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
American black bears are primarily a species of temperate and boreal forests, but they also range into subtropical areas of Florida and Mexico as well as into the subarctic. They live at elevations ranging from sea level to 3,500 m, and inhabit areas as diverse as dry Mexican scrub forests, Louisiana swamps, Alaskan rainforests, and Labrador tundra (where they occupy the typical niche of the brown/grizzly bear [U. arctos]; Veitch and Harrington 1996). Between these extremes they occupy assorted deciduous and coniferous forest types, each providing a different array of foods.

The American black bear is a generalist, opportunist, omnivore. Depending on location and season, they consume herbaceous vegetation, roots, buds, numerous kinds of fleshy fruits, nuts, insects in life stages from egg to adult, and vertebrates from fish to mammals, including their own kills as well as carrion. Moreover, they readily consume various human-related foods, from garbage and birdseed to a variety of agricultural products, including standing corn and oats just before harvest, apples, and honey and brood in apiaries. The ability of black bears to vary their diet with the circumstances has enabled them to persist not only in a diversity of habitat types, but also in highly fragmented forested areas in proximity to humans (Pelton 2003).

A key habitat feature in many areas is a source of fall mast that enables black bears to increase their fat reserves in preparation for winter. Historically, American chestnuts (Castanea dentata) likely were a key fall food in eastern North America, but since a blight eliminated this food source in the early and mid 1900s, oak (Quercus spp.) acorns and beechnuts (Fagus grandifolia) have become the principal fall foods for bears throughout this region (Vaughan 2002). In areas where oaks and beech are absent or uncommon, hazelnuts (Corylus spp.), whitebark pine nuts (Pinus albicaulis), madrone (Arbutus xalapensis), mansanita (Arctostaphylos spp.), huckleberries (Vaccinium spp.), buffalo berries (Shepherdia canadensis) or other fruits, or sometimes meat, are the fall dietary mainstays. In the southwestern U.S. and in Mexico, succulents such as yucca (Yucca spp.) and cacti also play important roles in providing food, especially during drought (Doan-Crider 2003).

American black bears hibernate for up to 7 months in the northern portions of their range, but considerably shorter in more southern areas. In some southern areas, where food is available year-round, they may remain active during winter. However, all parturient females den and give birth to cubs, typically in January–February. Although mating occurs in May–July, implantation is delayed and active gestation is only 2 months. Females give birth beginning at age 3–8 years, depending on food availability and hence their body weight, and can produce cubs every other year (in places with less food, this interval is often extended to 3 years). Average litter size is approximately 2.5 cubs in eastern and 2.0 cubs in western North America (Alt 1989).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Cover Requirements

More info for the terms: cover, density, mast, philopatric

See Denning and Preferred Habitat.

Home range and density: Home range size, distribution within home ranges, and density of American black bears are determined by sex, habitat quality, population density, distribution of food, breeding season, and topography [9,64,76,113,130,149,187,201,208,211]. Adult males have the largest home ranges, followed by adult females, yearling males, and yearling females [9,104,130,132,149,250].

Home ranges may or may not overlap between sexes and age classes depending on intraspecific relationships and habitat quality [9,104,114,130,149,187,208]. Females that are related usually have overlapping home ranges [9,106,114,148,187,187,213,223]; however, Schenk and others [223] found that home range overlap in Chapleau Crown Game Preserve, Ontario, was not a consequence of natal philopatric tendencies. Usually, subadult males and subadult females are allowed to stay on their mothers' home ranges for their first year of independence before dispersing (see Dispersal) [132]. After female yearlings separate from their mothers (16-17 months of age), they live alone within their natal home range. As they get older, some expand their ranges, some leave to establish territories in adjacent areas, and some disperse several kilometers away. Mothers may shift their territories away from their daughters, probably to avoid crowding [208]. Home ranges of adult males and females may overlap. In the Pisgah Bear Sanctuary, home ranges of males and females overlapped at home range peripheries and in core areas. Overlap increased during summer and decreased during autumn [106].

Home ranges may be smaller and have more overlap in mild climates and productive habitats [9,104,106,114,132,148,187,188,201,223]. In boreal forests, home ranges do not usually overlap, and territoriality between adult females is common [106,114,208,213]. This may be a consequence of low habitat productivity [106]. In ponderosa pine-mixed conifer forests in north-central Arizona, home range size was 5 times larger in fragmented forest areas than nonfragmented areas [178].

Home range size is largest during the breeding season and smallest before entry into dens in fall and emergence from dens in spring. Home range size of adult females and cubs peaks when foods are most abundant, from September to October [76]. During the breeding season in Superior National Forest, Minnesota, home ranges of males overlapped each other. Each breeding range included the territories of 7 to 15 female territories, and no males had exclusive access to any one female. After the breeding season, males migrated up to 124 miles (200 km) to forage. Foraging occurred between females' territories or on the outer 0.2 mile (0.4 km) of them. All subadult males (n=20) dispersed a mean of 38 miles (61 km; range= 8-136 miles (13-219 km)). Most males established their home ranges by 4 years old and used the home range for mating for at least 1 year after [208].

Topography may determine home range size, access to food resources, and/or potential mates. In Pisgah Bear Sanctuary, topography constrained size and shape of home ranges. The perimeter of home ranges aligned with ridges and valleys and home ranges were oriented on topographic features such as basins and watersheds. Steep slopes were utilized because they contained high densities of berries. American black bears avoided crossing over ridgetops to slopes on the other side probably due to high energetic costs and to avoid humans hiking along ridgelines [201].

Habitat use within home ranges is dictated by seasonal food production and breeding season, but a "core" use area may remain essentially unchanged throughout the year [114,149,187]. In Superior National Forest, foraging becomes the dominant activity after the breeding season ends, coinciding with the ripening of soft and hard mast. Between 40% and 69% of males and females, including females with cubs, foraged >4 miles (7 km) outside of their home ranges during late summer to access areas containing abundant food [208].

The table below shows mean annual home range sizes for American black bears in various geographic regions of the United States:

Mean annual home range sizes for American black bears (km²)
Location

Gender

Male Female
Okanogan National Forest, Washington 289.7 (n=26) 37.1 (n=11) [75]
Long Island, Washington 5.1 (n=10) 2.4 (n=13) [148]
Weiser River, Idaho 112.1 (n=2) 48.9 (n=7) [9]
Whitefish Range, Montana 30.1 (n=16) 5.2 (n=31) [114]
Upper Peninsula of Michigan 75.6 (n=3) 48.1 (n=12) [104]
Big Bend National Park, Texas 97.7 (n=7) 32.1 (n=7) [188]
White River National Wildlife Refuge, Arkansas not available 4.9 (n=16) [187]
Eglin Air Force Base, Florida 351.0 (n=6) 88 (n=3) [250]

Habitat quality and size limit American black bear density. Density of American black bears may be greater in areas with abundant food resources [25,113,114,132,148,208]. On the Neuse-Pamlico Peninsula, densities and home ranges of adult female American black bears were higher in areas dominated by pocosins, marshes, and clearcuts compared to areas dominated by large loblolly pine plantations due to superior cover and food resources. Annual home range size for females was 6.6 km² (95% harmonic mean, n=8), and density was 1.35 American black bear/ km² in pocosins, marshes, and clearcuts. Annual home range size was 11.6 km² (n=5), and density was 0.53 American black bear/km² in loblolly pine plantations [113].

The estimated density of American black bears in west-central Idaho and the Shasta-Trinity National Forest, California, was 1 American black bear/0.5 mile² (1.3 km²) [25,198]. Density in the Whitefish Range of Montana ranged from 1 American black bear/0.8 mi² to 1 American black bear/1.7 mi² [114]. On the Superior National Forest, density was 1 American black bear/4.5 km² [208]. Density of American black bears in Coahuila, Mexico, was 0.35 American black bear/km² [63]. In the Ozark and Ouachita Mountains in Arkansas, density was 7.5 American black bears/100 km² [44].

  • 9. Amstrup, Steven C.; Beecham, John. 1976. Activity patterns of radio-collared black bears in Idaho. Journal of Wildlife Management. 40(2): 340-348. [9505]
  • 25. Beecham, John J. 1983. Population characteristics of black bears in west central Idaho. Journal of Wildlife Management. 47(2): 405-412. [17019]
  • 44. Clark, Joseph D.; Smith, Kimberly G. 1994. A demographic comparison of two black bear populations in the Interior Highlands of Arkansas. Wildlife Society Bulletin. 22(4): 593-603. [67682]
  • 63. Doan-Crider, Diana L.; Hellgren, Eric C. 1996. Population characteristics and winter ecology of black bears in Coahuila, Mexico. Journal of Wildlife Management. 60(2): 398-407. [67684]
  • 64. Elowe, Kenneth D.; Dodge, Wendell E. 1989. Factors affecting black bear reproductive success and cub survival. Journal of Wildlife Management. 53(4): 962-968. [10339]
  • 75. Gaines, William L.; Lyons, Andrea L.; Lehmkuhl, John F.; Raedeke, Kenneth J. 2005. Landscape evaluation of female black bear habitat effectiveness and capability in the North Cascades, Washington. Biological Conservation. 125(4): 411-425. [67687]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 104. Hirsch, James G.; Bender, Louis C.; Haufler, Jonathan B. 1999. Black bear, Ursus americanus, movements and home ranges on Drummond Island, Michigan. The Canadian Field-Naturalist. 113(2): 221-225. [67692]
  • 106. Horner, Margaret A.; Powell, Roger A. 1990. Internal structure of home ranges of black bears and analyses of home-range overlap. Journal of Mammalogy. 71(3): 402-410. [67693]
  • 113. Jones, Mark D.; Pelton, Michael R. 2003. Female American black bear use of managed forest and agricultural lands in coastal North Carolina. Ursus. 14(2): 188-197. [68476]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 130. Koehler, Gary M.; Pierce, D. John. 2003. Black bear home-range sizes in Washington: climatic, vegetative, and social influences. Journal of Mammalogy. 84(1): 81-91. [67698]
  • 132. Kolenosky, George B.; Strathearn, Stewart M. 1987. Black bear. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 443-454. [50677]
  • 148. Lindzey, Frederick G.; Meslow, E. Charles. 1977. Home range and habitat use by black bears in southwestern Washington. Journal of Wildlife Management. 41(3): 413-425. [68413]
  • 149. Lindzey, Frederick, G.; Meslow, E. Charles. 1977. Population characteristics of black bears on an island in Washington. Journal of Wildlife Management. 41(3): 408-412. [68734]
  • 178. Mollohan, Cheryl M.; LeCount, Albert L. 1989. Problems of maintaining a viable black bear population in a fragmented forest. In: Tecle, Aregai; Covington, W. Wallace; Hamre, R. H., tech. coords. Multiresource management of ponderosa pine forests: Proceedings; 1989 November 14-16; Flagstaff, AZ. Gen. Tech. Rep. RM-185. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 149-159. [11313]
  • 187. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 2002. Pattern of space use by female black bears in the White River National Wildlife Refuge, Arkansas, USA. Journal for Nature Conservation. 10(2): 87-93. [67714]
  • 188. Onorato, Dave P.; Hellgren, Eric C.; Mitchell, F. Scott; Skiles, J. Raymond, Jr. 2003. Home range and habitat use of American black bears on a desert montane island in Texas. Ursus. 14(2): 120-129. [68499]
  • 198. Piekielek, William; Burton, Timothy S. 1975. A black bear population study in northern California. California Fish and Game. 61(1): 4-25. [51872]
  • 201. Powell, Roger A.; Mitchell, Michael S. 1998. Topographical constraints and home range quality. Ecography. 21(4): 337-341. [67716]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]
  • 211. Rogers, Lynn L.; Wilker, Gregory A.; Scott, Sally S. 1990. Managing natural populations of black bears in wilderness. In: Lime, David W., ed. Managing America's enduring wilderness resource: Proceedings of the conference; 1989 September 11-17; Minneapolis, MN. St. Paul, MN: University of Minnesota, Minnesota Extension Service; Minnesota Agricultural Experiment Station: 363-366. [15409]
  • 213. Rogers, Lynn. 1976. Effects of mast and berry crop failures on survival, growth, and reproductive success of black bears. Transactions, North American Wildlife Conference. 41: 431-438. [8951]
  • 223. Schenk, Anita.; Obbard, Martyn E.; Kovacs, Kit M. 1998. Genetic relatedness and home-range overlap among female black bears (Ursus americanus) in northern Ontario, Canada. Canadian Journal of Zoology. 76(8): 1511-1519. [67721]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferred Habitat

More info for the terms: avoidance, bog, cover, density, forbs, hardwood, mast, mesic, natural, selection, shrub, shrubs, tree, xeric

The American black bear requires a mosaic of vegetation associations rather than one plant community, so habitat diversity is important. American black bears prefer mesic over xeric sites and forests over open areas [261], but wet meadows, swamps, high tidelands, burned areas, and avalanche chutes may be used [191]. In general, a combination of adjacent forest, riparian borders, edge habitats, and forest openings spread over large, relatively remote areas provide good habitat for American black bears [7,65,88,114,133,156,209,221,222,243,251,268].

Habitat use is dictated by seasonal food production [9,96,114,208]. In general, meadows are preferred for foraging on grasses and forbs during spring [76,114,248,261]. Riparian habitat, avalanche chutes, and early-successional habitat created by logging or fire are preferred for foraging during summer [72,86,92], and mature forest containing hard mast is preferred during fall [64,150,208,208,221,222,264,268] (see Food Habits). For denning and cover, mature or old-growth forest containing coarse woody debris, snags, and adequate cover are typically preferred [35,54,193,204,261] (see Stand- and landscape-level habitat and Snags and coarse woody debris).

Stand- and landscape-level habitat:
CanadaOn the coast of British Columbia, American black bears prefer midelevation habitat, late-successional forest, and forest patches with high structural complexity and coarse woody debris. In the Nimpkish Valley of Vancouver Island, American black bears denned exclusively in structures of wood on slopes >15%. Of 67 American black bear dens, large-diameter (x= 56 inches (143 cm) DBH)) hollow trees were used most often, followed by root boles, stumps, logs, and under trees. Western redcedar (Thuja plicata) and Alaska-cedar (Chamaecyparis nootkatensis) were used most often (28% and 30% of dens, respectively), because they tend to decay in the heartwood but retain a hard outer shell, providing good thermal and security cover. Some dens were located 52 feet (16 m) above ground, and those that required entrance from the tops of hollow trees provided the most security. The following table shows tree species and diameters of den types used by the American black bear [54]:

Tree species and mean diameters of American black bear dens in the Nimpkish Valley, Vancouver, 1993-1995 [54]
  Den type (number of dens)
Tree species Hollow tree (n) Log (n) Root bole (n) Stump (n) Under tree (n) Mean diameter inches (cm) SE n, total
Alaska-cedar 20 0 0 0 0 61 (156) 9 20
Western redcedar 14 1 4 0 0 61 (155) 14 19
Western hemlock (Tsuga heterophylla) 3 0 2 2 2 55 (139) 16 9
Douglas-fir (Pseudotsuga menziesii) 0 3 5 0 0 45 (115) 13 8
Pacific silver fir (Abies amabilis) 0 0 0 2 0 55 15 2
Sitka spruce (Picea sitchensis) 0 0 0 2 0 75 (190) 9 2
Mountain hemlock (T. mertensiana) 0 0 0 0 1 53 (135) 0 1
Unknown 0 0 4 2 0 39 (98) 20 6
Total 37 4 15 8 3 56 6 67

Of 185 visual observations of American black bears on the northeastern coast of Labrador, "forested" habitat was used most often (53.8% of observations). "Forested" habitat consisted of 3-foot (1 m)- tall spruce/fir; black spruce (Picea mariana)/lichen; birch (Betula spp.) thickets; dwarf shrubs; and tuckamore (spruce trees stunted from coastal salt spray). Barren grounds, which consisted of any nonwetland area with <5% canopy cover, were used nearly as much as forest (40.4% of observations). Of 18 den sites found, 7 were located in forest, 6 were in barren grounds, and 5 were in shrub thickets. Because large, hollow trees were uncommon in the area, all dens were excavated and den roofs were supported by root systems of woody vegetation [41].

In British Columbia, American black bears use Oregon white oak (Q. garryana) for foraging, thermal, and security cover [71].

AlaskaIn the Yukon-Tanana uplands of interior Alaska, preferred spring forage areas were riverbottoms containing brush ≥2.5 feet (0.8 m) tall and paper birch (Betula papyrifera), quaking aspen (Populus tremuloides), and black cottonwood (P. balsamifera ssp. trichocarpa). Riverbottoms contained new green leaves and abundant horsetail (Equisetum spp.), which composed 86% of their spring diet. During summer, American black bears preferred foraging for bog blueberries (Vaccinium uliginosum) in "old" burns (age not given) dominated by willow (Salix spp.), alder (Alnus spp.), and dwarf birch (B. nana) [96].

Den site selection and den type were related to topography and climatic conditions in south-central Alaska. On the Kenai Peninsula, American black bears denned in 2 major vegetation types: "regrowth" boreal upland forest (67% of dens, "regrowth" not defined ) and "mature" boreal upland forest (31% of dens, "mature" not defined). At high elevations of the Kenai Peninsula and the Susitna River Basin, caves and excavated dens under large boulders and rockpiles were used most often because few trees attained large diameters. In virgin coastal rain forest at low elevations of the Kenai Peninsula, large-diameter western hemlock, white spruce (Picea glauca), and black spruce were preferred for denning. At low elevations in the Susitna River Basin, American black bears preferred denning in alder draws with spruce or paper birch. In Prince William Sound, excavated dens at low elevations were more prone to flooding at low altitudes and were not used as often as tree dens or rock caves [228].

In southeastern Alaska, American black bears preferred den sites located in windstorm-protected forest (58%) over windstorm-prone forest (6%). In windstorm-protected forest, large, hollow trees (>35 inches (88 cm)) were least prone to wind damage. Density of large trees was twice that of the windstorm-prone forest and the forest was in later successional stages [56].

Pacific NorthwestOn Long Island, Washington, yearling and adult male and female American black bears selected habitat within home ranges disproportionately to availability, preferring recently logged areas over older logged areas. Preference was probably related to availability of berries and cover. Habitat consisted of forest formerly dominated by Sitka spruce. In recently logged areas (7 to 14 years old), shrub cover was 56%. Dominant shrubs were salal (Gaultheria shallon), red huckleberry (Vaccinium parvifolium), and evergreen huckleberry (V. ovatum). Berry-producing shrubs were 7 to 8 times more abundant in the recently logged areas than in older areas. Young western hemlock was the most dominant tree species, and cover was 7%. In intermediate-aged logged areas (14 to 20 years old), shrub cover was 21%. Young western hemlock occurred in small, dense stands, and cover was 58%. These areas provided adequate cover and food for American black bear, but not as much food as recently logged habitat. In the oldest logged areas (≥37 years old) and in alder stands, shrub cover was 7% to 8%. These areas were dominated by western hemlock and used least often. Mature timber (age not given) stands were dominated by western redcedar and covered 346 acres (140 ha) of the island. Shrub cover was 45%. Tidelands were associated principally with slough systems and contained various sedges (Carex spp.), rushes (Scirpus spp.), and halophytic forbs. Edges (115 feet (35 m)) between 2 vegetation types) occurred between areas used for foraging and for cover and were often used in all ages of habitat [148].

American black bear use of habitat on Long Island, Washington [149]
Habitat % cover on island % cover on American black bear home ranges % American black bear locations in habitat types (n=1,973 locations) % locations on edges
7- to 14-year-old logged 28 36 26 23
14- to 20-year-old logged 22 22 35 16
≥37-year-old logged 33 27 33 57
Alder 5 1 0.2 no data
Mature timber 7 8 3 54
Tidelands 6 6 3 100

On the Willamette National Forest, Oregon, female American black bears preferred early-successional habitat for foraging and late-successional habitat for cover and denning. Adjacency of early-successional stages (shrub and sapling-pole) to mature forest was also preferred. Habitat was dominated by Douglas-fir on dry, low-elevation sites; western hemlock on moist, low elevation sites; and Pacific silver fir, Douglas-fir, western hemlock, and mountain hemlock on high-elevation sites. Open-canopy sapling/pole habitat (canopy closure <60%; shrub understory common) was preferred for foraging during summer. Open-canopy mature timber (canopy closure <80%; average tree DBH >21 inches (53 cm); understory of shrubs and small trees common) and closed-canopy mature timber (canopy closure 80% to 100%; average tree DBH >21 inches; some ground vegetation) were preferred for cover and denning. During fall, open- and closed-canopy mature stands with steep slopes and southeastern exposures at low-elevations were preferred for foraging and hiding from hunters. American black bears were negatively associated with roads and positively associated with riparian habitat [263].

In the Blue Mountains of northeastern Oregon, American black bears used large-diameter (>40 inches (102 cm)) hollow western larch (Larix occidentalis) and grand fir (Abies grandis) trees located within old-growth forest for denning. Of 59 American black bear den locations, 41% occurred inside hollow trees that were either standing or lying on the ground. American black bears entered 42% of standing hollow trees from the tops or near the tops of trees, which offered the best protection from predators. These trees averaged 45 inches (114 cm) DBH (range 36-63 inches (91-160 cm)) and 62 feet (19 m) tall (range 26-98 feet (8-30 m)). Den entrances averaged 43 feet (13 m) above the ground [35]. Other trees used by American black bears in the Columbia River Basin region for denning and resting include white fir (A. concolor) [189], western redcedar, and subalpine fir (A. lasiocarpa) [133].

Due to the dry climate in the northeastern Cascade Range, American black bears prefer riparian and deciduous forest for foraging. In the Okanogan National Forest, Washington, American black bears preferred the following habitats for home ranges (in decreasing order): deciduous forest, Douglas-fir forest, riparian forest, meadow, subalpine fir forest, shrubfield, mosaic (mixture of trees, shrubs, forbs, and bare ground), mosaic-harvest, bare, ponderosa pine (Pinus ponderosa) forest, other conifer forest, shrub-steppe, postfire meadow, and western hemlock forest. Within home ranges, American black bears selected for a mosaic of food resources and cover in forested habitat classes. Preferred home range habitat was (in decreasing order): riparian forest, ponderosa pine forest equal to Douglas-fir forest, meadow, hemlock forest equal to subalpine fir forest, other conifers, shrubfield equal to mosaic, mosaic-harvest, shrub-steppe, and meadow-fire areas [156].

CaliforniaIn forests dominated by Douglas-fir on the Six Rivers, Klamath, and Shasta-Trinity National Forests, mean relative abundance of American black bears was greatest in late-successional stages and lowest in intermediate successional stages [204]:

Mean relative abundance of American black bears among successional stages in Douglas-fir forest [204]
Successional stage American black bears captured (n)
Early (trees <10 years old) 20
Sapling (10-20 years old) 25
Pole (20-50 years old) 5
Sawtimber (50-150 years old) 42
Mature (150-250 years old) 45
Old growth (>250 years old) 48
   Total number captured in all habitats 196

SouthwestDuring spring in southwestern Colorado, American black bears prefer foraging in mixed-shrub and Gambel oak (Q. gambelii) habitats. During summer, late-seral Gambel oak, mixed shrub, ponderosa pine-Gambel oak, quaking aspen, and riparian habitats containing abundant berry-producing plants are preferred. During fall, American black bears move to low elevations seeking hard mast such as acorns and Colorado pinyon (P. edulis) seeds [76,248].

Northern and central Rocky MountainsIn the Whitefish Range in northwestern Montana, American black bears occupied 2 major habitats. Permanent home range habitat was located in low-elevation Engelmann spruce (Picea engelmannii)-subalpine fir/Oregon boxwood (Paxistima myrsinites) forest containing various seral stages. Most home range habitat had previously burned (age of burn not given), and all seral stages were used equally by American black bears except clearcuts <8 years old. Avoidance of recent clearcuts suggested that American black bears would probably not use recent burns either. Home range habitat was used for foraging during spring, for cover, and for denning. Dens were located within home range habitat and occurred most often at the bases of hollow trees (species not given), followed by rock caves, excavated underground dens, and under fallen logs. The second type of habitat used by American black bears was located outside of home ranges in sparsely forested, high-elevation (6,000 feet (1,829 m)) areas that were free of snow only during summer and fall. American black bears congregated in these areas to forage on abundant soft mast during summer and hard mast during fall [114].

On the Middle Fork of the Weiser River in west-central Idaho, habitat use by American black bears differed significantly (P<0.01) between seasons. Habitat was dominated by big sagebrush (Artemisia tridentata), grasses, and forbs at low elevations and ponderosa pine, Douglas-fir, and grand fir at high elevations. During spring, selection cut-open forest was preferred for foraging on grasses and forbs. During summer and fall, American black bears preferred open forest-shrubfield, shrubfield, riparian, and selection cut-forest (10 to 35 years old) because these habitats supported the densest stands of berries. Uncut forest was preferred for nightly bedding (56.9%, n=281). Clearcuts (<8 years old) were seldom used (2 of 640 American black bear locations), and rock-talus and big sagebrush-grass habitats were avoided [261]:

Availability and use (%) of cover types by season and activity categories for 10 female American black bears over 2 years on the Middle Fork of the Weiser River, Idaho [261]
Cover type Random availability (n=489) Spring use (n=151) Summer and fall use (n=483) Foraging (n=123) Bedding (n=281)
Uncut forest 13.9 43.6+* 37.9+ 12.3 56.9+
Open forest 10.6 12.8 5.0-* 5.7 5.0-
Open forest-shrubfield 7.4 8.3 13.9+ 15.6 11.4
Riparian 0.4 1.3 2.5+ 1.6 0.4
Quaking aspen 0.8 1.3 3.3+ 3.3 3.2
Shrubfield 4.7 0.6- 7.9 14.8+ 5.0
Meadow 6.7 3.2 0.0- 3.3 0.0-
Rock-talus 1.6 0.0- 0.0- 0.0- 0.0-
Sagebrush-grass 17.8 3.2- 0.6- 2.5- 0.0-
Roads 3.5 1.3 0.4- 0.8 0.0-
Clearcut 2.7 0.6 0.2- 0.8 0.4-
Selection cut-shrubfield 5.7 7.1 8.9 16.4+ 3.6
Selection cut-open forest 20.2 15.4 16.6 21.3 10.3-
Selection cut-forest 3.9 1.3 2.9 1.6 3.9
* "+" indicates use >availability, "-" indicates use <availability (P<0.10).

Great LakesIn Minnesota, Wisconsin, and Michigan, American black bears prefer foraging in the following general habitats: riparian areas and alder and ash swamps with adjacent refuge trees during spring; forest openings and stands of black cherry (Prunus serotina) during summer; and mature oak stands during fall. For refuge, large eastern white pine (Pinus strobus) or eastern hemlock (Tsuga canadensis) occurring at 1 tree/6 acres are commonly used. During April and May, mothers and cubs spend >95% of their time within 300 feet (90 m) of eastern white pines or eastern hemlocks that are >8 inches (20 cm) DBH [209,212]. Quaking aspen forests of various ages are also used by American black bears in the Great Lakes region [4].

NortheastFor foraging and cover, 5 adult female American black bears (n=641 radio-telemetry locations) in Garrett County, Maryland, preferred wetlands and second-growth (70-90 years old) mixed forest with high stream densities over second-growth hardwood forest. Mixed forest contained conifers, which provided more escape, concealment, and thermal cover than hardwood forest. Habitats containing commercial, industrial, and residential activities were not included in any of the American black bear home ranges; however, residential and agricultural areas provided food during fall when natural food sources were scarce. Primary highways limited American black bear movements, but margins of logging roads and other roads with light traffic (<100 vehicles/day) were readily used for traveling and foraging. Wetland habitat is decreasing in Maryland, and American black bears have shown increased use of riparian habitat to compensate or substitute for wetlands [67].

South-central USWithin a montane desert sky island in Big Bend National Park, Texas, female American black bears preferred Mexican pinyon (P. cembroides)-oak-juniper/talus/meadow habitat for home ranges. Males preferred lower-elevation areas within smooth-leaf sotol-yucca-lechuguilla (Dasylirion leiophyllum-Yucca spp.-Agave lechuguilla)/grass; creosotebush (Larrea tridentata)-lechuguilla-mesquite (Prosopis spp.)/prickly-pear (Opuntia spp.)-grass; or oak-ponderosa pine-cypress (Cupressus spp.) habitats [175,188]. Den sites were located most often in rock outcrops and canyon walls (slopes >70%). South-facing slopes at high elevations (>5,906 feet (1,800 m)) in the southern Chisos Mountains are considered optimal denning habitat within Big Bend National Park [175].

In bottomland hardwood habitat in the lower Mississippi Valley, oak trees are preferred for denning [187]. On the White River National Wildlife Refuge in Arkansas, most dens (90.2%, n=51) were located in elevated tree cavities, with openings located in the top or middle of the main trunk. Overcup oak (Q. lyrata) with a mean DBH of 39.5 inches (100.3 cm) was used most often (77.8%, n=36). Other tree species used for denning included baldcypress (Taxodium distichum) and sycamore (Platanus occidentalis). Five of 51 dens (9.8%) were located under fallen leaves on the ground. Timing and intensity of flooding influenced denning chronology and use of multiple dens. Most American black bears (55.6%, n=27) used 1 den/season, but some females used up to 4 different dens/season. Emergence from dens was delayed during a longer flooding season [186].

Southern AppalachiansDen sites in central hardwood forests are typically located in live trees, >35 inches (90 cm) DBH and >150 years old. Potential denning trees include eastern white pine, eastern hemlock, northern red oak (Q. rubra), chestnut oak (Q. prinus), yellow-poplar (Liriodendron tulipifera), yellow birch (Betula alleghaniensis), red maple (Acer rubrum), and white oak (Q. alba) [129,268].

In Shenandoah National Park, Virginia, 84% of pregnant American black bears denned in live tree cavities. The most common tree species used was northern red oak. Mean DBH of den trees was 38.1 inches (96.8 cm) (n=38). Mean height was 76.8 feet (23.4 m) (n=39), and mean height of cavity entrances was 32.5 feet (9.9 m) (n=39). Other trees used for denning included (in decreasing importance): white oak, yellow-poplar, snags (species not given), and white ash (Fraxinus americana) [117].

In Great Smoky Mountains National Park, Tennessee and North Carolina, large (38.2 inches (97.1 cm) DBH)) eastern hemlock, red maple, and northern red oak trees were preferred by American black bears for denning. Of 12 dens found, 7 were located at a mean height of 43.6 feet (13.3 m) (range 20.0-57.1 feet (6.1-17.4 m)) above ground. Two dens were located inside the bases of trees with their entrances high above the ground, 2 were beneath root networks of large trees or beneath stumps, and 1 was in the sheltered base of a red maple [193].

In the Pisgah Bear Sanctuary, recently logged areas (<10 years old) had mixed effects on American black bear habitat. Major forest types were eastern hemlock, cove hardwoods (yellow-poplar, magnolias (Magnolia spp.), and birches (Betula spp.)), oak-hickory, pine, and pine-hardwood mix. Early seral stages provided abundant food for American black bears, but denning habitat was poor. Increased productivity of soft mast-producing plants would last only as long as the canopy remained open [177].

SoutheastAmerican black bears on the Neuse-Pamlico Peninsula in eastern North Carolina preferred marshes, clearcuts (age not given), and pocosins over large loblolly pine (Pinus taeda) plantations due to availability of superior food and cover [113].

On the Southeastern Coastal Plain of the United States, American black bears prefer ground nests for denning [89,101,164]. Dens located in hollow trees are sometimes used; however, few large trees are available due to intense land use practices [101,273].

Habitat use by Florida black bears probably does not change seasonally because many habitats produce food throughout the year [160]. Riparian areas and swamps are 2 of the most important habitats for Florida black bears on the southeastern coastal plain [250,251]. At Eglin Air Force Base in northern Florida, riparian areas were preferred seasonally and annually over swamps, longleaf pine-Beyrech threeawn (P. palustris-Aristida beyrichiana) sandhills, pine (Pinus spp.), and open habitats. The closed canopy and dense understory of riparian areas provided food, denning habitat, and escape cover. Swamps ranked second in overall use and were used most often for denning. Open areas ranked lowest in preference due to lack of forested cover. During summer, pine habitat was used most often due to availability of soft mast species provided by 3- to 5-year-interval prescribed burns. During fall, sandhills habitat was used most often due to abundance of acorns [250].

In southern Florida, understory conditions are more important to the Florida black bear than species composition or understory height. Uplands dominated by saw-palmetto (Serenoa repens) are preferred by Florida black bears for food and cover [161,162]. A mature overstory of south Florida slash pine (P. elliottii var. densa) is not required for a saw-palmetto patch to have value to Florida black bears [161].

Availability of suitable den sites is not a limiting factor for Louisiana black bears. Louisiana black bears used ground nests most often in small bottomland hardwood stands, baldcypress-water tupelo (Nyssa aquatica) swamps, and coastal marshes in the Atchafalaya River Basin, Louisiana. Louisiana black bears inhabiting logged bottomland hardwood forest within a floodway used trees with elevated entrances most often. Den trees are not required for successful reproduction, but Hightower and others [102] recommend protecting den trees >36 inches (91 cm) DBH in areas prone to flooding. Tree species used for dens include oaks, American elm (Ulmus americana), sweetgum (Liquidambar styraciflua), and water hickory (Carya aquatica) [102].

  • 4. Alban, David H.; Perala, Donald A.; Jurgensen, Martin F.; Ostry, Michael E.; Probst, John R. 1991. Aspen ecosystem properties in the Upper Great Lakes. Res. Pap. NC-300. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 47 p. [18412]
  • 7. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 9. Amstrup, Steven C.; Beecham, John. 1976. Activity patterns of radio-collared black bears in Idaho. Journal of Wildlife Management. 40(2): 340-348. [9505]
  • 35. Bull, Evelyn L.; Akenson, James J.; Betts, Burr J.; Torgersen, Torolf R. 1996. The interdependence of wildlife and old-growth forests. In: Bradford, P., Manning, T.; I'Anson, B. Proceedings of wildlife tree/stand level biodiversity workshop; 1995 October 17-19; Victoria, BC. Victoria, BC: British Columbia Ministry of Forests: 5-9. [67888]
  • 41. Chaulk, Keith; Bondrup-Nielsen, Soren; Harrington, Fred. 2005. Black Bear, Ursus americanus, ecology on the northeast coast of Labrador. The Canadian Field-Naturalist. 119(2): 164-174. [67681]
  • 54. Davis, Helen. 1996. Characteristics and selection of winter dens by black bears in coastal British Columbia. Burnaby, BC: Simon Fraser University. 147 p. Thesis. [67916]
  • 56. DeGayner, Eugene J.; Kramer, Marc G.; Doerr, Joseph G.; Robertsen, Margaret J. 2005. Windstorm disturbance effects on forest structure and black bear dens in southeast Alaska. Ecological Applications. 15(4): 1306-1316. [54535]
  • 64. Elowe, Kenneth D.; Dodge, Wendell E. 1989. Factors affecting black bear reproductive success and cub survival. Journal of Wildlife Management. 53(4): 962-968. [10339]
  • 65. Evans, James. 1981. General biology of ten mammals that affect reforestation in southwestern Oregon. In: Hobbs, S. D; Helgerson, O. T., eds. Reforestation of skeletal soils: Proceedings of a workshop; 1981 November 17-19; Medford, OR. Corvallis, OR: Oregon State University, Forest Research Laboratory, Forestry Intensified Research Program (FIR) Adaptive Phase: 30-36. [7143]
  • 67. Fecske, Dorothy M.; Barry, Ronald E.; Precht, Francis L.; Quigley, Howard B.; Bittner, Steven L.; Webster, Tracy. 2002. Habitat use by female black bears in western Maryland. Southeastern Naturalist. 1(1): 77-92. [51866]
  • 71. Fuchs, Marilyn A. 2001. Towards a recovery strategy for Garry oak and associated ecosystems in Canada: ecological assessment and literature review. Technical Report GBEI/EC-00-030. Ottawa, ON: Environment Canada, Canadian Wildlife Service, Pacific and Yukon Region. 106 p. [64529]
  • 72. Fuller, Todd K.; DeStefano, Stephen. 2003. Relative importance of early-successional forests and shrubland habitats to mammals in the northeastern United States. Forest Ecology and Management. 185(1-2): 75-79. [42061]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 88. Hamilton, Robert J. 1981. Effects of prescribed fire on black bear populations in southern forests. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 129-134. [67669]
  • 92. Hanson, William A. 1979. Preliminary results of the Bear Creek fire effects studies. Proposed open file report. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Anchorage District Office. 83 p. [6400]
  • 96. Hatler, David F. 1972. Food habits of black bears in interior Alaska. The Canadian Field-Naturalist. 86(1): 17-31. [10389]
  • 101. Hellgren, Eric C.; Vaughan, Michael R. 1988. Seasonal food habits of black bears in Great Dismal Swamp, Virginia-North Carolina. Proceedings of the Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 42: 295-305. [19221]
  • 102. Hightower, Dwayne A.; Wagner, Robert O.; Pace, Richard M., III. 2002. Denning ecology of female American black bears in south central Louisiana. Ursus. 13: 11-17. [68659]
  • 113. Jones, Mark D.; Pelton, Michael R. 2003. Female American black bear use of managed forest and agricultural lands in coastal North Carolina. Ursus. 14(2): 188-197. [68476]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 117. Kasbohm, John W.; Vaughan, Michael R.; Kraus, James G. 1996. Black bear denning during a gypsy moth infestation. Wildlife Society Bulletin. 24(1): 62-70. [67695]
  • 129. Klenzendorf, Sybille A.; Vaughan, Michael R.; Martin, Dennis D. 2002. Den-type use and fidelity of American black bears in western Virginia. Ursus. 13: 39-44. [68479]
  • 133. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 148. Lindzey, Frederick G.; Meslow, E. Charles. 1977. Home range and habitat use by black bears in southwestern Washington. Journal of Wildlife Management. 41(3): 413-425. [68413]
  • 149. Lindzey, Frederick, G.; Meslow, E. Charles. 1977. Population characteristics of black bears on an island in Washington. Journal of Wildlife Management. 41(3): 408-412. [68734]
  • 150. Litvaitis, John A. 2001. Importance of early successional habitats to mammals in eastern forests. Wildlife Society Bulletin. 29(2): 466-473. [67702]
  • 156. Lyons, Andrea L.; Gaines, William L.; Servheen, Christopher. 2003. Black bear resource selection in the northeast Cascades, Washington. Biological Conservation. 113(1): 55-62. [45766]
  • 160. Maehr, David S.; Brady, James R. 1984. Food habits of Florida black bears. Journal of Wildlife Management. 48(1): 230-235. [67705]
  • 161. Maehr, David S.; Larkin, Jeffrey L. 2004. Do prescribed fires in south Florida reduce habitat quality for native carnivores? Natural Areas Journal. 24(3): 188-197. [67706]
  • 162. Maehr, David S.; Larkin, Jeffrey L. 2004. Prescribed burns and large carnivores in south Florida: can fire be too much of a good thing? Transactions of the 69th North American wildlife and natural resources conference. 69: 369-383. [67732]
  • 164. Martorello, Donald A.; Pelton, Michael R. 2003. Microhabitat characteristics of American black bear nest dens. Ursus. 14(1): 21-26. [68481]
  • 175. Mitchell, F. Scott; Onorato, Dave P.; Hellgren, Eric C.; Skiles, J. Raymond, Jr.; Harveson, Louis A. 2005. Winter ecology of American black bears in a desert montane island. Wildlife Society Bulletin. 33(1): 164-171. [67712]
  • 177. Mitchell, Michael S.; Powell, Roger A. 2003. Response of black bears to forest management in the southern Appalachian Mountains. Journal of Wildlife Management. 67(4): 692-705. [48531]
  • 186. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 1997. Denning ecology of black bears in the White River National Wildlife Refuge, Arkansas. Journal of Wildlife Management. 61(3): 700-706. [67715]
  • 187. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 2002. Pattern of space use by female black bears in the White River National Wildlife Refuge, Arkansas, USA. Journal for Nature Conservation. 10(2): 87-93. [67714]
  • 188. Onorato, Dave P.; Hellgren, Eric C.; Mitchell, F. Scott; Skiles, J. Raymond, Jr. 2003. Home range and habitat use of American black bears on a desert montane island in Texas. Ursus. 14(2): 120-129. [68499]
  • 189. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the Interior Columbia River Basin. Gen. Tech. Rep. PNW-GTR-390. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [27902]
  • 191. Pelton, Michael R. 1987. Black bear. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America. Baltimore, MD: Johns Hopkins Press: 504-514. [14761]
  • 204. Raphael, Martin G. 1988. Long-term trends in abundance of amphibians, reptiles, and mammals in Douglas-fir forests of northwestern California. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 23-31. [22597]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]
  • 209. Rogers, Lynn L.; Allen, Arthur W. 1987. Habitat suitability index models: black bear, upper Great Lakes region. Biological Report 82(10.144). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 54 p. [11711]
  • 212. Rogers, Lynn L.; Wilker, Gregory A.; Scott, Sally S. 1990. What is important to black bears in the Lake States? In: Adams, Roy D., ed. Aspen symposium '89: Proceedings of symposium; 1989 July 25-27; Duluth, MN. Gen. Tech. Rep. NC-140. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 319-320. [12873]
  • 221. Samson, Claude; Huot, Jean. 1998. Movements of female black bears in relation to landscape vegetation type in southern Quebec. Journal of Wildlife Management. 62(2): 718-727. [67718]
  • 222. Samson, Claude; Huot, Jean. 2001. Spatial and temporal interactions between female American black bears in mixed forests of eastern Canada. Canadian Journal of Zoology. 79(4): 633-641. [67720]
  • 243. Staten, C. Michael. 1994. Managing terrestrial game and neotropical migratory birds. In: Smith, Winston Paul; Pashley, David N., eds. A workshop to resolve conflicts in the conservation of migratory land birds in bottomland hardwood forests: Proceedings; 1993 August 9-10; Tallulah, LA. Gen. Tech. Rep. SO-114. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 17-19. [26495]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]
  • 251. Stratman, Marty R.; Alden, C. David; Pelton, Michael R.; Sunquist, Melvin E. 2001. Habitat use by American black bears in the sandhills of Florida. Ursus. 12: 109-114. [68596]
  • 261. Unsworth, James W.; Beecham, John J.; Irby, Lynn R. 1989. Female black bear habitat use in west-central Idaho. Journal of Wildlife Management. 53(3): 668-673. [8407]
  • 263. Vander Heyden, Madeleine; Meslow, E. Charles. 1999. Habitat selection by female black bears in the central Cascades of Oregon. Northwest Science. 73(4): 283-294. [67689]
  • 264. Vaughan, Michael R. 2002. Oak trees, acorns, and bears. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 224-240. [43533]
  • 268. Weaver, Keith M. 2000. Black bear ecology and the use of prescribed fire to enhance bear habitat. In: Yaussy, Daniel A., compiler. Proceedings: workshop on fire, people, and the central hardwoods landscape; 2000 March 12-14; Richmond, KY. Gen. Tech. Rep. NE-274. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 89-96. [40313]
  • 273. White, Thomas H.; Bowman, Jacob L.; Jacobson, Harry A.; Leopold, Bruce D.; Smith, Winston P. 2001. Forest management and female black bear denning. Journal of Wildlife Management. 65(1): 34-40. [67729]
  • 86. Hamer, David. 1995. Buffaloberry (Shepherdia canadensis) fruit production in fire-successional bear feeding sites. Unpublished report [submitted to Parks Canada]. Banff, AB: Parks Canada, Banff National Park. 65 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24885]
  • 89. Hamilton, Robert J.; Marchinton, R. Larry. 1980. Denning and related activity of black bears in the coastal plain of North Carolina. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management; 1977 February; Kalispell, MT. Bear Biology Association Conference Series No. 3. [Place of publication unknown]: The Bear Biology Association: 121-126. [14751]
  • 193. Pelton, Michael R.; Beeman, Larry E.; Eagar, Daniel C. 1980. Den selection by black bears in the Great Smoky Mountains National Park. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management: Bear Biology Association Conference Series No. 3; 1977 February; Kalispell, MT. [Place of publication unknown]: The Bear Biology Association: 149-151. [68487]
  • 228. Schwartz, Charles C.; Miller, Sterling D.; Franzmann, Albert W. 1987. Denning ecology of three black bear populations in Alaska. In: Zager Peter, ed. Bears--their biology and management: Proceedings, 7th international conference on bear research and management; 1986 February-March; Williamsburg, VA; Plitvice Lakes, Yugoslavia. [Place of publication unknown]: International Association of Bear Research and Management: 281-291. [68595]
  • 248. Steinhoff, Harold W. 1978. Management of Gambel oak associations for wildlife and livestock. Golden, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Region. 119 p. [Preliminary edition]. [2232]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated Plant Communities

American black bears are very adaptable and inhabit a variety of plant communities. General plant communities include high-elevation and low-elevation coniferous and deciduous forests [8,54,58,63,114,157,191,193,209,244,246], pinyon-juniper (Pinus-Juniperus spp.) woodlands, chaparral [63,76,82,191,204,248], desert grasslands, desert scrub [190], swamps [28,89,215], pocosins, bayheads, and hammocks [89,93,113,231,271].

In Mexico, American black bears inhabit plant communities dominated by deciduous and evergreen oaks (Quercus spp.) and montane chaparral [63].
  • 28. Benson, John F.; Chamberlain, Michael J. 2007. Space use, survival, movements, and reproduction of reintroduced Louisiana black bears. Journal of Wildlife Management. 71(7): 2393-2403. [68733]
  • 54. Davis, Helen. 1996. Characteristics and selection of winter dens by black bears in coastal British Columbia. Burnaby, BC: Simon Fraser University. 147 p. Thesis. [67916]
  • 58. DeGraaf, Richard M.; Rudis, Deborah D. 2001. New England wildlife: habitat, natural history, and distribution. Hanover, NH: University Press of New England. 467 p. [21385]
  • 63. Doan-Crider, Diana L.; Hellgren, Eric C. 1996. Population characteristics and winter ecology of black bears in Coahuila, Mexico. Journal of Wildlife Management. 60(2): 398-407. [67684]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 93. Harlow, Richard F. 1961. Characteristics and status of Florida black bear. Transactions, 26th North American Wildlife Conference. 26: 481-495. [15402]
  • 113. Jones, Mark D.; Pelton, Michael R. 2003. Female American black bear use of managed forest and agricultural lands in coastal North Carolina. Ursus. 14(2): 188-197. [68476]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 157. MacHutchon, A. Grant. 1989. Spring and summer food habits of black bears in the Pelly River Valley, Yukon. Northwest Science. 63(3): 116-118. [67704]
  • 190. Parmenter, Robert R.; Van Devender, Thomas R. 1995. Diversity, spatial variability, and functional roles of vertebrates in the desert grassland. In: McClaran, Mitchel P.; Van Devender, Thomas R., eds. The desert grassland. Tucson, AZ: The University of Arizona Press: 196-229. [29843]
  • 191. Pelton, Michael R. 1987. Black bear. In: Chapman, Joseph A.; Feldhamer, George A., eds. Wild mammals of North America. Baltimore, MD: Johns Hopkins Press: 504-514. [14761]
  • 204. Raphael, Martin G. 1988. Long-term trends in abundance of amphibians, reptiles, and mammals in Douglas-fir forests of northwestern California. In: Szaro, Robert C.; Severson, Kieth E.; Patton, David R., technical coordinators. Management of amphibians, reptiles, and small mammals in North America: Proceedings of the symposium; 1988 July 19-21; Flagstaff, AZ. Gen. Tech. Rep. RM-166. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 23-31. [22597]
  • 209. Rogers, Lynn L.; Allen, Arthur W. 1987. Habitat suitability index models: black bear, upper Great Lakes region. Biological Report 82(10.144). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 54 p. [11711]
  • 215. Rose, Robert K. 1981. Small mammals in openings in Virginia's Dismal Swamp. Brimleyana. 6: 45-50. [19400]
  • 231. Sharitz, Rebecca R.; Gibbons, J. Whitfield. 1982. The ecology of southeastern shrub bogs (pocosins) and Carolina bays: a community profile. FWS/OBS-82/04. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service, Division of Biological Services. 93 p. [17015]
  • 244. Steele, Robert; Geier-Hayes, Kathleen. 1989. The grand fir/mountain maple habitat type in central Idaho: succession and management. Review draft. On file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 148 p. [8435]
  • 246. Steen, O. A.; Roberts, A. L. 1988. Guide to wetland ecosystems of the Very Dry Montane Interior Douglas-fir Subzone, Eastern Fraser Plateau Variant (IDFb2) in the Cariboo Forest Region, British Columbia. Williams Lake, BC: British Columbia Ministry of Forests and Lands. 101 p. [53384]
  • 271. Wenger, Karl F. 1958. Silvical characteristics of pond pine. Stn. Pap. No. 91. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 13 p. [49954]
  • 8. Alt, Gary L.; Matula, George J.; Alt, Floyd W.; Lindzey, James S. 1980. Dynamics of home range and movements of adult black bears in northeastern Pennsylvania. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management; 1977 February; Kalispell, MT. Bear Biology Association Conference Series No. 3. [Place of publication unknown]: The Bear Biology Association: 131-136. [14752]
  • 82. Gullion, Gordon W. [n.d.]. Report upon a visit to the Colorado National Forests, July 19-23, 1976, with recommendations for management of the aspen ecosystems for wood fiber and wildlife. Unpublished report to: W. B. Gallaher, Director, Range and Wildlife Management, U.S. Department of Agriculture, Forest Service, Lakewood, CO. 11 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17099]
  • 89. Hamilton, Robert J.; Marchinton, R. Larry. 1980. Denning and related activity of black bears in the coastal plain of North Carolina. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management; 1977 February; Kalispell, MT. Bear Biology Association Conference Series No. 3. [Place of publication unknown]: The Bear Biology Association: 121-126. [14751]
  • 193. Pelton, Michael R.; Beeman, Larry E.; Eagar, Daniel C. 1980. Den selection by black bears in the Great Smoky Mountains National Park. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management: Bear Biology Association Conference Series No. 3; 1977 February; Kalispell, MT. [Place of publication unknown]: The Bear Biology Association: 149-151. [68487]
  • 248. Steinhoff, Harold W. 1978. Management of Gambel oak associations for wildlife and livestock. Golden, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Region. 119 p. [Preliminary edition]. [2232]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black bears are most often found in areas with abundant cover and sources of food. They are usually found in rough terrain with lots of dense forest cover, including swampy areas. They require places to den during the winter, which can be in caves or under large boulders or tree roots. The most critical aspect of the habitat required by black bears is sufficient food supplies, which is why many black bears live successfully near humans.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Throughout their range, prime black bear habitat is characterized by relatively inaccessible terrain, thick understory vegetation, and abundant sources of food in the form of shrub or tree-borne soft or hard mast. In the southwest, prime black bear habitat is restricted to vegetated, mountainous areas ranging from 900 to 3,000 m in elevation. Habitats consist mostly of chaparral and pinyon-juniper woodland sites. Bears occasionally move out of the chaparral into more open sites and feed on prickly pear cactus. There are at least two distinct, prime habitat types in the Southeast. Black bears in the southern Appalachian Mountains survive in a predominantly oak- hickory and mixed mesophytic forest. In the coastal areas of the southeast, bears inhabit a mixture of flatwoods, bays, and swampy hardwood sites. In the northeast, prime habitat consists of a forest canopy of hardwoods such as beech, maple, and birch, and coniferous species. Swampy habitat areas are mainly white cedar. Corn crops and oak-hickory mast are also common sources of food in some sections of the northeast; small, thick swampy areas provide excellent refuge cover. Along the Pacific coast, redwood, sitka spruce, and hemlocks predominate as overstory cover. Within these forest types are early successional areas important for black bears, such as brushfields, wet and dry meadows, high tidelands, riparian areas and a variety of mast-producing hardwood species. The spruce-fir forest dominates much of the range of the black bear in the Rockies. Important nonforested areas are wet meadows, riparian areas, avalanche chutes, roadsites, burns, sidehill parks, and subalpine ridgetops.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Black bears inhabit forests and nearby openings, including forested wetlands. When inactive, they occupy dens under fallen trees, ground-level or above-ground tree cavities or hollow logs, underground cave-like sites, or the ground surface in dense cover. Young are born in a den. A low rate of den reuse was recorded in Pennsylvania.

These bears prefer mixed deciduous-coniferous forests with a thick understory but may occur in various situations. Large hardwood swamps and pocosins are important habitats on the Atlantic Coastal Plain. In the Great Dismal Swamp, Virginia and North Carolina, preferred habitats were pocosins, gum-cypress and maple-coniferous stands, disturbed areas, and roads; females exhibited seasonal changes in habitat preference (Hellgren and Vaughan 1991). In some areas (e.g., Alaska), bears make significant use of salmon spawning streams. In southeastern wetlands, bears would benefit from maintenance and enhancement of pocosins, mature gum, oak, and disturbed habitats (Hellgren et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Black bears exhibit large variations in home range, depending on location and gender(Banfield 1974, Baker 1983, Klenner 1987). Female and subadult ranges typically are much smaller than those of adult males. In Minnesota, females rarely dispersed from natal home range, males dispersed when 2-4 years old (Rogers 1987). In western North Carolina, neighboring individuals often used areas of overlap for same activities and at same time (Horner and Powell 1990). Home ranges of males averaged 505 hectares on Long Island, Washington (Lindzey and Meslow 1977), 5,200 hectares in northern Washington (Poelker and Hartwell 1973), 1,060 hectares in northwestern California (Kelleyhouse 1975) and 2,240 hectares in the San Bernardino Mountains of southern California (Novick 1979). Home ranges in Idaho ranged from 1,660 to 13,030 hectares (Armstrup and Beecham 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

More info for the terms: forbs, frequency, hardwood, mast, shrubs

American black bears are omnivorous and opportunistic [78,96,105,192,264,268]. Food habits are influenced by season, food abundance and accessibility, human activities near American black bear habitat, and reproductive status [268]. In general, grasses and forbs are preferred during spring; soft mast (typically berries) and insects are preferred during summer; and hard mast such as acorns and other nuts dominates the fall diet [76,96,96,101,110,132,157,160,162,192,242,252,272].

Grasses and herbaceous plants: Due to a poor ability to digest cellulose in mature plants, American black bears consume young, green vegetation, primarily during spring [208]. In Yukon, Canada [157] and the Yukon-Tanana uplands of interior Alaska, horsetail (Equisetum spp.) is important during spring and summer, comprising up to 86% of American black bear diets [96]. Apical meristems of saw-palmetto are an important part of Florida black bear diets [161], and cabbage palmetto (Sabal palmetto) dominates the spring diet [160].

Insects: Insects obtained from coarse woody debris are important food items, primarily during summer [18,37,100,160,168,199,268]. In northeastern Oregon, Bull and others [37] reported higher frequencies of insect consumption than elsewhere in the United States. High consumption of insects may have been related to a shortage of other foods. Total frequency of insect occurrence in 621 American black bear scats collected between April and October over 2 years was 70%. During July of one year, total frequency of occurrence was 98%. Insects eaten included carpenter ants (Camponotus spp.), forest ants (Formica spp.), other ants (Lasius spp., Tapinoma spp., and Aphaenogaster spp.), and yellowjackets (Vespula spp. and Dolichovespula spp.) [37]. In the Greater Yellowstone ecosystem, army cutworm moths (Euxoa auxiliaris) are eaten during summer months. Feeding sites are located on scree slopes at high elevations (x=11,010 feet (3,356 m)), with alpine tundra-covered benches and plateaus above and below feeding sites [168].

Soft mast: The most common soft mast eaten by American black bears are berries produced by shrubs. Some of the more important masting species include blueberries (Vaccinium spp.) [21,32], huckleberries (Vaccinium spp.), blackberries (Rubus spp.), serviceberries (Amelanchier spp.), strawberries (Fragaria spp.), autumn-olive (Elaeagnus umbellata) [5], and russet buffaloberry (Shepherdia canadensis) [86,87]. Saw-palmetto fruits are an important year-round food item for Florida black bears [160,162,250]. For a list of native fleshy fruits eaten by American black bears across their range, see Wilson [274].

Hard mast: Hard mast is important for American black bears in all geographic regions except the Pacific Northwest [264] and is generally more abundant in eastern portions of the American black bear's range [209]. American black bears may travel long distances during fall looking for hard mast [114] and may climb up to 98 feet (30 m) in trees to forage [192]. Hard mast eaten by American black bears may include acorns [71,91,98,114,192,198,258,264,268], hickory (Carya spp.) nuts [113], beechnuts (Fagus spp.) [192], whitebark pine (Pinus albicaulis) seeds [123,124,125,140,169,170,196], limber pine (P. flexilis) seeds [171], and pinyon (Pinus spp.) seeds [139]. Acorns preferred by American black bears include those of Gambel oak in ponderosa pine habitat in the Rocky Mountains [258], red oak and white oak in central hardwood forests [98,247,264], and Oregon white oak in the northwestern United States and southwestern Canada [71,144]. Production of acorns is often episodic and synchronous, so acorns may not be a reliable food source [43].

Whitebark pine seeds are a high-quality food for American black bears due to their high digestibility, relatively large size, and high fat content. Consumption of whitebark pine seeds occurs primarily south of the western US-Canada border [123,124,125]. Use is greater in continental climates (18.7%) in the northern and central Rockies than in maritime climates (2.7%) in the northwestern United States [123,125,169]. Within the Greater Yellowstone Area, American black bear consumption of whitebark pine seeds is greatest in mature stands (>100 years old) [123,125,169]. Whitebark pine seeds are eaten primarily during fall. American black bears may also raid red squirrel (Tamiasciurus hudsonicus) whitebark pine seed caches during spring [123,124,125,140,169,196]. Whitebark pine cone production may vary widely based on site, individual trees, years, and white pine blister-rust infection. In Yellowstone National Park, large cone crops usually occur every 4 to 9 years. Seed consumption may vary considerably among years, depending on crop size. Heavy consumption of whitebark pine seeds occurs when crops average >13 to 23 cones/tree [170]. American black bears may eat seeds up to 1 year after crop production [170].

In the Rocky Mountains, limber pine seeds may be an important food for American black bears when other foods are limited [171], and pinyon seeds are eaten in the Great Basin and southwestern United States [139].

Vertebrates: American black bears are more likely to eat carrion than to capture live prey [208]; however, they are capable of killing vertebrates. Vertebrate carrion or prey items include woodland caribou (Rangifer tarandus caribou) [41,42,238,277,280], elk (Cervis canadensis) [37,229,278], white-tailed deer (Odocoileus virginianus) [12], mule deer (O. hemionus) [37,207,278], and moose (Alces alces) [41,135,197,226]. Other vertebrates eaten by American black bears include Mount Graham red squirrels (Tamiasciurus hudsonicus grahamensis) [70], sooty grouse (Dendragapus fuliginosus) [127], bird eggs [23,57,205,220,265], and salmon (Oncorhynus spp.) [198,275]. Florida black bears may eat nine-banded armadillos (Dasypus novemcinctus) and feral pigs (Sus scrofa) [160].

Other: Stems and leaves of quaking aspen [26,132], poplar (Populus spp.) catkins, and black cottonwood buds are eaten during spring [133]. When wild foods are scarce, American black bears may occasionally prey on domestic sheep, goats, pigs, and young cattle. They may also eat garbage, agricultural crops, and orchard fruits [67,115,167,167,213,285].

For information on forage preferences and palatability ratings of American black bears in various phases within the grand fir/Rocky Mountain maple (Acer glabrum) habitat type and the Douglas-fir/white spirea (Spiraea betulifolia) habitat types in Idaho, see Steele and Geier-Hayes [244,245]. For a list of foods eaten by American black bears by season in lodgepole pine (P. contorta) and mixed deciduous-coniferous forest in Kananaskis Country, Alberta, see Holcroft and Herrero [105].

  • 18. Auger, Janene; Ogborn, Gary L.; Pritchett, Clyde L.; Black, Hal L. 2004. Selection of ants by the American black bear (Ursus americanus). Western North American Naturalist. 64(2): 166-174. [51120]
  • 21. Barker, W. G.; Hall, I. V.; Aalders, L. E.; Wood, G. W. 1964. The lowbush blueberry industry in eastern Canada. Economic Botany. 18(4): 357-365. [9019]
  • 23. Bayne, Erin M.; Hobson, Keith A. 1997. Comparing the effects of landscape fragmentation by forestry and agriculture on predation of artificial nests. Conservation Biology. 11(6): 1418-1429. [63245]
  • 26. Beetle, A. A. 1974. Range survey in Teton County, Wyoming: Part 4 quaking aspen. SM 27. Laramie, WY: University of Wyoming, Agricultural Experiment Station. 28 p. [26850]
  • 32. Books, David J. 1972. Little Sioux Burn: year 2. Naturalist. 23(3&4): 2-7. [11550]
  • 37. Bull, Evelyn L.; Torgersen, Torolf R.; Wertz, Tara L. 2001. The importance of vegetation, insects, and neonate ungulates in black bear diet in northeastern Oregon. Northwest Science. 75(3): 244-253. [67680]
  • 41. Chaulk, Keith; Bondrup-Nielsen, Soren; Harrington, Fred. 2005. Black Bear, Ursus americanus, ecology on the northeast coast of Labrador. The Canadian Field-Naturalist. 119(2): 164-174. [67681]
  • 42. Chubbs, Tony E.; Keith, Lloyd B.; Mahoney, Shane P.; McGrath, Michael J. 1993. Responses of woodland caribou (Rangifer tarandus caribou) to clear-cutting in east-central Newfoundland. Canadian Journal of Zoology. 71: 487-493. [22025]
  • 43. Clark, Joseph D. 2004. Oak-black bear relationships in southeastern uplands. In: Spetich, Martin A., ed. Upland oak ecology symposium: history, current conditions, and sustainability; 2002 October 7-10; Fayetteville, AR. Gen. Tech. Rep. SRS-73. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 116-119. [67683]
  • 57. DeGraaf, Richard M. 1995. Nest predation rates in managed and reserved extensive northern hardwood forest. Forest Ecology and Management. 79: 227-234. [26750]
  • 67. Fecske, Dorothy M.; Barry, Ronald E.; Precht, Francis L.; Quigley, Howard B.; Bittner, Steven L.; Webster, Tracy. 2002. Habitat use by female black bears in western Maryland. Southeastern Naturalist. 1(1): 77-92. [51866]
  • 70. Froehlich, Genica Frances. 1990. Habitat use and life history of the Mount Graham red squirrel. Tucson, AZ: University of Arizona. 61 p. Thesis. [27978]
  • 71. Fuchs, Marilyn A. 2001. Towards a recovery strategy for Garry oak and associated ecosystems in Canada: ecological assessment and literature review. Technical Report GBEI/EC-00-030. Ottawa, ON: Environment Canada, Canadian Wildlife Service, Pacific and Yukon Region. 106 p. [64529]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 91. Hannah, Peter R. 1987. Regeneration methods for oaks. Northern Journal of Applied Forestry. 4: 97-101. [3728]
  • 96. Hatler, David F. 1972. Food habits of black bears in interior Alaska. The Canadian Field-Naturalist. 86(1): 17-31. [10389]
  • 98. Healy, William M. 2002. Managing eastern oak forests for wildlife. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 317-332. [43539]
  • 100. Hellgren, Eric C. 1993. Status, distribution, and summer food habits of black bears in Big Bend National Park. The Southwestern Naturalist. 38(1): 77-80. [20422]
  • 101. Hellgren, Eric C.; Vaughan, Michael R. 1988. Seasonal food habits of black bears in Great Dismal Swamp, Virginia-North Carolina. Proceedings of the Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 42: 295-305. [19221]
  • 105. Holcroft, Anne C.; Herrero, Stephen. 1991. Black bear, Ursus americanus, food habits in southwestern Alberta. The Canadian Field-Naturalist. 105(3): 335-345. [18673]
  • 110. Irwin, Larry L.; Hammond, Forrest M. 1985. Managing black bear habitats for food items in Wyoming. Wildlife Society Bulletin. 13: 477-483. [3034]
  • 113. Jones, Mark D.; Pelton, Michael R. 2003. Female American black bear use of managed forest and agricultural lands in coastal North Carolina. Ursus. 14(2): 188-197. [68476]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 124. Kendall, Katherine C.; Hoff, Ray J. 1995. An introduction to whitebark pine ecology and status. In: Mathiasen, Robert L., compiler. Proceedings of the 43rd Annual Western International Forest Disease Work Conference; 1995 August 29-September 1; Whitefish, MT. Coeur D'Alene, ID: Idaho Department of Lands: 97-102. [27703]
  • 125. Kendall, Katherine Clement. 1981. Bear use of pine nuts. Bozeman, MT: Montana State University. 27 p. Thesis. [1331]
  • 127. King, D. G. 1971. The ecology and population dynamics of blue grouse in the sub-alpine. Vancouver, BC: University of British Columbia. 140 p. Thesis. [40271]
  • 132. Kolenosky, George B.; Strathearn, Stewart M. 1987. Black bear. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 443-454. [50677]
  • 133. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 135. LaChapelle, Alain; Messier, Francois; Crete, Michel. 1984. Importance of moose as a black bear food in southwest Quebec. Alces. 20: 79-83. [13899]
  • 139. Lanner, Ronald M. 1981. The pinon pine: A natural and cultural history. Reno, NV: University of Nevada Press. 208 p. [21981]
  • 140. Lanner, Ronald M. 1996. Introduction. In: Lanner, Ronald M. Made for each other: A symbiosis of birds and pines. New York: Oxford University Press: 1-9. [29915]
  • 144. Larsen, Eric M.; Morgan, John T. 1998. Management recommendations for Washington's priority habitats: Oregon white oak woodlands. Olympia, WA: Washington Department of Fish and Wildlife. 37 p. [52756]
  • 157. MacHutchon, A. Grant. 1989. Spring and summer food habits of black bears in the Pelly River Valley, Yukon. Northwest Science. 63(3): 116-118. [67704]
  • 160. Maehr, David S.; Brady, James R. 1984. Food habits of Florida black bears. Journal of Wildlife Management. 48(1): 230-235. [67705]
  • 161. Maehr, David S.; Larkin, Jeffrey L. 2004. Do prescribed fires in south Florida reduce habitat quality for native carnivores? Natural Areas Journal. 24(3): 188-197. [67706]
  • 162. Maehr, David S.; Larkin, Jeffrey L. 2004. Prescribed burns and large carnivores in south Florida: can fire be too much of a good thing? Transactions of the 69th North American wildlife and natural resources conference. 69: 369-383. [67732]
  • 168. Mattson, David J.; Gillin, Colin M.; Benson, Scott A.; Knight, Richard R. 1991. Bear feeding activity at alpine insect aggregation sites in the Yellowstone ecosystem. Canadian Journal of Zoology. 69(9): 2430-2435. [67708]
  • 169. Mattson, David J.; Reinhart, Daniel P. 1994. Bear use of whitebark pine seeds in North America. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 212-220. [24645]
  • 170. Mattson, David J.; Reinhart, Daniel P.; Blanchard, Bonnie M. 1994. Variation in production and bear use of whitebark pine seeds in the Yellowstone area. In: Despain, Don G., ed. Plants and their environments: proceedings of the 1st biennial scientific conference on the Greater Yellowstone Ecosystem; 1991 September 16-17; Yellowstone National Park, WY. Tech. Rep. NPS/NRYELL/NRTR.-93/XX. Denver, CO: U.S. Department of the Interior, National Park Service, Natural Resources Publication Office: 205-220. [26286]
  • 171. McCutchen, Henry E. 1996. Limber pine and bears. The Great Basin Naturalist. 56(1): 90-92. [67710]
  • 192. Pelton, Michael R. 2000. Black bear. In: Ecology and management of large mammals in North America. Upper Saddle River, NJ: Prentice Hall: 389-408. [45089]
  • 196. Peterson, Kristopher I. 1999. Whitebark pine (Pinus albicaulis) decline and restoration in Glacier National Park. Grand Forks, ND: University of North Dakota. 75 p. Thesis. [44553]
  • 197. Peterson, Rolf O. 1988. The pit or the pendulum: issues in large carnivore management in natural ecosystems. In: Agee, James K.; Johnson, Darryll R., eds. Ecosystem management for parks and wilderness. Institute of Forest Resources Contribution No. 65. Seattle, WA: University of Washington Press: 105-117. [23380]
  • 198. Piekielek, William; Burton, Timothy S. 1975. A black bear population study in northern California. California Fish and Game. 61(1): 4-25. [51872]
  • 199. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 205. Reitsma, Leonard R.; Holmes, Richard T.; Sherry, Thomas W. 1990. Effects of removal of red squirrels, Tamiasciurus hudsonicus, and eastern chipmunks, Tamias striatus, on nest predation in a northern hardwood forest: an artificial nest experiment. Okios. 57(3): 375-380. [25356]
  • 207. Rickel, Bryce. 2005. Chapter 2: large native ungulates. In: Finch, Deborah M., ed. Assessment of grassland ecosystem conditions in the southwestern United States: wildlife and fish--volume 2. Gen. Tech. Rep. RMRS-GTR-135-vol. 2. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 13-35. [60887]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]
  • 209. Rogers, Lynn L.; Allen, Arthur W. 1987. Habitat suitability index models: black bear, upper Great Lakes region. Biological Report 82(10.144). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 54 p. [11711]
  • 213. Rogers, Lynn. 1976. Effects of mast and berry crop failures on survival, growth, and reproductive success of black bears. Transactions, North American Wildlife Conference. 41: 431-438. [8951]
  • 220. Saab, Victoria A.; Vierling, Kerri T. 2001. Reproductive success of Lewis's woodpecker in burned pine and cottonwood riparian forests. The Condor. 103(3): 491-501. [61988]
  • 226. Schwartz, Charles C.; Franzmann, Albert W. 1991. Interrelationship of black bears to moose and forest succession in the northern coniferous forest. Wildlife Monographs No. 113. Washington, DC: The Wildlife Society. 58 p. [67724]
  • 229. Schwartz, John E., II; Mitchell, Glen E. 1945. The Roosevelt elk on the Olympic Peninsula, Washington. Journal of Wildlife Management. 9(4): 295-319. [8878]
  • 238. Skoog, Ronald Oliver. 1968. Ecology of the caribou (Rangifer tarandus granti) in Alaska. Berkeley, CA: University of California, Berkeley. 699 p. Dissertation. [37914]
  • 242. Spowart, Richard A.; Samson, Fred B. 1986. Carnivores. In: Cooperrider, Allan Y.; Boyd, Raymond J.; Stuart, Hanson R., eds. Inventory and monitoring of wildlife habitat. Denver, CO: U.S. Department of the Interior, Bureau of Land Management, Service Center: 475-496. [13526]
  • 244. Steele, Robert; Geier-Hayes, Kathleen. 1989. The grand fir/mountain maple habitat type in central Idaho: succession and management. Review draft. On file at: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. 148 p. [8435]
  • 245. Steele, Robert; Geier-Hayes, Kathleen. 1994. The Douglas-fir/white spirea habitat type in central Idaho: succession and management. Gen. Tech. Rep. INT-305. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 81 p. [23481]
  • 247. Steiner, Kim C. 1995. Autumn predation of northern red oak seed crops. In: Gottschalk, Kurt W.; Fosbroke, Sandra L., eds. Proceedings, 10th central hardwood forest conference; 1995 March 5-8; Morgantown, WV. Gen. Tech. Rep. NE-197. Radnor, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 489-494. [25881]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]
  • 252. Stubblefield, Cynthia H. 1993. Food habits of black bear in the San Gabriel Mountains of southern California. The Southwestern Naturalist. 38(3): 290-293. [22146]
  • 258. Tucker, John M.; Muller, Cornelius H. 1958. A reevaluation of the derivation of Quercus margaretta from Quercus gambelii. Evolution. 12(1): 1-17. [2365]
  • 264. Vaughan, Michael R. 2002. Oak trees, acorns, and bears. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 224-240. [43533]
  • 265. Vega, Robyn M. S. 1993. Bird communities in managed conifer stands in the Oregon Cascades: habitat associations and nest predation. Corvallis, OR: Oregon State University. 83 p. Thesis. [27972]
  • 268. Weaver, Keith M. 2000. Black bear ecology and the use of prescribed fire to enhance bear habitat. In: Yaussy, Daniel A., compiler. Proceedings: workshop on fire, people, and the central hardwoods landscape; 2000 March 12-14; Richmond, KY. Gen. Tech. Rep. NE-274. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 89-96. [40313]
  • 272. Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc. 745 p. [25194]
  • 274. Willson, Mary F. 1993. Mammals as seed-dispersal mutualists in North America. Oikos. 67: 159-176. [27081]
  • 275. Willson, Mary F.; Gende, Scott M.; Marston, Brian H. 1998. Fishes and the forest. BioScience. 48(6): 455-462. [30312]
  • 277. Wittmer, Heiko U.; Sinclair, Anthony R. E.; McLellan, Bruce N. 2005. The role of predation in the decline and extirpation of woodland caribou. Oecologia. 144(2): 257-267. [54846]
  • 278. Woodward, A.; Schreiner, E. G.; Houston, D. B.; Moorhead, B. B. 1994. Ungulate-forest relationships in Olympic National Park: retrospective exclosure studies. Northwest Science. 68(2): 97-110. [23143]
  • 280. Yeo, Jeffrey J.; Peek, James M. 1994. Successional patterns of antlered game in cedar-hemlock forests. In: Baumgartner, David M.; Lotan, James E.; Tonn, Jonalea R., compilers. Interior cedar-hemlock-white pine forests: ecology and management: Symposium proceedings; 1993 March 2-4; Spokane, WA. Pullman, WA: Washington State University, Department of Natural Resources: 199-205. [25803]
  • 5. Allan, Philip F.; Steiner, Wilmer W. 1965. Autumn olive for wildlife and other conservation uses. Leaflet No. 458 [Revised]. Washington, DC: U.S. Department of Agriculture. 8 p. [44936]
  • 12. Arizona Fish and Game Department, comp. 1977. The Arizona white-tailed deer. Special Report No. 6. [Federal Aid in Wildlife Restoration Act: Project W-53-R]. Phoenix, AZ: Arizona Fish and Game Department. 108 pp. [61802]
  • 78. Goldsmith, Audrey; Walraven, Michael E.; Graber, David; White, Marshall. 1981. Ecology of the black bear in Sequoia National Park. Technical Report No. 1. Davis, CA: University of California at Davis, Institute of Ecology, Cooperative National Park Resources Studies Unit. 64 p. [Final report to the National Park Service, Western Region for contract CX-8000-4-0022]. [18240]
  • 86. Hamer, David. 1995. Buffaloberry (Shepherdia canadensis) fruit production in fire-successional bear feeding sites. Unpublished report [submitted to Parks Canada]. Banff, AB: Parks Canada, Banff National Park. 65 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24885]
  • 87. Hamer, David. 1996. Buffaloberry [Shepherdia canadensis (L.) Nutt.] fruit production in fire-successional bear feeding sites. Journal of Range Management. 49(6): 520-529. [27214]
  • 115. Jorgensen, Carole J. 1983. Bear-sheep interactions, Targhee National Forest. In: Meslow, E. Charles, ed. Bears--their biology and management: Proceedings, 5th international conference on bear research and management; 1980 February; Madison, WI. [Place of publication unknown]: International Association for Bear Research and Management: 191-200. [14764]
  • 123. Kendall, Katherine C. 1983. Use of pine nuts by grizzly and black bears in the Yellowstone area. In: Meslow, E. Charles, ed. Bears--their biology and management: Proceedings, 5th international conference on bear research and management; 1980 February; Madison, WI. [Place of publication unknown]: International Association for Bear Research and Management: 166-173. [8385]
  • 167. Mattson, David J. 1990. Human impacts on bear habitat use. In: Darling, Laura M.; Archibald, W. Ralph, eds. Bears--their biology and management: Proceedings, 8th international conference on bear research and management; 1989 February; Victoria, BC. [Place of publication unknown]: International Association for Bear Research and Management: 33-56. [68484]
  • 285. Zwartjes, Patrick W.; Cartron, Jean-Luc E.; Stoleson, Pamela L. L.; Haussamen, Walter C.; Crane, Tiffany E. 2005. Assessment of native species and ungulate grazing in the Southwest: terrestrial wildlife. Gen. Tech. Rep. RMRS-GTR-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 74 p. [+ CD]. [60764]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Black bears are omnivorous. They eat plants, fruit, Insecta, seeds and nuts, flesh, and carrion. Available food types vary from season to season and between regions. Only a small portion of a bears diet consists of animal matter, and this is usually made up of colonial insects, such as Isoptera, and Coleoptera. Most vertebrate are consumed as carrion. Black bears are not active predators and hunt vertebrates only if the opportunity exists. In spring, after black bears emerge from their winter dens, is a time when food is scarce. Bears tend to lose weight during this period and continue to live off of body fat stored during the previous fall. As summer approaches, black bears begin to eat a wide variety of berry crops and the large numbers of insects that are emerging. In the fall they put on large amounts of fat in preparation for the winter sleep.

Animal Foods: carrion ; insects

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Throughout their range in North America, black bears consume primarily grasses and forbs in spring, soft mast in the form of shrub and tree-borne fruits in summer, and a mixture of hard and soft mast in fall. However, the availability of different food types varies regionally. Only a small portion of the diet of bears consists of animal matter, and then primarily in the form of colonial insects and beetles. Most vertebrates are consumed in the form of carrion. Black bears are not active predators and feed on vertebrates only if the opportunity exists.

The diet of black bears is high in carbohydrates and low in proteins and fats. Consequently, they generally prefer foods with high protein or fat content, thus their propensity for the food and garbage of people. Bears feeding on a protein-rich food source show significant weight gains and enhanced fecundity. Spring, after black bears emerge from winter dens, is a period of relative food scarcity. Bears tend to lose weight during this period and continue to subsist partly off of body fat stored during the preceding fall. They take advantage of any succulent and protein- rich foods available; however, these are not typically in sufficient quantity to maintain body weight. As summer approaches, a variety of berry crops become available. Summer is generally a period of abundant and diverse foods for black bears, enabling them to recover from the energy deficits of winter and spring. Black bears accumulate large fat reserves during the fall, primarily from fruits, nuts, and acorns.

Animal Foods: carrion ; insects

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic omnivore. Variable diet of plants and animals (vertebrates and invertebrates), commonly including fruits, insects, and carrion; also garbage. There is no evidence of black bears being preferentially attracted to human menstrual odors or attacking menstruating women (Rogers et al. 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Predators

More info for the term: competition

Other than humans, American black bears have few predators [165] except grizzly bears [114], mountain lions (Puma concolor) [159], and gray wolves (Canis lupus) [208]. Male and female American black bears may kill and eat each other. American black bears of either sex can benefit from cannibalism; however, cannibalism is probably most common in large males. Cannibalism by nonkin American black bears may serve several purposes: for food and to reduce competition for other food resources, space, and mates [208].
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 159. Maehr, David S.; Belden, Robert C.; Land, E. Darrell; Wilkins, Laurie. 1990. Food habits of panthers in southwest Florida. Journal of Wildlife Management. 54(3): 420-423. [24565]
  • 165. Maser, Chris. 1981. Land mammals. In: Natural history of Oregon Coast mammals. Gen. Tech. Rep. PNW-133. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station: 35-371. [66302]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Black bears are important in ecosystems because of their effects on populations of insects and fruits. They help to disperse the seeds of the plants they eat and consume large numbers of colonial insects and moth larvae. They sometimes take small and large mammals as prey, such as rabbits and deer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black bear cubs may be at risk of being killed by large predators, such as Canis lupus and Puma concolor. However, most black bears that are killed, both young and adults, are killed by humans.

Known Predators:

  • humans (Homo_sapiens)
  • wolves (Canis_lupus)
  • mountain lions (Puma_concolor)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Black bears are important in ecosystems because of their effects on populations of insects and fruits. They help to disperse the seeds of the plants they eat and consume large numbers of colonial insects and moth larvae. They sometimes take small and large mammals as prey, such as rabbits and deer.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Black bear cubs may be at risk of being killed by large predators, such as wolves and mountain lions. However, most black bears that are killed, both young and adults, are killed by humans.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Ursus americanus is prey of:
Homo sapiens
Canis lupus
Puma concolor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Ursus americanus preys on:
Microtus xanthognathus
Cervus elaphus
Rangifer tarandus
Alces alces

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: Many EOs.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: cover, density, fire cycle, fire exclusion, fire regime, fire severity, forbs, fuel, fuel loading, hardwood, heath, litter, low-severity fire, marsh, mast, mesic, natural, prescribed burn, prescribed fire, presence, restoration, series, severity, shrub, shrubs, stand-replacement fire, succession, tree, tussock, wildfire

Habitat modification by fire has a greater effect on American black bears than direct mortality [80,259]. HABITAT RELATED FIRE EFFECTS depend on habitat type, habitat condition, fire severity, and pattern of fire across a landscape [153,155,199]. American black bears require a mosaic of successional stages for foraging, cover, and denning, so fires that create patches of burned and unburned habitat are most beneficial [7,27,52,121,133,144,153,156,199,221,222,243,251,268].

Fire may negatively impact American black bears in the short term by reducing food resources, cover, and potential den sites [31,53,69,88,136,152,194,216,250]. As production of early-seral vegetation increases, more food and cover become available [10,10,14,51,51,61,68,86,87,88,99,99,136,154,230,259]. Increased food resources in early- and midseral habitat may increase reproductive success [50,52,122,225,226] see Impacts on reproductive success). As the canopy closes in later stages of succession, availability of some foods may decrease; however, cover and potential den sites increase [121,126] (see Timing of food production and Impacts on den sites and cover).

Impacts on food production: Many plant species that American black bears consume benefit from fire [10,16,64,68,85,86,87,91,99,136]. They include grasses, forbs, fruit-producing shrubs, and some tree species [10,51,61,68,86,87,99,136]. Fire may also provide a medium for invasion of insects that American black bears eat (see Food Habits) [37]. Immediately following a severe wildfire, American black bears may benefit from availability of carcasses of elk and deer killed by fire [30,69,80,114,235,236] and displaced small mammals along firelines [121].

Fire is important in the maintenance and regeneration of whitebark pine [13]. Following low-, medium-, and high-severity fires, whitebark pine often establishes from seeds cached by the Clark's nutcracker (Nucifraga columbiana) [254,269]. Infrequent stand-replacement fires are an important component of whitebark pine's fire ecology [13,119]; however, large, stand-replacement prescribed burns are not recommended in areas where whitebark pine is in severe decline (for example, northern Idaho and northwestern Montana). Small-scale prescribed burning is recommended, especially where whitebark pine is seral; otherwise, regeneration may be extremely slow [179,180,181,240,256]. For more information about fire and whitebark pine, see the FEIS review of whitebark pine.

Frequent surface fires perpetuate oak growth in some areas by removing mid- and understory strata and reducing shading [2,22,107]. To mimic a natural disturbance pattern in mature mixed oak stands, Healy [98] suggests enhancing oak regeneration by conducting a shelterwood cut followed by a prescribed fire. Quaking aspen often sprouts after fire, providing a food source for the American black bear [82,267].

Fire exclusion may have adverse impacts on American black bear foraging habitat in some areas [261]. Once-productive, seral berry fields in Oregon and Washington have been invaded by conifers. Because plants growing under a closed canopy generally produce few berries, fruit production has been steadily declining [174]. Logging treatments that include severe soil scarification or slash burns may also reduce berry yields. Even where timber harvest favors berry production, lack of cover in early postfire years may limit American black bear use [283]. Huckleberries and blueberries are more productive on recently burned sites compared to unburned sites. However, severe, duff-consuming fires can destroy shallow rhizomes [15,33,45,85,163,217].

Timing of food production: Availability of forage may decrease in the "short term" after fire [10,14,51,51,61,68,87,88,99,99,136,154,230,259], but may begin to increase 1 year following fire. Potter and Kessell [200] modeled potential feeding and reproductive habitat utilization for large mammals in any homogenous forest community. The model examined wildlife use of an unburned habitat and habitats at 0, 10, and 25 postfire years. American black bears showed the lowest preference for foraging in unburned communities and the highest preference for foraging in the postfire year 10 community [200].

Depending on fire severity and habitat type, soft mast production may begin to increase 1 year following fire, and abundant fruit crops may be produced for up to 20 years after fire [10,51,61,68,86,87,99,136]. Blueberry (Vaccinium spp.) and blackberry (Rubus spp.) produce the most fruit "several years" after fire [136]. In boreal forests in the Great Lakes-St Lawrence region, blueberries, red raspberries (R. idaeus), serviceberries (Amelanchier spp.), and cherries (Prunus spp.) were most abundant 2 to 20 years after fire or logging [99,136]. In Minnesota, blueberry production increased 1 year after fire, attracting American black bears [32]. Near Farewell, Alaska, American black bears were seen eating blueberries in late August and early September on a 5-year-old burn in habitat formerly dominated by black spruce and white spruce, ericaceous (Ericaceae) and dwarf birch shrublands, and sedge (Cyperaceae) tussock plant communities. Sightings of American black bears were incidental, and systematic wildlife inventories were not conducted [92].

In general, fruit production of most western huckleberry species is delayed for at least 5 years following fire. On some sites, fruit production may be reduced for 20 to 30 years or longer [15,33,45,163,217]. Refer to the FEIS reviews of evergreen huckleberry, big huckleberry, and other huckleberry species for more information about fire effects.

Russet buffaloberry is resistant to fire, surviving by root crowns and dormant buds located on the taproot [185]. Stand-replacing prescribed burns on southern aspects led to the greatest production of russet buffaloberries at least 5 years after fire in a seral lodgepole pine and hybrid white spruce × Engelmann spruce forest in the Front Ranges of Banff National Park and the Ghost River Wilderness Area in Alberta. Fruit production began to decrease in 25-year-old burns where trees had restocked successfully. Fruit production on sites >50 years old varied depending on the site and fire characteristics. In areas that remained forest-free due to environmental factors, russet buffaloberry fruit production remained high. Two or more prescribed burns may be required to achieve the desired reduction in tree crown cover in habitat containing russet buffaloberry [86,87]. For more information about fire and russet buffaloberry, see the FEIS review of russet buffaloberry.

Three years after a wildfire in Seney National Wildlife Refuge in Michigan's Upper Peninsula, American black bears were commonly seen foraging in burned areas. Habitat use was greatest during postfire year 4, when soft mast production peaked. The 260 km² wildfire occurred in quaking aspen-paper birch habitat. Wooded wetlands, marshy grasslands, and open lakes were also common. The fire burned in a patchy pattern with varying intensities and severities, from light surface fires to severe crown fires where upper organic layers were ashed and all vegetation was consumed. Observations of American black bears in the area were incidental, and quantitative data on postfire habitat use were not collected [10].

In the northern Kenai Peninsula lowlands of Alaska, foods eaten by American black bears were similar between a recent burn (13-18 years old) and an old burn (35-40 years old). Major exceptions were that American black bears ate 4 times more moose calves in the recent burn, and more mountain cranberries (V. vitis-idaea) in the old burn. The 2 wildfires were located in northern coniferous forest dominated by white spruce, black spruce, balsam poplar, quaking aspen, and paper birch. The recent burn lasted 3 weeks and burned 86,490 acres (35,000 ha). Within the study area, 67% of the habitat was burned. The fire creating the old burn lasted 6 weeks and burned 308,900 acres (125,000 ha). Within the study area, 42% of the habitat was burned. Due to fuel loading, topography, and changes in fire severity, numerous "islands" of mature forest were left unburned, creating a mosaic effect with large amounts of edge. Abundant postfire vegetative growth occurred in the recent burn, increasing the moose population and providing abundant prey for American black bears during spring. Approximately 6.2 moose calves/American black bear were killed and eaten during spring in the recent burn compared to 1.2 moose calves/American black bear in the old burn. During spring and fall, mountain cranberries were eaten more frequently in the old burn because mountain cranberry had not yet recovered from the recent burn. More invertebrates were available in the old burn because the burned wood had rotted. Devil's club (Oplopanax horridus) and claspedleaf twistedstalk (Streptopus amplexifolius) were the most common foods eaten in unburned patches of the recent burn. Horsetails and bluejoint reedgrass (Calamagrostis canadensis) were available in the old and recent burns and were the only 2 plant groups consumed as green vegetation. During summer, most American black bears from both burns left their traditional use areas to forage on devil's club [226].

Following a severe fire within chaparral and Madrean evergreen forest in the southern Mazatzal Mountains, Arizona, American black bears extensively used unburned patches of vegetation within postfire habitats, illustrating the importance of managing a mosaic of burned and unburned habitat. Presence of shrubs in proximity to large coniferous trees was considered optimal postfire foraging and bedding habitat [52]. According to Cunningham and others [52], shrub live oak-pointleaf manzanita (Quercus turbinella-Arctostaphylos pungens) chaparral reestablishment begins approximately 11 years after fire. As the density of chaparral increases, American black bears use burned areas more often. To reduce fire severity and potential negative impacts on American black bear, the authors recommend periodically removing litter via prescribed fire [52].

Impacts on dens and cover: Quantitative data on fire's impacts on dens and American black bear cover are scarce. Depending on fire severity, den sites and cover may or may not be negatively affected by fire. Low- to medium-severity fire may increase the density of snags and downed wood used by American black bears [39]. A severe fire that removes large amounts of snags, coarse woody debris, and vegetative cover would most likely negatively affect American black bears [36,54,54,84,114,186,199,250].

Impacts on reproductive success: Reproductive success may increase several years following fire due to increased vegetative growth within early-successional habitat [50,52,122,225,226].

On the northern Kenai Peninsula lowlands of Alaska, density of moose was greater on a recent burn (13-18 years old) than an old burn (35-40 years old), resulting in significantly (P<0.05) greater reproductive success, cub survival, and body size of American black bears on the recent burn. In the recent burn, excellent early-successional habitat was available for moose forage, resulting in a moose population twice that of the old burn. Consumption of moose calves by American black bears was 4 times greater in the recent burn compared to the old burn. Density and litter size of American black bears were similar between recent and old burns; however, females in the recent burn bred at a younger age and had shorter reproductive intervals than females in the old burn. Survival of cubs was higher in the recent burn, but survival of subadult and adult females and males was lower. Hunting was the main cause of death for all age classes except cubs [225,226]:

Population dynamics of moose and American black bears in a recent and old burn in the northern Kenai Peninsula lowlands of Alaska [225,226]
  Recent burn
(13-18 years old)
Old burn
(35-40 years old)
Significance level

Moose

Density (moose/km²) 3.3 to 3.7 1.3 to 0.3 ---*
Population trend during study peaked down ---
Population peak (yrs.) postfire years 15-16 postfire years 13-14 ---
Twinning rate (%) 70 22 ---

American black bears

Density 258 205 not significant
Age of 1st reproduction (years) 4.6 5.8 P<0.05
Interval between successful weanings of yearlings (years) 2.0 2.4 P<0.05
Cub survival 0.91 0.74 P<0.05
Subadult male survival 0.38 0.70 ---
Subadult female survival 0.66 0.93 ---
Adult male survival 0.77 0.90 ---
Adult female survival 0.85 0.89 ---
Body size greater smaller (kg not given) P<0.05
Number of moose calves consumed by 1 American black bear/season 6.2 1.2 ---
*no data.

Density of American black bears, adult survival rates, and cub production were similar between burned and unburned areas in 2 desert sky-island habitats in the southern Mazatzal Mountains, Arizona. The largest impact of the fire was lack of recruitment of cubs to the yearling age class. Elevations in both study areas ranged from 2,300 to 7,500 feet (700-2,300 m), with many slopes >45%. Habitat at low elevations (<2,900 feet (900 m)) was semidesert grassland and Arizona Sonoran desert scrub. At moderate elevations (2,900-6,100 feet (900-1,800 m)), habitat type was interior shrub live oak-pointleaf manzanita chaparral. At high elevations (>6,070 feet), habitat types were pure ponderosa pine forest and Madrean evergreen forest consisting of ponderosa pine mixed with Gambel oak, Emory oak (Q. emoryi), and other chaparral species [50,52].

A severe wildfire killed >90% of vegetation within the 237 km² burned study area. Within the burned Madrean evergreen forest, 2 patches of unburned vegetation remained (16 km² and 10.2 km²), and American black bears used them more than expected based on their availability. Within burned areas, most vegetation used for American black bear cover was removed. Trunks and large tree branches were charred but intact. Daytime cover was not available until postfire year 4, and forage was not available until postfire year 2 [50,52].

From 1997 to 2000, the number of cubs produced per female was similar between burned and unburned sites (1.3 cubs/female). In the burned area, 16 cubs were produced, and 0 survived to 1 year of age. Females with cubs had to share small, unburned patches within burned areas with adult males. Death of cubs was caused either by adult males or from malnutrition. In the unburned habitat, 13 cubs were produced, and 36% survived to 1 year of age [50,52]:

Production and survival of American black bear cubs in the Mazatzal Mountains, Arizona from 1997 to 2000 [50,52]
Study area No. breeding females % of females producing cubs No. cubs produced % of cubs surviving to 1 year of age

Burn (1996)

1997 4 100.0 9 0.0
1998 5 40.0 5 0.0
1999 3 33.3 2 0.0
Total 12   16 0.0

Unburned

1997 4 75.0 6 16.6
1998 3 66.6 5 60.0
1999 3 33.3 2 no data
Total 10 no data 13 36.4

Prescribed fire: Prescribed fire combined with other silvicultural treatments creates and maintains suitable conditions for the American black bear by increasing food availability [82,268]. Large-scale prescribed burns are not recommended because American black bears may be displaced by lack of food, cover, and den sites. Frequent, low-severity surface fires on a small scale are recommended in most habitats because they create a variety of successional stages [34,86,111,144] and do not destroy large coarse woody debris [34,84,88,144,256,262,267].

To maximize soft mast production in open slash pine (Pinus elliottii) forests in southeastern Georgia, Johnson and Landers [111] suggest conducting low-severity prescribed burns at 3-year intervals. To encourage hard mast production, some longer intervals (>5 years) are encouraged [111].

Low-severity prescribed burns conducted at 5-year intervals benefit production of Oregon white oak. In areas with Douglas-fir encroachment, Larsen and Morgan [144] suggest burning every 3 to 5 years, and in areas where oak sapling growth success is critical or fuel loading is not a problem, burning every 5 to 10 years [144]. For more recommendations on Oregon white oak restoration and enhancement for wildlife, see Larsen and Morgan [144].

High-severity stand-replacing prescribed burns may lead to productive russet buffaloberry feeding habitat for American black bears ≥5 years after fire. Due to potential hazards of conducting stand-replacing prescribed burns, 2 or more burns may be necessary to simulate a high-severity burn. Prescribed burning on south-facing slopes results in successful regeneration of buffaloberry [86].

In forests located in the southeastern US and the southern Appalachians, extensive laurel (Kalmia spp.) and rhododendron (Rhododendron spp.) thickets provide dense cover for American black bears, and prescribed fire should be used carefully in these areas [88]. Hamilton [88] does not recommend prescribed fire in areas used for denning or cover by American black bears. Instead, it should be applied to heath or grass balds to stimulate growth of grasses, forbs, and fruit-producing shrubs. Low-severity burning should be conducted during winter because summer burning may reduce American black bear's food supply. Prescribed fire should also be applied with caution along the periphery of Carolina bays, and fire should be excluded from Coastal Plain hardwood swamps, sand ridges dominated by oaks, and from mountainous terrain due to potential detrimental effects on mast production and hardwood regeneration [88].

Small-scale prescribed burns are recommended for renewing seral whitebark pine communities at high-elevations areas where whitebark pine is badly damaged by mountain pine beetles (Dendroctonus ponderosae) and white pine blister rust [256]. In quaking aspen habitat, prescribed burning during spring is beneficial for regeneration of quaking aspen. In older stands where fuel is lacking, prescribed burns may not be possible. A good substitute for prescribed fire in quaking aspen habitat is dormant season logging, which promotes sprout regeneration [82].

A late winter/early spring prescribed burn in grassland habitat in Craig Mountain Wildlife Management Area in west-central Idaho improved habitat quality for mule deer, elk, and bighorn sheep (Ovis canadensis). The effects of the prescribed fire were not examined for American black bears; however, American black bears occupied the area may have benefited from improved forage of grasses during spring. Grasslands were composed of perennial bunchgrasses. The 3 grassland types burned were: bluebunch wheatgrass (Pseudoroegneria spicata)/plains prickly-pear (Opuntia polyacantha), bluebunch wheatgrass/Sandberg bluegrass (Poa secunda), and Idaho fescue (Festuca idahoensis)-bluebunch wheatgrass. Elevation ranged from 800 to 3,600 feet (200-1,100 m), and slopes ranged from 20% to 80%. Three-thousand acres (1,214 ha) were burned in late February and mid-March. The fire created a mosaic pattern, burning 30% to 65% of the area. Prior to fire exclusion, fires occurred in the area every 10 to 25 years. The fire was an effective tool for maintaining, rejuvenating, and improving big game winter ranges [112].

Evidence suggests that most oaks are favored by relatively frequent fires [1,11,17,151,218,262,279]. A series of low-severity prescribed fires prior to timber harvest can promote advanced regeneration of white oak. In the southern Appalachians, biennial summer fires are often most effective in promoting advance regeneration [262,266]. In upland habitat of the southeastern coastal plain of Florida, Stratman [250] recommends prescribed fire intervals of 7 to 10 years to promote oak regeneration and mast production. In stands dominated by oak, advance regeneration in the understory is a prerequisite for reestablishment subsequent to timber harvest [34,262]. To favor oak reproduction and establishment, Brose and Van Lear [34] recommend prescribed fires at intervals of 3 to 5 years following shelterwood cuts in upland stands with advance oak regeneration [34]. Refer to the FEIS reviews of northern red oak, white oak, Oregon white oak, and other oak species used by American black bears for more information about fire effects to oaks.

In sand pine (P. clausa)-scrub habitat in Ocala National Forest, Florida, full recovery of vegetation occurred 16 months following a prescribed stand-replacement fire. Three months after the fire, Florida black bears ate apical meristems from 50% of saw-palmetto and scrub palmetto (Sabal etonia) sprouts [81]. A mosaic of recent burns and relatively fire-free pine and saw-palmetto habitat is most beneficial for Florida black bears, and regular production of saw-palmetto fruits cannot be expected with frequent prescribed burning [159]. Maehr and others [161] recommend maintaining saw-palmetto in several stages of postfire recovery. Patches of saw-palmetto should be maintained at 1- to 20-postfire-year intervals to provide food, cover, and den sites [161].

Florida black bears showed the highest annual use of 2-year-old and 6-year-old prescribed burns in longleaf pine-Beyrech threeawn sandhills and pine (Pinus spp.) habitat in northern Florida. Burns <1 year old did not provide American black bears with adequate food resources or escape cover. High use of 2-year-old and 6-year-old burns was probably attributed to peak production of mast species and proximity to riparian areas used for cover. During fall, 2-year-old and 5-year-old burns resulting form low-severity fire were used most often. The low-severity of fall burns probably allowed high survival of oaks. In upland habitat, low-severity prescribed fire intervals of 3 to 5 years benefits Florida black bears by stimulating mast production of plants such as huckleberry, ground blueberry (V. myrsinites), sweet gallberry (Ilex coriacea), bitter gallberry (I. glabra), and greenbrier (Smilax spp.). A fire cycle >5 years stimulates mast production of highbush blueberry (V. corymbosum), sparkleberry (V. arboreum), black tupelo (Nyssa sylvatica), and common persimmon (Diospyros virginiana). Winter fire exclusion prevents disturbance of denning Florida black bears [250].

Hall [84] and Weaver [268] recommend protecting snags and coarse woody debris during prescribed burning. Before conducting a prescribed burn, potential den trees and large (>20 inches (50 cm)), hollow logs should be protected from fire by removing combustible material from the immediate areas [84,268].

The following table provides fire regime information on vegetation communities in which American black bear may occur, based on the habitat characteristics and species composition of communities American black bear are known to occupy. There is not conclusive evidence that American black bear occur in all the habitat types listed, and some community types, especially those used rarely, may have been omitted.

Fire regime information on vegetation communities in which American black bear may occur. For each community, fire regime characteristics are taken from the LANDFIRE Rapid Assessment Vegetation Models [138]. These vegetation models were developed by local experts using available literature, local data, and/or expert opinion as documented in the PDF file linked from each Potential Natural Vegetation Group listed below. Cells are blank where information is not available in the Rapid Assessment Vegetation Model.
Pacific Northwest California Southwest Great Basin Northern Rockies
Northern Great Plains Great Lakes Northeast South-central US Southern Appalachians
Southeast        
Pacific Northwest
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northwest Grassland
Alpine and subalpine meadows and grasslands   Replacement 68% 350 200 500
Mixed 32% 750 500 >1,000
Northwest Woodland
Oregon white oak-ponderosa pine   Replacement 16% 125 100 300
Mixed 2% 900 50  
Surface or low 81% 25 5 30
Pine savannah (ultramafic)   Replacement 7% 200 100 300
Surface or low 93% 15 10 20
Ponderosa pine   Replacement 5% 200    
Mixed 17% 60    
Surface or low 78% 13    
Oregon white oak   Replacement 3% 275    
Mixed 19% 50    
Surface or low 78% 12.5    
Subalpine woodland   Replacement 21% 300 200 400
Mixed 79% 80 35 120
Northwest Forested
Sitka spruce-western hemlock   Replacement 100% 700 300 >1,000
Douglas-fir (Willamette Valley foothills)   Replacement 18% 150 100 400
Mixed 29% 90 40 150
Surface or low 53% 50 20 80
Ponderosa pine (xeric)   Replacement 37% 130    
Mixed 48% 100    
Surface or low 16% 300    
Dry ponderosa pine (mesic)   Replacement 5% 125    
Mixed 13% 50    
Surface or low 82% 8    
Douglas-fir-western hemlock (dry mesic)   Replacement 25% 300 250 500
Mixed 75% 100 50 150
Douglas-fir-western hemlock (wet mesic)   Replacement 71% 400    
Mixed 29% >1,000    
Mixed conifer (southwestern Oregon)   Replacement 4% 400    
Mixed 29% 50    
Surface or low 67% 22    
California mixed evergreen (northern California)   Replacement 6% 150 100 200
Mixed 29% 33 15 50
Surface or low 64% 15 5 30
Mountain hemlock   Replacement 93% 750 500 >1,000
Mixed 7% >1,000    
Lodgepole pine (pumice soils)   Replacement 78% 125 65 200
Mixed 22% 450 45 85
Pacific silver fir (low elevation)   Replacement 46% 350 100 800
Mixed 54% 300 100 400
Pacific silver fir (high elevation)   Replacement 69% 500    
Mixed 31% >1,000    
Subalpine fir   Replacement 81% 185 150 300
Mixed 19% 800 500 >1,000
Mixed conifer (eastside dry)   Replacement 14% 115 70 200
Mixed 21% 75 70 175
Surface or low 64% 25 20 25
Mixed conifer (eastside mesic)   Replacement 35% 200    
Mixed 47% 150    
Surface or low 18% 400    
Red fir   Replacement 20% 400 150 400
Mixed 80% 100 80 130
Spruce-fir   Replacement 84% 135 80 270
Mixed 16% 700 285 >1,000
California
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
California Grassland
Herbaceous wetland   Replacement 70% 15    
Mixed 30% 35    
Wet mountain meadow-Lodgepole pine (subalpine)   Replacement 21% 100    
Mixed 10% 200    
Surface or low 69% 30    
Alpine meadows and barrens   Replacement 100% 200 200 400
California Shrubland
Coastal sage scrub-coastal prairie   Replacement 8% 40 8 900
Mixed 31% 10 1 900
Surface or low 62% 5 1 6
Chaparral   Replacement 100% 50 30 125
Montane chaparral   Replacement 34% 95    
Mixed 66% 50    
California Woodland
California oak woodlands   Replacement 8% 120    
Mixed 2% 500    
Surface or low 91% 10    
Ponderosa pine   Replacement 5% 200    
Mixed 17% 60    
Surface or low 78% 13    
California Forested
California mixed evergreen   Replacement 10% 140 65 700
Mixed 58% 25 10 33
Surface or low 32% 45 7  
Coast redwood   Replacement 2% ≥1,000    
Surface or low 98% 20    
Mixed conifer (North Slopes)   Replacement 5% 250    
Mixed 7% 200    
Surface or low 88% 15 10 40
Mixed conifer (South Slopes)   Replacement 4% 200    
Mixed 16% 50    
Surface or low 80% 10    
Aspen with conifer   Replacement 24% 155 50 300
Mixed 15% 240    
Surface or low 61% 60    
Jeffrey pine   Replacement 9% 250    
Mixed 17% 130    
Surface or low 74% 30    
Mixed evergreen-bigcone Douglas-fir (southern coastal)   Replacement 29% 250    
Mixed 71% 100    
Interior white fir (northeastern California)   Replacement 47% 145    
Mixed 32% 210    
Surface or low 21% 325    
Red fir-white fir   Replacement 13% 200 125 500
Mixed 36% 70    
Surface or low 51% 50 15 50
Red fir-western white pine   Replacement 16% 250    
Mixed 65% 60 25 80
Surface or low 19% 200    
Sierra Nevada lodgepole pine (cold wet upper montane)   Replacement 23% 150 37 764
Mixed 70% 50    
Surface or low 7% 500    
Sierra Nevada lodgepole pine (dry subalpine)   Replacement 11% 250 31 500
Mixed 45% 60 31 350
Surface or low 45% 60 9 350
Southwest
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southwest Grassland
Desert grassland   Replacement 85% 12    
Surface or low 15% 67    
Desert grassland with shrubs and trees   Replacement 85% 12    
Mixed 15% 70    
Shortgrass prairie with trees   Replacement 80% 15 2 35
Mixed 20% 60    
Plains mesa grassland   Replacement 81% 20 3 30
Mixed 19% 85 3 150
Plains mesa grassland with shrubs or trees   Replacement 76% 20    
Mixed 24% 65    
Montane and subalpine grasslands   Replacement 55% 18 10 100
Surface or low 45% 22    
Montane and subalpine grasslands with shrubs or trees   Replacement 30% 70 10 100
Surface or low 70% 30    
Southwest Shrubland
Salt desert scrubland   Replacement 13% 200 100 300
Mixed 87% 31 20 100
Southwestern shrub steppe   Replacement 72% 14 8 15
Mixed 13% 75 70 80
Surface or low 15% 69 60 100
Southwestern shrub steppe with trees   Replacement 52% 17 10 25
Mixed 22% 40 25 50
Surface or low 25% 35 25 100
Interior Arizona chaparral   Replacement 100% 125 60 150
Gambel oak   Replacement 75% 50    
Mixed 25% 150    
Mountain-mahogany shrubland   Replacement 73% 75    
Mixed 27% 200    
Southwest Woodland
Madrean oak-conifer woodland   Replacement 16% 65 25  
Mixed 8% 140 5  
Surface or low 76% 14 1 20
Pinyon-juniper (mixed fire regime)   Replacement 29% 430    
Mixed 65% 192    
Surface or low 6% >1,000    
Pinyon-juniper (rare replacement fire regime)   Replacement 76% 526    
Mixed 20% >1,000    
Surface or low 4% >1,000    
Ponderosa pine/grassland (Southwest)   Replacement 3% 300    
Surface or low 97% 10    
Bristlecone-limber pine (Southwest)   Replacement 67% 500    
Surface or low 33% >1,000    
Southwest Forested
Riparian forest with conifers   Replacement 100% 435 300 550
Riparian deciduous woodland   Replacement 50% 110 15 200
Mixed 20% 275 25  
Surface or low 30% 180 10  
Ponderosa pine-Gambel oak (southern Rockies and Southwest)   Replacement 8% 300    
Surface or low 92% 25 10 30
Ponderosa pine-Douglas-fir (southern Rockies)   Replacement 15% 460    
Mixed 43% 160    
Surface or low 43% 160    
Southwest mixed conifer (warm, dry with aspen)   Replacement 7% 300    
Mixed 13% 150 80 200
Surface or low 80% 25 2 70
Southwest mixed conifer (cool, moist with aspen)   Replacement 29% 200 80 200
Mixed 35% 165 35  
Surface or low 36% 160 10  
Aspen with spruce-fir   Replacement 38% 75 40 90
Mixed 38% 75 40  
Surface or low 23% 125 30 250
Stable aspen without conifers   Replacement 81% 150 50 300
Surface or low 19% 650 600 >1,000
Lodgepole pine (Central Rocky Mountains, infrequent fire)   Replacement 82% 300 250 500
Surface or low 18% >1,000 >1,000 >1,000
Spruce-fir   Replacement 96% 210 150  
Mixed 4% >1,000 35 >1,000
Great Basin
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Great Basin Grassland
Mountain meadow (mesic to dry)   Replacement 66% 31 15 45
Mixed 34% 59 30 90
Great Basin Shrubland
Wyoming big sagebrush semidesert with trees   Replacement 84% 137 30 200
Mixed 11% >1,000 20 >1,000
Surface or low 5% >1,000 20 >1,000
Wyoming sagebrush steppe   Replacement 89% 92 30 120
Mixed 11% 714 120  
Interior Arizona chaparral   Replacement 88% 46 25 100
Mixed 12% 350    
Mountain big sagebrush with conifers   Replacement 100% 49 15 100
Montane chaparral   Replacement 37% 93    
Mixed 63% 54    
Gambel oak   Replacement 75% 50    
Mixed 25% 150    
Mountain shrubland with trees   Replacement 22% 105 100 200
Mixed 78% 29 25 100
Black and low sagebrushes with trees   Replacement 37% 227 150 290
Mixed 63% 136 50 190
Curlleaf mountain-mahogany   Replacement 31% 250 100 500
Mixed 37% 212 50  
Surface or low 31% 250 50  
Great Basin Woodland
Juniper and pinyon-juniper steppe woodland   Replacement 20% 333 100 >1,000
Mixed 31% 217 100 >1,000
Surface or low 49% 135 100  
Ponderosa pine   Replacement 5% 200    
Mixed 17% 60    
Surface or low 78% 13    
Great Basin Forested
Interior ponderosa pine   Replacement 5% 161   800
Mixed 10% 80 50 80
Surface or low 86% 9 8 10
Ponderosa pine-Douglas-fir   Replacement 10% 250   >1,000
Mixed 51% 50 50 130
Surface or low 39% 65 15  
Great Basin Douglas-fir (dry)   Replacement 12% 90   600
Mixed 14% 76 45  
Surface or low 75% 14 10 50
Aspen with conifer (low to midelevation)   Replacement 53% 61 20  
Mixed 24% 137 10  
Surface or low 23% 143 10  
Douglas-fir (warm mesic interior)   Replacement 28% 170 80 400
Mixed 72% 65 50 250
Aspen with conifer (high elevation)   Replacement 47% 76 40  
Mixed 18% 196 10  
Surface or low 35% 100 10  
Stable aspen-cottonwood, no conifers   Replacement 31% 96 50 300
Surface or low 69% 44 20 60
Spruce-fir-pine (subalpine)   Replacement 98% 217 75 300
Mixed 2% >1,000    
Aspen with spruce-fir   Replacement 38% 75 40 90
Mixed 38% 75 40  
Surface or low 23% 125 30 250
Stable aspen without conifers   Replacement 81% 150 50 300
Surface or low 19% 650 600 >1,000
Northern Rockies
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Rockies Grassland
Mountain grassland   Replacement 60% 20 10  
Mixed 40% 30    
Northern Rockies Shrubland
Riparian (Wyoming)  
Mixed 100% 100 25 500
Wyoming big sagebrush Replacement 63% 145 80 240
Mixed 37% 250    
Mountain shrub, nonsagebrush   Replacement 80% 100 20 150
Mixed 20% 400    
Mountain big sagebrush steppe and shrubland   Replacement 100% 70 30 200
Northern Rockies Woodland
Ancient juniper   Replacement 100% 750 200 >1,000
Northern Rockies Forested
Ponderosa pine (Northern Great Plains)   Replacement 5% 300    
Mixed 20% 75    
Surface or low 75% 20 10 40
Ponderosa pine (Northern and Central Rockies)   Replacement 4% 300 100 >1,000
Mixed 19% 60 50 200
Surface or low 77% 15 3 30
Ponderosa pine (Black Hills, low elevation)   Replacement 7% 300 200 400
Mixed 21% 100 50 400
Surface or low 71% 30 5 50
Ponderosa pine (Black Hills, high elevation)   Replacement 12% 300    
Mixed 18% 200    
Surface or low 71% 50    
Ponderosa pine-Douglas-fir   Replacement 10% 250   >1,000
Mixed 51% 50 50 130
Surface or low 39% 65 15  
Western redcedar   Replacement 87% 385 75 >1,000
Mixed 13% >1,000 25  
Douglas-fir (xeric interior)   Replacement 12% 165 100 300
Mixed 19% 100 30 100
Surface or low 69% 28 15 40
Douglas-fir (warm mesic interior)   Replacement 28% 170 80 400
Mixed 72% 65 50 250
Douglas-fir (cold)   Replacement 31% 145 75 250
Mixed 69% 65 35 150
Grand fir-Douglas-fir-western larch mix   Replacement 29% 150 100 200
Mixed 71% 60 3 75
Mixed conifer-upland western redcedar-western hemlock   Replacement 67% 225 150 300
Mixed 33% 450 35 500
Western larch-lodgepole pine-Douglas-fir   Replacement 33% 200 50 250
Mixed 67% 100 20 140
Grand fir-lodgepole pine-larch-Douglas-fir   Replacement 31% 220 50 250
Mixed 69% 100 35 150
Persistent lodgepole pine   Replacement 89% 450 300 600
Mixed 11% >1,000    
Whitebark pine-lodgepole pine (upper subalpine, Northern and Central Rockies)   Replacement 38% 360    
Mixed 62% 225    
Lower subalpine lodgepole pine   Replacement 73% 170 50 200
Mixed 27% 450 40 500
Lower subalpine (Wyoming and Central Rockies)   Replacement 100% 175 30 300
Upper subalpine spruce-fir (Central Rockies)   Replacement 100% 300 100 600
Northern Great Plains
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northern Plains Grassland
Oak savanna   Replacement 7% 44    
Mixed 17% 18    
Surface or low 76% 4    
Northern Plains Woodland
Oak woodland   Replacement 2% 450    
Surface or low 98% 7.5
Great Plains floodplain   Replacement 100% 500    
Great Lakes
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Great Lakes Grassland
Mosaic of bluestem prairie and oak-hickory   Replacement 79% 5 1 8
Mixed 2% 260    
Surface or low 20% 2   33
Great Lakes Woodland
Great Lakes pine barrens   Replacement 8% 41 10 80
Mixed 9% 36 10 80
Surface or low 83% 4 1 20
Jack pine-open lands (frequent fire-return interval)   Replacement 83% 26 10 100
Mixed 17% 125 10  
Northern oak savanna   Replacement 4% 110 50 500
Mixed 9% 50 15 150
Surface or low 87% 5 1 20
Great Lakes Forested
Northern hardwood maple-beech-eastern hemlock   Replacement 60% >1,000    
Mixed 40% >1,000    
Conifer lowland (embedded in fire-prone system)   Replacement 45% 120 90 220
Mixed 55% 100    
Conifer lowland (embedded in fire-resistant ecosystem)   Replacement 36% 540 220 >1,000
Mixed 64% 300    
Great Lakes floodplain forest  
Mixed 7% 833    
Surface or low 93% 61    
Great Lakes spruce-fir   Replacement 100% 85 50 200
Minnesota spruce-fir (adjacent to Lake Superior and Drift and Lake Plain)   Replacement 21% 300    
Surface or low 79% 80    
Great Lakes pine forest, jack pine   Replacement 67% 50    
Mixed 23% 143    
Surface or low 10% 333
Maple-basswood   Replacement 33% >1,000    
Surface or low 67% 500    
Maple-basswood mesic hardwood forest (Great Lakes)   Replacement 100% >1,000 >1,000 >1,000
Maple-basswood-oak-aspen   Replacement 4% 769    
Mixed 7% 476    
Surface or low 89% 35    
Northern hardwood-eastern hemlock forest (Great Lakes)   Replacement 99% >1,000    
Oak-hickory   Replacement 13% 66 1  
Mixed 11% 77 5  
Surface or low 76% 11 2 25
Pine-oak   Replacement 19% 357    
Surface or low 81% 85    
Red pine-white pine (frequent fire)   Replacement 38% 56    
Mixed 36% 60    
Surface or low 26% 84    
Red pine-white pine (less frequent fire)   Replacement 30% 166    
Mixed 47% 105    
Surface or low 23% 220    
Great Lakes pine forest, eastern white pine-eastern hemlock (frequent fire)   Replacement 52% 260    
Mixed 12% >1,000    
Surface or low 35% 385    
Eastern white pine-eastern hemlock   Replacement 54% 370    
Mixed 12% >1,000    
Surface or low 34% 588    
Northeast
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Northeast Grassland
Northern coastal marsh Replacement 97% 7 2 50
Mixed 3% 265 20  
Northeast Woodland
Eastern woodland mosaic   Replacement 2% 200 100 300
Mixed 9% 40 20 60
Surface or low 89% 4 1 7
Rocky outcrop pine (Northeast)   Replacement 16% 128    
Mixed 32% 65    
Surface or low 52% 40    
Pine barrens   Replacement 10% 78    
Mixed 25% 32    
Surface or low 65% 12    
Oak-pine (eastern dry-xeric)   Replacement 4% 185    
Mixed 7% 110    
Surface or low 90% 8    
Northeast Forested
Northern hardwoods (Northeast)   Replacement 39% >1,000    
Mixed 61% 650    
Eastern white pine-northern hardwoods   Replacement 72% 475    
Surface or low 28% >1,000    
Northern hardwoods-eastern hemlock   Replacement 50% >1,000    
Surface or low 50% >1,000    
Northern hardwoods-spruce   Replacement 100% >1,000 400 >1,000
Appalachian oak forest (dry-mesic)   Replacement 2% 625 500 >1,000
Mixed 6% 250 200 500
Surface or low 92% 15 7 26
Beech-maple   Replacement 100% >1,000    
Northeast spruce-fir forest   Replacement 100% 265 150 300
Southeastern red spruce-Fraser fir   Replacement 100% 500 300 >1,000
South-central US
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
South-central US Grassland
Oak savanna   Replacement 3% 100 5 110
Mixed 5% 60 5 250
Surface or low 93% 3 1 4
South-central US Shrubland
Southwestern shrub steppe   Replacement 76% 12    
Mixed 24% 37    
South-central US Woodland
Oak-hickory savanna   Replacement 1% 227    
Surface or low 99% 3.2    
Interior Highlands dry oak/bluestem woodland and glade   Replacement 16% 25 10 100
Mixed 4% 100 10  
Surface or low 80% 5 2 7
Interior Highlands oak-hickory-pine   Replacement 3% 150 100 300
Surface or low 97% 4 2 10
Pine bluestem   Replacement 4% 100    
Surface or low 96% 4    
South-central US Forested
Interior Highlands dry-mesic forest and woodland   Replacement 7% 250 50 300
Mixed 18% 90 20 150
Surface or low 75% 22 5 35
Gulf Coastal Plain pine flatwoods   Replacement 2% 190    
Mixed 3% 170    
Surface or low 95% 5    
West Gulf Coastal plain pine (uplands and flatwoods)   Replacement 4% 100 50 200
Mixed 4% 100 50  
Surface or low 93% 4 4 10
West Gulf Coastal Plain pine-hardwood woodland or forest upland   Replacement 3% 100 20 200
Mixed 3% 100 25  
Surface or low 94% 3 3 5
Southern floodplain   Replacement 42% 140    
Surface or low 58% 100    
Southern floodplain (rare fire)   Replacement 42% >1,000    
Surface or low 58% 714    
Cross Timbers   Replacement 3% 170    
Mixed 2% 250    
Surface or low 94% 6    
Southern Appalachians
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southern Appalachians Grassland
Eastern prairie-woodland mosaic   Replacement 50% 10    
Mixed 1% 900    
Surface or low 50% 10    
Southern Appalachians Woodland
Appalachian shortleaf pine   Replacement 4% 125    
Mixed 4% 155    
Surface or low 92% 6    
Table Mountain-pitch pine   Replacement 5% 100    
Mixed 3% 160    
Surface or low 92% 5    
Oak-ash woodland   Replacement 23% 119    
Mixed 28% 95    
Surface or low 49% 55    
Southern Appalachians Forested
Bottomland hardwood forest   Replacement 25% 435 200 >1,000
Mixed 24% 455 150 500
Surface or low 51% 210 50 250
Mixed mesophytic hardwood   Replacement 11% 665    
Mixed 10% 715    
Surface or low 79% 90    
Appalachian oak-hickory-pine   Replacement 3% 180 30 500
Mixed 8% 65 15 150
Surface or low 89% 6 3 10
Eastern hemlock-eastern white pine-hardwood   Replacement 17% >1,000 500 >1,000
Surface or low 83% 210 100 >1,000
Oak (eastern dry-xeric)   Replacement 6% 128 50  
Mixed 16% 50 20  
Surface or low 78% 10 1 10
Appalachian Virginia pine   Replacement 20% 110 25 125
Mixed 15% 145    
Surface or low 64% 35 10 40
Appalachian oak forest (dry-mesic)   Replacement 6% 220    
Mixed 15% 90    
Surface or low 79% 17    
Southern Appalachian high-elevation forest   Replacement 59% 525    
Mixed 41% 770    
Southeast
Vegetation Community (Potential Natural Vegetation Group) Fire severity* Fire regime characteristics
Percent of fires Mean interval
(years)
Minimum interval
(years)
Maximum interval
(years)
Southeast Grassland
Southeast Gulf Coastal Plain Blackland prairie and woodland   Replacement 22% 7    
Mixed 78% 2.2    
Floodplain marsh   Replacement 100% 4 3 30
Everglades (marl prairie)   Replacement 45% 16 10 20
Mixed 55% 13 10  
Palmetto prairie   Replacement 87% 2 1 4
Mixed 4% 40    
Surface or low 9% 20    
Pond cypress savanna   Replacement 17% 120    
Mixed 27% 75    
Surface or low 57% 35    
Gulf Coast wet pine savanna   Replacement 2% 165 10 500
Mixed 1% 500    
Surface or low 98% 3 1 10
Southeast Shrubland
Pocosin   Replacement 1% >1,000 30 >1,000
Mixed 99% 12 3 20
Southeast Woodland
Longleaf pine/bluestem   Replacement 3% 130    
Surface or low 97% 4 1 5
Longleaf pine (mesic uplands)   Replacement 3% 110 40 200
Surface or low 97% 3 1 5
Longleaf pine-Sandhills prairie   Replacement 3% 130 25 500
Surface or low 97% 4 1 10
Pine rocklands  
Mixed 1% 330    
Surface or low 99% 3 1 5
Pond pine   Replacement 64% 7 5 500
Mixed 25% 18 8 150
Surface or low 10% 43 2 50
South Florida slash pine flatwoods   Replacement 6% 50 50 90
Surface or low 94% 3 1 6
Atlantic wet pine savanna   Replacement 4% 100    
Mixed 2% 175    
Surface or low 94% 4     
Southeast Forested
Sand pine scrub   Replacement 90% 45 10 100
Mixed 10% 400 60  
Coastal Plain pine-oak-hickory   Replacement 4% 200    
Mixed 7% 100      
Surface or low 89% 8    
Atlantic white-cedar forest   Replacement 34% 200 25 350
Mixed 8% 900 20 900
Surface or low 59% 115 10 500
Maritime forest   Replacement 18% 40   500
Mixed 2% 310 100 500
Surface or low 80% 9 3 50
Mesic-dry flatwoods   Replacement 3% 65 5 150
Surface or low 97% 2 1 8
Loess bluff and plain forest** Replacement 7% 476    
Mixed 9% 385    
Surface or low 85% 39    
Southern floodplain   Replacement 7% 900    
Surface or low 93% 63    
*Fire Severities:
Replacement=Any fire that causes greater than 75% top removal of a vegetation-fuel type, resulting in general replacement of existing vegetation; may or may not cause a lethal effect on the plants.
Mixed=Any fire burning more than 5% of an area that does not qualify as a replacement, surface, or low-severity fire; includes mosaic and other fires that are intermediate in effects
Surface or low=Any fire that causes less than 25% upper layer replacement and/or removal in a vegetation-fuel class but burns 5% or more of the area [90,137].
  • 7. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 15. Arno, Stephen F.; Simmerman, Dennis G.; Keane, Robert E. 1985. Forest succession on four habitat types in western Montana. Gen. Tech. Rep. INT-177. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 74 p. [349]
  • 27. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 32. Books, David J. 1972. Little Sioux Burn: year 2. Naturalist. 23(3&4): 2-7. [11550]
  • 36. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 37. Bull, Evelyn L.; Torgersen, Torolf R.; Wertz, Tara L. 2001. The importance of vegetation, insects, and neonate ungulates in black bear diet in northeastern Oregon. Northwest Science. 75(3): 244-253. [67680]
  • 39. Bunnell, Fred L.; Houde, Isabelle; Johnston, Barb; Wind, Elke. 2002. How dead trees sustain live organisms in western forests. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 291-318. [44365]
  • 50. Cunningham, Stan C.; Ballard, Warren B. 2004. Effects of wildfire on black bear demographics in central Arizona. Wildlife Society Bulletin. 32(3): 928-937. [55418]
  • 52. Cunningham, Stanley C.; Ballard, Warren B.; Monroe, Lindsey M.; Rabe, Michael J.; Bristow, Kirby D. 2003. Black bear habitat use in burned and unburned areas, central Arizona. Wildlife Society Bulletin. 31(3): 786-792. [52929]
  • 54. Davis, Helen. 1996. Characteristics and selection of winter dens by black bears in coastal British Columbia. Burnaby, BC: Simon Fraser University. 147 p. Thesis. [67916]
  • 64. Elowe, Kenneth D.; Dodge, Wendell E. 1989. Factors affecting black bear reproductive success and cub survival. Journal of Wildlife Management. 53(4): 962-968. [10339]
  • 68. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 85. Hall, Ivan V.; Shay, Jennifer, M. 1981. The biological flora of Canada. 3. Vaccinium vitis-idaea L. var. minus Lodd. Supplementary account. The Canadian Field-Naturalist. 95(4): 434-464. [9125]
  • 88. Hamilton, Robert J. 1981. Effects of prescribed fire on black bear populations in southern forests. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 129-134. [67669]
  • 91. Hannah, Peter R. 1987. Regeneration methods for oaks. Northern Journal of Applied Forestry. 4: 97-101. [3728]
  • 92. Hanson, William A. 1979. Preliminary results of the Bear Creek fire effects studies. Proposed open file report. Anchorage, AK: U.S. Department of the Interior, Bureau of Land Management, Anchorage District Office. 83 p. [6400]
  • 98. Healy, William M. 2002. Managing eastern oak forests for wildlife. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 317-332. [43539]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 133. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 144. Larsen, Eric M.; Morgan, John T. 1998. Management recommendations for Washington's priority habitats: Oregon white oak woodlands. Olympia, WA: Washington Department of Fish and Wildlife. 37 p. [52756]
  • 156. Lyons, Andrea L.; Gaines, William L.; Servheen, Christopher. 2003. Black bear resource selection in the northeast Cascades, Washington. Biological Conservation. 113(1): 55-62. [45766]
  • 159. Maehr, David S.; Belden, Robert C.; Land, E. Darrell; Wilkins, Laurie. 1990. Food habits of panthers in southwest Florida. Journal of Wildlife Management. 54(3): 420-423. [24565]
  • 161. Maehr, David S.; Larkin, Jeffrey L. 2004. Do prescribed fires in south Florida reduce habitat quality for native carnivores? Natural Areas Journal. 24(3): 188-197. [67706]
  • 186. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 1997. Denning ecology of black bears in the White River National Wildlife Refuge, Arkansas. Journal of Wildlife Management. 61(3): 700-706. [67715]
  • 199. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 221. Samson, Claude; Huot, Jean. 1998. Movements of female black bears in relation to landscape vegetation type in southern Quebec. Journal of Wildlife Management. 62(2): 718-727. [67718]
  • 222. Samson, Claude; Huot, Jean. 2001. Spatial and temporal interactions between female American black bears in mixed forests of eastern Canada. Canadian Journal of Zoology. 79(4): 633-641. [67720]
  • 226. Schwartz, Charles C.; Franzmann, Albert W. 1991. Interrelationship of black bears to moose and forest succession in the northern coniferous forest. Wildlife Monographs No. 113. Washington, DC: The Wildlife Society. 58 p. [67724]
  • 230. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin. Series 1. No. 18. Ottawa, ON: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 243. Staten, C. Michael. 1994. Managing terrestrial game and neotropical migratory birds. In: Smith, Winston Paul; Pashley, David N., eds. A workshop to resolve conflicts in the conservation of migratory land birds in bottomland hardwood forests: Proceedings; 1993 August 9-10; Tallulah, LA. Gen. Tech. Rep. SO-114. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experiment Station: 17-19. [26495]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]
  • 251. Stratman, Marty R.; Alden, C. David; Pelton, Michael R.; Sunquist, Melvin E. 2001. Habitat use by American black bears in the sandhills of Florida. Ursus. 12: 109-114. [68596]
  • 256. Tomback, Diana F.; Clary, Jane Kees; Koehler, James; Hoff, Raymond J.; Arno, Stephen F. 1995. The effects of blister rust on post-fire regeneration of whitebark pine: the Sundance Burn of northern Idaho (U.S.A.). Conservation Biology. 9(3): 654-664. [26002]
  • 261. Unsworth, James W.; Beecham, John J.; Irby, Lynn R. 1989. Female black bear habitat use in west-central Idaho. Journal of Wildlife Management. 53(3): 668-673. [8407]
  • 268. Weaver, Keith M. 2000. Black bear ecology and the use of prescribed fire to enhance bear habitat. In: Yaussy, Daniel A., compiler. Proceedings: workshop on fire, people, and the central hardwoods landscape; 2000 March 12-14; Richmond, KY. Gen. Tech. Rep. NE-274. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 89-96. [40313]
  • 2. Agee, James K. 1993. Fire ecology of Pacific Northwest forests. Washington, DC: Island Press. 493 p. [22247]
  • 1. Abrams, Marc D.; Downs, Julie A. 1990. Successional replacement of old-growth white oak by mixed mesophytic hardwoods in southwestern Pennsylvania. Canadian Journal of Forest Research. 20: 1864-1870. [13328]
  • 10. Anderson, Stanley H. 1982. Effects of the 1976 Seney National Wildlife Refuge wildfire on wildlife and wildlife habitat. Resource Publication 146. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 28 p. [52897]
  • 11. Archambault, Louis; Barnes, Burton V.; Witter, John A. 1990. Landscape ecosystems of disturbed oak forests of southeastern Michigan, U.S.A. Canadian Journal of Forest Research. 20: 1570-1582. [13448]
  • 13. Arno, Stephen F. 1980. Forest fire history in the Northern Rockies. Journal of Forestry. 78(8): 460-465. [11990]
  • 14. Arno, Stephen F. 1990. Larix lyallii Parl. alpine larch. In: Burns, Russell M.; Honkala, Barbara H., technical coordinators. Silvics of North America. Volume 1. Conifers. Agric. Handb. 654. Washington, DC: U.S. Department of Agriculture, Forest Service: 152-159. [13380]
  • 16. Asherin, Duane A. 1973. Prescribed burning effects on nutrition, production and big game use of key northern Idaho browse species. Moscow, ID: University of Idaho. 96 p. Dissertation. [360]
  • 17. Auclair, Allan Nelson Douglas. 1968. Dynamics of Prunus serotina in southern Wisconsin. Madison, WI: University of Wisconsin. 125 p. Thesis. [12759]
  • 22. Barnes, T. A.; Van Lear, D. H. 1998. Prescribed fire effects on advanced regeneration in mixed hardwood stands. Southern Journal of Applied Forestry. 22(3): 138-142. [30014]
  • 30. Blanchard, Bonnie M.; Knight, Richard R. 1990. Reactions of grizzly bears, Ursus arctos horribilis, to wildfire in Yellowstone National Park, Wyoming. The Canadian Field-Naturalist. 104(4): 592-594. [15305]
  • 31. Bogener, Dave. 2003. SP-T11 -- Effects of fuel load management and fire prevention on wildlife and plant communities. Oroville, CA: State of California, Department of Water Resources. Draft final report. Oroville Facilities Relicensing: Federal Energy Regulatory Commission Project No. 2100. 42 p. [53768]
  • 33. Bradley, Anne F.; Noste, Nonan V.; Fischer, William C. 1992. Fire ecology of forests and woodlands in Utah. Gen. Tech. Rep. INT-287. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 128 p. [18211]
  • 34. Brose, Patrick H.; Van Lear, David H. 1998. Responses of hardwood advance regeneration to seasonal prescribed fires in oak-dominated shelterwood stands. Canadian Journal of Forestry. 28(3): 331-339. [30049]
  • 45. Coates, D.; Haeussler, S. 1986. A preliminary guide to the response of major species of competing vegetation to silvicultural treatments. Land Management Handbook No. 9. Victoria, BC: Ministry of Forests, Information Services Branch. 88 p. [17453]
  • 51. Cunningham, Stan C.; Kirkendall, LariBeth; Ballard, Warren. 2006. Gray fox and coyote abundance and diet responses after a wildfire in central Arizona. Western North American Naturalist. 66(2): 169-180. [64517]
  • 53. Daubenmire, R. 1968. Ecology of fire in grasslands. In: Cragg, J. B., ed. Advances in ecological research. Vol. 5. New York: Academic Press: 209-266. [739]
  • 69. French, Marilynn Gibbs; French, Steven P. 1996. Large mammal mortality in the 1988 Yellowstone fires. In: Greenlee, Jason, ed. The ecological implications of fire in Greater Yellowstone: Proceedings, 2nd biennial conference on the Greater Yellowstone Ecosystem; 1993 September 19-21; Yellowstone National Park, WY. Fairfield, WA: International Association of Wildland Fire: 113-115. [27835]
  • 80. Greater Yellowstone Coordinating Committee. 1988. Greater Yellowstone Area fire situation, 1988. Final report. Billings, MT: U.S. Department of Agriculture, Forest Service, Custer National Forest. 207 p. [38771]
  • 81. Greenberg, Cathryn H. 2003. Vegetation recovery and stand structure following a prescribed stand-replacement burn in sand pine scrub. Natural Areas Journal. 23(2): 141-151. [44586]
  • 84. Hall, Frederick C. 1976. Fire and vegetation in the Blue Mountains: implications for land managers. In: Proceedings, annual Tall Timbers fire ecology conference; 1974 October 16-17; Portland, Oregon. No. 15. Tallahassee, FL: Tall Timbers Research Station: 155-170. [6272]
  • 99. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 107. Horton, K. W.; Hopkins, E. J. 1965. Influence of fire on aspen suckering. Forestry Publication No. 1095. Ottawa: Canadian Department of Forestry, Forest Research Branch. 19 p. [34581]
  • 111. Johnson, A. Sydney; Landers, J. Larry. 1978. Fruit production in slash pine plantations in Georgia. Journal of Wildlife Management. 42(3): 606-613. [9855]
  • 119. Keane, Robert E. 2000. The importance of wilderness to whitebark pine research and management. In: McCool, Stephen F.; Cole, David N.; Borrie, William T.; O'Loughlin, Jennifer, compilers. Wilderness science in a time of change conference: Proceedings. Volume 3: Wilderness as a place for scientific inquiry; 1999 May 23-27; Missoula, MT. RMRS-P-15-VOL-3. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 84-92. [40087]
  • 121. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 122. Kelsall, John P.; Telfer, E. S.; Wright, Thomas D. 1977. The effects of fire on the ecology of the boreal forest, with particular reference to the Canadian north: a review and selected bibliography. Occasional Paper No. 32. Ottawa, ON: Fisheries and Environment Canada, Canadian Wildlife Service. 58 p. [8403]
  • 126. Keyser, Patrick D.; Ford, W. Mark. 2006. Influence of fire on mammals in eastern oak forests. In: Dickinson, Matthew B., ed. Fire in eastern oak forests: delivering science to land managers, proceedings of a conference; 2005 November 15-17; Columbus, OH. Gen. Tech. Rep. NRS-P-1. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northern Research Station: 180-190. [66410]
  • 138. LANDFIRE Rapid Assessment. 2007. Rapid assessment reference condition models. In: LANDFIRE. U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Lab; U.S. Geological Survey; The Nature Conservancy (Producers). Available: http://www.landfire.gov/models_EW.php [66533]
  • 151. Loftis, David L. 1990. A shelterwood method for regenerating red oak in the southern Appalachians. Forest Science. 36(4): 917-929. [13439]
  • 152. Lowe, Philip O.; Ffolliott, Peter F.; Dieterich, John H.; Patton, David R. 1978. Determining potential wildlife benefits from wildfire in Arizona ponderosa pine forests. Gen. Tech. Rep. RM-52. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [4481]
  • 153. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; Fredriksen, Richard L.; Harlow, Richard F.; Metz, Louis J.; Pearson, Henry A. 1978. Effects of fire on fauna: a state-of-knowledge review. Gen. Tech. Rep. WO-6. Washington, DC: U.S. Department of Agriculture, Forest Service, Washington Office. 41 p. [25066]
  • 154. Lyon, L. Jack; Hooper, Robert G.; Telfer, Edmund S.; Schreiner, David Scott. 2000. Fire effects on wildlife foods. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 51-58. [44448]
  • 155. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 163. Martin, Patricia A. E. 1979. Productivity and taxonomy of the Vaccinium globulare, V. membranaceum complex in western Montana. Missoula, MT: University of Montana. 136 p. Thesis. [9130]
  • 174. Minore, Don. 1972. The wild huckleberries of Oregon and Washington--a dwindling resource. PNW-143. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 20 p. [8952]
  • 179. Morgan, Penelope; Murray, Michael P. 2001. Landscape ecology and isolation: implications for conservation of whitebark pine. In: Tomback, Diana F.; Arno, Stephen F.; Keane, Robert E., eds. Whitebark pine communities: Ecology and restoration. Washington, DC: Island Press: 289-309. [36707]
  • 180. Murray, Michael P.; Bunting, Stephen C.; Morgan, Penelope. 1995. Whitebark pine and fire suppression in small wilderness areas. In: Brown, James K.; Mutch, Robert W.; Spoon, Charles W.; Wakimoto, Ronald H., tech. coords. Proceedings: symposium on fire in wilderness and park management; 1993 March 30-April 1; Missoula, MT. Gen. Tech. Rep. INT-GTR-320. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 237-240. [26224]
  • 181. Murray, Michael P.; Bunting, Stephen C.; Morgan, Penny. 1997. Subalpine ecosystems: the roles of whitebark pine and fire. In: Greenlee, Jason M., ed. Proceedings, 1st conference on fire effects on rare and endangered species and habitats; 1995 November 13-16; Coeur d'Alene, ID. Fairfield, WA: International Association of Wildland Fire: 295-299. [28152]
  • 185. Noste, Nonan V.; Bushey, Charles L. 1987. Fire response of shrubs of dry forest habitat types in Montana and Idaho. Gen. Tech. Rep. INT-239. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 22 p. [255]
  • 194. Penfound, William T. 1968. Influence of a wildfire in the Wichita Mountains Wildlife Refuge, Oklahoma. Ecology. 49(5): 1003-1006. [12297]
  • 200. Potter, Meredith W.; Kessell, Stephen R. 1985. Predicting mosaics and wildlife diversity resulting from fire disturbance to a forest ecosystem. Environmental Management. 4(3): 247-254. [30114]
  • 216. Rowe, J. S.; Scotter, G. W. 1973. Fire in the boreal forest. Quaternary Research. 3: 444-464. [72]
  • 218. Rundel, Philip W. 1980. Adaptations of mediterranean-climate oaks to environmental stress. In: Plumb, Timothy R., tech. coord. Proceedings of the symposium on the ecology, management and utilization of California oaks; 1979 June 26-28; Claremont, CA. Gen. Tech. Rep. PSW-44. Berkeley, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Forest and Range Experiment Station: 43-54. [7014]
  • 225. Schwartz, Charles C.; Franzmann, Albert W. 1989. Bears, wolves, moose, and forest succession, some management considerations on the Kenai Peninsula, Alaska. Alces. 25: 1-10. [67734]
  • 235. Singer, Francis J.; Schreier, William; Oppenheim, Jill; Garton, Edward O. 1989. Drought, fires, and large mammals. BioScience. 39(10): 716-722. [67678]
  • 236. Singer, Francis J.; Schullery, Paul. 1989. Yellowstone wildlife: populations in process. Western Wildlands. 15(2): 18-22. [67676]
  • 240. Smith, Jane Kapler; Fischer, William C. 1997. Fire ecology of the forest habitat types of northern Idaho. Gen. Tech. Rep. INT-GTR-363. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 142 p. [27992]
  • 254. Tomback, Diana F. 1982. Dispersal of whitebark pine seeds by Clark's nutcracker: a mutualism hypothesis. Journal of Animal Ecology. 51: 451-467. [2346]
  • 259. U.S. Department of Interior, National Park Service, Rocky Mountain Region, Yellowstone National Park. 1991. Yellowstone National Park fire management plan. Denver, CO: U.S. Department of the Interior, National Park Service, Rocky Mountain Region, Yellowstone National Park. 116 p. Draft. [15370]
  • 262. Van Lear, David H.; Waldrop, Thomas A. 1989. History, uses, and effects of fire in the Appalachians. Gen. Tech. Rep. SE-54. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 20 p. [10126]
  • 266. Vogel, Willis G. 1990. Results of planting oaks on coal surface-mined lands. In: Van Sambeek, J. W.; Larson, M. M., eds. Fourth workshop on seedling physiology and growth problems in oak plantings: Proceedings (abstracts); 1989 March 1-2; Columbus, OH. Gen. Tech. Rep. NC-139. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station: 19. Abstract. [13146]
  • 267. Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in the Southwest. Tucson, AZ: University of Arizona. 82 p. [4031]
  • 269. Weaver, T.; Dale, D. 1974. Pinus albicaulis in central Montana: environment, vegetation and production. The American Midland Naturalist. 92(1): 222-230. [2470]
  • 279. Wydeven, Adrian P.; Kloes, Glenn G. 1989. Canopy reduction, fire influence oak regeneration (Wisconsin). Restoration and Management Notes. 7(2): 87-88. [11413]
  • 283. Zager, Peter Edward. 1980. The influence of logging and wildfire on grizzly bear habitat in northwestern Montana. Missoula, MT: University of Montana. 131 p. Dissertation. [5032]
  • 61. Despain, Don G. 1978. Effects of natural fires in Yellowstone National Park. Information Paper No. 34. [Place of publication unknown]: U.S. Department of the Interior, National Park Service, Yellowstone National Park. 2 p. [15670]
  • 82. Gullion, Gordon W. [n.d.]. Report upon a visit to the Colorado National Forests, July 19-23, 1976, with recommendations for management of the aspen ecosystems for wood fiber and wildlife. Unpublished report to: W. B. Gallaher, Director, Range and Wildlife Management, U.S. Department of Agriculture, Forest Service, Lakewood, CO. 11 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [17099]
  • 86. Hamer, David. 1995. Buffaloberry (Shepherdia canadensis) fruit production in fire-successional bear feeding sites. Unpublished report [submitted to Parks Canada]. Banff, AB: Parks Canada, Banff National Park. 65 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24885]
  • 87. Hamer, David. 1996. Buffaloberry [Shepherdia canadensis (L.) Nutt.] fruit production in fire-successional bear feeding sites. Journal of Range Management. 49(6): 520-529. [27214]
  • 90. Hann, Wendel; Havlina, Doug; Shlisky, Ayn; [and others]. 2005. Interagency fire regime condition class guidebook. Version 1.2, [Online]. In: Interagency fire regime condition class website. U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior; The Nature Conservancy; Systems for Environmental Management (Producer). Variously paginated [+ appendices]. Available: http://www.frcc.gov/docs/1.2.2.2/Complete_Guidebook_V1.2.pdf [2007, May 23]. [66734]
  • 112. Johnson, Craig A. 1989. Early spring prescribed burning of big game winter range in the Snake River Canyon of westcentral Idaho. In: Baumgartner, David M.; Breuer, David W.; Zamora, Benjamin A.; Neuenschwander, Leon F.; Wakimoto, Ronald H., eds. Prescribed fire in the Intermountain Region: Forest site preparation and range improvement: Symposium proceedings; [Dates & location unknown] Pullman, WA: Washington State University, Cooperative Extension: 151-155. [67674]
  • 136. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; [Date of conference unknown]; Birmingham, AL. Gen. Tech. Rep. SO-65. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experimental Station: 19-27. [Proceedings of the Wildlife and Fish Ecology Technical Session, 1986 Society of American Foresters National Convention]. [25968]
  • 137. LANDFIRE Rapid Assessment. 2005. Reference condition modeling manual (Version 2.1), [Online]. In: LANDFIRE. Cooperative Agreement 04-CA-11132543-189. Boulder, CO: The Nature Conservancy; U.S. Department of Agriculture, Forest Service; U.S. Department of the Interior (Producers). 72 p. Available: http://www.landfire.gov/downloadfile.php?file=RA_Modeling_Manual_v2_1.pdf [2007, May 24]. [66741]
  • 217. Ruediger, William; Mealey, Stephen. 1978. Coordination guidelines for timber harvesting in grizzly bear habitat in northwestern Montana. [Place of publication unknown]: [Publisher unknown]. 44 p. On file at: U.S. Department of Agriculture, Forest Service, Intermountain Research Station, Fire Sciences Laboratory, Missoula, MT. [19354]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: litter, mast, natural, selection, tree

LIFE HISTORY:
Diet and nutrition influence most aspects of the American black bear life history including reproduction, development, survival, timing of denning, and seasonal movements [264].

Mating: American black bears have low reproductive rates [76,114]. Mating occurs from late May to August and peaks in June [76,114,132,208,272]. Females typically mate for the first time at 3 years old [64,272] but may not mate until 8 years old in northern portions of their range [41,114,131]. Females that have borne young usually breed every other year [76,114,131]. If females abandon their cubs after den emergence in spring, they may breed again in early summer of the same year [66].

Reproductive success: Female reproductive success may be determined by diet and nutrition. During years of high mast production, good nutritional condition of American black bears resulted in earlier maturation, larger litter sizes, shorter breeding intervals, and higher survival rates [25,43,48,64,76,114,131,208,209,213,226]. For example, over a 6-year study period, 26 of 28 female American black bears in western Massachusetts produced cubs when they had consumed a high fat and high carbohydrate diet of hard and soft mast. During years of low mast production, 10 of 10 females produced no cubs [64]. In some studies, variability in food supply did not solely explain fluctuations in reproduction [44,118,172].

Gestation period and litter size: Due to delayed implantation, embryos are not implanted and cubs are not born until the winter denning period [76,78,272]. Litter size ranges from 1 to 5 cubs [76,132,272], depending on the age and nutritional condition of the female before the denning period [272]. Litters typically consist of twins or triplets [272]. Subadult (1.5-3 years old) females produce the smallest litters (typically 1 cub) their first time breeding [272], and older females produce intermediate-sized litters [76,132]. Mean litter size was 1.6 cubs in the Shasta-Trinity National Forest, California (n=6 adult females) [198], Sequoia National Park, California (n=9 adult females) [78], and the Whitefish Range in northwestern Montana (n=45 adult females) [114]. Mean litter sizes were 2.25 (n=20) and 1.41 (n=17) in the Ouachita Mountains and Ozark Mountains of Arkansas, respectively [44]. Mean litter size in northeastern Minnesota was 2.38 cubs (n=52 adult females) [208]. In northern Coahuila, Mexico, mean litter size was 2.75 cubs (n=12 adult females) [63]. Sex ratio of cubs may be determined by maternal condition. In La Mauricie National Park, Quebec, females gave birth to more males when maternal weight was heavier [221].

Development: A mother's milk supply depends on the quality of nutrients obtained the year before she gives birth [213]. Large, well-nourished females produce healthier cubs than malnourished females [132]. American black bears in eastern deciduous forests generally experience higher growth rates than those in western North America due to a larger variety of foods, including oak (Quercus spp.) acorns [132]. After leaving the den, cubs gain weight quickly if abundant food is available [213]. Young are weaned approximately 7 months after birth, between July and September [76,114]. In northern portions of the American black bear's range, where summers are shorter and food is less abundant, females may wean at a later date [114]. Young remain with their mothers until they are approximately 1.5 years old, and/or when their mothers enter estrus [76,114,149,208,208,227].

Social organization: American black bears are generally solitary. Exceptions occur during the breeding season, the first 1.5 years of a cub's life [78,114,132,208,272], and areas where American black bears congregate to forage on seasonally abundant foods [132,208,213].

Habits: American black bears are diurnal [9,41,74,142,149] but may be nocturnal in areas containing human food sources such as garbage dumps, agricultural areas [142], or in habitat cooccupied with grizzly bears (Ursus arctos horribilis) [158]. During early spring and late fall, females are more nocturnal than males. They forage nocturnally to improve physical condition needed for breeding, denning, and lactation [9].

Mortality: Starvation is the most significant cause of natural mortality [76,114,213,221], especially in northern latitudes where foraging periods are shorter [114]. Mortality rates may range from 5% when food is abundant to 70% when food is scarce [76]. Natural mortality is high between birth and 2 years of age and depends primarily on food availability [76,213,221], physical condition of the mother, litter size, and/or experience of the mother [64]. Mortality is also high for subadult males (>2 years old) during dispersal from natal areas because subadult males may be forced into less preferred habitat by older American black bears [132]. After home ranges are established, mortality for males and females is 5% to 10%/year [76]. Other causes of natural mortality include disease, predation, injuries from other American black bears, and cannibalism [76,114].

Human-related mortality for American black bears is caused by hunting, collisions with vehicles, and poaching. Hunting-related mortality for subadult males is greatest during dispersal from natal areas [64,114,146,227]. Mortality from humans is greater during seasons or years when natural food resources are low and American black bears enter human-inhabited areas looking for food [169,213,221,255].

Survival rates: In the Ouachita Mountains, Arkansas, mean annual survival rates of males and females over a 2-year period was 94% for American black bears >1 year old and 88% for cubs. In the Ozark Mountains, Arkansas, mean annual survival rates were 0.87 for males and females >1 year old, and 0.25 for cubs [44]. In northeastern Minnesota, the cub survival rate ranged from 59% to 88%, depending on food supply during year of conception and year of birth [208]. In the Pisgah Bear Sanctuary in North Carolina, the mean annual survival rate of male and female American black bears trapped 251 times over a 15-year period was 76% (SD= 0.04, n=151) [241].

Dispersal: Natal dispersal occurs in the subadult age class and is male-biased [64,114,146,208,223,227]. Typically, >95% of subadult females establish home ranges within their mothers' home ranges [64,146,227] (see Home range and density). In areas of high American black bear densities or limited food resources, adult females may prompt subadult females to disperse [25,114]. Dispersal distance of 18 subadult males in northeastern Minnesota ranged from 8 to 136 miles (13-219 km) and averaged 38 miles (61 km) [208]. Dispersal distance for 57 yearling to 3-year-old males in western Virginia ranged from 0.6 to 49.7 miles (0.9-80.0 km) and averaged 8 miles (13 km) [146].

Denning: American black bears den to conserve energy during winter months [148,224]. The denning period depends on length of winter [132,148,228] but typically occurs from October to May [9,41,73,148]. In southern latitudes, American black bears typically den for 3 months (January or February to March or April), but not all American black bears den [63,89,102,175,186].

Onset of denning may be related to sex, reproductive status, food availability [73,114,117,224], and/or weather [114,148,224,228]. Females typically enter dens earlier and leave dens later than males [54,73,148]. In the northeastern Cascade Range of Washington, females entered dens approximately 1 week earlier in the fall and left dens 1 week later in the spring than males [73]. Pregnant females den longer than nonpregnant females or males [54,148,208,224,228]. A pregnant female in south-central Alaska spent 247 days in her den [228]. In southern portions of the American black bear's range, subadult and adult males and nonpregnant females may not hibernate [89]. In Coahuila, Mexico, all pregnant females (n=13) denned, 2 of 5 females with yearlings denned, and 0 males (n=10) denned [63].

American black bears may enter dens early and emerge from dens late when food is scarce [117,132]. Otherwise, a negative energy balance may occur if they continue to forage as food becomes less abundant [224]. Acorn crop failure may influence denning behavior. During a gypsy moth infestation that destroyed the acorn crop in Shenandoah National Park, Virginia, pregnant American black bears entered dens an average of 1 week earlier and emerged from dens 1 week later than other females [117].

Secure den sites ensure survival [54,101,186]. Den selection may be influenced by factors including availability of dens, climate, reproductive status, age of the American black bear, energetic efficiency of the den, and/or safety from predators [54,56,73,76,186,224]. Den type varies geographically; however, dens located in dead- and live-tree cavities are preferred across the American black bear's range [35,36,114,133,189,234]. In northern latitudes, den sites may be located in hollow trees and logs, under fallen logs or piles of man-made debris, under tree roots, in trees with hollow chambers at their bases [36,54], or in rock crevices [59]. In southern portions of the American black bear range, dens may consist of open nests of leaves and grass, shallow depressions on the ground [89,132], or may be elevated in hollow trees, especially in areas where seasonal flooding may occur [186,273]. In second-growth forests that lack large tree cavities, caves, slash piles, rock crevices, or nests on the ground surface may be used for den sites [114,208]. Dens with large chambers may be an important factor in den selection for pregnant females and for old, large American black bears [54,129]. In western Virginia, American black bears >10 years old used rock cavities more often than trees, probably because they could not find big enough tree cavities [129]. American black bears on Vancouver Island denned close to spring forage areas to decrease long movements and encounters with other American black bears [54]. Dens may or may not be reused [24,54,114,117,129,208,228]. Den reuse may be related to the longevity of den structures [54] or availability of suitable den sites [228]. For detailed information about habitat used for denning in various geographic locations, see Preferred Habitat.

  • 9. Amstrup, Steven C.; Beecham, John. 1976. Activity patterns of radio-collared black bears in Idaho. Journal of Wildlife Management. 40(2): 340-348. [9505]
  • 25. Beecham, John J. 1983. Population characteristics of black bears in west central Idaho. Journal of Wildlife Management. 47(2): 405-412. [17019]
  • 35. Bull, Evelyn L.; Akenson, James J.; Betts, Burr J.; Torgersen, Torolf R. 1996. The interdependence of wildlife and old-growth forests. In: Bradford, P., Manning, T.; I'Anson, B. Proceedings of wildlife tree/stand level biodiversity workshop; 1995 October 17-19; Victoria, BC. Victoria, BC: British Columbia Ministry of Forests: 5-9. [67888]
  • 36. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 41. Chaulk, Keith; Bondrup-Nielsen, Soren; Harrington, Fred. 2005. Black Bear, Ursus americanus, ecology on the northeast coast of Labrador. The Canadian Field-Naturalist. 119(2): 164-174. [67681]
  • 43. Clark, Joseph D. 2004. Oak-black bear relationships in southeastern uplands. In: Spetich, Martin A., ed. Upland oak ecology symposium: history, current conditions, and sustainability; 2002 October 7-10; Fayetteville, AR. Gen. Tech. Rep. SRS-73. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southern Research Station: 116-119. [67683]
  • 44. Clark, Joseph D.; Smith, Kimberly G. 1994. A demographic comparison of two black bear populations in the Interior Highlands of Arkansas. Wildlife Society Bulletin. 22(4): 593-603. [67682]
  • 48. Costello, Cecily M.; Jones, Donald E.; Inman, Robert M.; Inman, Kristine H.; Thompson, Bruce C.; Quigley, Howard B. 2003. Relationship of variable mast production to American black bear reproductive parameters in New Mexico. Ursus. 14(1): 1-16. [68419]
  • 54. Davis, Helen. 1996. Characteristics and selection of winter dens by black bears in coastal British Columbia. Burnaby, BC: Simon Fraser University. 147 p. Thesis. [67916]
  • 56. DeGayner, Eugene J.; Kramer, Marc G.; Doerr, Joseph G.; Robertsen, Margaret J. 2005. Windstorm disturbance effects on forest structure and black bear dens in southeast Alaska. Ecological Applications. 15(4): 1306-1316. [54535]
  • 59. DeGraaf, Richard M; Shigo, Alex L. 1985. Managing cavity trees for wildlife in the Northeast. Gen. Tech. Rep. NE-101. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 21 p. [13481]
  • 63. Doan-Crider, Diana L.; Hellgren, Eric C. 1996. Population characteristics and winter ecology of black bears in Coahuila, Mexico. Journal of Wildlife Management. 60(2): 398-407. [67684]
  • 64. Elowe, Kenneth D.; Dodge, Wendell E. 1989. Factors affecting black bear reproductive success and cub survival. Journal of Wildlife Management. 53(4): 962-968. [10339]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 101. Hellgren, Eric C.; Vaughan, Michael R. 1988. Seasonal food habits of black bears in Great Dismal Swamp, Virginia-North Carolina. Proceedings of the Annual Conference of Southeastern Association of Fish and Wildlife Agencies. 42: 295-305. [19221]
  • 102. Hightower, Dwayne A.; Wagner, Robert O.; Pace, Richard M., III. 2002. Denning ecology of female American black bears in south central Louisiana. Ursus. 13: 11-17. [68659]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 117. Kasbohm, John W.; Vaughan, Michael R.; Kraus, James G. 1996. Black bear denning during a gypsy moth infestation. Wildlife Society Bulletin. 24(1): 62-70. [67695]
  • 118. Kasbohm, John W.; Vaughan, Michael R.; Kraus, James G. 1996. Effects of gypsy moth infestation on black bear reproduction and survival. Journal of Wildlife Management. 60(2): 408-416. [67696]
  • 129. Klenzendorf, Sybille A.; Vaughan, Michael R.; Martin, Dennis D. 2002. Den-type use and fidelity of American black bears in western Virginia. Ursus. 13: 39-44. [68479]
  • 132. Kolenosky, George B.; Strathearn, Stewart M. 1987. Black bear. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 443-454. [50677]
  • 133. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 146. Lee, Daniel J.; Vaughan, Michael R. 2003. Dispersal movements by subadult American black bears in Virginia. Ursus. 14(2): 162-170. [68480]
  • 148. Lindzey, Frederick G.; Meslow, E. Charles. 1977. Home range and habitat use by black bears in southwestern Washington. Journal of Wildlife Management. 41(3): 413-425. [68413]
  • 149. Lindzey, Frederick, G.; Meslow, E. Charles. 1977. Population characteristics of black bears on an island in Washington. Journal of Wildlife Management. 41(3): 408-412. [68734]
  • 169. Mattson, David J.; Reinhart, Daniel P. 1994. Bear use of whitebark pine seeds in North America. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 212-220. [24645]
  • 175. Mitchell, F. Scott; Onorato, Dave P.; Hellgren, Eric C.; Skiles, J. Raymond, Jr.; Harveson, Louis A. 2005. Winter ecology of American black bears in a desert montane island. Wildlife Society Bulletin. 33(1): 164-171. [67712]
  • 186. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 1997. Denning ecology of black bears in the White River National Wildlife Refuge, Arkansas. Journal of Wildlife Management. 61(3): 700-706. [67715]
  • 189. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the Interior Columbia River Basin. Gen. Tech. Rep. PNW-GTR-390. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [27902]
  • 198. Piekielek, William; Burton, Timothy S. 1975. A black bear population study in northern California. California Fish and Game. 61(1): 4-25. [51872]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]
  • 209. Rogers, Lynn L.; Allen, Arthur W. 1987. Habitat suitability index models: black bear, upper Great Lakes region. Biological Report 82(10.144). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 54 p. [11711]
  • 213. Rogers, Lynn. 1976. Effects of mast and berry crop failures on survival, growth, and reproductive success of black bears. Transactions, North American Wildlife Conference. 41: 431-438. [8951]
  • 221. Samson, Claude; Huot, Jean. 1998. Movements of female black bears in relation to landscape vegetation type in southern Quebec. Journal of Wildlife Management. 62(2): 718-727. [67718]
  • 223. Schenk, Anita.; Obbard, Martyn E.; Kovacs, Kit M. 1998. Genetic relatedness and home-range overlap among female black bears (Ursus americanus) in northern Ontario, Canada. Canadian Journal of Zoology. 76(8): 1511-1519. [67721]
  • 226. Schwartz, Charles C.; Franzmann, Albert W. 1991. Interrelationship of black bears to moose and forest succession in the northern coniferous forest. Wildlife Monographs No. 113. Washington, DC: The Wildlife Society. 58 p. [67724]
  • 264. Vaughan, Michael R. 2002. Oak trees, acorns, and bears. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 224-240. [43533]
  • 272. Whitaker, John O., Jr. 1980. National Audubon Society field guide to North American mammals. New York: Alfred A. Knopf, Inc. 745 p. [25194]
  • 273. White, Thomas H.; Bowman, Jacob L.; Jacobson, Harry A.; Leopold, Bruce D.; Smith, Winston P. 2001. Forest management and female black bear denning. Journal of Wildlife Management. 65(1): 34-40. [67729]
  • 24. Beckmann, Jon P.; Berger, Joel. 2003. Rapid ecological and behavioural changes in carnivores: the responses of black bears (Ursus americanus) to altered food. Journal of Zoology. 261(2): 207-212. [67665]
  • 66. Farley, Sean D.; Robbins, Charles T. 1995. Lactation, hibernation, and mass dynamics of American black bears and grizzly bears. Canadian Journal of Zoology. 73(12): 2216-2222. [67685]
  • 73. Gaines, William L. 2003. Black Bear, Ursus americanus, denning chronology and den site selection in the northeastern Cascades of Washington. The Canadian Field-Naturalist. 117(4): 626-633. [50306]
  • 74. Gaines, William L.; Lyons, Andrea L. 2003. Crepuscular and nocturnal activity patterns of black bears in the North Cascades of Washington. Northwest Science. 77(2): 140-146. [44627]
  • 142. Lariviere, Serge; Huot, Jean; Samson, Claude. 1994. Daily activity patterns of female black bears in a northern mixed-forest environment. Journal of Mammalogy. 75(3): 613-620. [67700]
  • 172. McDonald, John E., Jr.; Fuller, Todd K. 2005. Effects of spring acorn availability on black bear diet, milk composition, and cub survival. Journal of Mammalogy. 86(5): 1022-1028. [67711]
  • 224. Schooley, Robert L.; McLaughlin, Craig R.; Matula, George J., Jr.; Krohn, William B. 1994. Denning chronology of female black bears: effects of food, weather, and reproduction. Journal of Mammalogy. 75(2): 466-477. [23909]
  • 227. Schwartz, Charles C.; Franzmann, Albert W. 1992. Dispersal and survival of subadult black bears from the Kenai Peninsula, Alaska. Journal of Wildlife Management. 56(3): 426-431. [67722]
  • 234. Silovsky, Gene D.; Pinto, Carlos. 1974. Forest wildlife inventories: identification of conflicts and management needs. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 53-61. [7992]
  • 241. Sorensen, Vanessa A.; Powell, Roger A. 1998. Estimating survival rates of black bears. Canadian Journal of Zoology. 76(7): 1335-1343. [67727]
  • 255. Tomback, Diana F.; Arno, Stephen F.; Keane, Robert E. 2001. The compelling case for management intervention. In: Tomback, Diana F.; Arno, Stephen F.; Keane, Robert E., eds. Whitebark pine communities: Ecology and restoration. Washington, DC: Island Press: 3-25. [36691]
  • 78. Goldsmith, Audrey; Walraven, Michael E.; Graber, David; White, Marshall. 1981. Ecology of the black bear in Sequoia National Park. Technical Report No. 1. Davis, CA: University of California at Davis, Institute of Ecology, Cooperative National Park Resources Studies Unit. 64 p. [Final report to the National Park Service, Western Region for contract CX-8000-4-0022]. [18240]
  • 89. Hamilton, Robert J.; Marchinton, R. Larry. 1980. Denning and related activity of black bears in the coastal plain of North Carolina. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management; 1977 February; Kalispell, MT. Bear Biology Association Conference Series No. 3. [Place of publication unknown]: The Bear Biology Association: 121-126. [14751]
  • 131. Kolenosky, George B. 1990. Reproductive biology of black bears in east-central Ontario. In: Darling, Laura M.; Archibald, W. Ralph, eds. Bears--their biology and management: Proceedings, 8th international conference on bear research and management; 1989 February; Victoria, BC. [Place of publication unknown]: International Association for Bear Research and Management: 385-392. [68422]
  • 158. MacHutchon, A. Grant; Himmer, Stefan; Davis, Helen; Gallagher, Marie. 1998. Temporal and spatial activity patterns among coastal bear populations. In: Miller, Sterling D.; Reynolds, Harry D., eds. Proceedings, 10th international conference on bear research and management; 1995 July; Fairbanks, AK; 1995 September; Mora, Sweden. In: Ursus. [Place of publication unknown]: International Association for Bear Research and Management; 10: 539-546. [68478]
  • 228. Schwartz, Charles C.; Miller, Sterling D.; Franzmann, Albert W. 1987. Denning ecology of three black bear populations in Alaska. In: Zager Peter, ed. Bears--their biology and management: Proceedings, 7th international conference on bear research and management; 1986 February-March; Williamsburg, VA; Plitvice Lakes, Yugoslavia. [Place of publication unknown]: International Association of Bear Research and Management: 281-291. [68595]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Direct Effects of Fire

American black bears are adept at avoiding injury or death from fire [69,121,236,240] but are occasionally killed [49,103,235]. Direct mortality occurs from asphyxiation, heat stress, burns, and/or physiological stress when fire fronts are wide and fast moving, fires are actively crowning, and/or thick smoke occurs at ground level [31,155].
  • 31. Bogener, Dave. 2003. SP-T11 -- Effects of fuel load management and fire prevention on wildlife and plant communities. Oroville, CA: State of California, Department of Water Resources. Draft final report. Oroville Facilities Relicensing: Federal Energy Regulatory Commission Project No. 2100. 42 p. [53768]
  • 49. Cowan, Ian McTaggert. 1956. The black-tailed deer. In: Taylor, Walter P., ed. The deer of North America. Harrisburg, PA: The Telegraph Press: 521-617. [14313]
  • 69. French, Marilynn Gibbs; French, Steven P. 1996. Large mammal mortality in the 1988 Yellowstone fires. In: Greenlee, Jason, ed. The ecological implications of fire in Greater Yellowstone: Proceedings, 2nd biennial conference on the Greater Yellowstone Ecosystem; 1993 September 19-21; Yellowstone National Park, WY. Fairfield, WA: International Association of Wildland Fire: 113-115. [27835]
  • 103. Hines, William W. 1973. Black-tailed deer populations and Douglas-fir reforestation in the Tillamook Burn, Oregon. Game Research Report No. 3. Federal Aid to Wildlife Restoration--Project W-51-R: Final Report. Corvallis, OR: Oregon State Game Commission. 59 p. [8431]
  • 121. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 155. Lyon, L. Jack; Telfer, Edmund S.; Schreiner, David Scott. 2000. Direct effects of fire and animal responses. In: Smith, Jane Kapler, ed. Wildland fire in ecosystems: Effects of fire on fauna. Gen. Tech. Rep. RMRS-GTR-42-vol. 1. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station: 17-23. [44435]
  • 235. Singer, Francis J.; Schreier, William; Oppenheim, Jill; Garton, Edward O. 1989. Drought, fires, and large mammals. BioScience. 39(10): 716-722. [67678]
  • 236. Singer, Francis J.; Schullery, Paul. 1989. Yellowstone wildlife: populations in process. Western Wildlands. 15(2): 18-22. [67676]
  • 240. Smith, Jane Kapler; Fischer, William C. 1997. Fire ecology of the forest habitat types of northern Idaho. Gen. Tech. Rep. INT-GTR-363. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station. 142 p. [27992]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Density estimates in different areas: 1 bear per 1.3-8.8 sq km. Estimated density of 0.52-0.66 bears/sq km at Great Dismal Swamp National Wildlife Refuge, is the highest known density in the southeastern U.S.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Black bears communicate with body and facial expressions, sounds, touch, and through scent marking. Scent marks advertise territory boundaries to other bears. Black bears have a keen sense of smell.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Black bears communicate with body and facial expressions, sounds, touch, and through scent marking. Scent marks advertise territory boundaries to other bears. Black bears have a keen sense of smell.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Bears are dormant (but do not truly hibernate) in winter, though winter denning by males and barren females in the southern part of the range relatively short.

Daily activity may vary seasonally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Black bears can live to 30 years in the wild but most often live for only about 10, mostly because of encounters with humans. More than 90% of black bear deaths after the age of 18 months are the result of gunshots, trapping, motor vehicle accidents, or other interactions with humans.

Range lifespan

Status: wild:
30.0 (high) years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Sex: female

Status: wild:
26.0 years.

Average lifespan

Status: wild:
32.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Black bears can live to 30 years in the wild but most often live for only about 10, mostly because of encounters with humans. More than 90% of black bear deaths after the age of 18 months are the result of gunshots, trapping, motor vehicle accidents, or other interactions with humans.

Range lifespan

Status: wild:
30.0 (high) years.

Average lifespan

Status: wild:
10.0 years.

Average lifespan

Sex: female

Status: wild:
26.0 years.

Average lifespan

Status: wild:
32.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 34 years (captivity) Observations: During hibernation body temperature floats around 32.5ºC. Although pregnancy in bears lasts for about 220 days, there is a delayed implantation and embryonic development only occurs in the last 10 weeks of pregnancy (Ronald Nowak 1999). In the wild, it has been suggested that they may live over 33 years (http://www.bear.org/), which is dubious. Record longevity in captivity belongs to a wild born female that was about 34 years when she died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males and females meet temporarily for mating when females are in estrus. Male home ranges overlap with those of several females.

Mating System: polygynous

Males and females coexist briefly during the mating season, which generally peaks from June to mid-July. Females usually give birth every other year, but sometimes wait 3 or 4 years, depending on food availability. Pregnancy generally lasts about 220 days, but this includes a period of time when the egg has not started developing. The fertilized eggs remain in a suspended state until the fall, when embryonic development begins. This development lasts only 10 weeks. Births occur mainly in January and February, while the female is hibernating. The number of young per litter ranges from one to five and is usually two or three. At birth the young weigh 200 to 450 grams each, the smallest young relative to adult size of any placental mammal. They are born naked and blind.

Females reach sexual maturity at from 2 to 9 years old, and have cubs every other year after maturing. Males reach sexual maturity at 3 to 4 years old but continue to grow until they are 10 to 12 years old, at which point they are large enough to dominate younger bears without fighting.

Breeding interval: Female black bears have cubs every other year if they have enough food to support pregnancy.

Breeding season: Black bears breed in June and July.

Range number of offspring: 1.0 to 5.0.

Average gestation period: 220.0 days.

Range weaning age: 6.0 to 8.0 months.

Range age at sexual or reproductive maturity (female): 2.0 to 5.0 years.

Range age at sexual or reproductive maturity (male): 2.0 to 5.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 277.5 g.

Average gestation period: 70 days.

Average number of offspring: 2.

Black bear cubs remain in the den with their sleeping mother and nurse throughout the winter. When the family emerges in the spring the cubs weigh between 2 and 5 kg. They are ususally weaned at around 6 to 8 months of age, but remain with the mother and den with her during their second winter of life, until they are about 17 months old. At this time the mother forces the young out of her territory. They may weigh between 7 and 49 kg at this point, depending on food supplies. Black bear mothers care for their young and teach them necessary life skills throughout the time that their cubs are with them.

Male black bears do not contribute directly to their offspring but do indirectly by preventing new males from moving into the area. This makes it less likely for the young or mother to encounter an aggressive male or have to compete with new bears for food.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males and females meet temporarily for mating when females are in estrus. Male home ranges overlap with those of several females.

Mating System: polygynous

The sexes coexist briefly during the mating season, which generally peaks from June to mid-July. Females remain in estrus throughout the season until they mate. They usually give birth every other year, but sometimes wait 3 or 4 years. Pregnancy generally lasts about 220 days, but this includes a delayed implantation. The fertilized eggs are not implanted in the uterus until the autumn, and embryonic development occurs only in the last 10 weeks of pregnancy. Births occur mainly in January and February, commonly while the female is hibernating. The number of young per litter ranges from one to five and is usually two or three. At birth the young weigh 200 to 450 grams each, the smallest young relative to adult size of any placental mammal. They are born naked and blind. Black bear cubs remain in the den with their torpid mother and nurse throughout the winter. When the family emerges in the spring the cubs weigh between 2 and 5 kg. They are ususally weaned at around 6 to 8 months of age, but remain with the mother and den with her during their second winter of life, until they are about 17 months old. At this time the female is coming into estrus and forces the young out of her territory. They may weigh between 7 and 49 kg at this point, depending on food supplies.

Females reach sexual maturity at from 2 to 9 years old, and have cubs every other year after maturing. Males reach sexual maturity at 3 to 4 years old but continue to grow until they are 10 to 12 years old, at which point they are large enough to dominate younger bears without fighting.

Breeding interval: Female black bears have cubs every other year if they have enough food to support pregnancy.

Breeding season: Black bears breed in June and July.

Range number of offspring: 1.0 to 5.0.

Average gestation period: 220.0 days.

Range weaning age: 6.0 to 8.0 months.

Range age at sexual or reproductive maturity (female): 2.0 to 5.0 years.

Range age at sexual or reproductive maturity (male): 2.0 to 5.0 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 277.5 g.

Average gestation period: 70 days.

Average number of offspring: 2.

Black bear cubs remain in the den with their sleeping mother and nurse throughout the winter. When the family emerges in the spring the cubs weigh between 2 and 5 kg. They are ususally weaned at around 6 to 8 months of age, but remain with the mother and den with her during their second winter of life, until they are about 17 months old. At this time the mother forces the young out of her territory. They may weigh between 7 and 49 kg at this point, depending on food supplies. Black bear mothers care for their young and teach them necessary life skills throughout the time that their cubs are with them.

Male black bears do not contribute directly to their offspring but do indirectly by preventing new males from moving into the area. This makes it less likely for the young or mother to encounter an aggressive male or have to compete with new bears for food.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding occurs in June-July. Implantation is delayed about 4 months (also reported as 5-6 months). Gestation lasts 7-7.5 months (average 220 days). Females give birth every 2 years at most. Young are born in January-February, stay with mother until fall of second year. Litter size is 1-5 (modal number generally is 2 or 3, average is less than 2 in western North America). Females generally first give birth at 2-5 years (usually 4-5 years).

A female bear's reproductive success is dependent on her condition when she enters winter dormancy. A female that has fed well in autumn puts on much body fat and gives birth to usually 2 (rarely up to 5) cubs, whereas a female in poor condition does not produce any cubs. In the southern Appalachians, productivity and survival of young were enhanced when fall food (especially hard mast) supply was favorable (Eiler et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ursus americanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAATCGATGACTGTTCTCTACAAATCATAAAGATATTGGCACTCTTTACCTTCTGTTCGGTGCATGAGCCGGAATAGTAGGTACTGCTCTCAGCCTTTTAATCCGTGCCGAGCTAGGTCAGCCCGGGGCTCTGTTGGGGGATGATCAAATCTACAATGTAATCGTAACTGCCCATGCATTCGTAATAATCTTCTTTATGGTCATGCCTATTATAATTGGGGGATTTGGGAACTGATTAGTACCCTTAATAATTGGTGCCCCCGACATAGCATTTCCTCGAATAAATAATATAAGTTTCTGACTGCTGCCACCATCTTTCTTATTGCTCCTAGCCTCTTCTATAGTAGAAGCAGGGGCAGGGACTGGATGAACTGTCTACCCCCCTCTAGCGGGTAATCTGGCCCATGCAGGGGCATCAGTAGACTTAACAATCTTTTCTCTACACTTAGCAGGTATCTCTTCTATTCTAGGAGCTATCAATTTCATCACTACTATTATCAACATGAAGCCCCCTGCAATGTCTCAATATCAAACCCCCCTGTTTGTATGATCAGTCCTAATTACGGCAGTGCTTCTTCTTTTATCTCTGCCAGTCTTAGCAGCTGGAATTACCATACTACTTACAGATCGAAACCTTAATACCACCTTTTTTGACCCAGCCGGAGGAGGAGACCCTATTCTATATCAACACTTGTTTTGATTCTTCGGACACCCTGAAGTTTATATCCTAATTCTTCCAGGGTTCGGAATGATCTCTCACATTGTCACTTATTACTCAGGAAAAAAAGAGCCTTTCGGCTATATAGGAATAGTCTGAGCGATAATGTCTATTGGATTCTTAGGATTTATCGTGTGAGCTCACCATATGTTTACCGTAGGTATAGATGTCGACACACGAGCTTACTTCACTTCAGCCACCATAATTATTGCAATCCCAACAGGGGTTAAAGTATTTAGCTGATTAGCCACCCTACACGGAGGGAATATTAAATGATCTCCCGCTATAATATGAGCCCTAGGCTTTATTTTCCTGTTTACAGTGGGGGGCCTTACAGGAATTGTCCTAGCTAACTCATCTCTAGATATTGTTCTTCATGATACATACTATGTGGTAGCTCATTTCCACTATGTGTTATCAATGGGGGCTGTCTTTGCCATTATGGGGGGATTTGTGCATTGATTCCCACTGTTTTCAGGCTATACGCTTAATAATACATGAGCAAAAATTCACTTCATAATCATGTTCGTAGGGGTTAATATGACATTCTTTCCCCAGCATTTTCTAGGCCTGTCAGGAATACCTCGGCGATACTCCGACTATCCGGATGCCTATACAACATGAAATACAGTATCTTCTATAGGCTCATTCATTTCACTAACAGCAGTTATACTAATAATTTTTATGATTTGGGAGGCCTTTGCATCAAAACGAGAGGTGGCAGTGGTAGAACTCACTTCAACCAACATTGAGTGGCTACATGGATGTCCTCCTCCATATCACACATTTGAAGAACCCACTTACGTTACACTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ursus americanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 70
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

U.S. Federal Legal Status

The Louisiana black bear is threatened in the following areas: all counties of Louisiana; all counties south of or touching a line from Greenville to Meridian, Mississippi; all counties east of or touching a line from Linden, southwest to Bryan, and south-southwest to Rockport, Texas [260].

Other subspecies of American black bear within the same range as the Louisiana black bear are listed as having a "similarity of appearance to a threatened taxon". This includes all counties of Louisiana, Mississippi, and Texas, and the historic county range of the Louisiana black bear [260].

  • 260. U.S. Department of the Interior, Fish and Wildlife Service. 2013. Endangered Species Program, [Online]. Available: http://www.fws.gov/endangered/. [86564]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black bears once lived throughout most of North America, but hunting and agriculture drove them into heavily forested areas. Populations surive over much of their former range in less populated wooded regions and in protected areas. They are numerous and thriving, although they continue to face threats in some areas due to habitat destruction. Black bears appear in CITES appendix II.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Garshelis, D.L., Crider, D. & van Manen, F. (IUCN SSC Bear Specialist Group)

Reviewer/s
McLellan, B.N. & Garshelis, D.L. (Bear Red List Authority)

Contributor/s

Justification
This species is widespread, with a large global population estimated at more than twice that of all other species of bears combined. Moreover, in most areas populations are expanding numerically and geographically. Threats exist only in a few isolated places.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Black bears once lived throughout most of North America, but hunting and agriculture drove them into heavily forested areas. Residual populations survive over much of the range in sparsely populated wooded regions and under protection in national parks. They are numerous and thriving, but continue to face threats regionally due to habitat destruction and hunting. Black bears appear in CITES appendix II.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread in North America; stable, secure population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Similarity of Appearance (Threatened)
Date Listed: 01/07/1992
Lead Region:   Southeast Region (Region 4)   
Where Listed: County range of LA b.bear

Status: Status Undefined
Date Listed:
Lead Region: (Region ) 
Where Listed: White River Population

Status: Status Undefined
Date Listed:
Lead Region:   Washington Office (Region 9)   
Where Listed: PA population


Population detail:

Population location: U.S.A. (LA, all counties; MS, TX, only within the historic county range of the Louisiana black bear)
Listing status: SAT

For most current information and documents related to the conservation status and management of Ursus americanus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
During the past two decades, most American black bear populations have grown both numerically and geographically (Williamson 2002). Sixty percent of U.S. and Canadian states and provinces report increasing populations, and all other populations appear to be either stable or fluctuating with no clear trend (Garshelis and Hristienko 2006). Based on sums of estimates for individual states, the total U.S. population, excluding Alaska, is estimated at somewhat greater than 300,000. No reliable estimate exists for numbers of black bears in Alaska, although most authorities presume there to be 100,000–200,000 animals. Similarly, large populations in some parts of Canada are not reliably known, but countrywide estimates centre around 450,000 (principally in British Columbia, Ontario, and Québec). Thus, the total number of black bears in North America is likely within the range 850,000–950,000. No population estimates exist for the country of Mexico, although some areas within Mexico have high and increasing black bear densities (SEMARNAP 1999, Doan-Crider 2003).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Through most of its range, this species is not threatened. Legal hunting is well controlled by state and provincial agencies. American black bears are harvested as a game species in all 12 Canadian provinces and territories where they exist and in 28 or 29 (depending on whether New Jersey allows a season) U.S. states. The sport harvest for this species in Canada and the U.S. totals 40,000–50,000 annually. Currently, the black bear is not hunted in Mexico, but some conditional permits are allowed for depredation cases.

A few small, isolated populations of American black bears may be threatened with extirpation, simply due to small population size and the effects of fluctuating food (and in some cases water) resources. In one unusual case, a black bear population on a large island in Québec was extirpated apparently from introduced deer excessively browsing berry-producing shrubs, and thus eliminating an essential food supply for the resident bears (Côté 2005). However, most small, isolated populations are in southern U.S. and northern Mexico. In a recent dramatic case, bears from Big Bend National Park, an isolated population in southwestern Texas, made long-range movements to Chihuahua and Coahuila, Mexico, apparently in search of better fall mast. Such movements, especially in fall, are not unusual for black bears, but in this case most of the bears never returned; they either stayed in Mexico, died naturally when crossing the desert, or were poached. As a result, the entire population was reduced to 5–7 bears, including only 2 adult females (Hellgren et al. 2005). Since then, the population has rebounded, possibly by bears immigrating back. Other examples exist where small, seemingly isolated populations have persisted and even grown, from a combination of reproduction and occasional immigration events (Doan-Crider and Hellgren 1996, Onorato et al. 2004).

Conflicts with humans constitute another potential threat to bears in some areas. In years when natural food supplies are scarce, people may encounter, and frequently kill, large numbers of bears seeking substitute foods such as agricultural crops or garbage. As more people encroach upon bear habitat, and as bear numbers grow, the frequency of interactions between humans and bears likely will increase. Indeed, the number of black bear attacks on humans (including fatalities) seems to be increasing across North America (S. Herrero pers. comm.).

Increasing density of roads is another growing threat to American black bears. Not only do roads lead directly to mortalities from vehicular collisions, but they also provide greater access to hunters and potential poachers and may be barriers to bear movements (Wooding and Maddrey 1994).

A looming concern, but not a widespread problem in North America, is the poaching of bears for their paws and gall bladders, which can be sold commercially. Those products, particularly bile from gall bladders, are highly valued by practitioners of Traditional Chinese Medicine. Several U.S. states and Canadian provinces allow the sale of bear parts, taken legally by hunters either in that jurisdiction or transported into that jurisdiction from elsewhere (Williamson 2002). An argument can be made that this creates opportunities for an illicit commercial trade for poachers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: Locally threatened by habitat loss and interference by humans. Black market value of gall bladder and paws has led to an increase in the illegal harvest of this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Use of Fire in Population Management

More info for the terms: cover, fire severity, high-severity fire, severity

American black bears may or may not benefit from fire depending on habitat type, fire severity, and time elapsed since the fire occurred. They require habitat in various successional stages, and fires that create a mosaic of habitats are optimal [283]. Fire may temporarily reduce food resources, cover, and den sites for the American black bear [31,53,69,152,194,216,250]. However, regeneration of vegetation may begin 1 year following fire, and vegetation may be abundant for 20 years or more, providing excellent forage and cover [10,51,61,68,86,87,99,136]. Den sites located in dead and live trees are preferred by American black bears [35,36,114,133,189,234], and may be destroyed or created by fire. If mature, unburned forest is adjacent to burned areas, den sites may be available [121].

To create various successional stages used by American black bears, frequent, low-severity, small-scale prescribed fires are recommended [34,86,111,144]. High-severity fire is generally not recommended due to potential loss of den sites [34,84,88,144,256,262,267]. In general, prescribed burning is not recommended during winter when American black bears are denning [88,111,250].
  • 35. Bull, Evelyn L.; Akenson, James J.; Betts, Burr J.; Torgersen, Torolf R. 1996. The interdependence of wildlife and old-growth forests. In: Bradford, P., Manning, T.; I'Anson, B. Proceedings of wildlife tree/stand level biodiversity workshop; 1995 October 17-19; Victoria, BC. Victoria, BC: British Columbia Ministry of Forests: 5-9. [67888]
  • 36. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 68. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 88. Hamilton, Robert J. 1981. Effects of prescribed fire on black bear populations in southern forests. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 129-134. [67669]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 133. Kovalchik, Bernard L.; Clausnitzer, Rodrick R. 2004. Classification and management of aquatic, riparian, and wetland sites on the national forests of eastern Washington: series description. Gen. Tech. Rep. PNW-GTR-593. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 354 p. [53329]
  • 144. Larsen, Eric M.; Morgan, John T. 1998. Management recommendations for Washington's priority habitats: Oregon white oak woodlands. Olympia, WA: Washington Department of Fish and Wildlife. 37 p. [52756]
  • 189. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the Interior Columbia River Basin. Gen. Tech. Rep. PNW-GTR-390. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [27902]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]
  • 256. Tomback, Diana F.; Clary, Jane Kees; Koehler, James; Hoff, Raymond J.; Arno, Stephen F. 1995. The effects of blister rust on post-fire regeneration of whitebark pine: the Sundance Burn of northern Idaho (U.S.A.). Conservation Biology. 9(3): 654-664. [26002]
  • 10. Anderson, Stanley H. 1982. Effects of the 1976 Seney National Wildlife Refuge wildfire on wildlife and wildlife habitat. Resource Publication 146. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 28 p. [52897]
  • 31. Bogener, Dave. 2003. SP-T11 -- Effects of fuel load management and fire prevention on wildlife and plant communities. Oroville, CA: State of California, Department of Water Resources. Draft final report. Oroville Facilities Relicensing: Federal Energy Regulatory Commission Project No. 2100. 42 p. [53768]
  • 34. Brose, Patrick H.; Van Lear, David H. 1998. Responses of hardwood advance regeneration to seasonal prescribed fires in oak-dominated shelterwood stands. Canadian Journal of Forestry. 28(3): 331-339. [30049]
  • 51. Cunningham, Stan C.; Kirkendall, LariBeth; Ballard, Warren. 2006. Gray fox and coyote abundance and diet responses after a wildfire in central Arizona. Western North American Naturalist. 66(2): 169-180. [64517]
  • 53. Daubenmire, R. 1968. Ecology of fire in grasslands. In: Cragg, J. B., ed. Advances in ecological research. Vol. 5. New York: Academic Press: 209-266. [739]
  • 69. French, Marilynn Gibbs; French, Steven P. 1996. Large mammal mortality in the 1988 Yellowstone fires. In: Greenlee, Jason, ed. The ecological implications of fire in Greater Yellowstone: Proceedings, 2nd biennial conference on the Greater Yellowstone Ecosystem; 1993 September 19-21; Yellowstone National Park, WY. Fairfield, WA: International Association of Wildland Fire: 113-115. [27835]
  • 84. Hall, Frederick C. 1976. Fire and vegetation in the Blue Mountains: implications for land managers. In: Proceedings, annual Tall Timbers fire ecology conference; 1974 October 16-17; Portland, Oregon. No. 15. Tallahassee, FL: Tall Timbers Research Station: 155-170. [6272]
  • 99. Heinselman, Miron L. 1973. Fire in the virgin forests of the Boundary Waters Canoe Area, Minnesota. Quaternary Research. 3: 329-382. [282]
  • 111. Johnson, A. Sydney; Landers, J. Larry. 1978. Fruit production in slash pine plantations in Georgia. Journal of Wildlife Management. 42(3): 606-613. [9855]
  • 121. Kelleyhouse, David G. 1979. Fire/wildlife relationships in Alaska. In: Hoefs, M.; Russell, D., eds. Wildlife and wildfire: Proceedings of workshop; 1979 November 27-28; Whitehorse, YT. Whitehorse, YT: Environment Yukon, Fish and Wildlife Branch: 1-36. [14071]
  • 152. Lowe, Philip O.; Ffolliott, Peter F.; Dieterich, John H.; Patton, David R. 1978. Determining potential wildlife benefits from wildfire in Arizona ponderosa pine forests. Gen. Tech. Rep. RM-52. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station. 12 p. [4481]
  • 194. Penfound, William T. 1968. Influence of a wildfire in the Wichita Mountains Wildlife Refuge, Oklahoma. Ecology. 49(5): 1003-1006. [12297]
  • 216. Rowe, J. S.; Scotter, G. W. 1973. Fire in the boreal forest. Quaternary Research. 3: 444-464. [72]
  • 234. Silovsky, Gene D.; Pinto, Carlos. 1974. Forest wildlife inventories: identification of conflicts and management needs. In: Black, Hugh C., ed. Wildlife and forest management in the Pacific Northwest: Proceedings of a symposium; 1973 September 11-12; Corvallis, OR. Corvallis, OR: Oregon State University, School of Forestry, Forest Research Laboratory: 53-61. [7992]
  • 262. Van Lear, David H.; Waldrop, Thomas A. 1989. History, uses, and effects of fire in the Appalachians. Gen. Tech. Rep. SE-54. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station. 20 p. [10126]
  • 267. Wagle, R. F. 1981. Fire: its effects on plant succession and wildlife in the Southwest. Tucson, AZ: University of Arizona. 82 p. [4031]
  • 283. Zager, Peter Edward. 1980. The influence of logging and wildfire on grizzly bear habitat in northwestern Montana. Missoula, MT: University of Montana. 131 p. Dissertation. [5032]
  • 61. Despain, Don G. 1978. Effects of natural fires in Yellowstone National Park. Information Paper No. 34. [Place of publication unknown]: U.S. Department of the Interior, National Park Service, Yellowstone National Park. 2 p. [15670]
  • 86. Hamer, David. 1995. Buffaloberry (Shepherdia canadensis) fruit production in fire-successional bear feeding sites. Unpublished report [submitted to Parks Canada]. Banff, AB: Parks Canada, Banff National Park. 65 p. On file with: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory, Missoula, MT. [24885]
  • 87. Hamer, David. 1996. Buffaloberry [Shepherdia canadensis (L.) Nutt.] fruit production in fire-successional bear feeding sites. Journal of Range Management. 49(6): 520-529. [27214]
  • 136. Landers, J. Larry. 1987. Prescribed burning for managing wildlife in southeastern pine forests. In: Dickson, James G.; Maughan, O. Eugene, eds. Managing southern forests for wildlife and fish: a proceedings; [Date of conference unknown]; Birmingham, AL. Gen. Tech. Rep. SO-65. New Orleans, LA: U.S. Department of Agriculture, Forest Service, Southern Forest Experimental Station: 19-27. [Proceedings of the Wildlife and Fish Ecology Technical Session, 1986 Society of American Foresters National Convention]. [25968]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Considerations

More info for the terms: competition, cover, density, hardwood, mast, natural, restoration, shrub, shrubs, swamp, tree

Management options for optimizing American black bear habitat may include the following: maintaining a mosaic of successional stages, maintaining riparian habitat for foraging and traveling, maintaining den sites, decreasing tree damage, and minimizing conflicts with humans [7,156,211,261,263].

Silviculture: American black bears are habitat generalists that require a mosaic of habitat types and may have diverse responses to forest management [177]. Effects of forest management on the American black bear vary depending on habitat type, landscape, and past management activities [177]. Logging and prescribed burning may maintain a diversity of vegetation, increase cover, and increase the productivity of some important plants eaten by American black bears [7,110,113,114,173,177,208,261,263,268]. The benefits of logging and prescribed burning on shrub growth decrease once the canopy closes [177]. Logging and prescribed burning may decrease the availability of den sites, cover, travel corridors, and trees that produce hard mast [56,193]. Disturbance of American black bears during timber harvesting may also create negative effects. Female adults with cubs often remain in their dens during timber harvest but may eventually abandon the site. Newborn cubs may die if forced to abandon dens in early spring [54]. Despite food abundance in some logged areas, American black bears may avoid the centers of logged areas due to lack of cover and potential heat stress [114].

Rogers and Allen [209] suggest that timber management provides a diversity of vegetational age classes in close proximity to each other. Ideally, 5% to 25% of an area should be managed as an unforested cover type [209]. Season of harvest should be considered to avoid disturbance of denning sites and foraging areas. Logging should not occur in riparian areas, seeps, or wetlands because they provide important seasonal food resources. According to Weaver [268], management treatments in a central hardwood landscape should maintain a diversity of hard mast species, high mast yields, and perpetuate desired hard mast-producing species in future hardwood stands.

On the Bridger-Teton National Forest in Wyoming, Irwin and Hammond [110] recommend providing a mosaic of successional stages by clearcutting in patches <25 acres (10 ha) on north- and east-facing slopes; planting fruit-producing shrubs in clearcuts; protecting old-growth stands of whitebark pine to provide American black bear food when berry production is low; maintaining low-elevation Douglas-fir forest on south-facing slopes; and cutting or burning quaking aspen to stimulate growth [110].

In southeastern Alaska, food resources for American black bears are abundant for 15 to 20 years following logging [173]. In a 1974 report, Meehan [173] suggests that small patch cuts or clearcut strips with blocks or strips of timber left between are ideal for maximum wildlife production. Logged areas that are <20 years old should be available at all times, as well as mature timber and edges [173].

If maximizing the preharvest mammalian community is a management goal in North American boreal forests, the rate of successional convergence to predisturbance, old-growth forest may be increased by doing the following: 1) leave "moderate" amounts of coarse woody debris in harvested areas; 2) leave snags and dead wood in close proximity to live trees to form clumps; and 3) leave >30% of mature trees as clumped residuals in harvested areas [68].

In Maryland, Fecske and others [67] recommend maintaining mature mixed forest and wetland habitats. Plant conifers if necessary, and help to increase growth of rhododendron (Rhododendron spp.) thickets and other native shrubs for cover in maturing deciduous forest [67]. On the Atlantic Coastal Plain, landscape-scale American black bear management is necessary to maintain large blocks of habitat relatively free from human activities. Pocosins and other wetlands types are important high-quality habitats for American black bear, and Jones and Pelton [113] state that these habitats should be maintained or restored. In seasonally-flooded forested wetlands, large trees (≥33 inches (84 cm) DBH) should be protected for Louisiana black bear denning sites [186].

Fragmentation of American black bear habitat from logging may make it difficult for American black bears to move between remaining habitat and may increase their vulnerability to predators. In ponderosa pine-mixed conifer habitat in north central Arizona, forest fragmentation influenced home range size, movement between usable habitat, and movement to important seasonal use areas. In fragmented habitat, American black bears were concentrated into smaller areas and became more vulnerable when moving between suitable habitat patches. Road systems created by logging also increased access by hunters. According to Mollohan and LeCount [178], American black bears must be managed carefully in fragmented habitat and further fragmentation should be avoided. Travel corridors should be provided between usable habitats [178].

Impacts of salvage logging depend on the number and condition of fire-killed trees that are retained in salvage cuts. Salvage logging may have negative impacts on wildlife by eliminating foraging and denning sites [182].

An American black bear habitat suitability model was created by Rogers and Allen [209] for northeast Minnesota, northern Wisconsin, and Michigan's Upper Peninsula and the upper half of the Lower Peninsula. The model has 3 major components: 1) variables that estimate the abundance and quality of seasonal foods in specific cover types; 2) variables used to estimate the cover type composition within an area; and 3) a variable that is used to estimate the influence of human disturbance on the habitat quality of American black bear [209].

Snags and coarse woody debris: Large-diameter hollow trees and coarse woody debris are important for hiding, denning, and foraging on insects [35,36,54,56,59,98,144,189,249] (see Denning and Food Habits). Cavity tree management includes maintaining existing cavity trees and snags, creating snags if they are absent [59,98,129,193,209], and leaving slash after logging for potential den sites [7,36,39,79,268]. Preserving large trees and snags is particularly important in areas with high human use, marginal habitat, and areas where flooding may occur [209]. Potential den sites should be retained in various aspects and elevations [54].

In Alaska, Alberta, British Columbia, the Pacific Northwest, California, the northern Rocky Mountains, and the northern Great Basin, Bunnell and others [38,39] offer the following recommendations for the distribution of dead wood in a managed forest occupied by American black bears and other wildlife: maintain 2 to 3 large snags (>20 inches (50 cm) DBH in coastal habitat and >12 inches (30 cm) DBH in less productive habitat)) per hectare; maintain 10 to 20 smaller snags (size not given) per hectare; leave scattered logs 20 to 39 inches (50-100 cm DBH)) in 2 to 7 acre (1-3 ha) patches [38,39].

To manage for snags and coarse woody debris in the Pacific Northwest, the following management is recommended: 1) ensure sustained provision of dead and dying wood; 2) retain trees and snags of hardwoods and favored conifer species such as western larch, Douglas-fir, and ponderosa pine; 3) retain a range of size and age classes of dead wood; 4) meet dead wood requirements for large mammal species; and 5) limit salvage logging after fires [36,39]. For more information about recommended size, species, and number of logs to retain in the Columbia River Basin, see Bull and others [36]. See Naylor [183] for guidelines on retaining cavity trees in eastern white pine and red pine forests in the Great Lakes-St Lawrence forest of central Ontario. See Davis [54] for recommendations on management of American black bear dens in western British Columbia.

To provide maximum use of slash piles for wildlife, Allen [7] suggest that slash piles be 100 × 25 feet (30 ×8 m) in size and adjacent to forested cover if possible [7]. To provide sites for ground dens, Weaver [268] suggests piling felled tops of trees and promoting thick regeneration [268]. White and others [273] recommend minimizing logging debris at low elevations (≤148.0 feet (45.1 m)) to reduce the probability of Louisiana black bears choosing flood-prone areas to den [273].

Retention of coarse woody debris is encouraged to provide insects for American black bear consumption [18,37,100,160,168,199,268] (see Food Habits). As logs decay, insect activity on the exterior and interior of the wood increases, enhancing the value for American black bears [35,37,60,100,199]. Bull and others [37] suggest retaining coarse woody debris in a variety of sizes and decay stages to enhance ant diversity.

Hard and soft mast management: Hard mast and soft mast are important seasonal foods for the American black bear [76,97,120,169,208,209,214,232] (see Food Habits). Management that promotes the establishment, diversification, proliferation, and perpetuation of soft mast-producing species is encouraged [268]. In some locations, the temporary paucity of hard mast may be offset by the availability of soft mast, so ideally, both should be managed [117,118].

Oak regeneration is hampered by consumption of acorns by animals, insect damage of acorns, and competition by shade-tolerant vegetation [91]. Recommendations to promote oak acorn production in eastern North America include 1) periodic thinning to promote rapid growth and vigorous crowns [97,232]; 2) managing for a diversity of mast-producing species, especially white oak and red oak; and 3) maintaining half of the management unit as mast-producing stands (40 to 80+ years old) [232].

Whitebark pine habitat needs to be secure for American black bears during fall and potentially during late spring and summer [170]. According to Romme and Turner [214], whitebark pine habitat is projected to decrease in the future due to climate change and white pine blister rust. They advise caution when harvesting whitebark pine, especially at low elevations, and advise restricting human facilities in the whitebark pine zone [169].

In the absence of white pine blister rust, whitebark pines >100 years old provide productive seed crops. Good seeds crops may be produced for 200 to 300 years thereafter [169]. In areas where American black bear management is a high priority, Mattson and Reinhart [169] recommend that timber be harvested in 300-year stand rotations, and landscape-wide harvest should be approximately 3%/decade. Thinning of subalpine fir is required to encourage growth of whitebark pine. Planting areas with rust-resistant whitebark pine seedlings may also promote whitebark pine [256]. Because American black bears raid red squirrel caches for whitebark pine seeds, low red squirrel densities limit American black bear use of whitebark pine seeds. Several authors suggest favoring red squirrels in habitat with whitebark pine [123,124,125,140,169,196]. For whitebark pine restoration techniques, see the FEIS review of whitebark pine.

Costello and others [48] suggest that in areas where hard mast is a primary fall food for American black bears, annual mast production should be documented to forecast changes in reproductive output.

Conversion of mast-producing flatwood and hardwood communities to slash pine plantations and winter burning to control understory growth may have negative impacts on food resources for the Florida black bear [160]. Because mast production of saw-palmetto is unpredictable in Florida black bear habitats, Stratman [250] suggests promoting production of acorns in upland hardwood stands with oak on the southeastern coastal plain. The size of oak stands should optimally range from 7 to 12 acres (3-5 ha), and the stands should be adjacent to riparian and swamp habitat [250].

Clearcutting: By opening the canopy, clearcutting increases production of early seral vegetation, providing forage and cover, benefiting American black bears. Negative consequences of clearcutting include loss of hard mast production, loss of potential den sites [54,95,149,177,209], and loss of understory trees, which may not reach suitable sizes for den use in future cutting rotations [54]. As harvested stands age and logging slash decomposes, many resources made available by clearcutting decline [177].

Use of clearcuts by American black bears is determined by age, size, shape, and distribution of cutting units, as well as proximity of logging roads to American black bear habitat [209,263]. Recent clearcuts (<8 years old) are seldom used by American black bears in Montana, Idaho, and Washington [114,149,261] except to travel through [114]. On Long Island, Washington, American black bears avoided 9- to 14-year-old clearcuts but used 18- to 25-year-old clearcuts [149]. In the Whitefish Range in northwestern Montana, American black bears used 10-year-old clearcuts but did not use newer cuts [114]. For more information on habitat use by American black bears in clearcut areas, see Preferred Habitat.

Clearcutting on a large scale radically alters American black bear habitat because it involves large tracts of land and extensive road systems. The negative impacts of clearcutting on American black bears could be minimized by harvesting small, irregular-shaped areas adjacent to cut areas >20 years old [281]. The size of clearcuts relative to shape is important when determining value to wildlife. Clearcuts that are highly sinuous and follow natural contours and soil types have the smallest negative impacts [95]. Rogers and Allen [209] recommend providing irregular boundaries, islands of standing timber, and travel corridors along drainages and ridgelines to offset potential negative impacts of clearcutting [209].Vander Heyden and Meslow [263] and Young and Beecham [281] suggest that within American black bear habitat, clearcutting either be minimized or clearcuts be small in size. To maximize food and cover for American black bears, place clearcuts adjacent to mature timber and open-canopy pole stands [263,281]. Rogers and Allen [209] suggest that clearcuts ideally be ≤20 acres (8 ha), and the farthest distance from forested escape cover from a clearcut be ≤820 feet (250 m).

Regeneration activities associated with clearcutting include burning slash, planting trees, and controlling weeds, shrubs, and animals that hinder tree reproduction [195]. Clearcutting that involves posttreatment practices that involve bulldozer piling of slash, burning, and soil scarification may damage roots of berry-producing plants and be detrimental to American black bear habitat. Arno and others [15] and Hungerford [108] recommend either broadcast burning slash or leaving it untreated to protect future mast production [15,108]. Aerial application of herbicides to enhance conifer regeneration may reduce soft mast production for several years [149,208].

Tree damage: American black bears may cause damage to trees, especially in the Pacific Northwest [46,62,77,284]. During spring and early summer, American black bears may strip bark to eat new sapwood [65,145,176,176,184,253]. This typically 3.3 to 4.9 feet (1.0 to 1.5 m) from the ground [184], but upper boles of trees may also be stripped [65]. American black bears do not forage on all tree species or age classes equally [62]. Trees of any age are vulnerable to damage by American black bear [128,184,253] but pole-sized trees are most vulnerable [65,128]. In the Pacific Northwest, American black bears may damage Douglas-fir, ponderosa pine [29,62], grand fir, western redcedar [128], or second-growth redwood (Sequoia sempervirens) trees [77]. In the northern Rocky Mountains, American black bears may damage western larch [233].

Tree damage typically occurs in thinned stands [166]. In northwestern Montana, American black bears damaged trees 5 times more often in thinned stands compared to adjacent unthinned stands of western larch, lodgepole pine, and Engelmann spruce. Small western larch trees (4-13 inches (10-33 cm)) DBH suffered the greatest damage (63% of all trees damaged and 92% of the trees killed) [166]. In northwestern California, American black bears damaged dense stands of pole-sized (4-20 inches (10-50 cm DBH)) redwood trees located in regenerating stands more than trees in other size classes. Density of damage was negatively correlated with distance from the edge in old-growth stands (P<0.001, t= -4.702). American black bears may benefit dense regenerating redwood stands by thinning trees. Therefore, culling American black bears to prevent tree mortality may be counterproductive and increase the need for future tree thinning [219].

Options for reducing tree damage and mortality include specific silviculture treatments during precommercial thinning, creating physical barriers, using American black bear repellents, supplemental feeding during the time of year when most tree damage occurs, capturing and relocating American black bears, or killing them [46,184,202]. On private lands in the Pacific Northwest, supplemental feeding programs have been successful in reducing American black bear damage [284]. For detailed suggestions on tree damage management, see Nolte and others [184].

Livestock grazing: American black bears have been eliminated from much of their range by the livestock industry [40]. Domestic livestock may compete directly with American black bears in some habitats [40,285]. According to Irwin and Hammond [110], Rogers and Allen [209], and Debyle [55], grazing should be curtailed or eliminated on low-elevation south slopes, riparian areas, quaking aspen stands, and high-elevation avalanche chutes to avoid competition for food resources between American black bears and livestock.

Roads: The impacts of roads on American black bears are determined by location, road structure, amount of traffic, and timing of road use. In the northern Cascade Range of Washington, roads consistently had a negative impact on habitat used by female American black bear [75]. Roads may not be problematic for American black bears if they are gated to reduce vehicular traffic and maintained as linear wildlife openings [75,149,156,208,209,268]. Highways may reduce viability of American black bear populations by acting as barriers to intraterritorial movement, increasing mortality from motor vehicle collisions, and increasing human disturbance [237]. Wildlife underpasses or overpasses may be constructed to provide travel corridors for American black bears under or across high-speed highways [67,94].

Hunting: Overharvest of American black bears creates a younger age structure. As populations become younger, fewer females reach puberty, reducing per capita recruitment. The age structure of the female population is then forced to an even younger average age. Full effects of overharvest do not occur until 5 to 10 years after harvest. One way to manage the sex composition of American black bear harvest is to schedule hunting seasons based on denning chronology (see Denning). Because pregnant females enter dens before males, the fall hunting season could begin after females have entered their dens. In spring, hunting of males could occur before females and young emerge from dens [76]. According to Lee and Vaughan [146], managers should monitor sex ratio of harvest to ensure that females are not overharvested.

To reduce cub mortality and increase subsequent American black bear recruitment, Cunningham and others [50,52] suggest reducing hunting of females following severe fire and hunting males during spring.

Climate: During La Niña, drought may decrease food supply for American black bears and increase encounters with humans [282].

Other: Migration corridors are critical for linking habitat between American black bear populations [25,143,146].

According to Willson and others [275], areas used by American black bears for salmon foraging should be protected from human disturbance and development.

American black bears may be important long-distance dispersers of some fruit seeds. Fruit seeds are dispersed when American black bears swallow them whole and defecate them intact. Germination rates of some plants may be increased by chemical or mechanical scarification that occurs in the American black bear's gut [3,18,27,85,134,210,230,257]. American black bears are unlikely to defecate intact acorns, hickory nuts, beechnuts [270], or pine seeds [109,141].
  • 3. Ahlgren, Clifford E. 1960. Some effects of fire on reproduction and growth of vegetation in northeastern Minnesota. Ecology. 41(3): 431-445. [207]
  • 7. Allen, Arthur W. 1987. The relationship between habitat and furbearers. In: Novak, Milan; Baker, James A.; Obbard, Martyn E.; Malloch, Bruce, eds. Wild furbearer management and conservation in North America. North Bay, ON: Ontario Trappers Association: 164-179. [24997]
  • 15. Arno, Stephen F.; Simmerman, Dennis G.; Keane, Robert E. 1985. Forest succession on four habitat types in western Montana. Gen. Tech. Rep. INT-177. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Forest and Range Experiment Station. 74 p. [349]
  • 18. Auger, Janene; Ogborn, Gary L.; Pritchett, Clyde L.; Black, Hal L. 2004. Selection of ants by the American black bear (Ursus americanus). Western North American Naturalist. 64(2): 166-174. [51120]
  • 25. Beecham, John J. 1983. Population characteristics of black bears in west central Idaho. Journal of Wildlife Management. 47(2): 405-412. [17019]
  • 27. Bendell, J. F. 1974. Effects of fire on birds and mammals. In: Kozlowski, T. T.; Ahlgren, C. E., eds. Fire and ecosystems. New York: Academic Press: 73-138. [16447]
  • 29. Black, Hugh C.; Dimock, Edward J., II; Evans, James; Rochelle, James A. 1979. Animal damage to coniferous plantations in Oregon and Washington. Part 1. A survey, 1963-1975. Research Bulletin 25. Corvallis, OR: Oregon State University, School of Forestry. 43 p. [13683]
  • 35. Bull, Evelyn L.; Akenson, James J.; Betts, Burr J.; Torgersen, Torolf R. 1996. The interdependence of wildlife and old-growth forests. In: Bradford, P., Manning, T.; I'Anson, B. Proceedings of wildlife tree/stand level biodiversity workshop; 1995 October 17-19; Victoria, BC. Victoria, BC: British Columbia Ministry of Forests: 5-9. [67888]
  • 36. Bull, Evelyn L.; Parks, Catherine G.; Torgersen, Torolf R. 1997. Trees and logs important to wildlife in the interior Columbia River basin. Gen. Tech. Rep. PNW-GTR-391. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 55 p. [27653]
  • 37. Bull, Evelyn L.; Torgersen, Torolf R.; Wertz, Tara L. 2001. The importance of vegetation, insects, and neonate ungulates in black bear diet in northeastern Oregon. Northwest Science. 75(3): 244-253. [67680]
  • 38. Bunnell, Fred L.; Boyland, Mark; Wind, Elke. 2002. How should we spatially distribute dying and dead wood? In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 739-752. [44395]
  • 39. Bunnell, Fred L.; Houde, Isabelle; Johnston, Barb; Wind, Elke. 2002. How dead trees sustain live organisms in western forests. In: Laudenslayer, William F., Jr.; Shea, Patrick J.; Valentine, Bradley E.; Weatherspoon, C. Phillip; Lisle, Thomas E., tech. coords. Proceedings of the symposium on the ecology and management of dead wood in western forests; 1999 November 2-4; Reno, NV. Gen. Tech. Rep. PSW-GTR-181. Albany, CA: U.S. Department of Agriculture, Forest Service, Pacific Southwest Research Station: 291-318. [44365]
  • 40. Carrier, W. Dean; Czech, Brian. 1996. Threatened and endangered wildlife and livestock interactions. In: Krausman, Paul R., ed. Rangeland wildlife. Denver, CO: The Society for Range Management: 39-47. [27319]
  • 46. Collins, Gail H.; Wielgus, Robert B.; Koehler, Gary M. 2002. Effects of sex and age of American black bear on conifer damage and control. Ursus. 13: 231-236. [68597]
  • 48. Costello, Cecily M.; Jones, Donald E.; Inman, Robert M.; Inman, Kristine H.; Thompson, Bruce C.; Quigley, Howard B. 2003. Relationship of variable mast production to American black bear reproductive parameters in New Mexico. Ursus. 14(1): 1-16. [68419]
  • 50. Cunningham, Stan C.; Ballard, Warren B. 2004. Effects of wildfire on black bear demographics in central Arizona. Wildlife Society Bulletin. 32(3): 928-937. [55418]
  • 52. Cunningham, Stanley C.; Ballard, Warren B.; Monroe, Lindsey M.; Rabe, Michael J.; Bristow, Kirby D. 2003. Black bear habitat use in burned and unburned areas, central Arizona. Wildlife Society Bulletin. 31(3): 786-792. [52929]
  • 54. Davis, Helen. 1996. Characteristics and selection of winter dens by black bears in coastal British Columbia. Burnaby, BC: Simon Fraser University. 147 p. Thesis. [67916]
  • 55. DeByle, Norbert V. 1985. Management for esthetics and recreation, forage, water, and wildlife. In: DeByle, Norbert V.; Winokur, Robert P., eds. Aspen: ecology and management in the western United States. Gen. Tech. Rep. RM-119. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 223-232. [11925]
  • 56. DeGayner, Eugene J.; Kramer, Marc G.; Doerr, Joseph G.; Robertsen, Margaret J. 2005. Windstorm disturbance effects on forest structure and black bear dens in southeast Alaska. Ecological Applications. 15(4): 1306-1316. [54535]
  • 59. DeGraaf, Richard M; Shigo, Alex L. 1985. Managing cavity trees for wildlife in the Northeast. Gen. Tech. Rep. NE-101. Broomall, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station. 21 p. [13481]
  • 60. DeLong, S. Craig; Daniels, Lori D.; Heemskerk, Ben; Storaunet, Ken Olaf. 2005. Temporal development of decaying log habitats in wet spruce-fir stands in east-central British Columbia. Canadian Journal of Forest Research. 35: 2841-2850. [62000]
  • 62. Dimock, Edward J., II. 1974. Animal populations and damage. In: Cramer, Owen P., ed. Environmental effects of forest residues management in the Pacific Northwest: A state-of-knowledge compendium. Gen. Tech. Rep. PNW-24. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station: O-1 to O-28. [6394]
  • 65. Evans, James. 1981. General biology of ten mammals that affect reforestation in southwestern Oregon. In: Hobbs, S. D; Helgerson, O. T., eds. Reforestation of skeletal soils: Proceedings of a workshop; 1981 November 17-19; Medford, OR. Corvallis, OR: Oregon State University, Forest Research Laboratory, Forestry Intensified Research Program (FIR) Adaptive Phase: 30-36. [7143]
  • 67. Fecske, Dorothy M.; Barry, Ronald E.; Precht, Francis L.; Quigley, Howard B.; Bittner, Steven L.; Webster, Tracy. 2002. Habitat use by female black bears in western Maryland. Southeastern Naturalist. 1(1): 77-92. [51866]
  • 68. Fisher, Jason T.; Wilkinson, Lisa. 2005. The response of mammals to forest fire and timber harvest in the North American boreal forest. Mammal Review. 35(1): 51-81. [55373]
  • 75. Gaines, William L.; Lyons, Andrea L.; Lehmkuhl, John F.; Raedeke, Kenneth J. 2005. Landscape evaluation of female black bear habitat effectiveness and capability in the North Cascades, Washington. Biological Conservation. 125(4): 411-425. [67687]
  • 76. Gill, R. Bruce; Beck, Thomas D. I. 1990. Black bear management plan: 1990-1995. Division Report No. 15; DOW-R-D-15-90. Denver, CO: Department of Natural Resources, Colorado Division of Wildlife. 44 p. [17020]
  • 79. Gore, Jeffery A.; Patterson, William A., III. 1986. Mass of downed wood in northern hardwood forests in New Hampshire: potential effects of forest management. Canadian Journal of Forest Research. 16: 335-339. [45917]
  • 85. Hall, Ivan V.; Shay, Jennifer, M. 1981. The biological flora of Canada. 3. Vaccinium vitis-idaea L. var. minus Lodd. Supplementary account. The Canadian Field-Naturalist. 95(4): 434-464. [9125]
  • 91. Hannah, Peter R. 1987. Regeneration methods for oaks. Northern Journal of Applied Forestry. 4: 97-101. [3728]
  • 94. Harris, Larry D. 1989. The faunal significance of fragmentation of southeastern bottomland forests. In: Hook, Donal D.; Lea, Russ, eds. The forested wetlands of the southern United States: Proceedings of the symposium; 1988 July 12-14; Orlando, FL. Gen. Tech. Rep. SE-50. Asheville, NC: U.S. Department of Agriculture, Forest Service, Southeastern Forest Experiment Station: 126-134. [44550]
  • 97. Healy, William M. 1997. Thinning New England oak stands to enhance acorn production. Northern Journal of Applied Forestry. 14(3): 152-156. [27669]
  • 98. Healy, William M. 2002. Managing eastern oak forests for wildlife. In: McShea, William J.; Healy, William M., eds. Oak forest ecosystems: Ecology and management for wildlife. Baltimore, MD: The Johns Hopkins University Press: 317-332. [43539]
  • 100. Hellgren, Eric C. 1993. Status, distribution, and summer food habits of black bears in Big Bend National Park. The Southwestern Naturalist. 38(1): 77-80. [20422]
  • 108. Hungerford, Roger D. 1986. Vegetation response to stand cultural operations on small stem lodgepole pine stands in Montana. In: Baumgartner, David M.; Boyd, Raymond J.; Breuer, David W.; Miller, Daniel L., compilers/eds. Weed control for forest productivity in the Interior West: Symposium proceedings; 1985 February 5-7; Spokane, WA. Pullman, WA: Washington State University, Cooperative Extension: 63-71. [5896]
  • 109. Hutchins, H. E.; Lanner, R. M. 1982. The central role of Clark's nutcracker in the dispersal and establishment of whitebark pine. Oecologia. 55: 192-201. [1228]
  • 110. Irwin, Larry L.; Hammond, Forrest M. 1985. Managing black bear habitats for food items in Wyoming. Wildlife Society Bulletin. 13: 477-483. [3034]
  • 113. Jones, Mark D.; Pelton, Michael R. 2003. Female American black bear use of managed forest and agricultural lands in coastal North Carolina. Ursus. 14(2): 188-197. [68476]
  • 114. Jonkel, Charles J.; Cowan, Ian McT. 1971. The black bear in the spruce-fir forest. Wildlife Monographs No. 27. Washington, DC: The Wildlife Society. 57 p. [9912]
  • 117. Kasbohm, John W.; Vaughan, Michael R.; Kraus, James G. 1996. Black bear denning during a gypsy moth infestation. Wildlife Society Bulletin. 24(1): 62-70. [67695]
  • 118. Kasbohm, John W.; Vaughan, Michael R.; Kraus, James G. 1996. Effects of gypsy moth infestation on black bear reproduction and survival. Journal of Wildlife Management. 60(2): 408-416. [67696]
  • 120. Keane, Robert E.; Arno, Stephen F. 1996. Whitebark pine ecosystem restoration in western Montana. In: Hardy, Colin C.; Arno, Stephen F., eds. The use of fire in forest restoration: A general session of the Society for Ecological Restoration; 1995 September 14-16; Seattle, WA. Gen. Tech. Rep. INT-GTR-341. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 51-53. [26815]
  • 124. Kendall, Katherine C.; Hoff, Ray J. 1995. An introduction to whitebark pine ecology and status. In: Mathiasen, Robert L., compiler. Proceedings of the 43rd Annual Western International Forest Disease Work Conference; 1995 August 29-September 1; Whitefish, MT. Coeur D'Alene, ID: Idaho Department of Lands: 97-102. [27703]
  • 125. Kendall, Katherine Clement. 1981. Bear use of pine nuts. Bozeman, MT: Montana State University. 27 p. Thesis. [1331]
  • 128. Kingery, James L.; Graham, Russell T. 1994. Animal use and reforestation. In: Baumgartner, David M.; Lotan, James E.; Tonn, Jonalea R., compilers. Interior cedar-hemlock-white pine forests: ecology and management: Symposium proceedings; 1993 March 2-4; Spokane, WA. Pullman, WA: Washington State University, Department of Natural Resources: 207-211. [25804]
  • 129. Klenzendorf, Sybille A.; Vaughan, Michael R.; Martin, Dennis D. 2002. Den-type use and fidelity of American black bears in western Virginia. Ursus. 13: 39-44. [68479]
  • 134. Krefting, Laurits W.; Roe, Eugene I. 1949. The role of some birds and mammals in seed germination. Ecological Monographs. 19(3): 269-286. [8847]
  • 140. Lanner, Ronald M. 1996. Introduction. In: Lanner, Ronald M. Made for each other: A symbiosis of birds and pines. New York: Oxford University Press: 1-9. [29915]
  • 141. Lanner, Ronald M. 1996. Who needs Clark's nutcracker? In: Lanner, Ronald M. Made for each other: A symbiosis of birds and pines. New York: Oxford University Press: 61-74. [29922]
  • 143. Larkin, Jeffery L.; Maehr, David S.; Hoctor, Thomas S.; Orlando, Michael A.; Whitney, Karen. 2004. Landscape linkages and conservation planning for the black bear in west-central Florida. Animal Conservation. 7(1): 23-34. [67701]
  • 144. Larsen, Eric M.; Morgan, John T. 1998. Management recommendations for Washington's priority habitats: Oregon white oak woodlands. Olympia, WA: Washington Department of Fish and Wildlife. 37 p. [52756]
  • 145. Lawrence, William H.; Kverno, Nelson B.; Hartwell, Harry D. 1961. Guide to wildlife feeding injuries on conifers in the Pacific Northwest. Portland, OR: Western Forestry and Conservation Association; Olympia, WA: Washington Forest Protection Association; Industrial Forestry Association. 44 p. In cooperation with: University of Washington, College of Forestry. [21472]
  • 146. Lee, Daniel J.; Vaughan, Michael R. 2003. Dispersal movements by subadult American black bears in Virginia. Ursus. 14(2): 162-170. [68480]
  • 149. Lindzey, Frederick, G.; Meslow, E. Charles. 1977. Population characteristics of black bears on an island in Washington. Journal of Wildlife Management. 41(3): 408-412. [68734]
  • 156. Lyons, Andrea L.; Gaines, William L.; Servheen, Christopher. 2003. Black bear resource selection in the northeast Cascades, Washington. Biological Conservation. 113(1): 55-62. [45766]
  • 160. Maehr, David S.; Brady, James R. 1984. Food habits of Florida black bears. Journal of Wildlife Management. 48(1): 230-235. [67705]
  • 166. Mason, Andrew C.; Adams, David L. 1989. Black bear damage to thinned timber stands in northwest Montana. Western Journal of Applied Forestry. 4(1): 10-13. [67707]
  • 168. Mattson, David J.; Gillin, Colin M.; Benson, Scott A.; Knight, Richard R. 1991. Bear feeding activity at alpine insect aggregation sites in the Yellowstone ecosystem. Canadian Journal of Zoology. 69(9): 2430-2435. [67708]
  • 169. Mattson, David J.; Reinhart, Daniel P. 1994. Bear use of whitebark pine seeds in North America. In: Schmidt, Wyman C.; Holtmeier, Friedrich-Karl, compilers. Proceedings--international workshop on subalpine stone pines and their environment: the status of our knowledge; 1992 September 5-11; St. Moritz, Switzerland. Gen. Tech. Rep. INT-GTR-309. Ogden, UT: U.S. Department of Agriculture, Forest Service, Intermountain Research Station: 212-220. [24645]
  • 170. Mattson, David J.; Reinhart, Daniel P.; Blanchard, Bonnie M. 1994. Variation in production and bear use of whitebark pine seeds in the Yellowstone area. In: Despain, Don G., ed. Plants and their environments: proceedings of the 1st biennial scientific conference on the Greater Yellowstone Ecosystem; 1991 September 16-17; Yellowstone National Park, WY. Tech. Rep. NPS/NRYELL/NRTR.-93/XX. Denver, CO: U.S. Department of the Interior, National Park Service, Natural Resources Publication Office: 205-220. [26286]
  • 173. Meehan, William R. 1974. The forest ecosystem of southeast Alaska: 4. Wildlife habitats. Gen. Tech. Rep. PNW-16. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Forest and Range Experiment Station. 32 p. [13479]
  • 176. Mitchell, Glenn E. 1950. Wildlife-forest relationships in the Pacific Northwest region. Journal of Forestry. 48: 26-30. [6923]
  • 177. Mitchell, Michael S.; Powell, Roger A. 2003. Response of black bears to forest management in the southern Appalachian Mountains. Journal of Wildlife Management. 67(4): 692-705. [48531]
  • 178. Mollohan, Cheryl M.; LeCount, Albert L. 1989. Problems of maintaining a viable black bear population in a fragmented forest. In: Tecle, Aregai; Covington, W. Wallace; Hamre, R. H., tech. coords. Multiresource management of ponderosa pine forests: Proceedings; 1989 November 14-16; Flagstaff, AZ. Gen. Tech. Rep. RM-185. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 149-159. [11313]
  • 182. Nappi, A.; Drapeau, P.; Savard, J.-P. L. 2004. Salvage logging after wildfire in the boreal forest: is it becoming a hot issue for wildlife? The Forestry Chronicle. 80(1): 67-74. [48414]
  • 183. Naylor, Brian J. 1994. Managing wildlife habitat in red pine and white pine forests of central Ontario. Forestry Chronicle. 70(4): 411-419. [24002]
  • 184. Nolte, Dale L.; Wagner, Kimberly K.; Trent, Andy. 2003. Timber damage by black bears: Approaches to control the problem. Tech. Rep. 0324-2832-MTDC. Missoula, MT: U.S. Department of Agriculture, Forest Service, Missoula Technology and Development Center. 10 p. [48581]
  • 186. Oli, Madan K.; Jacobson, Harry A.; Leopold, Bruce D. 1997. Denning ecology of black bears in the White River National Wildlife Refuge, Arkansas. Journal of Wildlife Management. 61(3): 700-706. [67715]
  • 189. Parks, Catherine G.; Bull, Evelyn L.; Torgersen, Torolf R. 1997. Field guide for the identification of snags and logs in the Interior Columbia River Basin. Gen. Tech. Rep. PNW-GTR-390. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 40 p. [27902]
  • 195. Pengelly, W. L. 1972. Clearcutting: detrimental aspects for wildlife resources. Journal of Soil and Water Conservation. 27(6): 255-258. [39041]
  • 196. Peterson, Kristopher I. 1999. Whitebark pine (Pinus albicaulis) decline and restoration in Glacier National Park. Grand Forks, ND: University of North Dakota. 75 p. Thesis. [44553]
  • 199. Pilliod, David S.; Bull, Evelyn L.; Hayes, Jane L.; Wales, Barbara C. 2006. Wildlife and invertebrate response to fuel reduction treatments in dry coniferous forests of the western United States: a synthesis. Gen. Tech. Rep. RMRS-GTR-173. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 34 p. [65071]
  • 202. Raff, L. E. 1991. Black bears and stand management. In: Pacific rim forestry–bridging the world: Proceedings of the 1991 Society of American Foresters national convention; 1991 August 4-7; San Francisco, CA. Bethesda, MD: Society of American Foresters: 569-570. [67717]
  • 208. Rogers, Lynn L. 1987. Effects of food supply and kinship on social behavior, movements, and population growth of black bears in northeastern Minnesota. Wildlife Monographs No. 97. Washington, DC: The Wildlife Society. 72 p. [68405]
  • 209. Rogers, Lynn L.; Allen, Arthur W. 1987. Habitat suitability index models: black bear, upper Great Lakes region. Biological Report 82(10.144). Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 54 p. [11711]
  • 210. Rogers, Lynn L.; Applegate, Rodger D. 1983. Dispersal of fruit seeds by black bears. Journal of Mammalogy. 64(2): 310-311. [5941]
  • 211. Rogers, Lynn L.; Wilker, Gregory A.; Scott, Sally S. 1990. Managing natural populations of black bears in wilderness. In: Lime, David W., ed. Managing America's enduring wilderness resource: Proceedings of the conference; 1989 September 11-17; Minneapolis, MN. St. Paul, MN: University of Minnesota, Minnesota Extension Service; Minnesota Agricultural Experiment Station: 363-366. [15409]
  • 214. Romme, William H.; Turner, Monica G. 1991. Implications of global climate change for biogeographic patterns in the Greater Yellowstone Ecosystem. Conservation Biology. 5(3): 373-386. [21677]
  • 230. Scotter, George Wilby. 1964. Effects of forest fires on the winter range of barren-ground caribou in northern Saskatchewan. Wildlife Management Bulletin. Series 1. No. 18. Ottawa, ON: Canadian Wildlife Service, National Parks Branch, Department of Northern Affairs and National Resources. 111 p. [28989]
  • 232. Shaw, Samuel P. 1971. Wildlife and oak management. In: Oak symposium proceedings; 1971 August 16-20; Morgantown, WV. Upper Darby, PA: U.S. Department of Agriculture, Forest Service, Northeastern Forest Experiment Station: 84-89. [9087]
  • 233. Shearer, Raymond C.; Kempf, Madelyn M. 1999. Coram Experimental Forest: 50 years of research in a western larch forest. Gen. Tech. Rep. RMRS-GTR-37. Ogden, UT: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 66 p. [36406]
  • 237. Singleton, Peter H.; Gaines, William L.; Lehmkuhl, John F. 2002. Landscape permeability for large carnivores in Washington: a geographic information system weighted-distance and least-cost corridor assessment. Res. Pap. PNW-RP-549. Portland, OR: U.S. Department of Agriculture, Forest Service, Pacific Northwest Research Station. 89 p. [66468]
  • 249. Stevenson, Susan K.; Jull, Michael J.; Rogers, Bruce J. 2006. Abundance and attributes of wildlife trees and coarse woody debris at three silvicultural systems study areas in the interior cedar-hemlock zone, British Columbia. Forest Ecology and Management. 233(1): 176-191. [64073]
  • 250. Stratman, Marty R. 1998. Habitat use and effects of prescribed fire on black bears in northwestern Florida. Knoxville, TN: University of Tennessee. 86 p. Thesis. [62087]
  • 253. Sullivan, T. P.; Harestad, A. S.; Wikeem, B. M. 1990. Control of mammal damage. In: Lavender, D. P.; Parish, R.; Johnson, C. M.; Montgomery, G.; Vyse, A.; Willis, R. A.; Winston, D., eds. Regenerating British Columbia's forests. Vancouver, BC: University of British Columbia Press: 302-318. [10722]
  • 256. Tomback, Diana F.; Clary, Jane Kees; Koehler, James; Hoff, Raymond J.; Arno, Stephen F. 1995. The effects of blister rust on post-fire regeneration of whitebark pine: the Sundance Burn of northern Idaho (U.S.A.). Conservation Biology. 9(3): 654-664. [26002]
  • 257. Traveset, Anna; Willson, Mary F. 1997. Effect of birds and bears on seed germination of fleshy-fruited plants in temperate rainforests of southeast Alaska. Oikos. 80(1): 89-95. [67728]
  • 261. Unsworth, James W.; Beecham, John J.; Irby, Lynn R. 1989. Female black bear habitat use in west-central Idaho. Journal of Wildlife Management. 53(3): 668-673. [8407]
  • 263. Vander Heyden, Madeleine; Meslow, E. Charles. 1999. Habitat selection by female black bears in the central Cascades of Oregon. Northwest Science. 73(4): 283-294. [67689]
  • 268. Weaver, Keith M. 2000. Black bear ecology and the use of prescribed fire to enhance bear habitat. In: Yaussy, Daniel A., compiler. Proceedings: workshop on fire, people, and the central hardwoods landscape; 2000 March 12-14; Richmond, KY. Gen. Tech. Rep. NE-274. Newtown Square, PA: U.S. Department of Agriculture, Forest Service, Northeastern Research Station: 89-96. [40313]
  • 270. Webb, Sara L. 1986. Potential role of passenger pigeons and other vertebrates in the rapid Holocene migrations of nut trees. Quaternary Research. 26: 367-375. [11982]
  • 273. White, Thomas H.; Bowman, Jacob L.; Jacobson, Harry A.; Leopold, Bruce D.; Smith, Winston P. 2001. Forest management and female black bear denning. Journal of Wildlife Management. 65(1): 34-40. [67729]
  • 275. Willson, Mary F.; Gende, Scott M.; Marston, Brian H. 1998. Fishes and the forest. BioScience. 48(6): 455-462. [30312]
  • 282. Zack, Conrad S.; Milne, Bruce T.; Dunn, William C. 2003. Southern oscillation index as an indicator of encounters between humans and black bears in New Mexico. Wildlife Society Bulletin. 31(2): 517-520. [54946]
  • 284. Ziegltrum, Georg J.; Nolte, Dale L. 2001. Black bear forest damage in Washington state, USA: economic, ecological, social aspects. Ursus. 12: 169-172. [68598]
  • 77. Giusti, Gregory A. 1990. Black bear feeding on second growth redwoods: a critical assessment. In: Davis, L. R.; Marsh, R. E., eds. Proceedings, 14th annual vertebrate pest conference; [Date of conference unknown]; [Location of conference unknown]. Davis, CA: University of California Davis: 214-217. [19649]
  • 95. Harris, Larry D.; Hirth, David H.; Marion, Wayne R. 1979. The development of silvicultural systems for wildlife. In: Proceedings, 28th annual forestry symposium; [Dates & location unknown] Baton Rouge: Louisiana State University, School of Forestry: 65-80. [67673]
  • 123. Kendall, Katherine C. 1983. Use of pine nuts by grizzly and black bears in the Yellowstone area. In: Meslow, E. Charles, ed. Bears--their biology and management: Proceedings, 5th international conference on bear research and management; 1980 February; Madison, WI. [Place of publication unknown]: International Association for Bear Research and Management: 166-173. [8385]
  • 193. Pelton, Michael R.; Beeman, Larry E.; Eagar, Daniel C. 1980. Den selection by black bears in the Great Smoky Mountains National Park. In: Martinka, Clifford J.; McArthur, Katherine L., eds. Bears--their biology and management: Proceedings, 4th international conference on bear research and management: Bear Biology Association Conference Series No. 3; 1977 February; Kalispell, MT. [Place of publication unknown]: The Bear Biology Association: 149-151. [68487]
  • 219. Russell, William H.; Carnell, Ky; McBride, Joe R. 2001. Black bear (Ursus americanus Pallas) feeding damage across timber harvest edges in northern California coast redwood (Sequoia sempervirens [D. Don] Endl.) forests, USA. Natural Areas Journal. 21(4): 324-329. [42697]
  • 281. Young, D. D.; Beecham, J. J. 1986. Black bear habitat use at Priest Lake, Idaho. In: Zager, Peter, ed. Bears--their biology and management: Proceedings, 6th international conference on bear research and management; 1983 February; Grand Canyon, AZ. [Place of publication unknown]: International Association for Bear Research and Management: 73-80. [14756]
  • 285. Zwartjes, Patrick W.; Cartron, Jean-Luc E.; Stoleson, Pamela L. L.; Haussamen, Walter C.; Crane, Tiffany E. 2005. Assessment of native species and ungulate grazing in the Southwest: terrestrial wildlife. Gen. Tech. Rep. RMRS-GTR-142. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Research Station. 74 p. [+ CD]. [60764]

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
From the time of European settlement until well into the 20th century, American black bears were extensively and purposefully over-hunted with the goal of eliminating or severely reducing their numbers to limit damage to crops and livestock. Many state and provincial governments paid a bounty for killing black bears. Population recovery occurred only after those jurisdictions recognized a need to protect black bears as a big game species. Protection and recovery occurred state-by-state and province-by-province during 1902–1983 (Miller 1990). Afterwards, the number of bears killed was more closely regulated and, moreover, an infrastructure of agency personnel and hunters policed illegal take.

In Mexico all hunting seasons for American black bears have been closed since 1985, and the species is considered nationally endangered. Numerous conservation initiatives established by large private ranches and land cooperatives in northern Mexico have created large blocks of suitable habitat (e.g., oak-dominated forests) with protection from poaching (Doan-Crider 2003). Changing public attitudes toward bears in Mexico have also contributed to the recuperation and expansion of the species into historic range, including recolonization of areas of Texas that have long been devoid of bears (SEMARNAP 1999, Onorato et al. 2004).

In the southeastern U.S., where black bears occupy only about 20% of their historic range, population recovery was aided by the establishment of national parks and other protected areas in the Appalachian Mountains and the Coastal Plain (Pelton and van Manen 1997). These large areas protect the habitat (especially mast-producing trees) and restrict hunter access. Beginning in the early 1970s, additional areas were established where bear hunting was prohibited, linking protected areas to other forested lands, including many private lands. The resulting conglomerates serve as dedicated or defacto sanctuaries, especially for adult females, that are a source for bears expanding into other areas (Beringer et al. 1998).

In a few areas, populations of American black bears have either been augmented or reintroduced after former extirpation by transplanting bears from elsewhere. Reintroductions into Arkansas during the 1960s were highly successful: licensed hunters in this state now harvest several hundred bears annually, and Arkansas bears have expanded into neighbouring states. Augmentation of several populations in Louisiana during the 1960s likely contributed to population recovery there. The success of recent reintroduction efforts in southeastern Kentucky–north-central Tennessee (mid-1990s) and southeastern Arkansas (2000-2007) may not be known for some time (Clark et al. 2002).

The Louisiana black bear (U. a. luteolus), a subspecies of American black bear, was listed as threatened under the U.S. Endangered Species Act in 1992 because of severe loss and fragmentation of its habitat combined with unsustainable human-caused mortality (Bowker and Jacobson 1995). Some evidence exists that this native subspecies may have interbred with black bears introduced from Minnesota, and the two subspecies can no longer be distinguished. Therefore, all bears within the historic range of the Louisiana black bear, from east Texas to southern Mississippi, are protected due to their similarity of appearance to a threatened taxon. Much of the bottomland hardwood forest that the Louisiana black bear historically inhabited was converted to agriculture. Remnant bottomland hardwoods are now protected, some marginal farmland is being replanted with hardwood trees, and the bear range is being expanded by capturing individuals from within their present range and moving them to uninhabited areas of their former range. These efforts are further enhanced through public information and education. This management program is organized by a broad coalition of state and federal agencies, conservation groups, forestry and agricultural industries, and private landowners. As a result, this subspecies has been noticeably increasing in numbers and distribution in all three range states.

Another subspecies of black bear (U. a. floridanus) is listed as threatened by the state of Florida. A previous petition for listing this subspecies under the U.S. Endangered Species Act was denied because it was deemed that extant populations were sufficiently large and state regulations adequate to protect it from extirpation in most areas. Corridors, either existing or proposed, are important for linking some small, isolated populations with larger populations (Larkin et al. 2004, Dixon et al. 2006).

In British Columbia much conservation attention has been directed toward the Kermode subspecies (U. a. kermodei). This animal is commonly referred to as the “spirit bear” because it possesses a gene that when homozygous is manifested as white pelage (Ritland et al. 2001). White-phased animals have long been protected from hunting. A large system of protected areas was established in 2006 (Great Bear Rainforest Agreement) to ban or severely restrict logging within >200,000 ha of coastal temperate rainforest inhabited by this subspecies of black bear, as well as by brown bears. Additionally, the spirit bear was selected as the official provincial mammal of British Columbia.

Since 1992 all American black bears have been listed in Appendix II of CITES, under the similarity of appearance provision (Article II, para 2b). This listing stipulates that documentation of legal harvest is necessary for the import and export of body parts in order to prevent these from being confused as parts from illegally obtained bears. This listing was not designed to protect American black bears, but rather other species of threatened bears, particularly the Asiatic black bear (U. thibetanus), whose parts might otherwise be sold under the guise of being from American black bear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: Smith and Clark (1994) discussed factors (including release of 20-40 individuals/year for eight years) contributing to the successful re-establishment of a population after extirpation in the Ozark and Ouachita mountains of Arkansas.

Management Requirements: Adults (e.g., "problem bears") must be moved at least 64 km to assure that less than 50% return to original location; no increase in natural mortality occurs in translocated bears of age 2 years or older (Rogers 1986). See also Herrero (1985), Williamson (n.d.), Darling and Archibald (1990), and Clark and Smith (1991) for management information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Protected in various national parks, and national wildlife refuges, and wilderness areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Black bears have been known to occasionally kill livestock. However, attacks on livestock are very rare. Bears can do serious damage to cornfields and honey production. Some bears have become troublesome around camps and cabins if food is left within their reach. Black bears have severely injured and sometimes even killed campers or travelers who feed them. However, the danger associated with black bears is often overstated, fewer than 36 human deaths resulted from black bear encounters in the 20th century. Black bears are generally very timid and, unlike grizzly bear females, black bear mothers with cubs are unlikely to attack people. When black bear mothers confront humans, they send their cubs up a tree and retreat or bluff.

Negative Impacts: injures humans (bites or stings); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

People have intensively hunted black bears as trophies and for its hide, meat, and fat. In most of the states and provinces occupied by black bears, they are treated as a game animal, which means that regulated hunting is allowed. An estimated 30,000 black bears are killed annually in North America. Relatively few skins go to market now, as regulations sometimes forbid commerce and there is no great demand.

Medical research on the ways that black bears use to survive long period of low activity is giving researchers new insight into treatments for kidney failure, gallstones, severe burns, and other illnesses.

Positive Impacts: body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Black bears have been known to occasionally raid livestock, though losses to bears are negligible. Bears sometimes damage cornfields, and berry and honey production. Some bears have become troublesome around camps and cabins if food is left in their reach. Black bears have severely injured and sometimes even killed campers or travelers who feed them. However, the danger associated with black bears is sometimes overstated, fewer than 36 human deaths resulted from black bear encounters in the 20th century. Black bears are generally very timid and, unlike grizzly bear females, black bear mothers with cubs are unlikely to attack people. When black bear mothers confront humans, they typically send their cubs up a tree and retreat or bluff. People who live in or visit areas with black bears should be aware of the appropriate precautions for avoiding black bear encounters.

Negative Impacts: injures humans (bites or stings); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

People have intensively hunted U. americanus, for trophy value and for various products, including hides for clothes or rugs, and meat and fat for food. In most of the states and provinces occupied by black bears, they are treated as game animals, subject to regulated hunting. An estimated 30,000 individuals are killed annually in North America. Relatively few skins go to market now, as regulations sometimes forbid commerce and there is no great demand.

Medical research on the metabolic pathways that black bears use to survive long period of torpor is yielding new insight into treatments for kidney failure, gallstones, severe burns, and other illnesses.

Positive Impacts: body parts are source of valuable material; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Gall bladder and paws are of great value in the Asian black market (see Boston Globe, 2 March 1992, pp. 23-24).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

American black bear

The American black bear (Ursus americanus) is a medium-sized bear native to North America. It is the continent's smallest and most widely distributed bear species. Black bears are omnivores with their diets varying greatly depending on season and location. They typically live in largely forested areas, but do leave forests in search of food. Sometimes they become attracted to human communities because of the immediate availability of food. The American black bear is the world's most common bear species. It is listed by the IUCN as Least Concern, due to the species' widespread distribution and a large global population estimated to be twice that of all other bear species combined. Along with the brown bear, it is one of only two of the eight modern bear species not considered globally threatened with extinction by the IUCN. American black bears often mark trees using their teeth and claws as a form of communication with other bears, a behavior common to many species of bears.[1]

Contents

Taxonomy and evolution [edit]

Detail of head – taken at the Cincinnati Zoo
Cinnamon-coloured Black bear eating dandelions in Waterton Lakes National Park

Although they live in North America, American black bears are not closely related to brown bears and polar bears; genetic studies reveal that they split from a common ancestor 5.05 million years ago.[3] Both American and Asiatic black bears are considered sister taxa, and are more closely related to each other than to other species of bear.[3][4] Reportedly, the Sun Bear is also a relatively recent split from this lineage.[5]

A small primitive bear called Ursus abstrusus is the oldest known North American fossil member of the genus Ursus, dated to 4.95 mya.[6] This suggests that U. abstrusus may be the direct ancestor of the American black bear, which evolved in North America.[3][7] Although Wolverton and Lyman still consider U. vitabilis an "apparent precursor to modern black bears",[8] it has also been placed within U. americanus.[7]

The ancestors of American black bears and Asiatic black bears diverged from sun bears 4.58 mya. The American black bear then split from the Asian black bear 4.08 mya.[3][9] The earliest American black bear fossils, which were located in Port Kennedy, Pennsylvania, greatly resemble the Asiatic species,[10] though later specimens grew to sizes comparable to grizzlies.[11] From the Holocene to present, American black bears seem to have shrunk in size,[3] but this has been disputed because of problems with dating these fossil specimens.[8]

The American black bear lived during the same period as short-faced bears (Arctodus simus and A. pristinus) and the Florida spectacled bear (Tremarctos floridanus). These Tremarctine bears evolved from bears that had emigrated from Asia to North America 7–8 ma.[12] The short-faced bears are thought to have been heavily carnivorous and the Florida spectacled bear more herbivorous,[13] while the American black bears remained arboreal omnivores, like their Asian ancestors. The black bear's generalist behavior allowed it to exploit a wider variety of foods and has been given as a reason why of these 3 genera, it alone survived climate and vegetative changes through and last ice age while the other more specialized North American predators went extinct. However, both Arctodus and Tremarctos had survived several other ice ages. After these prehistoric Ursids went extinct during the last glacial period 10,000 years ago, black bears were probably the only bear present in much of North America until the arrival of brown bears to the rest of the continent.[11]

Subspecies [edit]

Listed alphabetically.[14]

American black bear sub-species
Sub-species nameCommon nameDistributionDescription
Ursus americanus altifrontalisOlympic black bearPacific Northwest coast from central British Columbia through northern California and inland to the tip of northern Idaho and British Columbia
Ursus americanus amblycepsNew Mexico black bearnative to Colorado, New Mexico, west Texas, the eastern half of Arizona into northern Mexico, southeastern Utah
Ursus americanus americanusEastern black beareastern Montana to the Atlantic coast, from Alaska south and east through Canada to the Atlantic and south to Texas. Thought to be increasing in some regions. It is amongst the largest-bodied subspecies and almost all specimens are black.Common to Eastern Canada and U.S. wherever suitably habitat is found. May very rarely sport a white blaze on chest.
Ursus americanus californiensisCalifornia black bearmountain ranges of southern California, north through the Central Valley to southern Oregon
Ursus americanus carlottaeHaida Gwaii black bear, Queen Charlotte black bearHaida Gwaii/Queen Charlotte Islands and AlaskaGenerally larger than its mainland counterparts with a huge skull and molars, and is found only as a black color phase[15]
Ursus americanus cinnamomumCinnamon bearIdaho, western Montana, and Wyoming, eastern Washington and Oregon, northeastern UtahHas brown or red-brown fur, reminiscent of cinnamon
Ursus americanus emmonsiiGlacier bearSoutheast Alaska. Stable.Distinguished by the fur of its flanks being silvery gray with a blue lustre[16]
Ursus americanus eremicusMexican black bearnortheastern Mexico. Endangered.
Ursus americanus floridanusFlorida black bearFlorida, southern Georgia, and Alabama.Has a light brown nose and shiny black fur. A white chest patch is also common. An average male weighs 136 kg (300 lb).
Ursus americanus hamiltoniNewfoundland black bearNewfoundlandGenerally bigger than its mainland relatives, ranging in size from 90 to 270 kg (200 to 600 lb) and averaging 135 kg (300 lb). It also has one of the longest hibernation periods of any bear in North America.[17]
Ursus americanus kermodeiKermode bear, Spirit bearCentral coast of British ColumbiaApproximately 10% of the population of this subspecies has white or cream-colored coats due to recessive genes and are called Kermodes or spirit bears. The other 90% are normal-colored black bears.[18]
Ursus americanus luteolusLouisiana black bearEastern Texas, Louisiana, southern Mississippi. Threatened (federal list).Has relatively long, narrow, and flat skull, and proportionately large molar teeth[19]
Ursus americanus machetesWest Mexico black bearNorth-central Mexico
Ursus americanus pernigerKenai black bearKenai Peninsula, Alaska
Ursus americanus pugnaxDall black bearAlexander Archipelago, Alaska
Ursus americanus vancouveriVancouver Island black bearVancouver Island, British Columbia

Native names [edit]

The word baribal is used as a name for the black bear in Spanish, French, Italian and German. Although the root word is popularly written as being from an unspecified Native American language, there is no evidence for this.[25]

Hybrids [edit]

American black bears are reproductively compatible with several other bear species, and have occasionally produced hybrid offspring. According to Jack Hanna's Monkeys on the Interstate, a bear captured in Sanford, Florida, was thought to have been the offspring of an escaped female Asian black bear and an American black bear.[26] In 1859, a black bear and a Eurasian brown bear were bred together in the London Zoological Gardens, but the three cubs did not reach maturity. In The Variation of Animals and Plants under Domestication Charles Darwin noted:

In the nine-year Report it is stated that the bears had been seen in the Zoological Gardens to couple freely, but previously to 1848 most had rarely conceived. In the Reports published since this date three species have produced young (hybrids in one case),...[27]

A black bear shot in autumn 1986 in Michigan was thought by some to be a black bear/grizzly bear hybrid, due to its unusually large size and its proportionately larger braincase and skull. DNA testing was unable to determine whether it was a black bear or grizzly.[28]

Current range and population [edit]

Historically, black bears occupied the majority of North America's forested regions. Today, they are primarily limited to sparsely settled, forested areas.[29]

Black bears currently inhabit much of their original Canadian range, though they do not occur in the southern farmlands of Alberta, Saskatchewan, and Manitoba. They have been extinct in Prince Edward Island since 1937. The total Canadian black bear population is between 396,000 and 476,000,[30] based on surveys taken in the mid-1990s in seven Canadian provinces, though this estimate excludes black bear populations in New Brunswick, Northwest Territories, Nova Scotia, and Saskatchewan. All provinces indicated stable populations of black bears over the last decade.[29]

The current range of black bears in the United States is constant throughout most of the northeast (down in the Appalachian Mountains almost continuously to Virginia and West Virginia), the northern midwest, the Rocky mountain region, the west coast and Alaska. However it becomes increasingly fragmented or absent in other regions. Despite this, black bears in those areas seems to have expanded their range during the last decade. Surveys taken from 35 states in the early 1990s indicate that black bears are either stable or increasing, excepting Idaho and New Mexico. The overall population of black bears in the United States has been estimated to range between 339,000 and 465,000,[31] though this excludes populations from Alaska, Idaho, South Dakota, Texas, and Wyoming, whose population sizes are unknown.[29]

As of 1993, known Mexican black bear populations existed in four areas, though knowledge on the distributions of populations outside those areas have not been updated since 1959. Mexico is the only country where the black bear is classed as endangered.[29]

Habitat [edit]

Throughout their range, habitats preferred by American Black Bears have a few shared characteristics. They are often found in areas with relatively inaccessible terrain, thick understory vegetation and large quantities of edible material (especially masts). The adaptation to woodlands and thick vegetation in this species may have originally been due to the black bear having evolved alongside larger, more aggressive bear species, such as the extinct short-faced bear and the still living brown bear, that monopolized more open habitats.[32] Although found in the largest numbers in wild, undisturbed areas and rural regions, black bears can adapt to surviving in some numbers in peri-urban regions as long as they contain easily accessible foods and some vegetative coverage.[5] In most of the contiguous United States, black bears today are usually found in heavily vegetated mountainous areas, from 400 to 3,000 m (1,300 to 9,800 ft). For bears living the American Southwest and Mexico, habitat usually consists of stands of chaparral and pinyon juniper woods. In this region, bears occasionally move to more open areas to feed on prickly pear cactus. At least two distinct, prime habitat types are inhabited in the Southeast United States. Black bears in the southern Appalachian Mountains survive in predominantly oak-hickory and mixed mesophytic forests. In the coastal areas of the southeast (such as Florida or Louisiana), bears inhabit a mixture of flatwoods, bays, and swampy hardwood sites. In the northeast part of the range (United States and Canada), prime habitat consists of a forest canopy of hardwoods such as beech, maple, and birch, and coniferous species. Corn crops and oak-hickory mast are also common sources of food in some sections of the northeast; small, thick swampy areas provide excellent refuge cover largely in stands of white cedar. Along the Pacific coast, redwood, sitka spruce, and hemlocks predominate as overstory cover. Within these northern forest types are early successional areas important for black bears, such as fields of brush, wet and dry meadows, high tidelands, riparian areas and a variety of mast-producing hardwood species. The spruce-fir forest dominates much of the range of the black bear in the Rockies. Important nonforested areas here are wet meadows, riparian areas, avalanche chutes, roadsides, burns, sidehill parks, and subalpine ridgetops. In areas where human development is relatively low, such as stretches of Canada and Alaska, American black bears tend to be found more regularly in lowland regions.[32] In parts of northeastern Canada, especially Labrador, black bears have adapted exclusively to semi-open areas which are more typical habitat in North America for brown bears (likely due to the absence here of brown and polar bears as well as other large carnivore species).[5]

Physical description [edit]

American black bears can be distinguished from brown bears by their smaller size, their less concave profiles, their shorter claws and the lack of a shoulder hump

Build [edit]

Some specimens may develop a white “crescent moon” mark on the chest. This white mark, which is constant in Asiatic black bears, occurs in only 25% of American black bears[33]

The skulls of American black bears are broad, with narrow muzzles and large jaw hinges. In Virginia, the total length of adult bear skulls was found to average 262 to 317 mm (10.3 to 12.5 in).[32] Across its range, greatest skull length for the species has been reportedly measured from 23.5 to 35 cm (9.3 to 14 in).[5] Females tend to have more slender and pointed faces than males. Their claws are typically black or grayish brown. The claws are short and rounded, being thick at the base and tapering to a point. Claws from both hind and front legs are almost identical in length, though the foreclaws tend to be more sharply curved. The paws of the species are relatively sizeable, with a rear foot length of 13.7 to 22.5 cm (5.4 to 8.9 in), being proportionly larger than other medium-sized bear species but much smaller than the paws of large adult brown and especially polar bears.[5] The soles of the feet are black or brownish, and are naked, leathery and deeply wrinkled. The hind legs are relatively longer than those of Asiatic black bears. The vestigal tail is usually 4.8 inches (12 cm) long. The ears are small and rounded, and are set well back on the head.

Black bears are highly dexterous, being capable of opening screw-top jars and manipulating door latches. They also have great physical strength. Even bear cubs have been known to turn over flat-shaped rocks weighing 310 to 325 pounds (140 to 147 kg) by flipping them over with a single foreleg.[34] They move in a rhythmic, surefooted way and can run at speeds of 25–30 mph (40–50 km/h).[35] Black bears have good eyesight, and have been proven experimentally to be able to learn visual discrimination tasks based on color faster than chimpanzees and as fast as dogs. They are also capable of rapidly learning to distinguish different shapes, such as small triangles, circles and squares.[36]

Size [edit]

Cinnamon-colored black bear in Yellowstone National Park

Black bear weight tends to vary according to age, sex, health, and season. Seasonal variation in weight is very pronounced: in autumn, their pre-den weight tends to be 30% higher than in spring, when black bears emerge from their dens. Black bears on the East Coast tend to be heavier on average than those on the West Coast, although black bears follow Bergmann's rule and bears from the northwest are often slightly heavier than the bears from the southeast. Adult males typically weigh between 57–250 kg (130–550 lb), while females weigh 33% less at 41–170 kg (90–370 lb).[5][37] In the state of California, studies have indicated that the average mass is 86 kg (190 lb) in adult males and 58 kg (130 lb) in adult females.[32] Adult black bears in Yukon Flats National Wildlife Refuge in east-central Alaska were found to average 87.3 kg (192 lb) in males and 63.4 kg (140 lb) in females, whereas on Kuiu Island in southeast Alaska (where nutritious salmon are readily available) adult bears averaged an estimated 115 kg (250 lb).[38][39] In Great Smoky Mountains National Park, adult males averaged 112 kg (250 lb) and adult females averaged 47 kg (100 lb) per one study.[40] In Yellowstone National Park, a population study found that adult males averaged 119 kg (260 lb) and adult females averaged 67 kg (150 lb).[41] In New York state, the two sexes reportedly average 135 kg (300 lb) and 74 kg (160 lb), respectively.[42] Adults typically range from 120 to 200 cm (47 to 79 in) in head-and-body length, and 70 to 105 cm (28 to 41 in) in shoulder height. The typically small tail is 7.7–17.7 cm (3.0–7.0 in) long.[34][43][44][45] Although they are the smallest species in North America, large males exceed the size of other bear species except the brown and polar bears.[34] The biggest wild American black bear ever recorded was a male from New Brunswick, shot in November 1972, that weighed 409 kg (900 lb) after it had been dressed, meaning it weighed an estimated 500 kg (1,100 lb) in life, and measured 2.41 m (7.9 ft) long.[46] Another notably outsized wild black bear, weighing in at 408 kg (900 lb) in total, was the cattle-killer shot in December 1921 on the Moqui Reservation in Arizona.[46] The record-sized bear from New Jersey was shot in Morris County December 2011 and scaled 376.5 kg (830 lb).[47] Even larger, the most massive black bear recorded in Pennsylvania (one of six weighing over 363 kg (800 lb) shot in the in the last 15 years in the state) weighed in at 399 kg (880 lb) and was shot in November 2010 in Pike County.[48] The North American Bear Center, located in Ely, Minnesota, is home to the world's largest captive male and female black bears. Ted, the male, weighed 431–453.5 kg (950–1,000 lb) in the fall of 2006.[49] Honey, the female, weighed 219.6 kg (484 lb) in the fall of 2007.[50]

Pelage [edit]

A white-furred Kermode black bear

The fur is soft, with dense underfur and long, coarse, thick guard hairs.[34] The fur is not as shaggy or coarse as that of brown bears.[46] American black bear skins can be distinguished from those of Asiatic black bears by the lack of a white mark on the chin and hairier footpads.[51] Despite their name, black bears show a great deal of color variation. Individual coat colors can range from white, blond, cinnamon, or light brown to dark chocolate brown or to jet black, with many intermediate variations existing. Bluish tinged black bears occur along a portion of coastal Alaska and British Columbia. White to cream colored black bears occur in coastal islands and the adjacent mainland of south-western British Columbia. Albino specimens have also been recorded.[52] Black coats tend to predominate in moist areas such as New England, New York, Tennessee, Michigan and western Washington. Approximately 70% of all black bears are black, though only 50% of black bears in the Rocky Mountains are black.[34] Many black bears in Northwestern North America are cinnamon, blond or light brown in color, and thus may sometimes be mistaken for grizzly bears. Grizzly (and other types of brown) bears can be distinguished by their shoulder hump, larger size and broader, more concave skull.[53]

In his book The Great Bear Almanac, Gary Brown summarized the predominance of black or brown/blond specimens by location:[34]

Color variations of black bears by location
LocationColor breakdown
Michigan100% black
Minnesota94% black, 6% brown
New England100% black
New York100% black
Tennessee100% black
Washington (coastal)99% black, 1% brown or blonde
Washington (inland)21% black, 79% brown or blonde
Yosemite National Park9% black, 91% brown or blonde

Behavior [edit]

In his Great Bear Almanac, Gary Brown lists 20 different sounds in eight different contexts. Sounds expressing aggression include growls, woofs, snorts, bellows and roars. Sounds expressing contentment include mumbles, squeaks and pants.[35] American black bears tend to be territorial and non-gregarious in nature. However, at abundant food sources (i.e. spawning salmon or garbage dumps) black bears may congregate and dominance hierarchies form, with the largest, most powerful males dominating the most fruitful feeding spots.[54] They mark their territories by rubbing their bodies against trees and clawing at the bark. Annual ranges held by mature male black bears tend to be very large but there is some variation. On Long Island off the coast of Washington, ranges average 5 sq mi (13 km2), whereas on the Ungava Peninsula in Canada ranges can average up to 1,000 sq mi (2,600 km2), with some males bears travelling as much as 4,349 sq mi (11,260 km2) in times of food shortages.[5][54] Black bears are excellent and strong swimmers, doing so for pleasure and to feed (largely on fish). Black bears climb regularly to feed, escape enemies or to hibernate. They are one of the half bear species that are habitually arboreal (the most arboreal species, the American and Asian black bears and the sun bear, being fairly closely related).[5] Their arboreal abilities tend to decline with age.[35] Black bears may be active at any time of the day or night, although mainly forage by night. Bears living near human habitations tend to be more extensively nocturnal and bears living near brown bears tend to be more extensively diurnal.[5][32]

Newborn black bear cubs

Reproduction and development [edit]

Sows usually produce their first litter at the age of 3–5 years.[35] Sows living in more developed areas tend to get pregnant at younger ages.[55] The breeding period usually occurs in the June–July period, though it can extend to August in the species' northern range. The breeding period lasts for 2–3 weeks. Both sexes are promiscuous. Males try to mate with several females but large, dominant ones may violently claim a female if another mature male comes near.[32] Sows tend to be short tempered with their mates after copulating. The fertilised eggs undergo delayed development and do not implant in the female’s womb until November. The gestation period lasts 235 days, and litters are usually born in late January to early February. Litters usually consist of two cubs, though litters of 6 have been recorded. At birth, cubs weigh 280–450 g (0.62–0.99 lb), and measure 20.5 cm (8.1 in) in length. They are born with fine, gray, downlike hair, and their hind quarters are underdeveloped. They typically open their eyes after 28–40 days, and begin walking after 5 weeks. Cubs are dependent on their mother's milk for 30 weeks, and will reach independence at 16–18 months. At the age of six weeks, they attain 900 g (2.0 lb), by 8 weeks they reach 2.5 kg (5.5 lb) and by the age of 6 months they weigh 18 to 27 kg (40 to 60 lb). They reach sexual maturity at the age of three years, and attain their full growth at 5 years.[35]

Female with cubs in Parc Omega, Quebec

Longevity and Mortality [edit]

The average lifespan in the wild is 18 years, though it is quite possible for wild specimens to survive for more than 23 years.[53] The record age of a wild specimen was 31 years, while that in captivity was 44 years.[34] Average annual survival rates for adult bears is variable, ranging from 86% in Florida to 73% in Virginia and North Carolina.[32] In Minnesota, 99% of wintering adult bears were able to survive the hibernation cycle in one study.[32] Remarkably, a study of black bears in Nevada found that the amount of annual mortality of a population of bears in wilderness areas was 0%, whereas in developed areas in the state this figure rose to 83%.[5] Survival in subadults is generally less assured. In Alaska, only 14–17% of subadult males and 30–48% of subadult females were found in a study to survive to adulthood.[32] Across the range, the estimated amount of cubs who survive past their first year is 60%.[5]

With the exception of the rare confrontation with an adult brown bear or gray wolf pack, adult black bears are not usually subject to natural predation.[32] Black bear cubs tend to be more vulnerable to predation than adults. Known predators of bear cubs have included bobcats, coyotes, cougars, wolves, brown bears and other bears of their own species.[5][32] Many of these will stealthily snatch small cubs right from under the sleeping mother. There is a single record of a golden eagle snatching a yearling cub.[5] Once out of hibernation, mother bears may be able to fight off most potential predators.[32] Even cougars will reportedly be displaced by an angry mother bear if they are discovered stalking the cubs.[56] Flooding of dens after birth may also occasionally kill newborn cubs. However, in current times, American black bears fatalities are overwhelming attributable to human activities. Seasonally, tens of thousands of black bears are hunting legally across North America, with many more being illegally poached or trapped. Auto-collisions also may claim many black bear lives annually.[5][32]

Hibernation [edit]

Mother black bear and cubs, hibernating

Black bears were once not considered true or "deep" hibernators, but because of discoveries about the metabolic changes that allow black bears to remain dormant for months without eating, drinking, urinating, or defecating, most biologists have redefined mammalian hibernation as "specialized, seasonal reduction in metabolism concurrent with scarce food and cold weather". Black bears are now considered highly efficient hibernators.[57][58]

Black bears enter their dens in October and November. Prior to that time, they can put on up to 30 pounds of body fat to get them through the seven months during which they fast. Hibernation in black bears typically lasts 3–5 months.[15] During this time, their heart rate drops from 40–50 beats per minute to 8 beats per minute. They spend their time in hollowed-out dens in tree cavities, under logs or rocks, in banks, caves, or culverts, and in shallow depressions. Females, however, have been shown to be pickier in their choice of dens, in comparison to males.[59] Although naturally-made dens are occasionally used, most dens are dug out by the bear itself.[53] A special hormone, leptin is released into the black bear's systems, to suppress appetite. Because they do not urinate or defecate during dormancy, the nitrogen waste from the bear's body is biochemically recycled back into their proteins. This also serves the purpose of preventing muscle loss, as the process uses the waste products to build muscle during the long periods of inactivity. In comparison to true hibernators, their body temperature does not drop significantly (staying around 35 degrees Celsius) and they remain somewhat alert and active. If the winter is mild enough, they may wake up and forage for food. Females also give birth in February and nurture their cubs until the snow melts.[60] During winter, black bears consume 25–40% of their body weight.[61] The footpads peel off while they sleep, making room for new tissue. In the most southernly areas (i.e. Florida, Mexico, the Southeastern United States) of the black bear's distribution only pregnant females and mothers with yearling cubs will enter hibernation.[5] After emerging from their winter dens in spring, they wander their home ranges for two weeks so that their metabolism accustoms itself to the activity. In mountainous areas, they seek southerly slopes at lower elevations for forage and move to northerly and easterly slopes at higher elevations as summer progresses. Black bears use dense cover for hiding and thermal protection, as well as for bedding.

Dietary habits [edit]

Black bear feeding on a bush
Black bear taking a dead chum salmon near Hyder, Alaska

Generally, American black bears are largely crepuscular in foraging active, though may actively feed at any time.[54] Up to 85% of the black bear's diet consists of vegetation,[35] though they tend to dig less than brown bears, eating far fewer roots, bulbs, corms and tubers than the latter species.[52] When initially emerging from hibernation, they will seek to feed on carrion from winter-killed animals and newborn ungulates. As the spring temperature warms, black bears seek new shoots of many plant species, especially new grasses, wetland plants and forbs.[61] Young shoots and buds from trees and shrubs during the spring period are also especially important to black bears emerging from hibernation, as they assist in rebuilding muscle and strengthening the skeleton and are often the only digestible foods available at that time.[62] During summer, the diet is comprised largely by fruits, especially berries and soft masts such as buds and drupes. During the autumn hyperphagia, feeding becomes pretty much the full-time task of black bears. Hard masts become the most important part of the black bear's diet in autumn and may even partially dictate the species distribution. Favored masts such as hazlenuts, oak acorns and whitebark pine nuts may be consumed by the hundreds each day by a single black bear during fall.[5][32] During the fall period, American black bears may also habitually raid the nut caches of tree squirrels.[61] Also extremely important in fall are berries such as huckleberries and buffalo berries.[5] Black bears living in areas near human settlements or around a considerable influx of recreational human activity often come to rely on foods inadvertently provided by humans, especially during summertime. These include refuse, birdseed, agricultural products and honey from apiaries.[53]

The majority of the black bear's animal diet consists of insects such as bees, yellow jackets, ants and their larvae.[61] Black bears are also fond of honey, and will gnaw through trees if hives are too deeply set into the trunks for them to reach them with their paws. Once the hive is breached, black bears will scrape the honeycombs together with their paws and eat them, regardless of stings from the bees.[46] Black bears that live in northern coastal regions (especially the Pacific coast) will fish for salmon during the night, as their black fur is easily spotted by salmon in the daytime. However, the white furred black bears of the islands of western Canada have a 30% greater success rate in catching salmon than their black furred counterparts.[63] Other fish including suckers, trout and catfish are readily caught when possible.[64] Although black bears do not often engage in active predation of other large animals for much of the year, the species will also regularly prey on mule and white-tailed deer fawns in spring given the opportunity.[65][66][67] In addition they have been recorded similarly preying on elk calves in Idaho[68] and moose calves in Alaska.[69]

Black bear with pink salmon.

Black bear predation on adult deer is rare but has been recorded.[70][71][72] They may even hunt prey up to the size of adult moose, which are considerably larger than themselves, by ambushing them.[73] In Labrador, black bears are exceptionally carnivorous, living largely off of caribou, usually sickly, young or dead specimens, and rodents such as voles. This is believed to be is due to a paucity of edible plant life in this sub-Arctic region and a local lack of competing large carnivores (including other bear species).[53] Like brown bears, black bears try to use surprise to ambush their prey and target the sickly animals in herds. Once a deer fawn is captured, it is frequently torn apart alive while feeding.[66] If able to capture a mother deer in spring, the bear frequently begins feeding on the udder of lactating females, but generally prefer meat from the viscera. Black bears often drag their prey to cover, preferring to feed in seclusion. The skin of large prey is stripped back and turned inside out with the skeleton usually left largely intact. Unlike wolves and coyotes, black bears rarely scatter the remains of their kills. Vegetation around the carcass is usually matted down by black bears and their droppings are frequently found nearby. Black bears may attempt to cover remains of larger carcasses, though they do not do so with the same frequency as cougars and grizzly bears.[74] They will readily consume eggs and nestlings of various birds and can easily access many tree nests, even the huge nest of the bald eagle.[35] Black bears have been reported stealing deer and other animals from human hunters.

Interspecific predatory relationships [edit]

Over much of their range, black bears are assured scavengers who, using their large size and considerable strength, can intimidate and, if necessary, dominate other predators in confrontations over carcasses. In occasions where they encounter the brown bear, however, the larger brown species dominates them. Black bears tend to escape competition from brown bears by being more active in the daytime, and living in more densely forested areas. Violent interactions resulting in the deaths of black bears have been recorded in Yellowstone National Park.[75][76]

Black bears may compete with cougars over carcasses. Like brown bears, they will sometimes steal kills from cougars. One study found that both bear species visited 24% of cougar kills in Yellowstone and Glacier National Parks, usurping 10% of carcasses.[77][78] Fights between the two species are rare, though they can be violent. Several accounts, almost entirely told ancedotedly from the 18th and 19th centuries, detail confrontations in which cougars and black bears have engaged in protacted combat and end with both competitors fatally wounded.[79][80][81]

Black bear interactions with wolves are much rarer than with brown bears, due to differences in habitat preferences. The majority of black bear encounters with wolves occur in the species' northern range, with no interactions being recorded in Mexico. Despite the black bear being more powerful on a one to one basis, packs of wolves have been recorded to kill black bears on numerous occasions without eating them. Unlike brown bears, black bears frequently lose against wolves in disputes over kills.[82] Wolf packs typically kill black bears when the large animals are in their hibernation cycle.[37]

There is at least one record of a black bear killing a wolverine in a dispute over food in Yellowstone National Park.[83] Black bears may sometimes habitually predate American alligator nests. Sometimes, they are fought off by the female alligator but will also occasionally wound or even kill an adult alligator, though neither species are likely to confront a large adult of the other directly.[84] Ancedotal cases of alligator predation on bears have been reported, though such cases may involve assaults on cubs.[85]

Relationships with humans [edit]

In folklore, mythology and culture [edit]

Harry Colebourn and Winnie, the bear from which Winnie the Pooh derives his name

Black bears feature prominently in the stories of some of America's indigenous peoples. One tale tells of how the black bear was a creation of the Great Spirit, while the grizzly was created by the Evil Spirit.[86] In the mythology of the Haida, Tlingit, Tsimshian people of the Northwest Coast, mankind first learned to respect bears when a girl married the son of black bear Chieftain.[87] In Kwakiutl mythology, black and brown bears became enemies when Grizzly Bear Woman killed Black Bear Woman for being lazy. Black Bear Woman's children, in turn, killed Grizzly Bear Woman's own cubs.[88] The Navajo believed that the Big Black Bear was chief among the bears of the four directions surrounding Sun's house, and would pray to it in order to be granted its protection during raids.[89]

Morris Michtom, the creator of the teddy bear, was inspired to make the toy when he came across a cartoon of Theodore Roosevelt refusing to shoot a black bear cub trapped up a tree.[90] Winnie the Pooh was named after Winnipeg, a female black bear cub that lived at London Zoo from 1915 until her death in 1934.[91] A black bear cub who in the spring of 1950 was caught in the Capitan Gap fire was made into the living representative of Smokey Bear, the mascot of the United States Forest Service.[92]

The American black bear is the mascot of The University of Maine and Baylor University, where the university houses two live black bears on campus.

Sleeping Bear Dunes is named after a Native American legend, where a female bear and her cub swam across Lake Michigan. Exhausted from their journey, the bears rested on the shoreline and fell sound asleep. Over the years, the sand covered them up, creating a huge sand dune.

Attacks on humans [edit]

Although an adult bear is quite capable of killing a human, American black bears typically avoid confronting humans when possible. Unlike grizzly bears, which became a subject of fearsome legend among the European settlers of North America, black bears were rarely considered overly dangerous, even though they lived in areas where the pioneers had settled. Black bears rarely attack when confronted by humans, and usually limit themselves to making mock charges, emitting blowing noises and swatting the ground with their forepaws. However, according to Stephen Herrero in his Bear Attacks: Their Causes and Avoidance, 23 people were killed by black bears from 1900 to 1980. The number of black bear attacks on humans is higher than those of the brown bear in North America, though this is largely because the black species considerably outnumbers the brown rather than greater aggressiveness.

The incidence of bear attacks in parks and campgrounds declined after the introduction of bear-resistant garbage cans and other reforms

Compared to brown bear attacks, aggressive encounters with black bears rarely lead to serious injury. However, the majority of black bear attacks tend to be motivated by hunger rather than territoriality, and thus victims have a higher probability of surviving by fighting back rather than submitting. Unlike grizzlies, female black bears do not display the same level of protectiveness to their cubs, and seldom attack humans in their vicinity.[52] However, occasionally, attacks by protective mothers do occur.[32] The worst recorded fatality incident occurred in May 1978, in which a black bear killed three teenagers who were fishing in Algonquin Park in Canada.[93] Another exceptional, spree-like attack occurred in July 1998 in Liard River Hot Springs Provincial Park in Canada, when an emaciated black bear attacked a child and mother, killing the latter as well as an adult man who tried to intervene. This bear was shot while mauling a fourth victim.[94][95]

The majority of attacks happened in national parks, usually near campgrounds, where the bears had become habituated to human contact and food.[52] 1,028 incidences of black bears acting aggressively toward people, 107 of which resulted in injury, were recorded from 1964 to 1976 in the Great Smoky Mountains National Park, and occurred mainly in tourist hotspots where people regularly fed the bears handouts.[93] In almost every case where open dumps or handouts that had previously attracted black bears were ceased, the amount of aggressive encounters with bears have decreased precipitously over time.[32] However, in the afforementioned case of the spree attack in Liard River Hot Springs, the attacking bear was believed to have been previously almost fully dependent on a local garbage dump that had closed and was starving as a result of the loss of that food source.[94] Attempts to relocate bears are typically unsuccessful, as black bears seem to be able to return to their home range even without familiar landscape cues.[32]

Livestock and crop predation [edit]

A limitation of food sources in early spring and wild berry and nut crop failures during summer months are probably major contributing factors to black bears regularly feeding from commercial human-based food sources. Crops are frequently eaten by these bears, especially during autumn hyperphagia when natural foods are scarce. Favored crops may include apples, oats and corns.[5] Black bears can do extensive damage in some areas of the northwestern United States by stripping the bark from trees and feeding on the cambium. Livestock depredations by black bears occur mostly in spring. Though black bears have the capacity to (and occasionally do) hunt adult cattle and horses, they seem to prefer smaller, more easily overwhelmed prey such as sheep, goats, calves, and pigs. They normally kill by biting the neck and shoulders, though they may break the neck or back of prey with blows from the paws. Evidence of a bear attack includes claw marks and is frequently found on the neck, back, and shoulders of larger animals. Surplus killing of sheep and goats are common. Bears have been known to frighten livestock herds over cliffs, causing injuries and death to many animals; whether or not this is intentional is not known.[74] Occasionally, pets, especially dogs which are most prone to harass a bear, are killed by black bears.[96] It is not recommended to use unleashed dogs as a deterrent from bear attacks. Although large, aggressive dogs sometimes cause a bear to run, if pressed, angry bears frequently turn the tables end up chasing the dog in return. A bear in pursuit of a pet dog has the potential to threaten both canid and human lives.[97][98]

Hunting and exploitation [edit]

Hunting [edit]

Historically, black bears were hunted by both Native Americans and European settlers. Some Native American tribes, in admiration for the black bear's intelligence, would decorate the heads of bears they killed with trinkets, and place them on blankets. Tobacco smoke would be wafted into the disembodied head's nostrils by the hunter that dealt the killing blow, and would compliment the animal for its courage.[46] The Kutchin typically hunted black bears during their hibernation cycle. Unlike the hunting of hibernating grizzlies, which was wrought with danger, black bears took longer to awaken, and was thus safer and easier.[22] During the European colonisation of eastern North America, thousands of black bears were hunted for their meat, fat and fur.[4] Theodore Roosevelt wrote extensively on black bear hunting in his Hunting the Grisly and other sketches, in which he stated "in [a black bear] chase there is much excitement, and occasionally a slight spice of danger, just enough to render it attractive; so it has always been eagerly followed". He wrote that black bears were difficult to hunt by stalking, due to their habitat preferences, though were easy to trap. Roosevelt described how in the Southern States, planters regularly hunted black bears on horseback with hounds. General Wade Hampton was known to have been present at 500 successful black bear hunts, two thirds of which he killed personally. He killed thirty or forty black bears with only a knife, which he would use to stab the bears between the shoulder blades while they were distracted by his hounds.[73] Unless well trained, horses were often useless in black bear hunts, as they often bolted when the bears stood their ground.[46] In 1799, 192,000 black bear skins were exported from Quebec. In 1822, 3,000 skins were exported from the Hudson's Bay Company.[99] In 1992, untanned, fleshed and salted black bear hides were sold for an average of $165.[100]

In Canada, black bears are considered as both a big game and furbearer species in all provinces save for New Brunswick and Northwest Territories, where they are only classed as a big game species. There are currently 80,822 licensed black bear hunters in all of Canada. Canadian black bear hunts take place in the fall and spring, and both male and female bears can be legally taken, though some provinces prohibit the hunting of females with cubs, or yearling specimens.[29]

Currently, 28 of the USA's states have black bear hunting seasons. Nineteen states require a bear hunting license, with some also requiring a big game license. In eight states, only a big game license is required to hunt black bears. Overall over 481,500 black bear hunting licences are sold per year. The hunting methods and seasons vary greatly according to state, with some bear hunting seasons including fall only, spring and fall, or year-round. New Jersey, in November 2010, approved of a six-day bear-hunting season in early December 2010 to slow the growth of the black bear population. Bear-hunting had been banned in New Jersey for five years.[101] A Fairleigh Dickinson University PublicMind poll found that 53% of New Jersey voters approved of the new season if scientists concluded black bears were leaving their usual habitats and destroying private property.[102] Men, older voters, and those living in rural areas were more likely to approve of a bear-hunting season in New Jersey than women, younger voters, and those living in more developed parts of the state.[102] In the western states, where there are large black populations, there are spring and year-round seasons. Approximately 18,845 black bears were killed annually in the USA between 1988–1992. Within this period, annual kills ranged from six bears in South Carolina to 2,232 in Maine.[29]

According to Dwight Schuh in his Bowhunter's Encyclopedia, black bears are the third most popular quarry of bowhunters, behind deer and elk.[103]

Meat and organs [edit]

Black bear meat
Nutritional value per 100 g (3.5 oz)
Energy649 kJ (155 kcal)
Carbohydrates0.00 g
Fat8.30 g
Protein20.10 g
Water71.20 g
Vitamin A equiv.78 μg (10%)
Thiamine (vit. B1)0.160 mg (14%)
Riboflavin (vit. B2)0.680 mg (57%)
Niacin (vit. B3)3.200 mg (21%)
Iron7.20 mg (55%)
Phosphorus162 mg (23%)
Percentages are relative to
US recommendations for adults.
Source: USDA Nutrient Database

Black bear meat had historically been held in high esteem among North America's indigenous people and colonists.[46] Black bears were the only bear species the Kutchin hunted for their meat, though this constituted only a small part of their diet.[22] According to the second volume of Frank Forester's field sports of the United States, and British provinces, of North America:

The flesh of the [black] bear is savoury, but rather luscious, and tastes not unlike pork. It was once so common an article of food in New-York as to have given the name of Bear Market to one of the principal markets of the city.

Frank Forester's field sports of the United States, and British provinces, of North America p. 186

Theodore Roosevelt himself likened the flesh of young black bears to that of pork, and not as coarse or flavourless as the meat of grizzlies.[104] The most favoured cuts of the black bear's meat are concentrated in the legs and loins. Meat from the neck, front legs and shoulders is usually ground into mincemeat or used for stews and casseroles. Keeping the fat tends to give the meat a strong flavour. As black bears can have trichinellosis, cooking temperatures need to be high in order to kill the parasites.[105]

Black bear fat was once valued as a cosmetic article which promoted hair growth and gloss. The fat most favoured for this purpose was the hard white fat found in the body's interior. As only a small portion of this fat could be harvested for this purpose, the oil was often mixed with large quantities of hog lard.[46] However animal rights activism over the last decade has slowed the harvest of these animals; therefore the lard from black bear has not been used in recent years for the purpose of cosmetics.

See also [edit]

References [edit]

  1. ^ a b Garshelis, D.L., Crider, D. & van Manen, F. (2008). Ursus americanus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 27 January 2009.
  2. ^ Ursus americanus, Mammal Species of the World, 3rd ed.
  3. ^ a b c d e Krause, J.; Unger, T.; Noçon, A.; Malaspinas, A.; Kolokotronis, S.; Stiller, M.; Soibelzon, L.; Spriggs, H.; Dear, P. H.; Briggs, A. W.; Bray, S. C. E.; O'Brien, S. J.; Rabeder, G.; Matheus, P.; Cooper, A.; Slatkin, M.; Pääbo, S.; Hofreiter, M. (2008). "Mitochondrial genomes reveal an explosive radiation of extinct and extant bears near the Miocene-Pliocene boundary". BMC Evolutionary Biology 8 (220): 220. doi:10.1186/1471-2148-8-220. PMC 2518930. PMID 18662376. 
  4. ^ a b Bears of the World by Lance Craighead, Publisher: Voyageur Press, 2003, ISBN 0-89658-008-3
  5. ^ a b c d e f g h i j k l m n o p q r Carnivores of the World by Dr. Luke Hunter. Princeton University Press (2011), ISBN 9780691152288
  6. ^ Michael O. Woodburne (2004). Late Cretaceous and Cenozoic Mammals of North America: Biostratigraphy and Geochronology. Columbia University Press. pp. 178, 252. ISBN 978-0-231-13040-0. Retrieved 25 June 2012. 
  7. ^ a b Kurten, B., and E. Anderson. 1980. Pleistocene mammals of North America. Columbia University Press, New York.
  8. ^ a b Wolverton, S., and R. L. Lyman (1998). "Measuring late Quaternary Ursid diminution in the Midwest". Quaternary Research 49 (3): 322–329. doi:10.1006/qres.1998.1964. 
  9. ^ Lisette Waits, David Paetkau, and Curtis Strobeck, "Overview" from Genetics of the Bears of the World chapter 3 of Bears: Status Survey and Conservation Action Plan, compiled by Christopher Servheen, Stephen Herrero and Bernard Peyton, IUCN/SSC Bear Specialist Group
  10. ^ Herrero, Stephen. "Aspects of Evolution and Adaptation in American Black Bears (Ursus americanus Pallas) and Brown and Grizzly Bears (U. arctos Linne.) of North America" (PDF). Environmental Sciences Centre (Kananaskis). Retrieved 2011-02-21. 
  11. ^ a b "The American Black Bear". Grizzlybear.org. Retrieved 2011-02-21. 
  12. ^ Qiu, Z. (2003). "Dispersals of Neogene Carnivorans between Asia and North America". Bulletin American Museum of Natural History 279: 18–31. doi:10.1206/0003-0090(2003)279<0018:C>2.0.CO;2. 
  13. ^ Schubert, B. W.; Hulbert, Jr.; MacFadden, B. J.; Searle, M.; Searle, S. (2010). "Giant short-faced bears (Arctodus simus) in Pleistocene Florida USA, a substantial range expansion". Journal of Paleontology 84: 79–87. doi:10.1666/09-113.1. 
  14. ^ Black Bear Subspecies, CoveBear
  15. ^ a b "Haida Gwaii Black Bear (Ursus Americanus Carlottae Subspecies)" (PDF). Retrieved 2011-02-21. 
  16. ^ "SPECIES VARIATION – Editorial Comment". Wildlife1.wildlifeinformation.org. Retrieved 2011-02-21. 
  17. ^ Black Bear, Parks Canada
  18. ^ "Spirit Bear Facts". Province of British Columbia. Archived from the original on 17 December 2009. Retrieved 2009-12-03. 
  19. ^ ''Louisiana Black Bear''. (PDF) . Retrieved on 2011-09-15.
  20. ^ "Abnaki-Penobscot Animal Words". Native-languages.org. Retrieved 2011-02-21. 
  21. ^ "Algonquin Animal Words". Native-languages.org. Retrieved 2011-02-21. 
  22. ^ a b c Nelson, Richard K. Hunters of the northern forest: designs for survival among the Alaskan Kutchin, University of Chicago Press, 1986, ISBN 0-226-57181-5
  23. ^ "English-Tlingit Dictionary". Alaskool.org. Retrieved 2011-02-21. 
  24. ^ English/Cherokee Dictionary wehali.com
  25. ^ Diebold, A. Richard, Jr. (1982). "Alleged American Indian "Baribal" 'American Black Bear': A Query". International Journal of American Linguistics 48 (1): 89–91. doi:10.1086/465718. JSTOR 1264753. 
  26. ^ Hybrid Bears. messybeast.com
  27. ^ Darwin, Charles (1868). The Variation of Animals and Plants under Domestication. Volume 2 (1st ed.). London: John Murray. p. 151. ISBN 1-4068-4250-8. 
  28. ^ Richard P. Smith, "Hybrid Black Bear" in Black Bear Hunting, Stackpole Books, 2007, ISBN 0-8117-0269-3
  29. ^ a b c d e f Michael R. Pelton, Alex B. Coley, Thomas H. Eason, Diana L. Doan Martinez, Joel A. Pederson, Frank T. van Manen, and Keith M. Weaver. "Chapter 8. American Black Bear Conservation Action Plan" (PDF). Archived from the original on 2011-07-23. Retrieved 2011-02-21. 
  30. ^ "Canadian Population". World Wildlife Fund. Retrieved 2011-08-31. 
  31. ^ "United States Population". World Wildlife Fund. Retrieved 2011-08-31. 
  32. ^ a b c d e f g h i j k l m n o p q Lariviere, S. (2001). "Ursus americanus". Mammalian Species 647: 1–11. doi:10.1644/1545-1410(2001)647<0001:UA>2.0.CO;2. 
  33. ^ "Bears of the World". Americanbear.org. Retrieved 2011-02-21. 
  34. ^ a b c d e f g Brown 1993, Ch. "Bear Anatomy and Physiology".
  35. ^ a b c d e f g Brown 1993, Ch. "Behaviour and Activities".
  36. ^ "Learning and Color Discrimination in the American Black Bear" (PDF). Retrieved 2011-02-21. 
  37. ^ a b Scorzafava, Dick (2007). Radical Bear Hunter. Stackpole Books. ISBN 978-0-8117-3418-9. 
  38. ^ Bertram, M.R.; Vivion M. T. (2002). "Black bear monitoring in eastern interior Alaska". Ursus 13 (69–77). 
  39. ^ Peacock, Elizabeth (2004). Population, Genetic and Behavioral Studies of Black Bears Ursus americanus in Southeast Alaska. PhD Thesis, University of Nevada, Reno
  40. ^ Ursus americanus (Pallas); Black Bear. Discoverlife.org. Retrieved on 2012-12-20.
  41. ^ Barnes, V.G., and O.E. Bray. 1967. Population characteristics and activities of black bears in Yellowstone National Park. Final rep., Colorado Wildl. Res. Unit, Colorado State Univ., Fort Collins; cited in Characteristics of Black Bears and Grizzly Bears in YNP. nps.gov
  42. ^ BLACK BEARS IN NEW YORK: Natural History, Range, and Interactions with People. Bureau of Wildlife – Black Bear Management Team, 2003; Second Edition: 2007
  43. ^ Audubon Field Guide. Audubonguides.com. Retrieved on 2011-09-15.
  44. ^ Kronk, C. (2007). Ursus americanus. Animal Diversity Web. Retrieved on 2011-09-15.
  45. ^ American black bear videos, photos and facts – Ursus americanus. ARKive. Retrieved on 2011-09-15.
  46. ^ a b c d e f g h Wood, Gerald (1983). The Guinness Book of Animal Facts & Feats. Sterling Publishing Co. ISBN 978-0-85112-235-9. 
  47. ^ [1]
  48. ^ [2]
  49. ^ Rogers, Lyn. "North American Bear Center — Meet Our Bears > Ted's Page". Bear.org. Retrieved 11 February 2011. 
  50. ^ "North American Bear Center — Meet Our Bears > Honey's Page". Bear.org. Retrieved 11 February 2011. 
  51. ^ Ursus thibetanus (G. Cuvier, 1823)[dead link]
  52. ^ a b c d Stephen Herrero (2002). Bear Attacks: Their Causes and Avoidance. Globe Pequot. ISBN 978-1-58574-557-9. Retrieved 16 May 2012. 
  53. ^ a b c d e Macdonald, D.W. (2006) The Encyclopedia of Mammals. Oxford University Press, Oxford ISBN 0199567999.
  54. ^ a b c Nowak, R.M. (1991) Walker's Mammals of the World. The Johns Hopkins University Press, Baltimore and London.
  55. ^ "''Urban Black Bears "Live Fast, Die Young"'', ScienceDaily (Oct. 1, 2008)". Sciencedaily.com. 2008-10-01. Retrieved 2011-02-21. 
  56. ^ Man Says Bear Saved Him From Mountain Lion Attack In Butte County « CBS Sacramento. Sacramento.cbslocal.com (2012-03-29). Retrieved on 2012-12-21.
  57. ^ "Hibernation". Bear.org. 2004-07-19. Retrieved 2011-02-19. 
  58. ^ "Yellowstone National Park – Denning and Hibernation Behavior (U.S. National Park Service)". Nps.gov. 2008-04-15. Retrieved 2011-02-19. 
  59. ^ Goals, Ben. "American Black Bear Teaching Guide". Cornell. Retrieved 22 November 2009. 
  60. ^ Bennett, Bobby (Spring 2006). "Hibernation of the Black and Brown Bear". Mountain Research Station. Retrieved 22 November 2009. 
  61. ^ a b c d Becker, Jim (1993). "The Black Bear". Spanning the Gap – The newsletter of Delaware Water Gap National Recreation Area. Retrieved 2011-02-21. 
  62. ^ American Black Bear Fact Sheet – National Zoo| FONZ. Nationalzoo.si.edu. Retrieved on 2011-09-15.
  63. ^ Bourton, Jody (2009-11-06). "Spirit bears become 'invisible' by Jody Bourton, Earth News reporter". BBC News. Retrieved 2011-02-21. 
  64. ^ black bear. Pvci.org. Retrieved on 2012-12-20.
  65. ^ Smith, R. 1983. Mule deer reproduction and survival in the LaSal Mountains of Utah, 1983. M.S. thesis, Utah State University, Logan.
  66. ^ a b Mathews, N. E.; Porter, W. F (1988). "Black bear predation on white-tailed deer neonates in the central Adirondacks". Canadian Journal of Zoology 66 (5): 1241–1242. doi:10.1139/z88-179. 
  67. ^ Ozoga, J. J., and Clute, R.K. (1988). "Mortality rates of marked and unmarked fawns". Journal of Wildlife Management 52 (3): 549–551. doi:10.2307/3801608. JSTOR 3801608. 
  68. ^ Schlegal, M. (1976). "Factor affecting calf elk survival in north central Idaho". Western Association of State Game and Fish Commission 56: 342–355. 
  69. ^ Franzmann, Albert W.; Schwartz, Charles C.; Peterson, Rolf O. (1980). "Moose calf mortality in summer at Kenai Peninsula, Alaska". Journal of Wildlife Management 44 (3): 764–768. doi:10.2307/3808038. JSTOR 3808038. 
  70. ^ Behrend, D.F.; Sage, R.W.; Jr (1974). "Unusual feeding behavior by black bears". Journal of Wildlife Management 38 (3): 570. doi:10.2307/3800894. 
  71. ^ Svoboda, Nathan J.; Belant, Jerrold L., Beyer, Dean E., Duquette, Jared F., Stricker, Heather K., Albright, Craig A. (2011). "American black bear predation of an adult white-tailed deer". Ursus 22 (1): 91–94. doi:10.2192/URSUS-D-10-00024.1. 
  72. ^ Austin, M. A., Obbard, M. E. and Kolenosky, G. B. (1994). "Evidence for a black bear, Ursus americanus, killing an adult moose, Alces alces". The Canadian Field Naturalist 108: 236–238. 
  73. ^ a b Roosevelt, Theodore (2007). Hunting the Grisly and Other Sketches. ReadHowYouWant.com. pp. 33–. ISBN 978-1-4250-7306-0. Retrieved 25 June 2012. 
  74. ^ a b "Bear Predation — Description". Texnat.tamu.edu. Archived from the original on 2006-10-17. Retrieved 2008-11-24. 
  75. ^ Kerry A. Gunther and Mark J. Biel. "Evidence of grizzly bear predation on a black bear in Hayden Valley" (PDF). Retrieved 2011-02-21. 
  76. ^ "Probable Grizzly Bear Predation On An American Black Bear In Yellowstone National Park" (PDF). Retrieved 2011-02-21. 
  77. ^ COSEWIC. Canadian Wildlife Service (2002). Assessment and Update Status Report on the Grizzly Bear (Ursus arctos) (PDF). Environment Canada. Retrieved 2007-04-08. 
  78. ^ Murphy, Kerry M.; Felzien, Gregory S.; Hornocker, Maurice G. and Ruth, Toni K. (1998). "Encounter Competition between Bears and Cougars: Some Ecological Implications". Ursus 10: 55. JSTOR 3873109. 
  79. ^ Turnbo, S. C. A Fight to a Finish Between a Bear and Panther. Thelibrary.org. Retrieved on 2012-12-19.
  80. ^ Stone 1975, pp. 137–39
  81. ^ Bradley 1940, p. 116
  82. ^ Mech, L. David and Boitani, Luigi (2001). Wolves: Behaviour, Ecology and Conservation. Chicago: University of Chicago Press. p. 448. ISBN 0-226-51696-2. 
  83. ^ "''In Yellowstone, It's a Carnivore Competition'', Washington Post, May 19, 2003". Ecoearth.info. 2003-05-19. Retrieved 2011-02-21. 
  84. ^ Crocodiles: Proceedings of the 6th Working Meeting of the Crocodile Specialist Group of the Species Survival Commission of the International Union for Conservation of Nature and Natural Resources (IUCN publication. New series). IUCN (1986), ISBN 2880329051.
  85. ^ Key West Florida Attractions | Alligator Exhibit. Key West Aquarium (2012-11-30). Retrieved on 2012-12-20.
  86. ^ Lippincott, Joshua B. Folklore and Legends of the North American Indian, Abela Publishing Ltd, 2009, ISBN 0-9560584-6-9
  87. ^ Bastian, Dawn Elaine and Mitchell, Judy K.. Handbook of Native American mythology, ABC-CLIO, 2004, ISBN 1-85109-533-0
  88. ^ Averkieva, Julia and Sherman, Mark, Kwakiutl String Figures, UBC Press, 1992, ISBN 0-7748-0432-7
  89. ^ Clark, LaVerne Harrell. They sang for horses: the impact of the horse on Navajo & Apache folklore, University Press of Colorado, 2001, ISBN 0-87081-496-6
  90. ^ "Teddy Bears". Library Of Congress. Archived from the original on 17 December 2007. Retrieved 2007-12-10. 
  91. ^ A Bear Named Winnie CBC.ca TV (2004)
  92. ^ "Zoogoer Nov/Dec 2002 Sidebar: Smokey Comes to Washington by Alex Hawes". Nationalzoo.si.edu. Retrieved 2011-02-21. 
  93. ^ a b Kruuk, Hans. Hunter and hunted: relationships between carnivores and people, Cambridge University Press, 2002, ISBN 0-521-89109-4
  94. ^ a b Shockey, Jim (April 1, 1999). "Black Bears—Simple Fools or Cunning Killers". Outdoor Life. Retrieved 2008-10-20. 
  95. ^ "Black Bear Kills Texas Woman, Canadian Man". Los Angeles Times. 17 August 1997. Retrieved 25 December 2010. 
  96. ^ Black Bear Attacks Dog. Wjhg.com. Retrieved on 2012-12-21.
  97. ^ Frequently Asked Questions Regarding Bears – Denali National Park & Preserve. Nps.gov. Retrieved on 2012-12-21.
  98. ^ Encountering Black Bears in Arkansas. University of Arkansas uaex.edu
  99. ^ Partington, Charles Frederick (1835) The British Cyclopædia of Natural History: Combining a Scientific Classification of Animals, Plants, and Minerals, Charles Frederick Partington, Vol. 1, Orr & Smith.
  100. ^ Brown 1993, Ch. "Use of Bears and Bear Parts".
  101. ^ Sciarrino, Robert (2010-07-21). "Black bear hunt gets final approval from Department of Environmental Protection head". NJ.com. Retrieved 2011-02-19. 
  102. ^ a b "Bear Necessity? Public Approves of Bear Hunt". Publicmind.fdu.edu. Retrieved 2011-02-19. 
  103. ^ Schuh, Dwight R. Bowhunter's Encyclopedia, Stackpole Books, 1992, ISBN 0-8117-2412-3
  104. ^ Roosevelt, Theodore. Hunting Trips of a Ranchman: Hunting Trips on the Prairie and in the Mountains, Adamant Media Corporation, ISBN 1-4212-6647-4
  105. ^ Smith, Richard P. Black Bear Hunting, Stackpole Books, 2007 ISBN 0-8117-0269-3

Bibliography [edit]

Brown, Gary (1993). The great bear almanac. Lyons & Burford. ISBN 978-1-55821-210-7. 

Further reading [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Characterized by a relatively low level of protein variation (see Cronin et al. 1991). Cronin et al. (1991) found very similar mtDNA haplotypes among black bears from Alaska, Montana, Oregon, and New Hampshire, though divergent haplotypes were identified in the populations from Montana and Oregon; evidently there has been maintenance of polymorphism and considerable gene flow throughout the history of the species. Bears from insular Newfoundland, New Brunswick, and Quebec, and most individuals from Alberta, exhibited very closely related mtDNA haplotypes; Newfoundland bears apparently arose through rapid genetic drift associated with a founder effect during postglacial colonization (Paetkau and Strobeck 1996).

Bears from Haida Gwaii (Queen Charlotte Islands), Vancouver Island, and coastal mainland British Columbia are indistinguishable with respect to mtDNA, but these bears are highly distinct from inland continental bears; the coastal mtDNA lineage occurs in each of the three recognized coastal subspecies, suggesting that the morphological characteristics differentiating these taxa may be postglacially derived (Byun et al. 1997).

See Cronin et al. (1991) and Shields and Kocher (1991) for information on phylogenetic relationships of North American ursids based on an analysis of mitochondrial DNA (black bear has been separated from brown and polar bears much longer than brown and polar bears have been separated from each other).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!