Articles on this page are available in 2 other languages: Chinese (Simplified) (5), Spanish (3) (learn more)

Overview

Brief Summary

Description

Brown Bears are solitary, powerful predators who can be aggressive to one another. There is a social hierarchy: adult males are dominant, and females with cubs are dominant over juvenile males and females without cubs. Brown Bears are omnivorous, consuming everything from mosses, fungi, herbs, grasses, fruits, berries, small vertebrates, insects, birds, and fish especially salmon during their spawning run to other mammals. They dig after burrowing mammals and take down large hoofed mammals caught in deep snow or otherwise disabled. They are excellent swimmers and have acute senses of hearing and smell, but poor eyesight, and can attack humans without warning. The largest North American males weigh more than 600 kg (1,325 pounds).

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:47, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

Longueur : 170-280 cm dont 6 à 21 cm de queue. Taille au garrot : 90-110 cm. Poids : 150-240 kg pour le mâle et 70-130 kg pour la femelle.

L’Ours brun a une silhouette massive caractéristique. Ses oreilles sont rondes et bien visibles. Il a une bosse au garrot. Ses quatre pattes comptent cinq doigts portant des griffes non rétractiles. Les membres antérieurs sont plus développés que les postérieurs.
Il porte une épaisse toison brune. Sa robe est plus claire sur les flancs et foncée, même noire, à l’extrémité des membres et sur le museau. Son pelage, très sombre en automne, s’éclaircit en été. L’Ours brun compte généralement entre 36 et 39 dents, les trois premières prémolaires étant atrophiées ou absentes : I3/3, C1/1, P1(3)/1(3), M2/3.

En France, l’Ours est principalement nocturne et s’active principalement du crépuscule à la première moitié de la nuit (de 18 à 23h) et à l’aube (de 5 à 8h). Dès la mi-novembre, il réduit ses activités et rentre en léthargie jusqu’à la mi-mars. Durant son hivernation, il s’abrite dans sa tanière qui peut être un terrier, une cavité creusée sous la roche, une caverne rocheuse ou un fourré à même le sol. Solitaire, l’Ours est polygame et ne reste en couple que durant le rut. La maturité sexuelle est atteinte vers 3-5 ans pour les femelles, 5-6 ans pour les mâles. L’accouplement a lieu entre la fin avril et la mi-juin dans les Pyrénées. La femelle s’accouple avec plusieurs partenaires et met bas, de 1 à 3 jeunes de 350 g environ, dans sa tanière en janvier-février. L’Ours brun a une gestation à nidification différée, c’est-à-dire que deux-trois jours après la fécondation, il y a blocage de la segmentation de l’œuf qui ne reprend que plusieurs mois plus tard, vers fin novembre. La gestation dure alors 8 à 10 semaines. La femelle peut donner naissance tous les 2-3 ans. Les oursons sont sevrés et s’émancipent au bout d’un an. Ils peuvent vivre jusqu’à 20-30 ans.

Opportuniste, l’Ours brun est omnivore à dominante végétivore. Il apprécie particulièrement les baies. La fraction carnée de son alimentation est bien moins importante et se compose d’insectes (fourmis, guêpes, abeilles…) et de mammifères (ovins, caprins, suidés, cervidés). Son alimentation varie en fonction des saisons, et il s’alimente peu ou pas en hiver.

Dans les Pyrénées, l’Ours brun se retrouve principalement entre 1300 et 1800 m d’altitude. Il est présent préférentiellement dans les peuplements mâtures de hêtres et sapins, dans les fourrés de versants escarpés de couloirs et lisières, dans les pinerais clairsemées à Pinus uncinata, les couloirs à avalanches et pelouse humides, les landes « sub-alpines » à éricacées, les pelouses à espèces nitrophiles mais aussi dans les zones forestières incendiées ou de lisières supérieures riches en arbustes à baies. N’étant pas territorial, il utilise un important domaine vital variant entre 200 et 1000 km2 dans les Pyrénées.

Références :
CAMARRA J.-J. & QUENETTE. 2012. L’Ours. Disponible sur : http://www.oncfs.gouv.fr
PARDE J.-M. & CAMARRA J.-J. 1992. L’ours (Ursus arctos, Linnaeus, 1758).. Société française pour l’Etude et la Protection des Mammifères. Encyclopédie des Carnivores de France 5 : 44p.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Formerly throughout western North America, north from northern Mexico; northwestern Africa, all of the Palearctic from western Europe, Near and Middle East through the northern Himalayas to western and northern China and Chukot (Russia) and Hokkaido (Japan) (Wozencraft, in Wilson and Reeder 1993); see Pasitschniak-Arts (1993) for additional details. In North America, present range includes Alaska, northern and western Canada, northern Continental Divide in Montana, Cabinet/Yaak mountains in Montana/Idaho, Selkirk Mountains in Idaho/Washington, Northern Cascades in Washington, and Yellowstone area, Wyoming/Montana/Idaho. Some bears in the Cabinet-Yaak ecosystem of Montana and Idaho and Selkirk ecosystem of Idaho and Washington mingle in the Purcell Mountains in southern British Columbia, and movement data indicate that the Cabinet-Yaak and Selkirk populations are connected to a much larger population (several hundred bears) extending north into British Columbia (USFWS 1999). However, the listed distinct population segment is confined to the U.S. portion of these ecosystems. Common only in Alaska, parts of the Yukon, northern and coastal British Columbia, and portions of the northern Rocky Mountains. USFWS has proposed reintroduction in the Bitterroot ecosystem of east-central Idaho and adjacent Montana. In Europe, apart from northern Europe, distribution has shrunk to a few isolated populations in the Pyrenees, the Apenines, the Alps, the Balkan Peninsula, and the Carpathians (see Hartl and Hell 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

The brown bear is the most widely distributed ursid. It once ranged across a large portion of North America, including northern Mexico (plus, at one time, much of the eastern half of the continent), throughout Europe, Asia, the Middle East, and even across North Africa. It presently occupies approximately 5,000,000 km² of the northwestern portion of North America, 800,000 km² of Europe (excluding Russia), and much of northern Asia. The largest numbers exist in Russia, U.S. (Alaska), and Canada. Many populations in Europe, and the more southerly portions of Asia and North America are small and isolated (Servheen et al. 1999, Swenson et al. 2000). A history of prolonged over-exploitation in Europe stretching back centuries resulted in the elimination of brown bears from many countries. The date of their extirpation from North Africa is uncertain, but they may have existed as late as the 1500s in the Sinai of Egypt (Manlius 1998) and mid-1800s in Algeria and Morocco (Hamdine et al. 1998). During the 20th Century, brown bears (called grizzly bears in interior North America) were extirpated in Mexico and a large portion of southwestern U.S. (Brown 1985, Mattson and Merrill 2002), while in Asia and the Middle East they have apparently been eliminated from Syria, and possibly Bhutan. Very small numbers of brown bears still remain in Iraq and Nepal (Gurung 2004, Ridings 2006). Andorra was reoccupied in 2003 from bears reintroduced into the French Pyrenees. A few wandering individuals recently crossed into Switzerland from Italy and into Lithuania from Latvia and Belarus, but not enough as yet to be considered extant populations.

The brown bear currently occurs in Afghanistan, Albania, Andorra (recently reoccupied), Armenia, Austria, Azerbaijan, Belarus, Bhutan (possibly extinct), Bosnia and Herzegovina, Bulgaria, Canada, China, Croatia, Czech Republic (possibly only vagrants), Estonia, Finland, France, Georgia, Greece, India, Iraq, Islamic Republic of Iran, Italy, Japan, Kazakhstan, Democratic People’s Republic of Korea, Kyrgyzstan, Latvia, the Former Yugoslav Republic of Macedonia, Mongolia, Montenegro, Nepal, Norway, Pakistan, Poland, Romania, Russian Federation, Serbia, Slovakia, Slovenia, Spain, Sweden, Tajikistan, Turkey, Turkmenistan, Ukraine, United States, and Uzbekistan. The species has become Extinct during past 500 years in Algeria, Egypt, Germany, Hungary, Israel, Lebanon, Liechtenstein, Lithuania, Mexico, Moldova, Morocco, Palestinian Territory (Occupied), Portugal, San Marino, Switzerland, and Syrian Arab Republic. Extinctions due to human agency have taken place more than 500 years ago in Belgium, Denmark, Ireland, Jordan, Luxembourg, Monaco, Netherlands, Tunisia, United Kingdom, and the Vatican.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Brown bears once ranged throughout northern and central Europe, Asia, the Atlas mountains of Morocco and Algeria, and western North America as far south as Mexico. They are now found in extremely small numbers from western Europe and Palestine to eastern Siberia and the Himalayan region, possibly the Atlas Mountains of northwest Africa, and Hokkaido. Northern North American populations in Alaska and western Canada remain fairly stable. Many populations in the United States are now locally extinct, including those of the Sierra Nevada, southern Rockies, and Northern Mexico.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Ursus arctos once ranged throughout northern and central Europe, Asia, the Atlas mountains of Morocco and Algeria, and western North America as far south as Mexico. They are now found in extremely small numbers from western Europe and Palestine to eastern Siberia and the Himalayan region, possibly the Atlas Mountains of northwest Africa, and Hokkaido. Northern North American populations in Alaska and western Canada remain fairly stable. Many populations in the United States have been extirpated, including those of the Sierra Nevada and southern Rockies. Northern Mexican populations were extirpated in the 1960's.

Biogeographic Regions: nearctic (Native ); palearctic (Native )

Other Geographic Terms: holarctic

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Historic Range:
Holarctic

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

One of the largest of living carnivores, brown bears are 1 to 2.8 meters in length from head to rump and their tails are 65 to 210 mm long. They are 90 to 150 cm tall at the shoulder and can tower at an intimidating height of 8 feet when standing upright on their hind legs. They range in weight from 80 to more than 600 kg. On average, adult males are 8 to 10% larger than females. Brown bears are largest along the the coast of southern Alaska and on nearby islands where males average 389 kg and females average 207 kg, though some males have been weighed at as much as 780 kg. Size rapidly declines to the north and east, with individuals in southwestern Yukon weighing only 140 kg on average. Fur is usually dark brown, but varies from cream to almost black. Individuals in the Rocky Mountains have long hairs along the shoulders and back which are frosted with white, giving a grizzled appearance, hence the common name grizzly bear in that region. Brown bears are extremely strong and have good endurance; they can kill a cow with one blow, outrun a horse, outswim an Olympian, and drag a dead elk uphill.

Range mass: 80 to 600 kg.

Range length: 1 to 2.8 m.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

One of the largest of living carnivores, grizzly bears are 1 to 2.8 meters in length from head to rump and their tails are 65 to 210 mm long. They are 90 to 150 cm tall at the shoulder and can tower at an intimidating height of 8 feet when standing upright on their hind legs. They range in weight from 80 to more than 600 kg. On average, adult males are 8 to 10% larger than females. Ursus arctos is largest along the the coast of southern Alaska and on nearby islands where males average 389 kg and females average 207 kg, though some males have been weighed at as much as 780 kg. Distance between the canines is from 6 to 8 cm. Size rapidly declines to the north and east, with individuals in southwestern Yukon weighing only 140 kg on average. Fur is usually dark brown, but varies from cream to almost black. Individuals in the Rocky Mountains have long hairs along the shoulders and back which are frosted with white, giving a grizzled appearance, hence the common name grizzly bear in that region. Brown bears are extremely strong and have good endurance; they can kill a cow with one blow, outrun a horse, outswim an Olympian, and drag a dead elk uphill.

Range mass: 80 to 600 kg.

Range length: 1 to 2.8 m.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 213 cm

Weight: 680000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are 8%-10% larger than females.

Length:
Average: "1.28 m "

Weight:
Average: 389 kg males; 207 kg females
Range: 80->600 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from black bear in being larger as an adult and by having a hump above the shoulders and a concave (rather than straight or convex) facial profile.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Ursus arctos
Catalog Number: USNM A6551
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): R. MacFarlane
Year Collected: 1863
Locality: Fort Anderson, 50 Mi Below, On Anderson River, Mackenzie District, Northwest Territories, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 216643
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Year Collected: 1889
Locality: Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A3837
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Sacramento River, Between Colusa And Sacramento, "Probably", California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 187891
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Sitka, Near, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 203198
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skull
Collector(s): C. Finley & J. Means
Year Collected: 1890
Locality: Davis Mountains, Jeff Davis County, Texas, United States, North America
  • Type: Merriam, C. H. 1914. Proc. Biol. Soc. Wash. 27: 191.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 203185
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Mills
Locality: Estes Park, Larimer County, Colorado, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 223991
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): J. Thompson
Year Collected: 1916
Locality: Liard River, Upper; Near British Columbia Boundary, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 176297
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull; Skeleton
Collector(s): G. Anderson
Year Collected: 1913
Locality: Locality Unknown
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 205186
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Year Collected: 1914
Locality: Admiralty Island, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 202794
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): C. Cross
Year Collected: 1913
Locality: Tatletuey Lake, Near Head Of Skeena River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 206136
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): Collector Unknown
Year Collected: 1914
Locality: Clearwater Creek, =A N Branch Of Stikine River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 248691
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Holzworth
Year Collected: 1928
Locality: Black River Head, Talkeetna Mountains, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 206625
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Farley
Locality: Long Valley, Near, N Of Sherwood, Mendocino County, California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 122495
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): Collector Unknown
Year Collected: 1903
Locality: Knick Arm, Head; Cook Inlet, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 203805
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Blue River, Summit County, Colorado, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype for Ursus arctos
Catalog Number: USNM A990
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Clark
Locality: Rio Mimbres, Old Copper Mines Near; Near Present Location Of Georgetown, Grant County, New Mexico, United States, North America
  • Lectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 239992
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Cast
Collector(s): F. Lambart
Year Collected: 1912
Locality: Yukon Boundary, 50 Mi S Of Arctic Coast, Alaska, United States, North America
  • Type: Merriam, C. H. 1914. Proc. Biol. Soc. Wash. 27: 177.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 221599
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): F. Enevoldsen
Year Collected: 1916
Locality: Ross River, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A2086
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Kennerly
Year Collected: 1855
Locality: Los Nogales, Mountains Near, Sonora, Mexico, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 215477
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): F. Enevoldsen
Year Collected: 1915
Locality: Ketza Divide, Pelly Mountains, Pelly River, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 99657
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): H. Cluff
Year Collected: 1899
Locality: Colonia Garcia, Chihuahua, Mexico, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 210576
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Edwards
Year Collected: 1915
Locality: Atnarko River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 67391
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Collector Unknown
Locality: Little Bighorn River, Near Head; N Part Of Bighorn Mtns., Carbon County, Montana, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A15671
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Rothrock & H. Henshaw
Year Collected: 1875
Locality: Havilah, Near; Southern Sierra Nevada, Kern County, California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 137471
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): C. Catt
Year Collected: 1905
Locality: Admiralty Island, Green'S Bay, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 206529
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Hubrick
Year Collected: 1914
Locality: Lakina Rier, South Slope Of Wrangell Range, S. Of Copper River, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 223275
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Axelson
Year Collected: 1916
Locality: Italio River, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 176591
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): A. Hasselborg
Year Collected: 1911
Locality: Berners Bay, E Side Of Lynn Canal, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 222102
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): E. Anderson
Year Collected: 1916
Locality: Mount Taylor, Near; Canyon 12 Mi E San Mateo Manzano National Forest, Valencia County, New Mexico, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 205170
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Hurst
Year Collected: 1914
Locality: Seldirk Mountains, Upper Columbia River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 133231
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): W. Osgood
Year Collected: 1903
Locality: Tanana Mountains, Glacier Mountain; 2 Mi Below Source Comet Creek, Near Forty-Mile Creek, Between, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 54793
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): B. Bretherton
Year Collected: 1893
Locality: Kodiak Island, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 206595
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): H. Anderson
Year Collected: 1915
Locality: Yellowstone National Park, Slough Creek, Wyoming, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 179780
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Ball
Year Collected: 1886
Locality: Golofnin Bay, S Side Of Seward Peninsula, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 205185
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): D. Rice
Year Collected: 1913
Locality: Wenatche National Forest, Township 30 N, Range 16 E, Willamette Meridian; E Slope Cascade Mtns., Chelan County, Washington, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 179893
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Rungius
Year Collected: 1910
Locality: Athabaska River, Headwaters, Alberta, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 222983
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): A. Rogers
Year Collected: 1890
Locality: Greybull River, High; Absaroka Mountains, Wyoming, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A15707
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Derry
Year Collected: 1876
Locality: Twin Lake, Lake County, Colorado, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 81102
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): G. Emmons
Year Collected: 1896
Locality: Admiralty Island, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 178763
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull
Collector(s): G. Norton
Year Collected: 1910
Locality: Yakutat, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 137318
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Sheldon
Year Collected: 1905
Locality: Montague Island, Prince William Sound, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 116562
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): J. Kidder
Year Collected: 1901
Locality: Chinitna Bay, Cook Inlet, Alaska Peninsula, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 179066
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Clark
Year Collected: 1912
Locality: Chichagof Island, Near Freshwater Bay, Alaska, United States, North America
  • Type: 1914 Aug 13. Proc. Biol. Soc. Washington. 27: 175.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 76470
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): R. Neumann
Year Collected: 1894
Locality: Shaktolik River, Norton Sound, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 225473
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): W. Drury
Year Collected: 1916
Locality: Upper Macmillan River, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 223133
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): F. Johnstone & F. Johnstone
Year Collected: 1916
Locality: Jervis Inlet, On River At Head, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 211748
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): F. Manseu
Year Collected: 1916
Locality: Jervis Inlet, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 210705
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): W. Mackay & G. Dippie
Year Collected: 1915
Locality: Champagne Landing, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 187888
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): R. Leigh
Year Collected: 1874
Locality: Teton River, N Fork, Fremont County, Idaho, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype for Ursus arctos
Catalog Number: USNM A3630
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): A. Taylor
Locality: Monterey, Monterey County, California, United States, North America
  • Lectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 210252
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Darbey
Year Collected: 1915
Locality: British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 212436
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): B. Lilly
Year Collected: 1913
Locality: Blue, A Few Mi W; Whorton Creek, S Slope Of White Mountains, Greenlee County, Arizona, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 128672
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull
Collector(s): C. Lambert
Year Collected: 1903
Locality: Kenai Peninsula, Extreme W End; Cape Elizabeth, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 158813
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull
Collector(s): C. Sheldon
Year Collected: 1908
Locality: Toklat River, Head; N Base Of Alaska Range; Near Mount Mckinley, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A3500
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): H. Mollhausen
Locality: Fort Defiance (=Mollhausen), Near, Arizona, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 205160
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): T. Dixon
Year Collected: 1913
Locality: Donjek River, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 180193
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): M. Martenson
Year Collected: 1911
Locality: Salina Creek, N Fork, 10-12 Mi SE Of Mayfield, Sanpete County, Utah, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 160155
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): H. Stewart & S. Piper
Locality: San Onofre Canyon, Santa Ana Mountains, San Diego County, California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A13289
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull; Skeleton
Collector(s): F. Hayden
Locality: Colorado, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 222323
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): G. Hill
Year Collected: 1916
Locality: Beaverfoot Range, Kootenay District, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 209889
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): W. Spaulding
Year Collected: 1914
Locality: Admiralty Island, Near Hawk Inlet, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 211452
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Edwards
Year Collected: 1915
Locality: Atnarko River: One of Upper Forks of Bella Coola, Lonesome Lake, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 177332
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Shinn
Year Collected: 1911
Locality: Escudilla Mountains, E Side, Apache National Forest, Apache County, Arizona, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 217426
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): W. Rindsfoos
Year Collected: 1916
Locality: Jack Pine River, Head, Near Mt. Bess, Near British Columbia Boundary, Alberta, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 171049
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): E. Richardson
Year Collected: 1907
Locality: Klappan Creek, =Third S Fork, Stikine River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 75048
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): A. Johnson
Year Collected: 1895
Locality: Yakutat Bay, NW Side, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 181089
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skin; Skull
Collector(s): P. Kleineidam
Locality: Eothen, Sundance National Forest, Black Hills, Crook County, Wyoming, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 178735
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): Edson
Locality: Beswick, E End Siskiyou Mountains, Siskiyou County, California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 187887
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Fannin
Year Collected: 1893
Locality: Pemberton (=Lillooet) Lake, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM A3536
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Xantus
Locality: Fort Tejon, Tehachapi Mountains, Kern County, California, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 180280
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): A. Hasselborg
Year Collected: 1912
Locality: Bartlett Bay, E Side Glacier Bay, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 203030
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Mounted Head
Collector(s): G. Shiras
Year Collected: 1913
Locality: Admiralty Island, Pybus Bay, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 91669
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): W. Pavlof
Year Collected: 1897
Locality: Pavlof Bay, Alaska Peninsula, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 210708
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): W. Mackay & G. Dippie
Year Collected: 1914
Locality: Columbia Valley, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 146459
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): C. Swanson
Year Collected: 1905
Locality: Hinchinbrook Island, Prince William Sound, Head Of Nuchek Bay, Alaska, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 75612
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Loring
Year Collected: 1895
Locality: Jasper House, Alberta, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lectotype for Ursus arctos
Catalog Number: USNM 76466
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): R. Neumann
Year Collected: 1895
Locality: Unalaklik River, Alaska, United States, North America
  • Lectotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 179928
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): G. Norton
Year Collected: 1906
Locality: Klappan Creek, =Third S Fork Of Stikine River, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 213005
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): J. Mcguire
Year Collected: 1913
Locality: Absaroka Mountains, Shoshone River, N Fork; Between Bighorn Basin And Yellowstone Nat'L. Park, Wyoming, United States, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 204188
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull
Collector(s): T. Smith & G. Geddis
Year Collected: 1914
Locality: Mcconnell River, Yukon, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 174511
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skin; Skull
Collector(s): N. Hollister & C. Walcott
Year Collected: 1911
Locality: Moose Pass, Near Mount Robson, British Columbia, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Ursus arctos
Catalog Number: USNM 8706
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull; Skeleton
Collector(s): Macfarlane
Year Collected: 1864
Locality: Rendezvous Lake, NE Of Fort Anderson, Mackenzie District, Northwest Territories, Canada, North America
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Montana Valley and Foothill Grasslands Habitat

This taxon can be found in the Montana valley and foothill grasslands ecoregions, along with some other North American ecoregions. This ecoregion occupies high valleys and foothill regions in the central Rocky Mountains of Montana in the USA and Alberta, Canada. The ecoregion the uppermost flatland reaches of the Missouri River drainage involving part of the Yellowstone River basin, and extends into the Clark Fork-Bitterroot drainage of the Columbia River system. The ecoregion, consisting of three chief disjunctive units, also extends marginally into a small portion of northern Wyoming. Having moderate vertebrate species richness, 321 different vertebrate taxa have been recorded here.

The dominant vegetation type of this ecoregion consists chiefly of wheatgrass (Agropyron spp.) and fescue (Festuca spp.). Certain valleys, notably the upper Madison, Ruby, and Red Rock drainages of southwestern Montana, are distinguished by extensive sagebrush (Artemisia spp.) communities as well. This is a reflection of semi-arid conditions caused by pronounced rain shadow effects and high elevation. Thus, near the Continental Divide in southwestern Montana, the ecoregion closely resembles the nearby Snake/Columbia shrub steppe.

A number of mammalian species are found in the ecoregion, including: American Pika (Ochotona princeps), a herbivore preferring talus habitat; Bighorn Sheep (Ovis canadensis), Black-tailed Prairie Dog (Cynomys ludovicianus), who live in underground towns that may occupy vast areas; Brown Bear (Ursos arctos); Hoary Marmot (Marmota caligata), a species who selects treeless meadows and talus as habitat; and the Northern River Otter (Lontra canadensis), a species that can tolerate fresh or brackish water and builds its den in the disused burrows of other animals.

There are six distinct anuran species that can be found in the Montana valleys and foothills grasslands, including: Canadian Toad (Anaxyrus hemiophrys); Western Toad (Anaxyrus boreas); Northern Leopard Frog (Lithobates pipiens); Plains Spadefoot Toad (Spea bombifrons); Columbia Spotted Frog (Rana luteiventris), an anuran that typically breeds in shallow quiet ponds; and the Boreal Chorus Frog (Pseudacris maculata).

Exactly two amphibian taxa occurr in the ecoregion: Long-toed Salamander (Ambystoma macrodactylum), a species who prefers lentic waters and spends most of its life hidden under bark or soil; Tiger Salamander (Ambystoma tigrinum).

Reptilian species within the ecoregion are: Milk Snake (Lampropeltis triangulum), an adaptable taxon that can be found on rocky slopes, prairie and near streambeds; Painted Turtle (Chrysemys picta); Western Plains Garter Snake (Thamnophis radix), a taxon that can hibernate in the burrows of rodents or crayfish or even hibernate underwater; Yellow-bellied Racer (Coluber constrictor); Spiny Softshell Turtle (Apalone spinifera); Western Terrestrial Garter Snake (Thamnophis elegans); Rubber Boa (Charina bottae); Western Skink (Plestiodon skiltonianus); and the Western Rattlesnake (Crotalis viridis).

The ecoregion supports endemic and relict fisheries: Westslope Cutthroat Trout (Oncorhynchus clarki lewisi), Yellowstone Cutthroat Trout (Oncorhynchus clarkii bouvieri), and fluvial Arctic Grayling (Thymallus arcticus), a relict species from past glaciation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Arizona Mountains Forests Habitat

This taxon is found in the Arizona Mountain Forests, which extend from the Kaibab Plateau in northern Arizona to south of the Mogollon Plateau into portions of southwestern Mexico and eastern Arizona, USA. The species richness in this ecoregion is moderate, with vertebrate taxa numbering 375 species. The topography consists chiefly of steep foothills and mountains, but includes some deeply dissected high plateaus. Soil types have not been well defined; however, most soils are entisols, with alfisols and inceptisols in upland areas. Stony terrain and rock outcrops occupy large areas on the mountains and foothills.

The Transition Zone in this region (1980 to 2440 m in elevation) comprises a strong Mexican fasciation, including Chihuahua Pine (Pinus leiophylla) and Apache Pine (P. engelmannii) and unique varieties of Ponderosa Pine (P. ponderosa var. arizonica). Such forests are open and park-like and contain many bird species from Mexico seldom seen in the U.S.. The Canadian Zone (above 2000 m) includes mostly Rocky Mountain species of mixed-conifer communities such as Douglas-fir (Pseudotsuga menziesii), Engelmann Spruce (Picea engelmanni), Subalpine Fir (Abies lasiocarpa), and Corkbark Fir (A. lasiocarpa var. arizonica). Dwarf Juniper (Juniperus communis) is an understory shrubby closely associated with spruce/fir forests. Exposed sites include Chihuahua White Pine (Pinus strobiformis), while disturbed north-facing sites consists primarily of Lodgepole Pine (Pinus contorta) or Quaking Aspen (Populus tremuloides).

There are a variety of mammalian species found in this ecoregion, including the endemic Arizona Gray Squirrel (Sciurus arizonensis), an herbivore who feeds on a wide spectrum of berries, bark and other vegetable material. Non-endemic mammals occurring in the ecoregion include: the Banner-tailed Kangaroo Rat (Dipodomys spectabilis NT); Desert Pocket Gopher (Geomys arenarius NT). In addition, there is great potential for restoring Mexican Wolf (Canis lupus) and Grizzly Bear (Ursus arctos horribilis) populations in the area because of its remoteness and juxtaposition to other ecoregions where these species were formerly prevalent.

There are few amphibians found in the Arizona mountain forests. Anuran species occurring here are: Red-spotted Toad (Anaxyrus punctatus); Southwestern Toad (Anaxyrus microscaphus); New Mexico Spadefoot Toad (Spea multiplicata); Woodhouse's Toad (Anaxyrus woodhousii); Northern Leopard Frog (Lithobates pipiens); Chiricahua Leopard Frog (Lithobates chiricahuensis VU); Madrean Treefrog (Hyla eximia), a montane anuran found at the northern limit of its range in this ecoregion; Boreal Chorus Frog (Anaxyrus woodhousii); Western Chorus Frog (Pseudacris triseriata); and Canyon Treefrog (Hyla arenicolor). The Jemez Mountains Salamander (Plethodon neomexicanus NT) is an ecoregion endemic, found only in the Jemez Mountains of Los Alamos and Sandoval counties, New Mexico. Another salamander occurring in the ecoregion is the Tiger Salamander (Ambystoma tigrinum).

A number of reptilian taxa occur in the Arizona mountains forests, including: Gila Monster (Heloderma suspectum NT), often associated with cacti or desert scrub type vegetation; Narrow-headed Garter Snake (Thamnophis rufipunctatus), a near-endemic found chiefly in the Mogollon Rim area; Sonoran Mud Turtle (Kinosternon sonoriense NT).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan & World Wildlife Fund

Supplier: C. Michael Hogan

Trusted

Article rating from 2 people

Average rating: 3.0 of 5

Comments: Now found mostly in arctic tundra, alpine tundra, and subalpine mountain forests. Once found in a wide variety of habitats including: open prairie, brushlands, riparian woodlands, and semidesert scrub. Ranges widely at the landscape level. Most populations require huge areas of suitable habitat. Common only where food is abundant and concentrated (e.g., salmon runs, caribou calving grounds). Typically digs own hibernation den, usually on steep northern slope where snow accumulates. See LeFranc et al. (1987).

Young are born in den in cave, crevice, hollow tree, hollow dug under rock, or similar site. Use of summit or ridge for mating (in May-June) reported for Banff National Park, Alberta, but not elsewhere (Hamer and Herrero 1990). In the Northwest Territories, Canada, all dens were on well-drained slopes; the majority of dens faced south (25), followed by west (13), east (10), and north (8); most dens were constructed under cover of tall shrubs (Betula glandulosa and Salix), the root structures of which supported ceilings of dens; esker habitat was selected more than expected by chance (McLoughlin et al. 2002).

In Spain, remnant deciduous forests and upland creek drainages were prime feeding areas (Clevenger et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Brown bears occupy a great variety of habitats from dry Asian steppes to Arctic shrublands to temperate rain forests. Their range overlaps that of both the American and Asiatic black bear (U. americanus, U. thibetanus), and also slightly that of the polar bear (U. maritimus). Elevationally they range from sea level to 5,000 m asl (Sathyakumar 2006). They occupy a greater diversity of habitats than any other species of bear and also exploit a large variety of food items. In terms of diet, they fall between the mainly plant-dependent ursids and the carnivorous polar bear (Mattson 1998, Sacco and Van Valkenburgh 2004). In North America, brown (grizzly) bears are more carnivorous where ungulates (especially in Arctic areas) or spawning salmon (coastal areas) are abundant (Mowat and Heard 2006).

The productivity and density of brown bears varies enormously, corresponding with the productivity of their habitats. Coastal areas of North America and Eastern Russia, with concentrations of spawning salmon, have high densities (>10 bears per 100 km²) of brown bears (Miller et al. 1997, Seryodkin 2006) with high reproductive rates (Hilderbrand et al. 1999). Deciduous and mixed forests of the Dinaric and Carpathian mountain ranges of Eastern Europe also host high bear densities with high reproductive rates (Kusak and Huber 1998, Frković et al. 2001). More moderate densities of bears occur across the interior mountain ranges of North America (McLellan 1994, Schwartz et al. 2003), Europe, and Asia where they forage on a great variety of grasses, herbs, roots, berries, nuts, as well as animal matter such as insects, mammals, and fish if available. Moderate densities of bears are also found across portions of the boreal forests of North American, Asia and Scandinavia (Bellemain et al. 2005). Lower densities are found in dry, desert-like areas, alpine and sub-alpine areas, as well as areas where habitat availability and numbers of bears have been reduced by high human and domestic livestock densities (Nawaz 2007); however, in most such areas (e.g., northern India, western China, Mongolia) density estimates are not available.

Breeding occurs during May to July but implantation of the blastocyst is delayed until late autumn. Cubs, usually in litters of 1 to 3 (rarely 4 or more), are born in January or early February when the mother is hibernating. In North America, female bears generally have their first litters at 5 to 8 years of age and have litters every 3 or 4 years thereafter (Schwartz et al. 2003). In some areas of Europe, however, females generally have their first litter at least one year earlier, and produce litters every two years (Swenson et al. 2000, Frković et al. 2001).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brown bears occupy a variety of habitats, from desert edges to high mountain forests and ice fields. In North America they seem to prefer open areas such as tundra, alpine meadows, and coastlines. Historically, they were common on the Great Plains prior to the arrival of European settlers. In Siberia, brown bears occur primarily in forests, while European populations are restricted mainly to mountain woodlands. The main habitat requirement for brown bears is some area with dense cover in which they can shelter by day.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brown bears occupy a variety of habitats, from desert edges to high mountain forests and ice fields. In North America they seem to prefer open areas such as tundra, alpine meadows, and coastlines. Historically, they were common on the Great Plains prior to the arrival of European settlers. In Siberia, Ursus arctos occurs primarily in forests, while European populations are restricted mainly to mountain woodlands. The main habitat requirement for Ursus arctos is some area with dense cover in which it can shelter by day.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

In North America, often exhibits discrete elevational movements from spring to fall, following seasonal food availability (LeFranc et al. 1987); generally at lower elevations in spring, higher elevations in mid-summer and winter.

Home range exhibits much variation among different individuals, areas, and seasons; male range generally is larger than that of female; annual range varies from less than 25 sq km (Kodiak Island) to more than 2000 sq km (see LeFranc et al. 1987), generally several hundred sq km (Banci 1991, Pasitschniak-Arts 1993). Range from 2,000 to 60,000 hectares in Yellowstone, averaging 8,000 hectares (Craighead 1976); male home ranges in the Yukon averaged 41,400 hectares (Pearson 1975).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Opportunistic omnivore. In all areas, vegetal matter is a dominant portion of the diet. Feeds on carrion, fish (especially coastal populations), large and small mammals, insects, fruit, grasses, bark, roots, mushrooms, and garbage. May cache food (and guard it). In the Yellowstone region, ungulate remains were a major portion of early season scats; graminoids dominated in May and June, and whitebark pine seeds were most important in late season scats; berries composed a minor portion of scats in all seasons (Mattson et al. 1991). May feed on insect aggregations (e.g., army cutworm moths, ladybird beetles); in Shoshone National Forest, Yellowstone ecosystem, alpine insect aggregations are an important source of food, especially in the absence of high-quality foraging alternatives in July and August of most years (Mattson et al. 1991). In Waterton Lakes National Park, Alberta, main food was roots of HEDYSARUM SULPHURESCENS in spring and autumn, ERYTHRONIUM GRANDIFLORUM corms and green vegetation (mainly umbellifers) from June through early August; VACCINIUM fruits were important in late July and August (see Hamer et al. [1991] for further details). Sometimes preys on black bear and conspecifics (Mattson et al., 1992, J. Mamm. 73:422-425).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Brown bears are omnivorous, eating almost anything nutritious. Their diet changes with seasonal availability of different food sources. They eat a wide variety of plant foods, including grasses, sedges, roots, moss, and bulbs. Fruits, nuts, berries, bulbs, and tubers are taken extensively during summer and early autumn. They consume insects, fungi, and roots at all times of the year and also dig mice, ground squirrels, marmots, and other fossorial animals out of their burrows. Moth larvae have been demonstrated to be especially important sources of protein and fat when brown bears are putting on fat in the fall. In the Canadian Rockies and other areas, grizzly bears (the type of brown bear in that area) are quite carnivorous, hunting moose, elk, mountain sheep, and mountain goats. Occasionally black bears are preyed upon. In Alaska, brown bears have been observed to eat carrion and occasionally capture young calves of caribou and moose. Brown bears have also been observed to feed on vulnerable populations of breeding salmon in the summer in these areas.

Animal Foods: mammals; fish; carrion ; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit; bryophytes

Other Foods: fungus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Brown bears are omnivorous, eating almost anything nutritious. Their diet changes with seasonal availability of different food sources. They eat a wide variety of plant foods, including grasses, sedges, roots, moss, and bulbs. Fruits, nuts, berries, bulbs, and tubers are taken extensively during summer and early autumn. They consume insects, fungi, and roots at all times of the year and also dig mice, ground squirrels, marmots, and other fossorial animals out of their burrows. Moth larvae have been demonstrated to be especially important sources of protein and fat when brown bears are putting on fat in the fall. In the Canadian Rockies and other areas, grizzly bears (the subspecies of brown bear in that area) are quite carnivorous, hunting moose, elk, mountain sheep, and mountain goats. Occasionally black bears are preyed upon. In Alaska, brown bears have been observed to eat carrion and occasionally capture young calves of caribou and moose. Brown bears have also been observed to feed on vulnerable populations of breeding salmon in the summer in these areas.

Animal Foods: mammals; fish; carrion ; insects

Plant Foods: leaves; roots and tubers; seeds, grains, and nuts; fruit; bryophytes

Other Foods: fungus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Brown bears are important predators and seed dispersers in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Because of their size and aggressiveness towards threats, brown bears are not often preyed upon. Humans have persecuted them throughout recent history and some cubs may be attacked by other bears or by mountain lions or wolves, although this is very rare.

Known Predators:

  • humans (Homo_sapiens)
  • other brown bears (Ursus_arctos)
  • wolves (Canis_lupus)
  • mountain lions (Puma_concolor)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Brown bears are important predators and seed dispersers in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Because of their size and aggressiveness towards threats, brown bears are not often preyed upon. Humans have persecuted them throughout recent history and some cubs may be attacked by other bears or by mountain lions or wolves, although this is very rare.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Ursus arctos is prey of:
Homo sapiens

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Ursus arctos preys on:
alpine vegetation
Geomyidae
Marmota
Cervus elaphus
Odocoileus hemionus
Ovis canadensis
Arvicolinae
Spermophilus
invertebrates
Actinopterygii
Bryophyta
fungi
Insecta
Mammalia
Marmota broweri
Phoca largha
Rangifer tarandus
Alces alces

Based on studies in:
USA: Montana (Tundra)

This list may not be complete but is based on published studies.
  • D. L. Pattie and N. A. M. Verbeek, Alpine birds of the Beartooth Mountains, Condor 68:167-176 (1966); Alpine mammals of the Beartooth Mountains, Northwest Sci. 41(3):110-117 (1967).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: In North America, there are currently about 30,000-35,000 grizzly bears in Alaska, 21,660 in Canada, and 800-1000 in the lower 48 states. Population estimates for Asian grizzlies are unavailable. See Knick and Kasworm (1989), Brannon et al. (1988), Knight et al. (1988), Hayward (1989), and Keating (1989) for discussion of status and mortality patterns in Glacier and Yellowstone parks and in Idaho-Washington-British Columbia. As of the early 1990s, the Yellowstone population was estimated at 200-350 (Mattson and Reid 1991). USFWS (1990) noted that a record 57 cubs were born in the Yellowstone ecosystem in 1990. Northern Continental Divide population was estimated at 440-680 in 1985, unknown number in Selway-Bitterroot (probably fewer than 10) (Matthews and Moseley 1990). Selkirk recovery zone includes an estimated 46 bears, 19 in the U.S. and 27 in Canada (USFWS 1999). Cabinet-Yaak recovery zone supports 30-40 bears (conservative estimate) (USFWS 1999). Between 1964 and 1991, there were 21 credible reports of grizzly bears in the North Cascades south of Canada (Almack et al. 1993). Canada: Current populations (early 1990s) have been estimated at between 140 and 5680 (mainly 1000-3000) individuals in each of 12 grizzly bear zones in Canada; local populations probably are being overharvested (Banci 1991, which see for a detailed analysis of status in Canada). See also Macey (1979 COSEWIC report) for further information on status in Canada (population estimated at about 20,000, the majority in the Yukon and British Columbia).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

May congregate in areas with abundant food; otherwise solitary except when breeding or caring for young. Density estimates range from 1/1.5-4 sq km (Kodiak Island) to 1/50 sq km (Yellowstone) to 0.6-7.9/1000 sq km (Norway).

In the Yellowstone region, lack of berries and large fluctuations in the size of pine seed crops were major factors limiting bear density (Mattson et al. 1991).

In British Columbia-Montana, survivorship of adult and subadult females was the most important variable in estimating population trend.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Brown bears communicate primarily through smells and sounds. Brown bears can be heard making moaning noises sometimes while they are foraging. They scratch and rub on trees and other landmarks to let other bears know the boundaries of their territory.

Brown bears have an excellent sense of smell (able to follow the scent of a rotting carcass for more than two miles), human-level hearing, but relatively poor eyesight.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Brown bears communicate primarily through smells and sounds. Brown bears can be heard making moaning noises sometimes while they are foraging. They scratch and rub on trees and other landmarks to communicate territorial boundaries and reproductive status.

Brown bears have an excellent sense of smell (able to follow the scent of a rotting carcass for more than two miles), human-level hearing, but relatively poor eyesight.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Tends to be predominantly crepuscular with the least activity during midday, but much individual variation. Dormant in winter. In North America, usually enters den in October or November, emerges usually in April-May (some in late March in south). In the Northwest Territories, Canada, den entrance occurred primarily in last two weeks of October; the majority of bears emerged from dens in the first week of May (McLoughlin et al. 2002). The latest dates of den entrance in North America are on southwest Kodiak Island, Alaska, where mean dates of den entrance for males and females are in mid-November and early December, respectively (Van Daele et al. 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Brown bears in the wild can live for 20 to 30 years, although most brown bears die in their first few years of life. In captivity, brown bears have been known to live up to 50 years.

Range lifespan

Status: captivity:
50 (high) years.

Typical lifespan

Status: wild:
20 to 30 years.

Average lifespan

Status: captivity:
50.0 years.

Average lifespan

Status: captivity:
47.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Brown bears in the wild can live for 20 to 30 years, although most brown bears die in their first few years of life. In captivity, brown bears have been known to live up to 50 years.

Range lifespan

Status: captivity:
50 (high) years.

Typical lifespan

Status: wild:
20 to 30 years.

Average lifespan

Status: captivity:
50.0 years.

Average lifespan

Status: captivity:
47.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: The implantation of the fertilized eggs is usually delayed for about 4 months. It has been suggested that these animals may live up to 50 years (Ronald Nowak 1999), which is doubtful. These are common animals in zoos, and so far record longevity in captivity is about 40 years for one wild born female (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds in late spring and early summer. Implantation is delayed; gestation lasts about 184 days. Litter size is 1-4 (average 2). Young are born in winter, remain with mother usually the first two winters. Breeding interval generally is 2-4 years. In North America, first parturition occurs at 5-6 years in the south, 6-9 years in the north. A few live as long as 20-25 years. Long life span, late sexual maturity, protracted reproductive cycles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female brown bears mate with most of the males in the area in which they live. Males may fight over females and guard them for 1 to 3 weeks.

Mating System: polygynandrous (promiscuous)

Mating of brown bears takes place from May to July. The young begin to develop in the mother's uterus when she enters her winter sleep. Sometime between January and March, while the mother is still sleeping through the winter, 2 to 3 young are born. Female brown bears do not mate again until their young have become independent, usually 2 to 4 years after the birth of their cubs.  Brown bears become sexually mature at 4 to 6 years of age, but continue growing until 10 to 11 years old.

Breeding interval: Brown bear females typically breed every 2 to 4 years.

Breeding season: Breeding occurs from May to July.

Range number of offspring: 3 (high) .

Average number of offspring: 2.

Range gestation period: 180 to 266 days.

Range weaning age: 18 to 30 months.

Range time to independence: 2 to 3 years.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 510 g.

Average number of offspring: 2.

Young are born blind, helpless, and naked, weighing only 340 to 680 grams. By 3 months old cubs weigh about 15 kg, by 6 months weight averages 25 kg. Mothers nurse cubs for 18 to 30 months, although the cubs are eating a wide variety of other foods by about 5 months of age. Cubs remain with their mother until at least their second spring of life (usually until the third or fourth). Male brown bears do not help in raising young.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Female brown bears copulate with multiple males during estrus, which lasts 10 to 30 days. Males may fight over females and guard them for 1 to 3 weeks. Female receptivity is probably communicated by scent marking throughout her territory.

Mating System: polygynandrous (promiscuous)

Mating of brown bears takes place from May to July. Fertilized eggs develop to the blastocyt stage, after which implantation in the uterus is delayed. The blastocyt becomes implanted approximately 5 months after mating, usually in November when the female has entered her winter sleep. A 6 to 8 week gestation follows, with births occuring from January to March (usually while the female is still in hibernation). Total gestation time, including pre-implantation, ranges from 180 to 266 days. Females remain in estrus throughout the breeding season until mating occurs and do not ovulate again for at least 2 (usually 3 or 4) years after giving birth. Two to three offspring are generally born per litter.

Brown bears mature sexually between 4-6 years of age, but continue growing until 10-11 years old. Bears have been known to live and reproduce in Yellowstone Park at 25 years of age, and potential lifespan in captivity is as great as 50 years.

Breeding interval: Brown bear females typically breed every 2 to 4 years.

Breeding season: Breeding occurs from May to July.

Range number of offspring: 3 (high) .

Average number of offspring: 2.

Range gestation period: 180 to 266 days.

Range weaning age: 18 to 30 months.

Range time to independence: 2 to 3 years.

Range age at sexual or reproductive maturity (female): 4 to 6 years.

Range age at sexual or reproductive maturity (male): 4 to 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 510 g.

Average number of offspring: 2.

Young are born blind, helpless, and naked, weighing only 340 to 680 grams. By 3 months old cubs weigh about 15 kg, by 6 months weight averages 25 kg. Lactation continues for 18 to 30 months, although the cubs are eating a wide variety of foods by about 5 months of age. Cubs remain with the mother until at least their second spring of life (usually until the third or fourth). Male brown bears do not contribute parental care.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ursus arctos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAGCCGGTGATTATTCTCTACGAACCATAAAGACATTGGCACTCTTTACCTTCTGTTCGGTGCATGAGCCGGAATAGTGGGCACTGCCCTCAGCCTTTTAATTCGTGCCGAGCTGGGTCAGCCCGGGGCTCTGTTGGGGGATGATCAGATCTACAATGTAATCGTAACTGCCCATGCATTCGTGATAATCTTCTTCATAGTTATGCCTATTATAATTGGGGGATTCGGGAACTGATTAGTGCCCTTGATGATCGGTGCTCCCGACATAGCGTTCCCTCGAATAAATAACATAAGCTTCTGGTTGCTGCCACCATCTTTCTTACTGCTTCTGGCCTCCTCTATGGTAGAAGCAGGTGCAGGGACTGGATGAACTGTCTATCCTCCTCTAGCGGGTAATCTGGCCCATGCAGGAGCATCGGTAGACTTAACAATCTTTTCTCTGCACCTAGCAGGCATCTCTTCTATTCTGGGGGCTATCAATTTCATCACTACTATTGTTAACATGAAACCCCCTGCAATATCTCAATATCAAACCCCTCTGTTTGTATGATCAGTCCTAATCACAGCAGTACTTCTTCTTTTATCTCTACCAGTCTTAGCGGCTGGAATTACTATACTACTTACAGATCGAAACCTTAACACTACCTTTTTTGATCCAGCTGGAGGAGGAGACCCTATTTTATATCAACACTTGTTCTGATTCTTCGGACATCCTGAGGTTTACATTCTAATCCTTCCTGGGTTCGGAATGATCTCTCACATTGTCACTTATTATTCAGGAAAAAAAGAACCTTTTGGCTATATAGGAATAGTCTGAGCGATAATATCCATTGGATTCTTAGGATTTATCGTGTGAGCTCATCATATGTTTACCGTAGGTATAGACGTTGACACACGAGCTTACTTCACTTCAGCTACCATAATCATTGCTATCCCGACAGGAGTCAAAGTATTTAGCTGACTAGCCACTCTGCACGGAGGGAATATTAAATGATCTCCCGCTATGATGTGAGCCCTGGGCTTTATCTTCCTGTTTACAGTAGGAGGCCTTACAGGAATTGTCCTAGCTAATTCATCTCTAGACATCGTTCTCCATGACACGTACTATGTGGTAGCCCATTTTCACTACGTGCTGTCAATGGGAGCTGTTTTCGCCATCATAGGAGGATTTGCCCACTGATTCCCACTATTTTCAGGCTACACACTTAACAACACATGAGCAAAAATTCACTTTATAATTATATTCATCGGGGTTAATATGACATTCTTTCCTCAGCATTTTCTAGGCCTGTCAGGAATACCTCGGCGATATTCCGACTATCCAGATGCCTATACAACATGAAACACAGTATCTTCTATAGGCTCATTTATTTCACTAACAGCAGTTATGCTAATAATTTTCATGATTTGGGAGGCCTTTGCATCAAAACGAGAGGTGGCAGTGGTAGAACTCACCTCAACCAACATTGAATGACTACATGGATGCCCTCCTCCATATCACACATTCGAAGAACCTGCCTACGTCACACTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ursus arctos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 23
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Has disappeared over much of Holarctic range, and continues to decline in the face of habitat alienation, alteration, and loss, as well as increased human access to wilderness; low reproductive rate limits recovery rate; stable populations occur in some large wilderness areas; protection and management are necessary for long-term survival.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
McLellan, B.N., Servheen, C. & Huber, D. (IUCN SSC Bear Specialist Group)

Reviewer/s
McLellan, B.N. & Garshelis, D.L. (Bear Red List Authority)

Contributor/s

Justification
The range of the brown bear has declined in North America, Europe, and Asia, and the species has been extirpated in North Africa. However, it remains widespread across three continents, and is still one of the world’s most widely distributed terrestrial mammals. Globally the population remains large, and is not significantly declining. There are many small, isolated populations that are in jeopardy of extirpation, but others, under more protection, are expanding.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed: Mexico


Population detail:

Population location: Mexico
Listing status: E

For most current information and documents related to the conservation status and management of Ursus arctos , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Their conservation status depends on the population. Some populations are clearly endangered, others are not. Brown bear numbers have dropped dramatically since the turn of the century, when settlers and livestock flooded the West, driving these bears out of much of their former range. Brown bears now cling to a mere 2 per cent of their former range. Logging, mining, road construction, resorts, subdivisions, golf courses, etc. have all encroached on suitable bear habitat, resulting in a decrease in bear numbers. Brown bear numbers were estimated at 100,000 in the conterminous United States in the early 1900's, but there are now fewer than 1,000. Brown bears are still fairly common in the mountainous regions of western Canada and Alaska, perhaps numbering about 30,000 individuals. In Eurasia there are an estimated 100,000 brown bears, with about 70,000 of those living in the Soviet Union. However, habitat destruction and persecution threaten brown bears throughout their range. A growing market in bear products for the Asian market, despite a complete lack of evidence that products made from bear parts have any medical value, threatens bear species throughout Eurasia and western North America.

IUCN Red List of Threatened Species: least concern

US Federal List: endangered

CITES: appendix i

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Their conservation status depends on the population. Some populations are clearly endangered, others are not. Brown bear numbers have dropped dramatically since the turn of the century, when settlers and livestock flooded the West, driving these bears out of much of their former range. Brown bears now cling to a mere 2 per cent of their former range. Logging, mining, road construction, resorts, subdivisions, golf courses, etc. have all encroached on suitable bear habitat, resulting in a decrease in bear numbers. Brown bear numbers were estimated at 100,000 in the conterminous United States in the early 1900's, but there are now fewer than 1,000. Brown bears are still fairly common in the mountainous regions of western Canada and Alaska, perhaps numbering about 30,000 individuals. In Eurasia there are an estimated 100,000 brown bears, with about 70,000 of those living in the Soviet Union. However, habitat destruction and persecution threaten brown bears throughout their range. A growing market in bear products for the Asian market, despite a complete lack of evidence that products made from bear parts have any medical value, threatens bear species throughout Eurasia and western North America.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

The Mexican Grizzly Bear, Ursus arcos nelsoni, is Extinct.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: Declining in most areas. See Knick and Kasworm (1989), Brannon et al. (1988), Knight et al. (1988), Hayward (1989), and Keating (1989) for discussion of status and mortality patterns in Glacier and Yellowstone parks and in Idaho-Washington-British Columbia. As of the early 1990s, the Yellowstone population was stable, but "optimism over prospects of long-term persistence...does not seem warranted" (Mattson and Reid 1991). Eberhardt et al. (1994) employed data on reproductive and survival rates to conclude that the Yellowstone population may be increasing. USFWS (1990) noted that a record 57 cubs were born in the Yellowstone ecosystem in 1990. Yellowstone population was reported as stable or slightly increasing in the 1980s by Blanchard et al. (1992). A population model presented by Dennis et al. (1991) suggested that the Yellowstone population is doomed to extinction in the long term. Recent trend in Glacier population is debatable. Populations in the Cabinet-Yaak/Selkirk ecosystem appear to be responding to protective measures that reduce mortality. Population trends are inconclusive (USFWS 1999). In the western Carpathians of Europe, excessive killing by human decreased the population to about 40 in 1932; subsequent protection led to an increase to about 700 in the early 1990s (Hartl and Hell 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The total world population of brown bears is estimated to exceed 200,000. Reliable population estimates (derived mainly from mark-recapture or resight, and modifications thereof) exist for several areas in North America and Europe (Miller et al. 1997, Swenson et al. 2000, Bellemain et al. 2005, Mowat et al. 2005), but few areas in Asia. Russia has the largest number of brown bears, believed to exceed 100,000, while estimates in the U.S. are around 33,000, Canada 25,000, and Europe (excluding Russia) 14,000.

Whereas the species is relatively abundant in more northern parts of its distribution, the southern portions of the range are highly fragmented, with many small populations. In North America, the southern fringe has isolated populations ranging in size from over 500 in and around Yellowstone National Park (U.S. Fish and Wildlife Service 2005) to approximately 15 individuals in the Cabinet Mountains of Montana (Proctor et al. 2004).

In southern Europe there are several extremely small, isolated populations: two populations in the Pyrenees (France and Spain) each have <10 bears, two populations in the Cantabrian Mountains (Spain) contain 20-30 and 80-100 bears, a population in the Appenine Mountains (Italy) has 40-50 bears, and the Alps (Italy, Austria, and Slovenia) has 35-40 bears (Swenson et al. 2000; http://www.largecarnivores.maverik.ch/bear-ois/index.htm).

Small populations of brown bears are also scattered across many portions of Asia, but little is known of numbers or connectivity. In Pakistan there are an estimated 150–200 bears in seven separate populations in the Himalaya, Karakoram and Hindu Kush Ranges, only one of which has more than 20 individuals (Nawaz 2007). In India, brown bears exist in 23 protected areas in the northern states of Jammu and Kashmir, Himachal Pradesh, and Uttaranchal, but they are regarded as fairly common in only two of these; country-wide there are likely <1,000 individuals, and possibly half that (Sathyakumar 2006). In China, brown bears exist is sparse, poorly defined populations in the west and also in the northeast, with guesstimates of ~6,000 and ~1,000 in each of these regions, respectively (Gong and Harris 2006). A more dense population on Hokkaido, Japan may have 2,000+ brown bears, although even there, where significant information has been collected through research and sport harvest returns, reliable population estimates are not available (Mano 2006).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Historical decline due to habitat loss and fragmentation and killing by humans. Primary threats are habitat alienation, alteration, and loss; increased access to wilderness; and hunting (both legal and illegal). Increased access increases human-bear contacts, some of which result in destruction of bears. Alien species threaten food resources in some areas; in Montana, white pine blister rust has killed whitebark pines (seeds serve as food for bears) and knapweed have displaced native plants that serve as foods for bears and their prey. See Horejsi (1989) for a discussion of land-use threats (petroleum and natural gas development, grazing by domestic stock) and excessive bear mortality in southwestern Alberta. See also Matthews and Moseley (1990) for discussion of threats. Basic problem in the Cabinet-Yaak/Selkirk ecosystem is reduced habitat availability due to land use by humans and increased human access into habitat; this results in increased bear mortality. Access management plans have addressed this problem to some degree but have not been fully implemented (USFWS 1999). Several large mines in Montana, if approved, may pose a threat (USFWS 1999). Forestry, mining, recreation, and road building also affect habitat in British Columbia where the two portions of this distinct population segment are connected (USFWS 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Although, as a whole, this species is secure, with relatively large numbers and an expansive range, several small, isolated populations are threatened due to their low numbers and frequent contact with humans. These small populations tend to be found in remnant wild areas surrounded by more extensive human development. As wide-ranging omnivores, brown bears are attracted to areas with available human-related foods; being large and somewhat aggressive, these bears may threaten life and property (often agricultural products) and may be killed as a consequence. Areas of high human use that attract bears may serve as significant mortality sinks (Nielsen et al. 2004, 2006). Additionally, bears living near humans may be killed inadvertently (e.g., vehicle or train collisions) or poached for parts or products: even small numbers of bears removed from small populations can have adverse effects on population growth (Wakkinen and Kasworm 2004); conversely, preventing just a few deaths may avert a population decline (Wiegand et al. 1998, Garshelis et al. 2005).

Even where brown bears exist in a large, contiguous population, they are sometimes hunted for sport or killed for control purposes at unsustainable rates. Estimates of sustainable exploitation rates are hampered by the difficulty and expense of obtaining reliable estimates of population size. Many countries do not have the resources to develop, implement, or enforce adequate monitoring programs and sustainable management plans for brown bears. Moreover, even with such plans in place, illegal take may equal or exceed the legal take. This is apparently occurring in the Russian Far East, where brown bears are poached for the commercial trade in gall bladders and paws (Seryodkin 2006).

In addition to direct removal of brown bears, many human activities such as agriculture, plantation forestry, highways, hydroelectric developments, and human settlements eliminate, fragment, or erode the value of bear habitat (Proctor et al. 2005, Waller and Servheen 2005). Habitat fragmentation is a serious threat that isolates population units with deleterious demographic and genetic impacts (Proctor et al. 2004). With increasing human populations, the value of brown bear habitat is being degraded in many areas (e.g., Can and Togan 2004, Nawaz 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Peek et al. (1987), Darling and Archibald (1990), and especially LeFranc et al. (1987) for reviews of conservation and management. See Banci (1991) for a detailed discussion of management issues in Canada, especially hunting, waste management, education, and park management. See Servheen and Sandstrom (1993) for a discussion of ecosystem management and linkage zones for grizzly bears and other large carnivores in the northern Rocky Mountains.

Intensive management is needed in peripheral areas where populations may need to be protected, supplemented, and/or reintroduced to wilderness habitat that still exists.

Translocation of nuisance bears has been only partially successful in Yellowstone area (see Brannon 1987). See Maguire and Servheen (1992) for a discussion of biological and sociological concerns relevant to population augmentation through translocation of bears from a larger population to a smaller one. Allendorf et al. (1992) examined genetic data and computer simulations and concluded that many extant populations can be maintained only by intensive management that includes movement of bears among currently isolated populations.

Best management strategy: elimination of human-associated food sources that attract bears and often result in mortality (Knight et al. (1988), and maintenance of intact wilderness systems. Management should be conservative and not unduly swayed by short-term positive trends (Mattson and Reid 1991).

See Herrero (1985) for information on prevention of attacks on humans.

In 1993, USFWS announced the availability for public review of the draft Bitterroot Ecosystem (Idaho, Montana) and North Cascades (Washington) chapters of the grizzly bear recovery plan; similar chapters already have been completed for the other ecosystems where grizzly bears still exist in the lower 48 states.

Recently revised recovery plan is controversial among bear biologists; an alternative plan has been authored under the aegis of The Wilderness Society (1994, Science 263:599).

A draft environmental impact statement for grizzly bear recovery in the Bitterroot Ecosystem was available in July 1997 (USFWS 1997). See Roy and Fischer (1995) for an overview of the recovery approach in the Bitterroot ecosystem.

Draft habitat-based recovery criteria for the Yellowstone ecosystem were available in July 1999 (contact Grizzly Bear Recovery Coordinator, University of Montana, Missoula; FW6_grizzly@fws.gov).

Biological Research Needs: Further genetic research needed to clarify the taxonomic relationships of coastal, island and other populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Even relatively large parks may be ineffective in protecting populations if many individuals use land outside park boundaries. About 95 percent of the habitat in the Cabinet-Yaak/Selkirk ecosystem is in public ownership (USFWS 1999).

Needs: Bears and habitat need to be protected in core areas throughout their range. A draft environmental impact statement for grizzly bear recovery in the Bitterroot Ecosystem was available in July 1997 (USFWS 1997). For the Cabinet-Yaak/Selkirk ecosystem, maintain habitat connectivity in Canada (USFWS 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Conservation actions for brown bears vary greatly among nations and regions within nations. Large populations of this species (in Russia, Japan, Canada, Alaska, and parts of eastern and northern Europe) are legally hunted, and thus managed as a game animal. Hunting regulations designed to ensure a sustainable harvest of bears vary among areas but often involve a lottery for a limited number of permits, a quota system, and restricted season length.

Most small populations are legally protected by national laws and international agreements, with varying degrees of enforcement. All international trade in brown bears is restricted by either CITES I (in parts of central Asia) or CITES II. In parts of the U.S., small populations of grizzly bears have successfully rebounded under protection of the Endangered Species Act (U.S. Fish and Wildlife Service 2005). Reintroductions and population augmentations also have helped to restore numbers and geographic range in several locations in the U.S. and Western Europe (Servheen et al. 1994, Clark et al. 2002).

This species is considered a priority for survey work in Afghanistan with so little current data and information available on its status in the region. It has also been placed on Afghanistan’s Protected Species List, prohibiting all hunting and trade of this species within Afghanistan.

There are numerous protected areas around the world with brown bears, but few are large enough to support a viable population; therefore, brown bear conservation must be integrated with many other human land-uses (Herrero 1994, Nielsen et al. 2006). Some countries have rules or management guidelines designed to reduce human impacts on brown bears and their habitat, whereas in other countries bear management protocols and regulations are limited or nonexistent (Servheen et al. 1999, Zedrosser et al. 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Brown bears have been long considered the most dangerous animal in North America, although real danger of attack from this animal is often exaggerated. In general, brown bears attempt to avoid human contact and will not attack unless startled at close quarters with young or engrossed in a search for food. They are unpredictable in temperament, however, and often exhibit impulsive and petulant behavior.

Brown bears have been persecuted extensively as predators of domestic livestock, especially cattle and sheep, although their actual impact on the livestock industry is probably negligible.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Brown bears have been widely sought as big game trophies and are currently subject to regulated sport hunting throughout much of their range. Once brown bears were used for their meat and hides but these products are not currently in high commercial demand. Some bear body parts (such as gall bladders) bring high prices on the traditional Asian medicine market, although no true medicinal benefit of these parts has ever been documented.

Currently, brown bears help to fuel an ecotourism industry, especially in areas such as Yellowstone National Park, Wyoming and parts of Alaska.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Brown bears have been long considered the most dangerous animal in North America, although real danger of attack from this animal is often exaggerated. In general, brown bears attempt to avoid human contact and will not attack unless startled at close quarters with young or engrossed in a search for food. They are unpredictable in temperament, however, and often exhibit impulsive and petulant behavior.

Brown bears have been persecuted extensively as predators of domestic livestock, especially cattle and sheep, although their actual impact on the livestock industry is probably negligible.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Brown bears have been widely sought as big game trophies and are currently subject to regulated sport hunting throughout much of their range. Once brown bears were used for their meat and hides but these products are not currently in high commercial demand. Some bear body parts (such as gall bladders) bring high prices on the traditional Asian medicine market, although no true medicinal benefit of these parts has ever been documented.

Currently, brown bears help to fuel an ecotourism industry, especially in areas such as Yellowstone National Park, Wyoming and parts of Alaska.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Grizzly bear

For the dance, see Grizzly Bear (dance).
"Grizzly" redirects here. For the 1976 film, see Grizzly (1976 film). For the 2014 film, see Grizzly (2014 film).

The grizzly bear (Ursus arctos ssp.) is any North American subspecies of the brown bear, including the mainland grizzly (Ursus arctos horribilis), the Kodiak bear (U. a. middendorffi), the peninsular grizzly (U. a. gyas) and the recently extinct California grizzly (U. a. californicus†)[1] and Mexican grizzly bear (U. a. nelsoni†). Specialists sometimes call the grizzly the North American brown bear because the grizzly and the brown bear are one species on two continents.[1] In some places, the grizzly is nicknamed the silvertip bear for the silvery, grizzled sheen in its fur.

Since the mainland grizzly is so widespread, it is representative and archetypal for the whole subspecific group. Even so, classification is being revised along genetic lines.[1] Except for females with cubs,[2] grizzlies are normally solitary, active animals, but in coastal areas, grizzlies gather around streams, lakes, rivers, and ponds during the salmon spawn. Every other year, females (sows) produce one to four young (usually two)[3] which are small and weigh only about 500 grams (1 lb). A sow is protective of her offspring and will attack if she thinks she or her cubs are threatened.

Classification[edit]

Meaning of "grizzly"[edit]

The word "grizzly" means "grizzled"; that is, golden and grey tips of the hair. This is not to be confused with the word "grisly". Nonetheless, after careful study, naturalist George Ord formally classified the California grizzly in 1815—not for its hair, but for its character—Ursus horribilis.[4] Thus Ord made a famous pun. Indeed there were many accounts of grizzlies fighting and beating longhorn bulls.[5]

Evolution and genetics[edit]

The ancestors of the grizzly bear subspecies were brown bears originating in Eurasia that traveled to North America approximately 50,000 years ago.[6] This is a very recent event, on an evolutionary timescale, causing the North American grizzly bear to be very similar to brown bears inhabiting Siberia and northeast Asia. The closest Eurasian subspecies to the grizzly bears are believed to be the Ussuri brown bear (U. a. lasiotus) for mainland grizzlies and the Kamchatka brown bear (U. a. beringianus) for the coastal Alaskan and Kodiak bears which arrived in North America shortly before the bering land bridge flooded.

When it received its scientific name in 1815, the grizzly was classified as a separate species from all other bears. However, modern genetic testing reveals the grizzly to be a subspecies of the brown bear (Ursus arctos). So in Eurasia, it is the "brown bear"; in North America, it is the "grizzly".

In other words, the grizzly and the brown bear are one species on two continents. Currently, Rausch and others classify three subspecies of the new "North American brown bear": U. a. horribilis, middendorffi, and gyas. But more recent studies of mtDNA suggest that this three-fold division of living grizzlies needs revision. Further testing of Y-chromosomes is required to yield an accurate new taxonomy with different subspecies.[1]

Coastal grizzlies, often referred to by the popular but geographically redundant synonym of "brown bear" or "Alaskan brown bear" are larger and darker than inland grizzlies, which is why they, too, were considered a different species from grizzlies. Kodiak grizzly bears were also at one time considered distinct. Thus, at one time there were five different "species" of brown bear, including three in North America.[7]

Appearance[edit]

Most adult female grizzlies weigh 130–200 kg (290–440 lb), while adult males weigh on average 180–360 kg (400–790 lb). The average total length in this subspecies is 198 cm (6.50 ft), with an average shoulder height of 102 cm (3.35 ft) and hindfoot length of 28 cm (11 in).[8] Newborn bears may weigh less than 500 grams (1.1 lb). In the Yukon River area, mature female grizzlies can weigh as little as 100 kg (220 lb). One study found that the average weight for an inland male grizzly was around 270 kilograms (600 lb) and the average weight for a coastal male was around 408 kilograms (900 lb). For a female, these average weights would be 136 kilograms (300 lb) inland and 227 kilograms (500 lb) coastal, respectively.[9] On the other hand, an occasional huge male grizzly has been recorded which greatly exceeds ordinary size, with weights reported up to 680 kg (1,500 lb).[10] A large coastal male of this size may stand up to 3 metres (9.8 ft) tall on its hind legs and be up to 1.5 metres (4.9 ft) at the shoulder.[11] Although variable from blond to nearly black, grizzly bear fur is typically brown in color with white tips.[12] A pronounced hump appears on their shoulders; the hump is a good way to distinguish a black bear from a grizzly bear, as black bears do not have this hump.

Range and population[edit]

Brown bear in Katmai National Park with partially eaten salmon - the heads, skin and subcutaneous tissue are eaten to obtain the most fat

Brown bears are found in Asia, Europe, and North America giving them one of the widest ranges of bear species. In North America, grizzly bears previously ranged from Alaska down to Mexico and as far east as the western shores of Hudson Bay.[6] In North America, the species is now found only in Alaska, south through much of western Canada, and into portions of the northwestern United States including Idaho, Montana, Washington and Wyoming, extending as far south as Yellowstone and Grand Teton National Parks, but is most commonly found in Canada. In Canada, there are approximately 25,000 grizzly bears occupying British Columbia, Alberta, the Yukon, the Northwest Territories, Nunavut, Ontario and the northern part of Manitoba.[6] In British Columbia, grizzly bears inhabit approximately 90% of their original territory. There were approximately 25,000 grizzly bears in British Columbia when the European settlers arrived.[6] However, population size significantly decreased due to hunting and habitat loss. In 2008, it was estimated there were 16,014 grizzly bears. Population estimates for British Columbia are based on hair-snagging, DNA-based inventories, mark-recapture and a refined multiple regression model.[13] In 2003 researches from the University of Alberta spotted a grizzly on Melville Island (Northwest Territories and Nunavut) in the high arctic, which is the most northerly sighting ever documented.[citation needed]

The Alaskan population of 30,000 individuals is the highest population of any province/state in North America. Populations in Alaska are densest along the coast, where food supplies such as salmon are more abundant.[14] The Admiralty Island National Monument protects the densest population — 1,600 bears on a 1,600-square mile island.[15]

Continental United States[edit]

Only about 1,500 grizzlies are left in the lower 48 states of the US.[16] Of these, about 800 live in Montana.[17] About 600 more live in Wyoming, in the Yellowstone-Teton area.[18] There are an estimated 70–100 grizzly bears living in northern and eastern Idaho. Its original range included much of the Great Plains and the southwestern states, but it has been extirpated in most of those areas. Combining Canada and the United States, grizzly bears inhabit approximately half the area of their historical range.[6]

In September 2007, a hunter produced evidence of grizzly bears returning to the Selway-Bitterroot Wilderness ecosystem, on the central Idaho and western Montana border, by killing a male grizzly bear there.[19] In northern Washington Grizzly bears have been sighted returning to the North Cascades ecosystem though the population there is estimated to be only 5–10 bears. There is the possibility that Grizzlies may begin repopulating in Colorado, although there has been no confirmed sighting of a grizzly in that state since 1979.[20]

Other provinces and the United States may use a combination of methods for population estimates. Therefore, it is difficult to say precisely what methods were used to produce total population estimates for Canada and North America, as they were likely developed from a variety of studies. The grizzly bear currently has legal protection in Mexico, European countries, some areas of Canada and in the United States. However, it is expected that repopulating its former range will be a slow process, due to a variety of reasons including the bear's slow reproductive habits and the effects of reintroducing such a large animal to areas prized for agriculture and livestock. Competition with competing predators and predation on cubs is another possible limiting factor for grizzly bear recovery, though grizzly bears also benefit from scavenged carcasses from predators as an easy food source when other food sources decline. There are currently about 55,000 wild grizzly bears total located throughout North America most of which reside in Alaska.[6]

Longevity[edit]

The grizzly bear is by nature a long-living animal. Females live longer than males due to their less dangerous life, avoiding the seasonal breeding fights males engage in. The average lifespan for a male is estimated at 22 years, with that of a female being slightly longer at 26.[21] The oldest wild inland grizzly was 34 years old in Alaska; the oldest coastal bear was 39.[22] Captive grizzlies have lived as long as 44 years, but most grizzlies inevitably die in their first few years of life from predation or hunting.[23]

Hibernation[edit]

Grizzly bears hibernate for 5–7 months each year.[24] During this time, female grizzly bears give birth to their offspring, who then consume milk from their mother and gain strength for the remainder of the hibernation period.[25] To prepare for hibernation, grizzlies must prepare a den, and consume an immense amount of food as they do not eat during hibernation. Grizzly bears do not defecate or urinate throughout the entire hibernation period. The male grizzly bear's hibernation ends in early to mid March, while females emerge in April or early May.[26]

In preparation for winter, bears can gain approximately 180 kg (400 lb), during a period of hyperphagia, before going into hibernation.[27] The bear often waits for a substantial snowstorm before it enters its den: such behavior lessens the chances predators will find the den. The dens are typically at elevations above 1,800 m (5,900 ft) on north-facing slopes.[28] There is some debate amongst professionals as to whether grizzly bears technically hibernate: much of this debate revolves around body temperature and the ability of the bears to move around during hibernation on occasion. Grizzly bears can "partially" recycle their body wastes during this period.[29] Although inland or Rocky Mountain grizzlies spend nearly half of their life in dens, coastal grizzlies with better access to food sources spend less time in dens. In some areas where food is very plentiful year round, grizzly bears skip hibernation altogether.[30]

Reproduction[edit]

Sow with two cubs

Grizzly bears have one of the lowest reproductive rates of all terrestrial mammals in North America.[31] This is due to numerous ecological factors. Grizzly bears do not reach sexual maturity until they are at least five years old.[6][32] Once mated with a male in the summer, the female delays embryo implantation until hibernation, during which miscarriage can occur if the female does not receive the proper nutrients and caloric intake.[33] On average, females produce two cubs in a litter[32] and the mother cares for the cubs for up to two years, during which the mother will not mate.[6] Once the young leave or are killed, females may not produce another litter for three or more years, depending on environmental conditions.[34] Male grizzly bears have large territories, up to 4,000 km2 (1,500 sq mi),[31] making finding a female scent difficult in such low population densities.

Grizzlies are subject to population fragmentation, which tends to reduce the population by causing inbreeding depression. The gestation period for grizzly bears is approximately 180–250 days.

Litter size is between one and four cubs, averaging twins or triplets. Cubs are always born in the mother's winter den while she is in hibernation. Female grizzlies are fiercely protective of their cubs, being able to fend off predators as large as male bears bigger than they are in defense of the cubs.[35] Cubs feed entirely on their mother's milk until summer comes, after which they still drink milk but begin to eat solid foods.[36] Cubs gain weight rapidly during their time with the mother — their weight will have ballooned from 4.5 to 45 kg (10 to 99 lb) in the two years spent with the mother. Mothers may see their cubs in later years but both avoid each other.[37]

Diet[edit]

Grizzly bear fishing for salmon at Brooks Falls, Alaska
Mother grizzly with a cub

Although grizzlies are of the order Carnivora and have the digestive system of carnivores, they are normally omnivores: their diets consist of both plants and animals. They have been known to prey on large mammals, when available, such as moose, elk, caribou, white-tailed deer, mule deer, bighorn sheep, bison, and even black bears; though they are more likely to take calves and injured individuals rather than healthy adults. Grizzly bears feed on fish such as salmon, trout, and bass, and those with access to a more protein-enriched diet in coastal areas potentially grow larger than inland individuals. Grizzly bears also readily scavenge food or carrion left behind by other animals.[38] Grizzly bears will also eat birds and their eggs, and gather in large numbers at fishing sites to feed on spawning salmon. They frequently prey on baby deer left in the grass, and occasionally they raid the nests of raptors such as bald eagles.[39]

Canadian or Alaskan grizzlies are larger than those that reside in the American Rocky Mountains. This is due, in part, to the richness of their diets. In Yellowstone National Park in the United States, the grizzly bear's diet consists mostly of whitebark pine nuts, tubers, grasses, various rodents, army cutworm moths, and scavenged carcasses.[40] None of these, however, match the fat content of the salmon available in Alaska and British Columbia. With the high fat content of salmon, it is not uncommon to encounter grizzlies in Alaska weighing 540 kg (1,200 lb).[41] Grizzlies in Alaska supplement their diet of salmon and clams with sedge grass and berries. In areas where salmon are forced to leap waterfalls, grizzlies gather at the base of the falls to feed on and catch the fish. Salmon are at a disadvantage when they leap waterfalls because they cluster together at their bases and are therefore easier targets for the grizzlies.[42] Grizzly bears are well-documented catching leaping salmon in their mouths at Brooks Falls in Katmai National Park and Preserve in Alaska. They are also very experienced in chasing the fish around and pinning them with their claws.[43][44] At such sites such as Brooks Falls and McNeil Falls in Alaska, big male grizzlies fight regularly for the best fishing spots.[45] Grizzly bears along the coast also forage for razor clams, and frequently dig into the sand to seek them.[46] During the spring and fall, directly before and after the salmon runs, berries and grass make up the mainstay of the diets of coastal grizzlies.[47]

Inland grizzlies may eat fish too, most notably in Yellowstone grizzlies eating Yellowstone cutthroat trout.[48] The relationship with cutthroat trout and grizzlies is unique because it is the only example where Rocky Mountain grizzlies feed on spawning salmonid fish.[48] However, grizzly bears themselves and invasive lake trout threaten the survival of the trout population and there is a slight chance that the trout will be eliminated.[49]

Meat, as already described, is an important part of a grizzly's diet. Grizzly bears occasionally prey on small mammals, such as marmots, ground squirrels, lemmings, and voles.[50] The most famous example of such predation is in Denali National Park and Preserve, where grizzlies chase, pounce on, and dig up Arctic ground squirrels to eat.[51] In some areas, grizzly bears prey on hoary marmots, overturning rocks to reach them, and in some cases preying on them when they are in hibernation.[52] Larger prey includes bison and moose, which are sometimes taken by bears in Yellowstone National Park. Because bison and moose are dangerous prey, grizzlies usually use cover to stalk them and/or pick off weak individuals or calves.[53][54] Grizzlies in Alaska also regularly prey on moose calves, which in Denali National Park may be their main source of meat. In fact, grizzly bears are such important predators of moose and elk calves in Alaska and in Yellowstone, that they may kill as many as 51 percent of elk or moose calves born that year. Grizzly bears have also been blamed in the decline of elk in Yellowstone National Park when the actual predators were thought to be gray wolves.[55][56][57][58][59] In northern Alaska, grizzlies are a significant predator of caribou, mostly taking sick or old individuals or calves.[60] Several studies show that grizzly bears may follow the caribou herds year-round in order to maintain their food supply.[61][62] In northern Alaska, grizzly bears often encounter muskox. Despite the fact that muskox do not usually occur in grizzly habitat and that they are bigger and more powerful than caribou, predation on muskox by grizzlies has been recorded.[63]

Grizzly bears along the Alaskan coast also scavenge on dead or washed up whales.[64] Usually such incidents involve only one or two grizzlies at a carcass, but up to ten large males have been seen at a time eating a dead humpback whale. Dead seals and sea lions are also consumed.[65]

Although the diets of grizzly bears vary extensively based on seasonal and regional changes, plants make up a large portion of them, with some estimates as high as 80–90%.[66] Various berries constitute an important food source when they are available. These can include blueberries, blackberries (Rubus fruticosus), salmon berries (Rubus spectabilis), cranberries (Vaccinium oxycoccus), buffalo berries (Shepherdia argentea), and huckleberries (Vaccinium parvifolium), depending on the environment. Insects such as ladybugs, ants, and bees are eaten if they are available in large quantities. In Yellowstone National Park, grizzly bears may obtain half of their yearly caloric needs by feeding on miller moths that congregate on mountain slopes.[67] When food is abundant, grizzly bears will feed in groups. For example, many grizzly bears will visit meadows right after an avalanche or glacier slide. This is due to an influx of legumes, such as Hedysarum, which the grizzlies consume in massive amounts.[68] When food sources become scarcer, however, they separate once again.

Interspecific competition[edit]

Grizzly bear cub in Western Canada

With the reintroduction of gray wolves to Yellowstone, many visitors have witnessed a once common struggle between a keystone species, the grizzly bear, and its historic rival, the gray wolf. The interactions of U. arctos horribilis with the wolves of Yellowstone have been under considerable study. Typically, the conflict will be in the defense of young or over a carcass, which is commonly an elk killed by wolves.[69] The grizzly bear uses its keen sense of smell to locate the kill. As the wolves and grizzly compete for the kill, one wolf may try to distract the bear while the others feed. The bear then may retaliate by chasing the wolves. If the wolves become aggressive with the bear, it is normally in the form of quick nips at its hind legs. Thus, the bear will sit down and use its ability to protect itself in a full circle. Rarely do interactions such as these end in death or serious injury to either animal. One carcass simply is not usually worth the risk to the wolves (if the bear has the upper hand due to strength and size) or to the bear (if the wolves are too numerous or persistent).[70] While wolves usually dominate grizzly bears during interactions at wolf dens, both grizzly and black bears have been reported killing wolves and their cubs at wolf dens even when the latter was in defense mode.[71][72]

Black bears generally stay out of grizzly territory, but grizzlies may occasionally enter black bear terrain to obtain food sources both bears enjoy, such as pine nuts, acorns, mushrooms, and berries. When a black bear sees a grizzly coming, it either turns tail and runs or climbs a tree. Black bears are not strong competition for prey because they have a more herbivorous diet. Confrontations are rare because of the differences in size, habitats, and diets of the bear species. When this happens, it is usually with the grizzly being the aggressor. The black bear will only fight when it is a smaller grizzly such as a yearling or when the black bear has no other choice but to defend itself. There is at least one confirmed observation of a grizzly bear digging out, killing and eating a black bear when the latter was in hibernation.[73]

The segregation of black bear and grizzly bear populations is possibly due to competitive exclusion. In certain areas, grizzly bears outcompete black bears for the same resources.[74] For example, many Pacific coastal islands off British Columbia and Alaska support either the black bear or the grizzly, but rarely both.[75] In regions where both species coexist, they are divided by landscape gradients such as age of forest, elevation and openness of land. Grizzly bears tend to favor old forests with high productivity, higher elevations and more open habitats compared with black bears.[74]

The relationship between grizzly bears and other predators is mostly one-sided; grizzly bears will approach feeding predators to steal their kill. In general, the other species will leave the carcasses for the bear to avoid competition or predation. Any parts of the carcass left uneaten are scavenged by smaller animals.[76] Cougars generally give the bears a wide berth. Grizzlies have less competition with cougars than with other predators, such as coyotes, wolves, and other bears. When a grizzly descends on a cougar feeding on its kill, the cougar usually gives way to the bear. When a cougar does stand its ground, it will use its superior agility and its claws to harass the bear, yet stay out of its reach until one of them gives up. Grizzly bears occasionally kill cougars in disputes over kills.[77] There have been several accounts, primarily from the late 19th and early 20th centuries, of cougars and grizzly bears killing each other in fights to the death.[78]

Coyotes, foxes, and wolverines are generally regarded as pests to the grizzlies rather than competition, though they may compete for smaller prey, such as ground squirrels and rabbits. All three will try to scavenge whatever they can from the bears. Wolverines are aggressive enough to occasionally persist until the bear finishes eating, leaving more than normal scraps for the smaller animal.[76] Packs of coyotes have also displaced grizzly bears in disputes over kills.[79]

Ecological role[edit]

The grizzly bear has several relationships with its ecosystem. One such relationship is a mutualistic relationship with fleshy-fruit bearing plants. After the grizzly consumes the fruit, the seeds are dispersed and excreted in a germinable condition. Some studies have shown germination success is indeed increased as a result of seeds being deposited along with nutrients in feces.[80] This makes grizzly bears important seed distributors in their habitats.[81]

While foraging for tree roots, plant bulbs, or ground squirrels, bears stir up the soil. This process not only helps grizzlies access their food, but also increases species richness in alpine ecosystems.[82] An area that contains both bear digs and undisturbed land has greater plant diversity than an area that contains just undisturbed land.[82] Along with increasing species richness, soil disturbance causes nitrogen to be dug up from lower soil layers, and makes nitrogen more readily available in the environment.[83] An area that has been dug by the grizzly bear has significantly more nitrogen than an undisturbed area.

Nitrogen cycling is not only facilitated by grizzlies digging for food, it is also accomplished via their habit of carrying salmon carcasses into surrounding forests.[84] It has been found that spruce tree (Picea glauca) foliage within 500 m (1,600 ft) of the stream where the salmon have been obtained contains nitrogen originating from salmon on which the bears preyed.[85] These nitrogen influxes to the forest are directly related to the presence of grizzly bears and salmon.[86]

Grizzlies directly regulate prey populations and also help prevent overgrazing in forests by controlling the populations of other species in the food chain.[87] An experiment in Grand Teton National Park in Wyoming in the United States showed removal of wolves and grizzly bears caused populations of their herbivorous prey to increase.[88] This, in turn, changed the structure and density of plants in the area, which decreased the population sizes of migratory birds.[88] This provides evidence grizzly bears represent a keystone predator, having a major influence on the entire ecosystem they inhabit.[87]

When grizzly bears fish for salmon along the coasts of Alaska and British Columbia, they often only eat the skin, brain and roe of the fish. In doing so, they provide a food source for gulls, ravens, and foxes, all or which eat salmon as well; this benefits both the bear and the smaller predators.[89]

Conflicts with humans[edit]

A rough and tumble with a grizzly by H. Bullock Webster, watercolor

Grizzlies are considered by some experts to be more aggressive than black bears when defending themselves and their offspring.[90] Aggressive behavior in grizzly bears is favored by numerous selection variables. Unlike the smaller black bears, adult grizzlies are too large to escape danger by climbing trees, so they respond to danger by standing their ground and warding off their attackers. Increased aggressiveness also assists female grizzlies in better ensuring the survival of their young to reproductive age.[91] Mothers defending their cubs are the most prone to attacking, being responsible for 70% of fatal injuries to humans.[92] Historically, bears have competed with other large predators for food, which also favors increased aggression.

Campers are warned to hang food, garbage, and toiletries out of reach of bears, or to use a secure bear cache.

Grizzly bears normally avoid contact with people. In spite of their obvious physical advantages and many opportunities, they almost never view humans as prey; bears rarely actively hunt humans.[93] Most grizzly bear attacks result from a bear that has been surprised at very close range, especially if it has a supply of food to protect, or female grizzlies protecting their offspring. In such situations, property may be damaged and the bear may physically harm the person.[94]

Exacerbating this is the fact that intensive human use of grizzly habitat coincides with the seasonal movement of grizzly bears.[94] An example of this spatiotemporal intersection occurs during the fall season: grizzly bears congregate near streams to feed on salmon when anglers are also intensively using the river.

Increased human–bear interaction has created "problem bears", which are bears that have become adapted to human activities or habitat.[95] Aversive conditioning, a method involving using deterrents such as rubber bullets, foul-tasting chemicals or acoustic deterent devices to teach bears to associate humans with negative experiences, is ineffectual when bears have already learned to positively associate humans with food.[96] Such bears are translocated or killed because they pose a threat to humans. The B.C. government kills approximately 50 problem bears each year[96] and overall spends more than one million dollars annually to address bear complaints, relocate bears and kill them.[96]

For back-country campers, hanging food between trees at a height unreachable to bears is a common procedure, although some grizzlies can climb and reach hanging food in other ways. An alternative to hanging food is to use a bear canister.[97]

Traveling in groups of six or more can significantly reduce the chance of bear-related injuries while hiking in bear country.[98]

Grizzly bears are especially dangerous because of the strength of their bite, which has been measured at over 8 megapascals (1160 psi). It has been estimated that a bite from a grizzly could crush a bowling ball.[99]

Protection[edit]

The grizzly bear is listed as threatened in the contiguous United States and endangered in parts of Canada. In May 2002, the Canadian Species at Risk Act listed the Prairie population (Alberta, Saskatchewan and Manitoba range) of grizzly bears as being wiped out in Canada.[100] As of 2002, grizzly bears were listed as Special Concern under the COSEWIC registry[101] and considered threatened under the U.S. Fish and Wildlife Service.[102]

Within the United States, the U.S. Fish and Wildlife Service concentrates its effort to restore grizzly bears in six recovery areas. These are Northern Continental Divide (Montana), Yellowstone (Montana, Wyoming, and Idaho), Cabinet-Yaak (Montana and Idaho), Selway-Bitterroot (Montana and Idaho), Selkirk (Idaho and Washington), and North Cascades (Washington). The grizzly population in these areas is estimated at 750 in the Northern Continental Divide, 550 in Yellowstone, 40 in the Yaak portion of the Cabinet-Yaak, and 15 in the Cabinet portion (in northwestern Montana), 105 in Selkirk region of Idaho, 10–20 in the North Cascades, and none currently in Selway-Bitterroots, although there have been sightings.[103] These are estimates because bears move in and out of these areas, and it is therefore impossible to conduct a precise count. In the recovery areas that adjoin Canada, bears also move back and forth across the international boundary.

The U.S. Fish and Wildlife Service claims the Cabinet-Yaak and Selkirk areas are linked through British Columbia, a claim that is disputed.[104]

All national parks, such as Banff National Park, Yellowstone and Grand Teton, and Theodore Roosevelt National Park have laws and regulations in place to protect the bears. Even so, grizzlies are not always safe in parks. In Glacier National Park in Montana and Banff National Park in Alberta, grizzlies are regularly killed by trains as the bears scavenge for grain that has leaked from poorly maintained grain cars. Road kills on park roads are another problem. The primary limiting factors for grizzly bears in Alberta and elsewhere are human-caused mortality, unmitigated road access, and habitat loss, alienation, and fragmentation. In the Central Rocky Mountains Ecosystem, most bears have died within a few hundred meters of roads and trails.[105]

On 9 January 2006, the US Fish and Wildlife Service proposed to remove Yellowstone grizzlies from the list of threatened and protected species.[106] In March 2007, the U.S. Fish and Wildlife Service "de-listed" the population,[107] effectively removing Endangered Species Act protections for grizzlies in the Yellowstone National Park area. Several environmental organizations, including the NRDC, brought a lawsuit against the federal government to relist the grizzly bear. On September 22, 2009, U.S. District Judge Donald W. Molloy reinstated protection due to the decline of whitebark pine tree, whose nuts are a main source of food for the bears.[108] In 1996 the International Union for Conservation of Nature moved the grizzly bear to "Lower Risk Least Concern" status on the IUCN Red List.[109][110]

Farther north, in Alberta, Canada, intense DNA hair-snagging studies on 2000 showed the grizzly population to be increasing faster than what it was formerly believed to be, and Alberta Sustainable Resource Development calculated a population of 841 bears.[105] In 2002, the Endangered Species Conservation Committee recommended that the Alberta grizzly bear population be designated as threatened due to recent estimates of grizzly bear mortality rates that indicated the population was in decline. A recovery plan released by the Provincial government in March 2008 indicated the grizzly population is lower than previously believed.[111] In 2010, the Provincial government formally listed its population of about 700 grizzlies as "Threatened".[112]

Environment Canada consider the grizzly bear to a "special concern" species, as it is particularly sensitive to human activities and natural threats. In Alberta and British Columbia, the species is considered to be at risk.[113] In 2008, it was estimated there were 16,014 grizzly bears in the British Columbia population, which was lower than previously estimated due to refinements in the population model.[114]

The Mexican grizzly bear (Ursus arctos nelsoni) is extinct.[115]

Conservation efforts[edit]

Drum or barrel trap used to safely relocate bears adjacent to a building in Grand Teton National Park in Wyoming, United States

Conservation efforts have become an increasingly vital investment over recent decades, as population numbers have dramatically declined. Establishment of parks and protected areas are one of the main focuses currently being tackled to help reestablish the low grizzly bear population in British Columbia. One example of these efforts is the Khutzeymateen Grizzly Bear Sanctuary located along the north coast of British Columbia; at 44,300 hectares (109,000 acres) in size, it is composed of key habitat for this threatened species. Regulations such as limited public access, as well as a strict no hunting policy, have enabled this location to be a safe haven for local grizzlies in the area.[116] When choosing the location of a park focused on grizzly bear conservation, factors such as habitat quality and connectivity to other habitat patches are considered.

The Refuge for Endangered Wildlife located on Grouse Mountain in Vancouver is an example of a different type of conservation effort for the diminishing grizzly bear population. The refuge is a five-acre terrain which has functioned as a home for two orphaned grizzly bears since 2001.[117] The purpose of this refuge is to provide awareness and education to the public about grizzly bears, as well as providing an area for research and observation of this secluded species.

Another factor currently being taken into consideration when designing conservation plans for future generations are anthropogenic barriers in the form of urban development and roads. These elements are acting as obstacles, causing fragmentation of the remaining grizzly bear population habitat and prevention of gene flow between subpopulations (for example, Banff National Park). This, in turn, is creating a decline in genetic diversity, and therefore the overall fitness of the general population is lowered.[118] In light of these issues, conservation plans often include migration corridors by way of long strips of "park forest" to connect less developed areas, or by way of tunnels and overpasses over busy roads.[119] Using GPS collar tracking, scientists can study whether or not these efforts are actually making a positive contribution towards resolving the problem.[120] To date, most corridors are found to be infrequently used, and thus genetic isolation is currently occurring, which can result in inbreeding and therefore an increased frequency of deleterious genes through genetic drift.[121] Current data suggest female grizzly bears are disproportionately less likely than males to use these corridors, which can prevent mate access and decrease the number of offspring.

Bear-watching[edit]

In the past 20 years in Alaska, ecotourism has boomed. While many people come to Alaska to bear-hunt, the majority come to watch the bears and observe their habits. Some of the best bear viewing in the world occurs on coastal areas of the Alaska Peninsula, including in Lake Clark National Park and Preserve, Katmai National Park and Preserve, and the McNeil River State Game Sanctuary and Refuge. Here bears gather in large numbers to feast on concentrated food sources, including sedges in the salt marshes, clams in the nearby tidal flats, salmon in the estuary streams, and berries on the neighboring hillsides.

Bear catches a salmon at Brooks Falls

Katmai National Park and Preserve is one of the best spots to view brown bears. The bear population in Katmai is estimated at a healthy 2100.[122] The park is located on the Alaskan Peninsula about 480 km (300 mi) southwest of the city of Anchorage. At Brooks Camp, a famous site exists where grizzlies can be seen catching salmon from atop a platform—you can even view this online from a cam.[123] In coastal areas of the park, such as Hallo Bay, Geographic Harbor, Swikshak Lagoon, American Creek, Big River, Kamishak River, Savonoski River, Moraine Creek, Funnel Creek, Battle Creek, Nantuk Creek,[124] Kukak Bay, and Kaflia Bay you can often watch bears fishing alongside wolves, eagles, and river otters. Coastal areas host the highest population densities year round because there is a larger viariety of food sources available, but Brooks Camp hosts the highest population (100 bears).[125]

The McNeil River State Game Sanctuary and Refuge, on the McNeil River, is home to the greatest concentration of brown bears in the world. An estimated 144 individual bears have been identified at the falls in a single summer with as many as 74 at one time;[126] 60 or more bears at the falls is a frequent sight, and it is not uncommon to see 100 bears at the falls throughout a single day.[127] The McNeil River State Game Refuge, containing Chenik Lake and a smaller number of grizzly bears, has been closed to grizzly hunting since 1995.[128] All of the Katmai-McNeil area is closed to hunting except for Katmai National Preserve, where regulated legal hunting takes place.[129] In all, the Katmai-McNeil area has an estimated 2500 grizzly bears.[130]

Admiralty Island, in southeast Alaska, was known to early natives as Xootsnoowú, meaning "fortress of bears," and is home to the densest grizzly population in North America. An estimated 1600 grizzlies live on the island, which itself is only 140 km (90 mi) long.[131] The best place to view grizzly bears in the island is probably Pack Creek, in the Stan Price State Wildlife Sanctuary. 20 to 30 grizzlies can be observed at the creek at one time and like Brooks Camp, visitors can watch bears from an above platform.[132] Kodiak Island, hence its name, is another good place to view bears. An estimated 3500 Kodiak grizzly bears inhabit the island, 2300 of these in the Kodiak National Wildlife Refuge.[133][134] The O'Malley River is considered the best place on Kodiak Island to view grizzly bears.[135]

Hunting[edit]

Trophy hunting causes an imbalance between the sexes, as hunters target primarily older males for their size.[87] Older males' deaths allow other males to migrate in and claim the territory. Older male bears will have had cubs with female bears in the region. This may cause the newly migrated male bears to become infanticidal towards the late males' cubs.[118][136]

Grizzly bear hunting for the purpose of wildlife management is permitted in British Columbia, Canada. Approximately 1602 special hunting license "tags" were drawn for via lottery & sold throughout all of B.C. in 2012, by the Ministry of Forests, Lands and Natural Resource Operations (a provincial government department). The Canadian government website notes that killing female grizzly bears is detrimental to the re-population of the species, and encourages culling of males.

See also[edit]

References[edit]

  1. ^ a b c d e Schwartz, C. C., Miller, S. D. and Haroldson, M. A. (2003). "Grizzly bear". pp. 556–586 in G. A. Feldhamer, B. C. Thompson and J. A. Chapman, eds. Wild Mammals of North America: Biology, Management, and Conservation. Johns Hopkins University Press, Baltimore, MD.
  2. ^ Grizzly Bears, Grizzly Bear Pictures, Grizzly Bear Facts – National Geographic. Animals.nationalgeographic.com. Retrieved on 2012-08-17.
  3. ^ "Grizzly Bear". Bronx Zoo. 
  4. ^ "Grisly indeed, Grizzly Island was aptly named". Daily Republic. Retrieved 5 May 2011. 
  5. ^ "California vs Texas Longhorns". fairlealonghorns.com. 
  6. ^ a b c d e f g h Blood, D. A. (2002). "Grizzly Bears in British Columbia". Province of British Columbia: Ministry of Water, Land and Air Protection. 
  7. ^ Grizz: Of Men and the Great Bear. National Geographic Article, February 1986. Douglas H. Chadwick.
  8. ^ Grizzly or Brown Bear. The Mammals of Texas – Online Edition
  9. ^ "Brown Bear". Bear Trust International. 
  10. ^ Wood, G. The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc (1983), ISBN 978-0-85112-235-9
  11. ^ "Kodiak Bear Fact Sheet". Alaska Department of Fish and Game. Retrieved 2008-10-27. 
  12. ^ Species Profile: Grizzly bear (Ursus arctos horribilis). U.S. Fish and Wildlife Service. Ecos.fws.gov. Retrieved on 2012-08-17.
  13. ^ Hamilton, A. N. 2008 Grizzly Bear Population Estimate for British Columbia. Ministry of Environment, British Columbia
  14. ^ Rogers, Lynn. "Grizzly Attack – Timothy Treadwell". katmaibears.com. 
  15. ^ [1]
  16. ^ "Grizzly Bear Facts | National Geographic". National Geographic. Retrieved 13 March 2013. 
  17. ^ "Montanakids | Grizzly Bears". Montanakids. Retrieved 2007. 
  18. ^ "With Deadly Attacks Up, Federal Officials Prepare to Remove Grizzly Protections". outsideonline.com. Retrieved 18 April 2013. 
  19. ^ "Grizzly shot in Selway-Bitterroot". Missoulian website. 2007-09-12. 
  20. ^ "Wildlife Officials Hope Grizzly Bears Stay Out Of Colorado". CBS Denver. 23 May 2012. 
  21. ^ "Brown Bear – Ursus Arctos". National Park Service. Retrieved 29 December 2013. 
  22. ^ Brown, Gary. The Great Bear Almanac. Guilford, CT, 1993, pg. 91.
  23. ^ "Grizzly Bear Population Ecology and Monitoring Denali National Park and Preserve". National Park Service. 
  24. ^ Teel, John (2008). GrizzlyBay.org "Hibernation in grizzly bears". Retrieved 2013-09-26. 
  25. ^ "Grizzly Bear". Animal Fact Guide. Retrieved 2013-09-26. 
  26. ^ Hellgren, Eric (1998). "Physiology of hibernation in bears". Ursus 10: 467. 
  27. ^ ""Hibernation-Migration-Fascination" Narrative". National Park Service. Retrieved 6 July 2013. 
  28. ^ "Grizzly Bear Information, Photos, and Facts". American Expedition. 
  29. ^ "Denning and Hibernation Behavior". National Park Service. Retrieved 6 July 2013. 
  30. ^ Di Jensen, Elle. "When Are Grizzly Bears Awake & When Do They Sleep?". Demand Media. 
  31. ^ a b "Trophy Hunting of BC Grizzly Bears". Pacific Wild. Archived from the original on 2009-03-31. 
  32. ^ a b MacDonald, Jason; MacDonald, Paula; MacPhee, Mitchell & Nicolle, Paige. "Endangered Wildlife: Grizzly Bear". Edu.pe.ca. 
  33. ^ Herrero, Stephen. "Grizzly Bear". The Canadian Encyclopedia. 
  34. ^ "Assessment and Update Status Report on the Grizzly Bear Ursus arctos in Canada". Committee on the Status of Endangered Wildlife in Canada. 2002. ISBN 0-662-32568-0. 
  35. ^ "Bear Wars: Rare Photos of a Mamma Grizzly Battling a Huge Male to Protect Her Cub". Field and Stream. 31 March 2011. 
  36. ^ "Grizzly Bay – Brown bear cubs with lots of photos". Grizzly Bay. 
  37. ^ "THE REINTRODUCTION OF ORPHANED GRIZZLY BEAR CUBS INTO THE WILD". Bear Biology. 
  38. ^ Herrero, Stephen (2002). Bear Attacks: Their Causes and Avoidance. Guilford, Conn.: Lyons Press. ISBN 1-58574-557-X. 
  39. ^ "Food For Thought". Shadow of the Bear. 
  40. ^ "Food Habits of Grizzly Bears and Black Bears in the Yellowstone Ecoystem". National Park Service. Retrieved 6 July 2013. 
  41. ^ "Brown Bear: facts, diet, habitat, baby cubs, claws, kodiak". Bear Life. 
  42. ^ "Brown, Grizzly or Kodiak Bear". shadowofthebear.com. 
  43. ^ "The ultimate teddy bears’ picnic as grizzlies congregate for annual salmon catch in US river". London: dailymail.co.uk. 27 July 2011. Retrieved 27 July 2011. 
  44. ^ "Image of the Month – Brown bear chasing salmon". Expeditions Alaska. 31 October 2010. 
  45. ^ "All About Bears – WildCam Grizzlies". National Geographic. 
  46. ^ "Grizzly Bears Clamming". The Grizzly Bear Blog. 
  47. ^ "Grizzly Bear – Denali National Park and Preserve". National Park Service. 
  48. ^ a b "Grizzly Bears & Cutthroat Trout". National Park Service. Retrieved December 29, 2013. 
  49. ^ Peterson, Christine (14 May 2013). "Grizzlies may be link between drops in cutthroat trout and elk calves". trib.com. 
  50. ^ "Grizzly bear feeding habits". Grizzly Bay. 
  51. ^ "Encounters Explorer – Grizzly Bear – Natural History". Wild Explorer. 
  52. ^ Whitaker, John O. (1980) The Audubon Society Field Guide to North American Mammals. Chanticleer Press, New York, p. 388. ISBN 0-394-50762-2.
  53. ^ "Moose Moms Prefer Traffic to Grizzly Bears, Study Says". National Geographic. Retrieved 12 October 2007. 
  54. ^ Wyman T (2002). "Grizzly bear predation on a bull bison in Yellowstone National Park". Ursus 13: 375. 
  55. ^ "Predator/Prey Relationships". Alaska Department of Fish and Game. 
  56. ^ Manning, Elizabeth (June 25, 2001). "Study show grizzlies are killing moose calves". Peninsula Clarion. 
  57. ^ "As calving season gets into full swing, so does the food source for predators". newsminer.com. Retrieved 26 December 2012. 
  58. ^ "Shiras Moose Demography Project". Wyoming Cooperative Fish and Wildlife Research Unit. 
  59. ^ "Grizzlies, not wolves, major elk calf predator". forwolves.org. 31 October 2004. 
  60. ^ Reynolds, Harry V.; Garner, Gerald W. and Reynolds, H. V. (1987). "Patterns of Grizzly Bear Predation on Caribou in Northern Alaska". Int. Conf. Bear Res. And Management (Alaska Department of Fish and Game) 7: 59–67. JSTOR 3872608. 
  61. ^ "Grizzly bear predation rates on caribou calves in northeastern Alaska". United States Global Service. 
  62. ^ Boertje, R. D.; Gasaway, W. C.; Grangaard, D. V.; Kelleyhouse, D. G. (1988). "Predation on moose and caribou by radio-collared grizzly bears in east central Alaska". Canadian Journal of Zoology 66 (11): 2492. doi:10.1139/z88-369. 
  63. ^ "GRIZZLY BEAR PREDATION ON MUSKOX". Gobies to Grizzlies. July 27, 2008. 
  64. ^ "MARINE MAMMALS ON THE MENU". Gobies to Grizzlies. Retrieved 16 September 2008. 
  65. ^ "June, 2008 – The Second Trip". Grizzly Bay. Retrieved July 2008. 
  66. ^ "Grizzly". Hinterland Who's Who. Archived from the original on 2011-01-03. Retrieved March 4, 2010. 
  67. ^ "Yellowstone Grizzly Bears Eat 40,000 Moths a Day In August". Yellowstone International. 21 June 2011. Retrieved 10 September 2011. 
  68. ^ Derych, John (2001). "Brown / Grizzly Bear Facts". North American Bear Center. 
  69. ^ Gunther, K. A. & Smith, D. W. (2004). "Interactions between wolves and female grizzly bears with cubs in Yellowstone National Park". Ursus 15 (2): 232–238. doi:10.2192/1537-6176(2004)015<0232:IBWAFG>2.0.CO;2. 
  70. ^ "Yellowstone wolves' return means more grizzly food". Los Angeles Times. 1 August 2013. 
  71. ^ "How wolves interact with other predators". wolfbehavior. 
  72. ^ "Potential Interactions Between Bears & Wolves". National Park Service. 
  73. ^ Busch, Robert H. (2000) The Grizzly Almanac. New York, p. 94. ISBN 1-58574-143-4.
  74. ^ a b Apps, C. D.; McLellan, B. N. & Woods, J. G. (2006). "Landscape partitioning and spatial inferences of competition between black and grizzly bears". Ecography 29 (4): 561–572. doi:10.1111/j.0906-7590.2006.04564.x. 
  75. ^ Mattson, T.; Herrero, D. J. & Merrill, S. (2005). "Are black bears a factor in the restoration of North American grizzly bear populations?". Ursus 16: 11–30. doi:10.2192/1537-6176(2005)016[0011:ABBAFI]2.0.CO;2. 
  76. ^ a b "Wolverine". Montana Outdoors. 
  77. ^ Hornocker, M., and S. Negri (Eds.). (2009). Cougar: ecology and conservation. University of Chicago Press. Chicago, IL, ISBN 0226353443.
  78. ^ "Cougar vs Bear Accounts". Everything about the Cougar / Mountain Lion. Retrieved 2013-06-15. 
  79. ^ "Yellowstone Wildlife – Coyote". yellowstonenationalpark.com. Retrieved 10 May 2011. 
  80. ^ Meyer, G. & Witmer, M. (1998). "Influence of Seed Processing by Frugivorous Birds on Germination Success of Three North American Shrubs". American Midland Naturalist 140 (1): 129–139. doi:10.1674/0003-0031(1998)140[0129:IOSPBF]2.0.CO;2. 
  81. ^ Willson, M. & Gende, S. (2004). "Seed Dispersal by Brown Bears, Ursus arctos, in Southeastern Alaska". Canadian Field-Naturalist 118 (4): 499–503. 
  82. ^ a b Doak, D. & Loso, M. (2003). "Effects of Grizzly Bear Digging on Alpine Plant Community Structure". Arctic, Antarctic and Alpine Research 35 (4): 499–503. doi:10.1657/1523-0430(2003)035[0421:EOGBDO]2.0.CO;2. 
  83. ^ Tardiff, S. & Stanford, J. (1998). "Grizzly Bear Digging: Effects on Subalpine Meadow Plants in Relation to Mineral Nitrogen Availability". Ecology 79 (7): 2219–2228. doi:10.1890/0012-9658(1998)079[2219:GBDEOS]2.0.CO;2. 
  84. ^ Rich, T.; Carlson, S.; Gende, S. & Rich, H. (2009). "Transportation of Pacific Salmon Carcasses from Streams to Riparian Forests by Bears". Canadian Journal of Zoology 87 (3): 195–203. doi:10.1139/Z09-004. 
  85. ^ Hilderbrand, G.; Hanley, T.; Robbins, C. & Schwartz, C. (1999). "Role of Brown Bears (Ursus arctos) in the Flow of Marine Nitrogen into a Terrestrial Ecosystem". Oecologia 121 (4): 546–550. doi:10.1007/s004420050961. 
  86. ^ Helfield, J. & Naiman, R. (2006). "Keystone Interactions: Salmon and Bear in Riparian Forests of Alaska". Ecosystems 9 (2): 167–180. doi:10.1007/s10021-004-0063-5. 
  87. ^ a b c Peek, J.; Beecham, J.; Garshelis, D.; Messier, F.; Miller, S. & Dale, S. (2003). Management of Grizzly Bears in British Columbia: A Review by and Independent Scientific Panel. Retrieved October 28, 2009. 
  88. ^ a b Berger, J.; Stacey, P.; Bellis, L. & Johnson, M. (2001). "A Mammalian Predator-Prey Imbalance: Grizzly Bear and Wolf Extinction Affect Avian Neo-Tropical Migrants". Ecological Applications 11 (4): 947–960. doi:10.2307/3061004. JSTOR 3061004. 
  89. ^ "Grizzly Bear Eating Salmon". The Grizzly Bear Blog. Retrieved 21 July 2010. 
  90. ^ Gunther, K.A.; Biel, M.J.; Anderson, N.; Waits, L (2002). "Probable Grizzly Bear Predation On An American Black Bear in Yellowstone National Park". Ursus 13: 372–374. JSTOR 3873219. 
  91. ^ Yahner, Richard H. (27 April 2011). "Why are grizzly bears more aggressive than our black bears?". The Daily Collegian (State College, Pennsylvania: Collegian (Students at Pennsylvania State University)). Archived from the original on 2012-04-25. Retrieved 16 October 2011. 
  92. ^ How Dangerous are Black Bears. Bear.org. Retrieved on 2012-08-17.
  93. ^ Ministry of Environment. 2002. Grizzly Bears in British Columbia. Retrieved on Oct. 12, 2009
  94. ^ a b MacHutchon, A. Grant & Wellwood, Debbie W. (2002). "Reducing bear-human conflict through river recreation management". Ursus 13: 357–360. JSTOR 3873216. 
  95. ^ Austin, M. A., Wrenshall, C. (2004). An Analysis of Reported Grizzly Bear (Ursus arctos): Mortality Data for British Columbia from 1978 to 2003 (pdf). BC Ministry of Water, Land and Air Protection. Retrieved on October 27, 2009.
  96. ^ a b c Ciarniello, L.; Davis, H. & Wellwood, D. (2002). ""Bear Smart" Community Program Background Report". BC Ministry of Water, Land and Air Protection. Retrieved October 30, 2009. 
  97. ^ Batin, Christopher (January 31, 2006). "How to Outrun a Grizzly [and other really bad ideas]". Outdoor Life. 
  98. ^ Herrero, S.; Higgins, A. (2000). "Human Injuries inflicted by bears in Alberta: 1960–98". Ursus 14 (1): 44–54. JSTOR 3872956. 
  99. ^ Facts: Casey & Brutus: Grizzly Encounters – National Geographic Channel – UK. Natgeotv.com (2010-04-20). Retrieved on 2013-08-29.
  100. ^ "Species at Risk – Grizzly Bear Prairie population". Environment Canada. 2006-05-08. Retrieved 2008-04-08. 
  101. ^ "Species Profile: Grizzly Bear Northwestern Population. In: Species at Risk Public Registry. 2009". Retrieved 2009-11-11. 
  102. ^ "Grizzly Bear Recovery. In: US Fish and Wildlife Service. 2009". 
  103. ^ Knibb, David (2008) Grizzly Wars: The Public Fight Over the Great Bear, Eastern Washington University Press, pp. 164–213, ISBN 978-1-59766-037-2.
  104. ^ Knibb, David (2008) Grizzly Wars: The Public Fight Over the Great Bear, Eastern Washington University Press, pp. 202–204, ISBN 978-1-59766-037-2.
  105. ^ a b "Wildlife Status – Grizzly bear – Population size and trends". Fish and Wildlife Division of Alberta Sustainable Resource Development. Archived from the original on 2008-12-26. Retrieved 2008-04-06. 
  106. ^ "Public Meetings for the U.S. Fish and Wildlife Service's Proposal to Remove Yellowstone Area Population of Grizzly Bears from List of Threatened and Endangered Wildlife". U.S. Fish & Wildlife Service. December 29, 2005. 
  107. ^ "Successful Recovery Efforts bring Yellowstone Grizzly Bears off the Endangered List". U.S. Fish & Wildlife Service. 
  108. ^ Barnett, Lindsay (September 22, 2009). "Judge renews protected status for Yellowstone's grizzly bears". Los Angeles Times. 
  109. ^ Bear Specialist Group 1996. "Ursus arctos. In: IUCN 2007. 2007 IUCN Red List of Threatened Species". Retrieved 2008-04-09. "Globally the population remains large, and is not significantly declining" 
  110. ^ Huber, Djuro (January 2010). "Ursus arctos (Brown Bear, Grizzly Bear, Mexican Grizzly Bear)". The IUCN red list of endangered species. International Union for Conservation of Nature and Natural Resources. Retrieved 11 June 2010. 
  111. ^ Alberta Grizzly Bear Recovery Team. "Alberta Grizzly Bear Recovery Plan 2008–2013, Alberta Species at Risk Recovery Plan No. 15" (PDF). Archived from the original on 2008-05-29. Retrieved 2008-04-06. 
  112. ^ Alberta designates grizzly bears a threatened species. Alberta.ca (2010-06-03). Retrieved on 2013-08-05.
  113. ^ "Species at Risk – Grizzly Bear Northwestern population". Environment Canada. 2006-05-08. Retrieved 2008-04-06. 
  114. ^ Hamilton, A.N. "Grizzly Bear Population Estimate for British Columbia. In: Ministry of Environment. 2008". 
  115. ^ Bear Specialist Group 1996. "Ursus arctos ssp. nelsoni. In: IUCN 2007. 2007 IUCN Red List of Threatened Species". Archived from the original on 2008-03-08. Retrieved 2008-04-09. 
  116. ^ "Khutzeymateen Grizzly Bear Sanctuary". env.gov.bc.ca. 
  117. ^ "Wildlife and Education: Refuge for Endangered Wildlife". Grouse Mountain: The Peak of Vancouver. 2009. Archived from the original on 2010-02-06. Retrieved 2009-11-11. 
  118. ^ a b Krebs, C. J. (2009). Ecology: The Experimental Analysis of Distribution and Abundance (6th ed.). San Francisco: Benjamin Cummings. ISBN 978-0-321-50743-3. 
  119. ^ Clevenger, A. P.; Waltho, N (2005). "Performance indices to identify attributes of highway crossing structures facilitating movement of large mammals". Biological Conservation 121 (121): 453–464. doi:10.1016/j.biocon.2004.04.025. 
  120. ^ Edwards, M. A.; Nagy, J. A.; Derocher, A. E (2008). "Using Subpopulation structure for barren-ground grizzly bear management". Ursus 19 (2): 91–104. doi:10.2192/1537-6176-19.2.91. 
  121. ^ Michael, F.P., Bruce, N.M., & Curtis S (2002). "Population Fragmentation of Grizzly Bears in Southeastern British Columbia, Canada". Ursus 8: 153–160. JSTOR 3873196. 
  122. ^ "Be a guest of Katmai's brown bears". CNN. Retrieved 27 June 2013. 
  123. ^ "Brown Bears of Katmai". National Park Service. Retrieved 6 July 2013. 
  124. ^ "Bear Watching in Katmai National Park and Preserve". National Park Service. Retrieved 6 July 2013. 
  125. ^ "Katmai National Park and Preserve Webcams Make Katmai Bears Accessible to the Public". Sierra Sun Times. Retrieved 30 July 2012. 
  126. ^ "McNeil River — State Game Sanctuary and Refuge". Retrieved 12 March 2013. 
  127. ^ "Friends of McNeil River Bears – About". Friends of McNeil River. Retrieved 4 July 2013. 
  128. ^ "McNeil River — State Game Sanctuary and Refuge Permits". Alaska Department of Fish and Game. Retrieved 12 March 2013. 
  129. ^ "Sport Hunting – Katmai National Park and Preserve". National Park Service. Retrieved 6 July 2013. 
  130. ^ Fiorucci, Dan (July 17, 2012). "10,000 Visitors Meet 2,500 Bears at Katmai National Park". articles.ktuu.com. 
  131. ^ "Bear Viewing on Admiralty Island near Juneau, Alaska | Juneau CVB". Travel Juneau. 
  132. ^ "Stan Price — State Wildlife Sanctuary". Alaska Department of Fish and Game. 
  133. ^ "Island Of The Big Grizzlies". Outdoor Channel. Retrieved 22 October 2012. 
  134. ^ "Kodiak Brown Bear". U.S. Fish and Wildlife Service. Retrieved 7 April 2012. 
  135. ^ "O’Malley River". Kodiak Brown Bear Center. 
  136. ^ Miller, S. D. (1990). "Impact of increased bear hunting on survivorship of young bears". Wildlife Society Bulletin 18: 462–467. JSTOR 3782749. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Brown bear

The brown bear (Ursus arctos) is a large bear distributed across much of northern Eurasia and North America. Adult bears generally weigh between 100 and 635 kg (220 and 1,400 lb). Its largest subspecies, the Kodiak bear, rivals the polar bear as the largest member of the bear family[2][3][4] and as the largest land-based predator.[5] There are several recognized subspecies within the brown bear species. In North America, two types of the subspecies Ursus arctos horribilis are generally recognized—the coastal brown bear and the inland grizzly bear; these two types broadly define the range of sizes of all brown bear subspecies. An adult grizzly living inland in Yukon may weigh as little as 80 kg (180 lb), while an adult coastal brown bear in nearby coastal Alaska living on a steady, nutritious diet of spawning salmon may weigh as much as 680 kg (1,500 lb).[3] The exact number of overall brown subspecies remains in debate.

While the brown bear's range has shrunk and it has faced local extinctions, it remains listed as a least concern species by the IUCN with a total population of approximately 200,000. As of 2012, this and the American black bear are the only bear species not classified as threatened by the IUCN. However, the Californian, North African (Atlas bear), and Mexican subspecies were hunted to extinction in the nineteenth and twentieth centuries, and many of the southern Asian subspecies are highly endangered. The smallest subspecies, the Himalayan brown bear, is critically endangered, occupying only 2% of its former range and threatened by uncontrolled poaching for its parts.[6] The Marsican brown bear in central Italy is believed to have a population of just 30 to 40 bears.

The brown bear's principal range includes parts of Russia, India, China, Canada, the United States (mostly Alaska), Scandinavia and the Carpathian region (especially Romania),[7] The brown bear is recognized as a national and state animal in several European countries. It is the most widely distributed of all bears.

Naming and etymology[edit]

The brown bear is sometimes referred to as the bruin, from Middle English. This name originated in the fable, History of Reynard the Fox, translated by William Caxton, from Middle Dutch bruun or bruyn, meaning brown (the color).[8] During the Old West, the grizzly was termed "Old Ephraim" and sometimes as "Moccasin Joe".[9] The scientific name of the brown bear, Ursus arctos, comes from the Latin "ursus", meaning "bear",[10] and Άρκτος "arctos", from the Greek word for bear.[11]

Taxonomy and evolution[edit]

Brown bears are thought to have evolved from Ursus etruscus. The oldest fossils occur in China from about 0.5 million years ago. They entered Europe about 250,000 years ago, and North Africa shortly after. Brown bear remains from the Pleistocene period are common in the British Isles, where it is thought they outcompeted cave bears. The species entered Alaska 100,000 years ago, though they did not move south until 13,000 years ago.[12] It is thought brown bears were unable to migrate south until the extinction of the much larger Arctodus simus.[13] Several paleontologists suggest the possibility of two separate brown bear migrations: grizzlies are thought to stem from narrow-skulled bears which migrated from northern Siberia to central Alaska and the rest of the continent, while Kodiak bears descend from broad-skulled bears from Kamchatka, which colonized the Alaskan peninsula. Brown bear fossils discovered in Ontario, Ohio, Kentucky and Labrador show the species occurred farther east than indicated in historic records.[12]

Subspecies[edit]

There is little agreement on classification of brown bears. Some systems have proposed as many as 90 subspecies, while recent DNA analysis has identified as few as five clades.[14] DNA analysis recently revealed that the identified subspecies of brown bears, both Eurasian and North American, are genetically quite homogeneous, and that their genetic phylogeography does not correspond to their traditional taxonomy.[15] As of 2005, 16 living subspecies have been recognized.[16][17] The subspecies have been listed as follows:

Eurasian[edit]

Subspecies nameImageDistributionDescription/Comments
Ursus arctos arctosEurasian brown bearOurs des pyrenees aspe 2002.jpgEurope, Caucasus, Siberia (except the east) and Mongolia[18]A predominantly dark colored (rarely light colored), moderately sized subspecies with dark claws, the Eurasian browns occurring in Siberia are larger than their European counterparts, as they are hunted less.[18] Where found in Europe, primarily a forest creature
Ursus arctos beringianusKamchatka brown bear (or Far Eastern brown bear)Brown-bear-in-spring.jpgKamchatka Peninsula and Paramushir Island[18]This is a very large, dark colored form. Light colored forms are encountered less than in European-Siberian subspecies. The claws are dark;[18] it is thought to be the ancestor of the Kodiak bear U. a. middendorffi.[12] and Peninsular brown bears U. a. gyas of Alaska.
Ursus arctos collarisEast Siberian brown bearUcollaris.jpgEast Siberia from the Yenisei River to the Altai Mountains, also found in northern MongoliaA predominantly dark form, it is intermediate in size between U. a. arctos and U. a. beringianus, with a proportionately larger skull.[18]
Ursus arctos crowtheri – †Atlas bear (extinct)Atlasbear.jpgHabitat while still extant was the Atlas Mountains and adjacent areas in North Africa, from Morocco to Libya.Last surviving bear is thought to have been killed by hunters in 1890.[19]
Ursus arctos isabellinusHimalayan brown bearUrsus arctos isabellinus (in Perm Zoo).jpgNepal, Pakistan, and Northern IndiaHas a reddish-brown or sandy coat color and large ears, this bear is smaller than most other brown bears found on the Asian continent. Prefers high altitude forest and alpine meadow. Critically Endangered.
Ursus arctos lasiotusUssuri brown bear (or Amur brown bear, black grizzly or horse bear)Ursus arctos lasiotus - Beijing Zoo 3.JPGRussia: Southern Kuril Islands, Sakhalin, Maritime territory, and the Ussuri/Amur river region south of the Stanovoy Range, China: Heilongjiang, Japan: Hokkaidō[18]This bear is thought to be the ancestor of U. a. horribilis.[12]
Ursus arctos marsicanusMarsican brown bearOrso marsicano.jpgMarsica, central ItalyThere are an estimated 30 to 40 bears remaining in the Marsica area. This is an unrecognized subspecies that is considered to be a member of the nominate subspecies.[20]
Ursus arctos pruinosusTibetan blue bearTibetan Blue Bear - Ursus arctos pruinosus - Joseph Smit crop.jpgTibetan plateau [18] an isolated sub-population lives in the Gobi Desert.This is a moderately sized subspecies with long and shaggy fur. Both dark and light variants are encountered, with intermediate colors predominating. The fur around the neck is light, and forms a "collar". The skull is distinguished its relatively flattened choanae, an arch-like curve of the molar row and large teeth.[18]
Ursus arctos syriacusSyrian brown bearUrsus arctos syriacus.jpgThe trans-Caucasus, Syria, Iraq, Turkey (Asia Minor), Iran, Afghanistan, Pakistan, western Himalayas and the Pamir-Alai and Tien Shan mountains,[18] probable historical presence in IsraelThe Syrian is a light colored, moderate to small-sized subspecies with light claws.[18] Recently, however, it was shown that this form, at least matrilineally, is not monophyletic and belongs to Ursus arctos arctos.[21]

North American[edit]

Subspecies nameImageDistributionDescription/Comments
Ursus arctos alascensis[22][20] – Alaska brown bearCoastal Alaska
Ursus arctos californicus – †California grizzly (extinct)Monarch the bear.jpgCaliforniaThe last known bear was shot in California in 1922.
Ursus arctos dalli - Dall Island brown bearDall Island
Ursus arctos gyasPeninsular brown bearBrown bear.jpgAlaska PeninsulaConsidered by some biologists to be same subspecies as U. a. middendorffi.[23]
Ursus arctos horribilisGrizzly bearGrizzly Bear Yellowstone.jpgNorthern and Western Canada, Alaska, and the northwestern United States, historically existed in Great PlainsGrizzlies are identified by a medium to dark brown coat with gray or blond "grizzled" tips on the fur. Smaller than coastal bears, a large male grizzly can weigh up to 364 kilograms (802 lb) in inland areas, with bears in the Yukon region weighing as little as 80 kg (180 lb). Coastal bears may be nearly twice a mountain grizzly's weight. Highly adaptable: it can live in montane pine forests, temperate rainforest, semi-arid scrubland, and shortgrass prairie.
Ursus arctos middendorffiKodiak bearBear Square.JPGKodiak, Afognak, Shuyak Islands (Alaska)This is the largest subspecies of brown bear, with other coastal brown bears potentially reaching nearly as large.
Ursus arctos nelsoni – †Mexican grizzly bear (extinct)Mexico grizzlies.pngFormerly northern Mexico, including Chihuahua, Coahuila, and Sonora, southwestern United States including southern ranges of Texas, Arizona, and New MexicoThis bear is believed extinct due to cattle ranching in both the United States and Mexico. Distinct in its ability to survive arid conditions, it could live in both montane pine forests of Mexico and canyonlands of Sonoran Desert.
Ursus arctos sitkensisAdmiralty Island, Baranof Island, and Chichagof Island the ABC Islands of Alaska.Appearing to be more closely related to the polar bear than to other brown bears,[15] this species is called "clade I" by Waits, and others, and is part of the subspecies identified as U. a. sitkensis, by Hall and as U. a. dalli by Kurtén.
Ursus arctos stikeenensisNorthwestern British Columbia[24] Around the Stikine River.Considered by some biologists to be same subspecies as U. a. horribilis. [24]
Ursus arctos ugavaesis – †Ungava brown bear (extinct)Ungava Peninsula, QuebecInhabited the forests of northern Quebec. The species was hunted by Indians and early settlers, and the last one was killed in c. 1913.[25]

Hybrids[edit]

A grizzly–polar bear hybrid (known as a pizzly bear or grolar bear) is a rare ursid hybrid resulting from a union of a brown bear and a polar bear. It has occurred both in captivity and in the wild. In 2006, the occurrence of this hybrid in nature was confirmed by testing the DNA of a strange-looking bear that had been shot in the Canadian arctic.[26][27][28] Previously, the hybrid had been produced in zoos, and was considered a "cryptid" (a hypothesized animal for which there is no scientific proof of existence in the wild).

Formerly considered subspecies[edit]

Former
Subspecies Name
ImageDistributionDescription
Ursus arctos pyrenaicusIberian brown bear, sometimes called Cantabrian brown bear, now considered Ursus arctos arctosEuropean brown bearSee photographs in Eroski article (in Spanish, also available in Catalan, Basque and Galician) and in Fauna Ibérica. Oso pardo ibérico (Ursus arctos pyrenaicus), in SpanishIberian Peninsula, primarily the Cantabrian Mountains and hills in Galicia, and the Pyrenees[29]Until recently, this bear was considered a separate subspecies. Today, it is considered to belong to the U. arctos arctos subspecies. Scientific evidence based on DNA studies would furthermore indicate the European brown bear can be divided into two distinct lineages. "There is a clear division into two main mitochondrial lineages in modern European brown bear populations. These populations are divided into those carrying an eastern lineage (clade IIIa, Leonard et al. 2000), which is composed of Russian, northern Scandinavian and eastern European populations, and those carrying a western lineage (clade I, Leonard et al. 2000), which is composed of two subgroups, one believed to originate from the Iberian Peninsula, including southern Scandinavian bears and the Pyreneean populations; and the other from the Italian–Balkan peninsulas (Taberlet et al. 1994; see however Kohn et al. 1995). In addition, based on the subfossil record in northwestern Moldova and mitochondrial DNA data from modern populations, a Carpathian refuge has also been proposed (Sommer & Benecke 2005; Saarma et al. 2007)."[30]

The brown bear is the largest animal on the Iberian Peninsula, although one of the smallest of the brown bears, weigh between 130 and 180 kg (290 and 400 lb) as adults. Their fur varies from a pale cream color to dark brown, but always with a distinctively darker, nearly black tone at the paws and a yellowish tinge at the tip of each hair. The brown bear population is considered endangered in Spain.

The brown bear population in the Pyrenees stems mostly from bears reintroduced from Slovenia, with one or two remaining original males.[29][30][31][32][33]

Physical description[edit]

Brown bear claws are longer and less curved than those of black bears
Brown bear skull

Brown bears have long, thick fur, with a moderately long mane at the back of the neck. In India, brown bears can be reddish with silver tips, while in China, brown bears are bicolored with a yellow-brown or whitish cape across the shoulders. North American grizzlies can be dark brown (almost black) to cream (almost white) or yellowish brown. Black hairs usually have white tips.[19] The winter fur is very thick and long, especially in northern subspecies, and can reach 11 to 12 centimetres (4 to 5 in) at the withers. The winter hairs are thin, yet rough to the touch. The summer fur is much shorter and sparser, and its length and density varies geographically.[18]

Brown bears have very large and curved claws, those present on the forelimbs being longer than those on the hind limbs. They may reach 5 to 6 centimetres (2.0 to 2.4 in) and sometimes 7 to 10 centimetres (2.8 to 3.9 in) along the curve.[18] They are generally dark with a light tip, with some forms having completely light claws.[18] Brown bear claws are longer and straighter than those of American black bears.[19] The claws are blunt, while those of a black bear are sharp. Due to their claw structure, in addition to their excessive weight, adult brown bears cannot climb trees as can both species of black bear. The paws of the brown bear are quite large. The rear feet of adult bears have been found to typically measure 21 to 36 cm (8.3 to 14.2 in) long, with huge Kodiak bears having measured up to 46 cm (18 in) along their rear foot.[34][35]

Adults have massive, heavily built concave skulls, which are large in proportion to the body. The forehead is high and rises steeply.[19] The projections of the skull are well developed when compared to those of Asian black bears: the latter have sagittal crests not exceeding more than 19–20% of the total length of the skull, while the former have sagittal crests comprising up to 40–41% of the skull's length. Skull projections are more weakly developed in females than in males. The braincase is relatively small and elongated. There is a great deal of geographical variation in the skull, and presents itself chiefly in dimensions.[18] Grizzlies, for example, tend to have flatter profiles than European and coastal American brown bears.[36] Skull lengths of Russian bears tend to be 31.5 to 45.5 centimetres (12.4 to 17.9 in) for males, and 27.5 to 39.7 centimetres (10.8 to 15.6 in) for females. The width of the zygomatic arches in males is 17.5 to 27.7 centimetres (6.9 to 11 in), and 14.7 to 24.7 centimetres (5.8 to 9.7 in) in females.[18] Brown bears have very strong teeth: the incisors are relatively big and the canine teeth are large, the lower ones being strongly curved. The first three molars of the upper jaw are underdeveloped and single crowned with one root. The second upper molar is smaller than the others, and is usually absent in adults. It is usually lost at an early age, leaving no trace of the alveolus in the jaw. The first three molars of the lower jaw are very weak, and are often lost at an early age.[18] Although they have powerful jaws, brown bear jaws are incapable of breaking large bones with the ease of spotted hyenas.[37]

Body size[edit]

The Brown Bear is the most variably sized of extant bear species. The dimensions of brown bears fluctuate very greatly according to sex, age, individual, geographic location, and season. The normal range of physical dimensions for a brown bear is a head-and-body length of 1.4 to 2.8 m (4.6 to 9.2 ft) and a shoulder height of 70 to 153 cm (28 to 60 in). Males are invariably larger than females, typically weighing around 30% more in most races. The tail is relatively short, ranging from 6 to 22 cm (2.4 to 8.7 in) in length.[38]

Young of the year typically weigh 2–27 kg (4.4–59.5 lb), while yearlings typically weigh 9–37 kg (20–82 lb).[3]

Generally speaking, brown bears weigh the least when they emerge from hibernation in the spring and then reach peak weights when preparing for hibernation in the fall (when they often gorge on large food stuffs).[3] Some subspecies show considerable variation. Whereas Eurasian brown bear (U. a. arctos) and grizzly bears (U. a. horribilis) from Northern Europe, Yellowstone National Park or interior Alaska seasonally weigh on average between 115 and 360 kg (254 and 794 lb), bears from the Yukon Delta, interior British Columbia, Jasper National Park and southern Europe can weigh from 55 to 155 kg (121 to 342 lb) on average.[3][39] Bears from the Syrian (U. a. syriacus) and the Gobi Desert (U. a. gobiensis) subspecies are around the same mass as the smaller Eurasian brown and grizzly bears and can exceptionally measure as small as 1 m (3.3 ft) in head-and-body length.[3] On the other end of the scale among interior brown bears, exceptional grizzly, Eurasian brown bears and East Siberian brown bears (U. a. collaris) have been weighed up to 680 kg (1,500 lb), 481 kg (1,060 lb) and 600 kg (1,300 lb), respectively.[35] Due to the lack of genetic variation within subspecies, the environmental conditions in a given area likely plays the largest part in such weight variations.[3] Interior brown bears are generally smaller than is often perceived, being around the same weight as an average African lion at an estimate average of 180 kg (400 lb) in males and 135 kg (298 lb) in females.[40] The largest inland brown bear subspecies appears to be the Ussuri brown bear (U. a. lasiotus), likely the ancestor of the modern-day American grizzly, which can obtain sizes comparable to those of the coastal bears as described below.[18]

The brown bears found in coastal regions of Alaska and far eastern Russia are the largest. The largest subspecies is the Kodiak bear (U. a. middendorffi), followed closely by the Kamchatka brown bear (U. a. beringianus), although bears from other coastal regions of eastern Asia and western North America can be comparably large. In these areas, the female averages from 181.4 to 318 kg (400 to 701 lb) and the male averages from 272 to 635 kg (600 to 1,400 lb).[3][4] The heaviest verified Kodiak bear weighed about 748 kg (1,650 lb).[41] It is not unusual for Kodiak bear males to weigh up to 680 kg (1,500 lb) in fall with some specimens attaining 780 kg (1,720 lb) or more.[42][verification needed] Such huge males can stand over 3 m (9.8 ft) tall while on their hind legs and loom 1.5 m (5 ft) high at the shoulder.[43] The heaviest recorded brown bear weighed over 1,150 kilograms (2,500 lb).[19][verification needed] Furthermore, a maximum weight of 1,500 kg (3,300 lb) for the Kodiak bear was published.[42][verification needed]

Distribution and habitat[edit]

Brown bear at Brooks Falls

Brown bears were once native to much of Asia, the Atlas Mountains of Africa, Europe, and North America,[44] but are now extinct in some areas, and their populations have greatly decreased in other areas. There are approximately 200,000 brown bears left in the world.[45] The largest populations are in Russia with 120,000,[46] the United States with 32,500, and Canada with around 25,000. About 95% of the brown bear population in the United States is in Alaska, though in the lower 48 states, they are repopulating slowly but steadily along the Rockies and the western Great Plains. Although many people hold the belief some brown bears may be present in Mexico and the Atlas Mountains of Morocco, both are almost certainly extinct. The last Mexican grizzly bear was shot in 1960. In Europe, there are 14,000 brown bears in ten fragmented populations, from Spain (estimated at only 20–25 animals in the Pyrenees in 2010,[47][48] in a range shared between France, Spain and Andorra, and some 210 animals in Asturias, Cantabria, Galicia and León, in the Picos de Europa and adjacent areas in 2013 [49] in the west, to Russia in the east, and from Sweden and Finland in the north to Romania (4000–5000), Bulgaria (900–1200), Slovakia (with about 600–800 animals), Slovenia (500–700 animals) and Greece (with about 200 animals) in the south. They are extinct in the British Isles, extremely threatened in France and Spain, and in trouble over most of Central Europe. The Carpathian brown bear population of Romania is the largest in Europe outside Russia, estimated at 4,500 to 5,000 bears, although declining alarmingly due to overhunting.[50] There is also a smaller brown bear population in the Carpathian Mountains in Ukraine (estimated at about 200 in 2005), Slovakia and Poland (estimated at about 100 in 2009 in the latter country).[51] The total Carpathian population is estimated at about 8,000.[52] Northern Europe is home to a large bear population, with an estimated 2,500 (range 2,350–2,900) in Sweden, about 1,600 in Finland,[53] about 700 in Estonia and 70 in Norway. Another large and relatively stable population of brown bears in Europe, consisting of 2,500–3,000 individuals, is the Dinaric-Pindos (Balkans) population, with contiguous distribution in northeast Italy, Slovenia, Croatia, Bosnia and Herzegovina, Serbia, Montenegro, Macedonia, Albania, Bulgaria and Greece.[54]

Brown bears live in Alaska, east through the Yukon and Northwest Territories, south through British Columbia and through the western half of Alberta. The Alaskan population is estimated at a healthy 32,000 individuals.[55] Small populations exist in the Greater Yellowstone Ecosystem of northwest Wyoming (with about 600 animals), the Northern Continental Divide Ecosystem of northwest Montana (with about 750 animals), the Cabinet-Yaak Ecosystem of northwest Montana and northeast Idaho (with about 30–40 animals), the Selkirk Ecosystem of northeast Washington and northwest Idaho (with about 40–50 animals), and the North Cascades Ecosystem of northcentral Washington (with about 5–10 animals). These five ecosystems combine for a total of roughly 1,470 wild grizzlies still persisting in the contiguous United States. Unfortunately, these populations are isolated from each other, inhibiting any genetic flow between ecosystems. This poses one of the greatest threats to the future survival of the grizzly bear in the contiguous United States.

In Asia, brown bears are found primarily throughout Russia, thence more spottily southwest to parts of the Middle East, to as far south as southwestern Iran, and to the southeast in a small area of Northeast China, Western China, and parts of North Korea, Pakistan, Afghanistan and India. They can also be found on the Japanese island of Hokkaidō, which holds the largest number of non-Russian brown bears in eastern Asia with about 2,000–3,000 animals.[34]

The population of brown bears in the Pyrenees mountain range between France and Spain is extremely low, estimated at 14 to 18, with a shortage of females. Their rarity in this area has led biologists to release bears, mostly female, from Slovenia in spring 2006 to reduce the imbalance and preserve the species' presence in the area. The bears were released despite protests from French farmers. A small population of brown bears (Ursus arctos marsicanus) still lives in central Italy (Apennine Mountains, Abruzzo and Latium), with no more than 70 individuals, protected by strong laws, but endangered by the human presence in the area.

In Arctic areas, the potential habitat of the brown bear is increasing. The warming of that region has allowed the species to move farther north into what was once exclusively the domain of the polar bear. In non-Arctic areas, habitat loss is blamed as the leading cause of endangerment, followed by hunting.

This species inhabits the broadest range of habitats of any living bear species.[34] They seem to have no altitudinal preferences and have been recorded from sea-level to an elevation of 5,000 m (16,000 ft) (the latter in the Himalayas).[34] In most of their range, brown bears generally seems to prefer semiopen country, with a scattering of vegetation that can allow them a resting spot during the day. However, they have been recorded as inhabiting every variety of northern temperate forest known to occur.[34] North American brown bears, or grizzly bears, generally seem to prefer open or semi-open landscapes, with the species once having been common on the Great Plains and continues to occur in sizeable numbers in tundra and coastal estuaries and islands. Variable numbers still occur in prairie areas of the northern Rocky Mountains (mostly in Canada but some in the contiguous United States).[34] In western Eurasia, they inhabit mostly mountainous woodlands, in ranges such as the Alps, the Pyrenees and the Caucasus, though they may have been driven into more wooded, precipitous habitats due to the prior extensive persecution of the species in some regions.[21][42] Desolate parts of northern and eastern Europe, like large patches of Scandinavia and the Carpathian Mountains, have always been quite heavily forested and have maintained relatively stable populations of bears, indicating that the brown bears here are well-adapted to forest-dwelling.[34] In Central Asia, human disturbances are minimal as this area has a harsher environment and is more sparsely populated. In this part of the world, bears may be found in steppe, alpine meadows and even desert edge. In Siberia, the species seems well-adapted to living in denser pine forests. Eastern Russian forests hold arguably the largest number of brown bears in the world outside of possibly Alaska and northeastern Canada.[34] It is thought the Eurasian bears which colonized America were tundra-adapted and the species is sometimes found around sub-Arctic ice fields. This is indicated by brown bears in the Chukotka Peninsula on the Asian side of Bering Strait, which are the only Asian brown bears to live year-round in lowland tundra like their North American cousins.[56]

Behavior[edit]

Although the brown bear is primarily nocturnal, it is frequently seen in morning and early evening hours.[57] In summer through autumn, it can double its weight, gaining up to 180 kg (400 lb) of fat, on which it relies to make it through winter, when it becomes very lethargic. Although they are not full hibernators and can be woken easily, both sexes like to den in a protected spot, such as a cave, crevice, or hollow log, during the winter months. Brown bears are mostly solitary, although they may gather in large numbers at major food sources (e.g., moth colonies, open garbage dumps or rivers holding spawning salmon) and form social hierarchies based on age and size.[58] Adult male bears are particularly aggressive and are avoided by adolescent and subadult males. Female bears with cubs rival adult males in aggression, and are more intolerant of other bears than single females. Young adolescent males tend to be least aggressive, and have been observed in nonantagonistic interactions with each other. Dominance between bears is asserted by making a frontal orientation, showing off canines, muzzle twisting and neck stretching to which a subordinate will respond with a lateral orientation, by turning away and dropping the head and by sitting or lying down.[59] During combat, bears use their paws to strike their opponents in the chest or shoulders and bite the head or neck. In his Great Bear Almanac, Gary Brown lists 11 different sounds bears produce in 9 different contexts. Sounds expressing anger or aggravation include growls, roars, woofs, champs and smacks, while sounds expressing nervousness or pain include woofs, grunts, and bawls. Sows will bleat or hum when communicating with their cubs.[19]

Home ranges[edit]

Brown bears usually occur over vast home ranges, however they are not highly territorial. Several adult bears often roam freely over the same vicinity without issue unless rights to a fertile female or food sources are being contested. Males always cover more area than females each year and will try to mate with as many females as they can (although females are not monogamous either). In areas where food is abundant and concentrated, such as coastal Alaska, home ranges for females are up to 24 km2 (9.3 sq mi) and for males are up to 89 km2 (34 sq mi). Similarly, in British Columbia, bears of the two sexes travel relatively compact home ranges of 115 km2 (44 sq mi) and 318 km2 (123 sq mi). In Yellowstone National Park, home ranges for females are up to 281 km2 (108 sq mi) and up to 874 km2 (337 sq mi) for males. In the central Arctic of Canada, where food sources are quite sparse, home ranges range up to 2,434 km2 (940 sq mi) in females and 8,171 km2 (3,155 sq mi) in males.[34]

Reproduction[edit]

The mating season is from mid-May to early July.[34] Being serially monogamous, brown bears remain with the same mate from several days to a couple of weeks.[60] Females mature sexually between the age of 4 and 8 years of age, while males first mate about a year later on average, when they are large and strong enough to successfully compete with other males for mating rights.[34]

Pair of mating brown bears, at Ähtäri Zoo in Ähtäri, Finland

Males, however, take no part in raising their cubs – parenting is left entirely to the females.

Through the process of delayed implantation, a female's fertilized egg divides and floats freely in the uterus for six months. During winter dormancy, the fetus attaches to the uterine wall. The cubs are born eight weeks later, while the mother sleeps. If the mother does not gain enough weight to survive through the winter, the embryo does not implant and is reabsorbed into the body. The average litter has one to four cubs, usually two. There have been cases of bears with as many as six cubs.[34] There are records of females sometimes adopting stray cubs or even trading cubs when they emerge from hibernation.[34] Older females tend to give birth to larger litters. The size of a litter also depends on factors such as geographic location and food supply. At birth, the cubs are blind, toothless, hairless, and weigh less than 450 grams (1 lb). They feed on their mother's milk until spring or even early summer, depending on climate conditions. At this time, the cubs weigh 7 to 9 kg (15 to 20 lb) and have developed enough to follow her and begin to forage for solid food.

Cubs remain with their mother from two to four years (exceptionally to 4 and a half years), during which time they learn survival techniques, such as which foods have the highest nutritional value and where to obtain them; how to hunt, fish, and defend themselves; and where to den. The cubs learn by following and imitating their mother's actions during the period they are with her.[61] Brown bears practice infanticide.[62] An adult male bear may kill the cubs of another bear either to make the female sexually receptive or simply for consumption. Cubs flee up a tree when they see a strange male bear, and the mother often successfully defends them, even though the male may be twice as heavy as she.

Longevity[edit]

The brown bear is naturally a long-living animal. Wild females have been known to be able to reproduce at as old as 28 years of age, the oldest known age for reproduction in the wild of any ursid.[34] Males commonly can live to 25 years, with the oldest female having been 37 years old. The species can live to 48 years of age in captivity. Annual mortality for bears of any age is estimated at around 10% in most protected areas.[34] However, in hunted populations, an estimated average mortality rate of 38% is given.[34] Around 13% to 44% of cubs die within their first year. Beyond predation by other large predators (rarely by gray wolf packs or Siberian tigers) and brown bears, starvation and accidents claim a few cubs. Even in populations living in protected areas without legal, non-governmental hunting, though, humans are still the leading cause of mortality for brown bears.[63] The largest number of legally hunting on the species occurs in Canada, Finland, Russia, Slovakia and Alaska.[34]

Dietary habits[edit]

Brown bear feeding on salmon

The Brown Bear is one of the most omnivorous animals in the world and has been recorded as consuming the greatest variety of foods of any bear.[34] Throughout life, this species is regularly curious about the potential of eating virtually any organism or object that they encounter. Food that is both abundant and easily accessed or caught is preferred. Their jaw structure has evolved to fit their dietary habits. Their diet varies enormously throughout their differing areas based on opportunity.

Despite their reputation, most brown bears are not highly carnivorous, as they derive up to 90% of their dietary food energy from vegetable matter.[64] They often feed on a variety of plant life, including berries, grasses, flowers, acorns and pine cones as well as fungi such as mushrooms.[3] Among all bears, brown bears are uniquely equipped to dig for tough foods such as roots and shoots. They use their long, strong claws to dig out earth to reach the roots and their powerful jaws to bite through them.[3] In spring, winter-provided carrion, grasses, shoots, sedges and forbs are the dietary mainstays for brown bears internationally.[34] Fruits, including berries, become increasingly important during summer and early autumn. Roots and bulbs become critical in autumn for some inland bear populations if fruit crops are poor.[34] They will also commonly consume animal matter, which in summer and autumn may regularly be in the form of insects, larvae and grubs, including beehives. Bears in Yellowstone eat an enormous number of moths during the summer, sometimes as many as 40,000 army cutworm moths in a single day, and may derive up to half of their annual food energy from these insects.[65] Brown bears living near coastal regions will regularly eat crabs and clams. In Alaska, bears along the beaches of estuaries regularly dig through the sand for clams.[19] This species may eat birds and their eggs, including almost entirely ground- or rock-nesting species.[19] The diet may be supplemented by rodents or similar smallish mammals, including marmots, ground squirrels, mice, rats, lemmings and voles.[3] With particular regularity, bears in Denali National Park will wait at burrows of Arctic ground squirrels hoping to pick off a few of the 1 kg (2.2 lb) rodents.[66]

In the Kamchatka peninsula and several parts of coastal Alaska, brown bears feed mostly on spawning salmon, whose nutrition and abundance explain the enormous size of the bears in these areas. The fishing techniques of bears are well-documented. They often congregate around falls when the salmon are forced to breach the water, at which point the bears will try to catch the fish in mid-air (often with their mouths). They will also wade into shallow waters, hoping to pin a slippery salmon with their claws. While they may eat almost all the parts of the fish, bears at the peak of spawning, when there is usually a glut of fish to feed on, may eat only the most nutrious parts of the salmon (including the eggs and head) and then indifferently leave the rest of the carcass to scavengers, which can include red foxes, bald eagles, common ravens and gulls. Despite their normally solitary habits, Brown bears will gather rather closely in numbers at good spawning sites. The largest and most powerful males claim the most fruitful fishing spots and bears (especially males) will sometimes fight over the rights to a prime fishing spot.[19]

Beyond the regular predation of salmon, most brown bears are not particularly active predators.[19] While perhaps a majority of bears of the species will charge at large prey at one point in their lives and most eat carrion, many predation attempts start with the bear clumsily and half-heartedly pursuing the prey and end with the prey escaping alive.[19] On the other hand, some brown bears are quite self-assured predators who habitually pursue and catch large prey items. Such bears are usually taught how to hunt by their mothers from an early age.[19] Large mammals preyed on can include various deer species such as elk, red deer, axis deer, European roe deer, Siberian roe deer, fallow deer, mule deer, white tailed deer, moose and caribou. Bovids are also regular prey including various sheep, goats, antelope, bison and muskoxen, as are wild boars.[3] When brown bears attack these large animals, they usually target young or infirm ones, as they are easier to catch. Typically when hunting (especially with young prey), the bear pins its prey to the ground and then immediately tears and eats it alive.[67] It will also bite or swipe some prey in order to stun it enough to knock it over for consumption.[42] To pick out young or infirm individuals, bears will charge at herds so the slower-moving and more vulnerable individuals will be made apparent. Brown bears may also ambush young animals by finding them via scent.[3] When emerging from hibernation, brown bears, whose broad paws allow them to walk over most ice and snow, may pursue large prey such as moose whose hooves cannot support them on encrusted snow.[42] Similarly, predatory attacks on large prey sometimes occur at riverbeds, when it is more difficult for the prey specimen to run away due to muddy or slippery soil.[3] On rare occasions, while confronting fully-grown, dangerous prey, bears kill them by hitting with their powerful forearms, which can break the necks and backs of large creatures such as adult moose and adult bison.[19] They also feed on carrion, and use their size to intimidate other predators, such as wolves, cougars, tigers, and black bears from their kills. Carrion is especially important in the early spring (when the bears are emerging from hibernation), much of it comprised by winter-killed big game.[3] Cannibalism is not unheard of, though predation is not normally believed to be the primary motivation when brown bears attack each other.[19]

When forced to live in close proximity with humans and their domesticated animals, bears may potentially predate any type of domestic animal. Among these, domestic cattle are sometimes exploited as prey. Cattle are bitten on the neck, back or head and then the abdominal cavity is opened for eating.[3] Plants and fruit farmed by humans are readily consumed as well, including corn, wheat, sorghum, melons and any form of berries.[19] They will also feed at domestic bee farms, readily consuming both honey and the contents of the honey bee colony.[19] Human foods and trash or refuse is eaten when possible. When an open garbage dump was kept in Yellowstone, brown bears were one of the most voracious and regular scavengers. The dump was closed after both brown and American black bears came to associate humans with food and lost their natural fear of them.[19]

Interspecific predatory relationships[edit]

Brown bear being followed by a wolf
Taxidermy exhibit portraying a brown bear fighting a Siberian tiger, Vladivostok Museum

Brown bears often use their large size for intimidation when a kill or a territory is in dispute with another large predator and they are normally dominant in such interactions. Sometimes, the conflict will escalate to the point of violence, but usually threat displays are sufficient, since most animals try to avoid potential bodily harm. However, the massive strength and size of the brown bear will usually result in its winning violent conflicts, even against wolf packs and Siberian tigers. In situations where the interspecies conflict turns deadly, brown bears may also eat the competitor, despite it not being the primary reason for attack.

Brown bears regularly intimidate wolves away from their kills. In Yellowstone National Park, brown bears pirate wolf kills so often, Yellowstone's Wolf Project director Doug Smith wrote, "It's not a matter of if the bears will come calling after a kill, but when." Despite the high animosity between the two species, most confrontations at kill sites or large carcasses end without bloodshed on either side. Though conflict over carcasses is common, on rare occasions the two predators tolerate each other on the same kill. To date, there is a single case of fully-grown wolves being killed by a grizzly bear.[68] Given the opportunity, however, both species will prey on the other's cubs.[69] Conclusively, the individual power of the bear against the collective strength of the wolf pack usually results in a long battle for kills or domination. In some areas, the brown bear also regularly displaces cougars from their kills.[70] Cougars kill small bear cubs on rare occasions, and there have been reports of bears killing fully-grown cougars.[71][72] Other accounts, told primarily from the 19th and early 20th centuries, tell of cougars and bears engaging in prolonged combat and ending with both combatants fatally wounded.[73] Brown bears are known to handle lions well when the two species interact in circuses. A Kodiak bear in the 1920s reportedly killed a man-eating African lion "so quickly the big audience hardly knew how it was done."[19] An earlier account from the 1890s tells of a 700 lb grizzly bear and a 550 lb African lion engaging in a bloody, prolonged fight in a bullring and ending with the latter badly injured.[74]

Smaller carnivorous animals, including coyotes, wolverines, lynxes and any other sympatric carnivores or raptorial birds, are dominated by Brown bears and generally avoid direct interactions with them, unless attempting to steal scraps of food. However, wolverines have been persistent enough to fend off a grizzly bear as much as ten times their weight off a kill.[19] There is one record of a golden eagle predating a Brown bear cub.[75]

Large herbivores, such as moose, buffalo, and muskox may have an intolerance of brown bears due to their possible threat to calves; moose regularly charge grizzly bears in their calf's defense.[76][77] Bison have been known to fatally injure lone grizzly bears in battles, and even a mountain goat was observed to do so with its horns.[19]

Adult bears are generally immune to predatory attacks except from other bears. Some bears emerging from hibernation seek out tigers in order to steal their kills.[78] Indeed, Russian researchers have identified "satellite bears" who "follow tigers over extensive periods of time, sequentially usurping kills"; these bears were observed tracking tigers in spring snow and regularly usurped their kills.[79] In the Russian Far East, brown bears along with smaller Asiatic black bears constitute 5–8% of the diet of Siberian tigers. In particular, the brown bear's input is estimated to be 1.0–1.5% in one source.[80] However, another source states that such attacks are rare and do not have any actual significance because Siberian tigers are almost extinct. Siberian tigers most typically attack brown bears in the winter in the hibernaculum[81] or in the late autumn and early spring, and when ungulate populations decrease.[82] Tigers typically attack bears by surprise when hunting them and are believed to forgo attacks if the bear is aware of their presence. Adult bears, generally smaller ones, are sometimes vulnerable to tiger attacks and have been killed in their dens in winter, with the tiger taking advantage of the bear's hibernating condition.[83] There are also records of bears killing tiger,[82] either in self-defense, or in disputes over kills or for consumption.[79][84][85]

Brown bears usually dominate other bear species in areas where they coexist. Due to their smaller size, American black bears are at a competitive disadvantage to brown bears in open, unforested areas. Although displacement of black bears by brown bears has been documented, actual interspecific killing of black bears by brown bears has only occasionally been reported. Confrontation is mostly avoided due to the black bear's diurnal habits and preference for heavily forested areas, as opposed to the brown bear's largely nocturnal habits and preference for open spaces.[86] Brown bears may also kill Asian black bears, though the latter species probably largely avoids conflicts with the Brown bear due to similar habits and habitat preferences to the American Black species.[87] They will eat the fruit dropped by the Asian black bear from trees, as they themselves are too large and cumbersome to climb.[88] Improbably, in the Himalayas Brown bears are reportedly intimidated by Asian black bears in confrontations.[89]

There has been a recent increase in interactions between brown bears and polar bears, theorized to be caused by climate change. Brown bears have been seen moving increasingly northward into territories formerly claimed by polar bears. Brown bears tend to dominate polar bears in disputes over carcasses,[90] and dead polar bear cubs have been found in brown bear dens.[91]

Relationship with humans[edit]

Front paw imprint
Rear paw imprint

Conflicts between bears and humans[edit]

Bears become attracted to human-created food sources, such as garbage dumps, litter bins, and dumpsters; they venture into human dwellings or barns in search of food as humans encroach into bear habitats. In the U.S., bears sometimes kill and eat farm animals. When bears come to associate human activity with a "food reward", they are likely to continue to become emboldened; the likelihood of human-bear encounters increases, as they may return to the same location despite relocation. The saying "a fed bear is a dead bear" has come into use to popularize the idea that allowing bears to scavenge human garbage, such as trash cans and campers' backpacks, pet food, or other food sources that draw the bear into contact with humans, can result in a bear's death.

Relocation of the bear has been used to separate the bear from the human environment, but it does not address the problem of the bear's newly learned association of humans with food or the environmental situations which created the human-habituated bear. "Placing a bear in habitat used by other bears may lead to competition and social conflict, and result in the injury or death of the less dominant bear."[92]

Yellowstone National Park, a reserve located in the western United States, contains prime habitat for the grizzly bear (Ursus arctos horribilis), and due to the enormous number of visitors, human-bear encounters are common. The scenic beauty of the area has led to an influx of people moving into the area. In addition, because there are so many bear relocations to the same remote areas of Yellowstone, and because male bears tend to dominate the center of the relocation zone, female bears tend to be pushed to the boundaries of the region and beyond. As a result, a large proportion of repeat offenders, bears that are killed for public safety, are females. This creates a further depressive effect on an already endangered species. The grizzly bear is officially described as "threatened" in the U.S. Though the problem is most significant with regard to grizzlies, these issues affect the other types of brown bears as well.

In Europe, part of the problem lies with shepherds; over the past two centuries, many sheep and goat herders have gradually abandoned the more traditional practice of using dogs to guard flocks, which have concurrently grown larger. Typically, they allow the herds to graze freely over sizeable tracts of land. As bears reclaim parts of their range, they may eat livestock. In some cases, the shepherds shoot the bear, thinking their livelihood is under threat. Many are now better informed about the ample compensation available, and will make a claim when they lose livestock to a bear.

It is likely that humans caused extinction of bear populations and fragmentation of their habitats since prehistorical time. It is, for instance, shown that bear populations from the Greater Caucasus and the Lesser Caucasus Mountains, separated by the densely populated Transcaucasian Depression, have been matrilineally isolated since the early Holocene era, i.e., after permanent human settlements appeared throughout the area[21]

Relationship with Native Americans[edit]

Gorgonia, a Native American (Mescalero Apache) man. He holds a bear pelt and wears moccasin boots, a breechcloth, kilt, and vest.

Native American tribes sympatric with brown bears often viewed them with a mixture of awe and fear. North American brown bears were so feared by the natives, that they were rarely hunted, especially alone. When natives hunted grizzlies, the expedition was conducted with the same preparation and ceremoniality as intertribal warfare, and was never done except with a company of 4–10 warriors. The tribe members who dealt the killing blow were highly esteemed among their compatriots. Californian natives actively avoided prime bear habitat, and would not allow their young men to hunt alone, for fear of bear attacks. During the Spanish colonial period, some tribes, instead of hunting grizzlies themselves, would seek aid from European colonists to deal with problem bears. Many authors in the American west wrote of natives or voyagers with lacerated faces and missing noses or eyes due to attacks from grizzlies.[13]

Sleeping Bear Dunes is named after a Native American legend, where a female bear and her cub swam across Lake Michigan. Exhausted from their journey, the bears rested on the shoreline and fell sound asleep. Over the years, the sand covered them up, creating a huge sand dune.

Many Native American tribes both respected and feared the brown bear, even thinking of it as a god.[93] One tale tells of how the black bear was a creation of the Great Spirit, while the grizzly was created by the Evil Spirit.[94] In Kwakiutl mythology, black and brown bears became enemies when Grizzly Bear Woman killed Black Bear Woman for being lazy. Black Bear Woman's children, in turn, killed Grizzly Bear Woman's own cubs.[95]

Bear encounters[edit]

There are an average of two fatal attacks by bears per year in North America.[96] In Scandinavia, there are only four known cases since 1902 of bear encounters which have resulted in death. The two most common causes for bear attack are surprise and curiosity.[97] Some types of bears, such as polar bears, are more likely to attack humans when searching for food, while American black bears are much less likely to attack.

The Alaska Science Center ranks the following as the most likely reasons for bear attacks:[97]

  1. Surprise
  2. Curiosity
  3. Invaded personal space (this includes a mother bear protecting her young)
  4. Predatory intent
  5. Hunting wounded
  6. Carcass defense
  7. Provoked charge

Aggressive behavior in brown bears is favored by numerous selection variables. Unlike the smaller black bears, adult brown bears are too large and have improperly shaped claws to escape danger by climbing trees, so they respond to danger by standing their ground and warding off their attackers. Increased aggressiveness also assists female brown bears in better ensuring the survival of their young to reproductive age.[98] Mothers defending cubs are the most prone to attacking, being responsible for 70% of brown bear-caused human fatalities in North America.[99]

Attacks on humans[edit]

Drum or barrel trap used to safely relocate bears; currently parked adjacent to a building in Grand Teton National Park in Wyoming, United States

Brown bears seldom attack humans on sight, and usually avoid people. They are, however, unpredictable in temperament, and may attack if they are surprised or feel threatened.[100] Sows with cubs account for the majority of injuries and fatalities in North America. Habituated or food-conditioned bears can also be dangerous, as their long-term exposure to humans causes them to lose their natural shyness, and, in some cases, to associate humans with food. Small parties of one or two people are more often attacked than large groups, with only one known case of an attack on a group of six or more. In that instance, it is thought that due to surprise, the bear may not have recognized the size of the group.[101] In the majority of attacks resulting in injury, brown bears precede the attack with a growl or huffing sound,[100] In contrast to injuries caused by American black bears, which are usually minor, brown bear attacks tend to result in serious injury and, in some cases, death.[100] Brown bears seem to confront humans as they would when fighting other bears: they rise up on their hind legs, and attempt to "disarm" their victims by biting and holding on to the lower jaw to avoid being bitten in turn.[13] Due to the bears' enormous physical strength, even a single bite or swipe can be deadly, as in tigers, with some human victims having had their heads completely crushed by a bear bite.[36] Most attacks occur in the months of July, August, and September, the time when the number of outdoor recreationalists, such as hikers or hunters, is higher. People who assert their presence through noises tend to be less vulnerable, as they alert bears to their presence. In direct confrontations, people who run are statistically more likely to be attacked than those who stand their ground. Violent encounters with brown bears usually last only a few minutes, though they can be prolonged if the victims fight back.[100]

Attacks on humans are considered extremely rare in the former Soviet Union, though exceptions exist in districts where they are not pursued by hunters.[18] Siberian bears, for example, tend to be much bolder toward humans than their shyer, more persecuted European counterparts. In 2008, a platinum mining compound in the Olyotorsky district of northern Kamchatka was besieged by a group of 30 bears, who killed two guards and prevented workers from leaving their homes.[102] Ten people a year are killed by brown bears in Russia.[103] In Scandinavia, only three fatal attacks were recorded in the 20th century.[104]

In Japan, a large brown bear nicknamed "Kesagake" (袈裟懸け, "kesa-style slasher") made history for causing the worst bear attack in Japanese history at Tomamae, Hokkaidō during numerous encounters during December, 1915. It killed seven people (including one pregnant woman) and wounded three others (with possibly another three previous fatalities to its credit) before being gunned down after a large-scale beast-hunt. Today, there is still a shrine at Rokusensawa (六線沢), where the event took place, in memory of the victims of the incident.

Within Yellowstone National Park, injuries caused by grizzly attacks in developed areas averaged approximately one per year during the 1930s through to the 1950s, though it increased to four per year during the 1960s. They then decreased to one injury every two years during the 1970s. Between 1980 and 2002, there have been only two human injuries caused by grizzly bears in a developed area. Though grizzly attacks were rare in the backcountry before 1970, the number of attacks increased to an average of approximately one per year during the 1970s, 1980s, and 1990s.[105]

History of defense from bears[edit]

A study by US and Canadian researchers has found pepper spray to be more effective at stopping aggressive bear behavior than guns, working in 92% of studied incidents versus 67% for guns.[106] Carrying pepper spray is highly recommended by many authorities when traveling in bear country; however, carrying two means of deterrent, one of which is a large caliber gun, is also advised. Solid shotgun slugs, or three buckshot rounds, or a pistol of .44 caliber or more is suggested if a heavy hunting rifle is not available. Guns remain a viable, last resort option to be used in defense of life from aggressive bears.[107] Too often, people do not carry a proper caliber weapon to neutralize the bear. According to the Alaska Science Center, a 12 gauge shotgun with slugs has been the most effective weapon. There have been fewer injuries as a result of only carrying lethal loads in the shotgun, as opposed to deterrent rounds. State of Alaska Defense of Life or Property (DLP) laws require one to report the kill to authorities, and salvage the hide, skull, and claws.[108]

Campers are often told to wear bright colored red ribbons and bells, and carry whistles to ward off bears. They are told to look for grizzly scat in camping areas, and be careful to carry the bells and whistles in those areas. Grizzly scat is difficult to differentiate from black bear scat, as diet is in a constant state of flux depending on the availability of seasonal food items. If a bear is killed near camp, the bear's carcass must be adequately disposed of, including entrails and blood, if possible. Failure to move the carcass has often resulted in it attracting other bears and further exacerbating a bad situation. Moving camps immediately is another recommended method.

A page at the State of Alaska Department of Natural Resources website offers information about how to "select a gun that will stop a bear (12-gauge shotgun or .300 mag rifle)." This information is helpful for people venturing into "bear country", regardless of state or country,

Culture[edit]

"The Story of the Three Bears", illustration from Childhood's Favorites and Fairy Stories

Brown bears often figure into the literature of Europe and North America, in particular that which is written for children. "The Brown Bear of Norway" is a Scottish fairy tale telling the adventures of a girl who married a prince magically turned into a bear, and who managed to get him back into a human form by the force of her love and after many trials and difficulties. With "Goldilocks and the Three Bears", a story from England, the three bears are usually depicted as brown bears. In German speaking countries, children are often told the fairytale of Snow White and Rose Red; the handsome prince in this tale has been transfigured into a brown bear. In the United States, parents often read their preschool age children the book Brown Bear, Brown Bear, What Do You See? to teach them their colors and how they are associated with different animals.

The Russian bear is a common national personification for Russia (as well as the former Soviet Union). The brown bear is also Finland's national animal.

Berni is a brown bear mascot of German football club Bayern Munich

The Bundesliga club Bayern Munich has a brown bear mascot named Berni.

The National Football League (NFL) franchise in Chicago, Illinois, is named the Bears. In this context, no differentiation between black and brown bears is needed.

The school mascot for George Fox University, Brown University, the University of California, Los Angeles, the University of California, Berkeley, the University of California, Riverside, and the University of Alberta is the brown bear.

The coat of arms of Madrid depicts a bear reaching up into a madroño or strawberry tree (Arbutus unedo) to eat some of its fruit, whereas the Swiss city of Bern's coat of arms also depicts a bear and the city's name is popularly thought to derive from the German word for bear.

In the town of Prats de Molló, in Vallespir, southern France, a "bear festival" (festa de l'ós) is celebrated annually at the beginning of spring, in which the locals dress up as bears, cover themselves with soot or coal and oil, and "attack" the onlookers, attempting to get everyone dirty. The festival ends with the ball de l'os (bear dance).

The grizzly bear is the state animal of Montana. The California golden bear is the state animal of California. Both animals are sub-species of the brown bear.

Legal status[edit]

  • The grizzly bear, sometimes called the silvertip bear, is listed as threatened in the contiguous United States. It is slowly repopulating in areas where it was previously extirpated, though it is still vulnerable.
  • The California golden bear (Ursus arctos californicus[109]) disappeared from the state of California in 1922, when the last one was shot in Tulare County. It is the official state animal.[110]
  • The Mexican grizzly bear is listed as an endangered species, but it may be extinct.
  • In Canada, it is listed as vulnerable in Alberta, British Columbia, Northwest Territories, and Yukon Territory. Prairie populations of grizzly bear are listed as extirpated in Alberta, Manitoba, and Saskatchewan.
  • The brown bear is a European Protected Species, given protection throughout the European Union.
  • The brown bear is the national animal of Finland.
  • The brown bear is depicted on the reverse of the Croatian 5 kuna coin, minted since 1993.

See also[edit]

References[edit]

  1. ^ McLellan, B. N., Servheen, C. & Huber, D. (2008). "Ursus arctos". IUCN Red List of Threatened Species. Version 2013.1. International Union for Conservation of Nature. Retrieved 2013-10-05. 
  2. ^ "Polar bear, (Ursus maritimus)" (PDF). U.S. Fish and Wildlife service. Retrieved 2008-03-22. "Appearance. The polar bear is the largest member of the bear family, with the exception of Alaska's Kodiak brown bears, which equal polar bears in size."  (Overview page)
  3. ^ a b c d e f g h i j k l m n o p "Mammalian Species- Ursus arctos" (PDF). American Society of Mammalogists, Smith College. Retrieved 2012-06-14. 
  4. ^ a b "Kodiak Brown Bear- Kodiak- U.S. Fish & Wildlife Service". U.S. Fish & Wildlife Service. Retrieved 2012-06-14. 
  5. ^ Boddington, Craig; illustrations by Carlson, Ken (2004). Fair Chase in North America. Boone and Crockett Club. p. 45. ISBN 0-940864-47-9. 
  6. ^ Himalayan brown bears now critically endangered 01-06-2014
  7. ^ White, Paul. "Brown Bear". Transylvania Wildlife Project. Archived from the original on 19 May 2013. Retrieved 13 January 2014. 
  8. ^ American Heritage Dictionary of the English Language: Fourth Edition. 2000.
  9. ^ Hunting the Grisly and other Sketches. FullTextArchive.com. Retrieved 2011-09-15.
  10. ^ Liddell, Henry George and Scott, Robert. "Ursus." A Latin Dictionary. Perseus Digital Library.
  11. ^ Liddell, Henry George and Scott, Robert."Arktos." A Greek-English Lexicon. Perseus Digital Library.
  12. ^ a b c d Bruce McLellan and David C. Reiner (1994). A Review of bear evolution Int. Conf. Bear Res. and Manage. 9(1):85–96
  13. ^ a b c Geist, Valerius (1989) "Did Large Predators keep Humans out of North America?", pp. 282–294 in Juliet Clutton-Brock (ed.) The Walking larder: patterns of domestication, pastoralism, and predation, Unwin Hyman, ISBN 0044450133.
  14. ^ U.S. Fish and Wildlife Service (2006-11-17). "Endangered and Threatened Wildlife and Plants; Designating the Greater Yellowstone Ecosystem Population of Grizzly Bears as a Distinct Population Segment; Removing the Yellowstone Distinct Population Segment of Grizzly Bears From the Federal List of Endangered and Threatened Wildlife" (PDF). Federal Register / Vol. 70, No. 221. pp. 69854–69884. Archived from the original on August 25, 2006. Retrieved August 1, 2006. 
  15. ^ a b Waits, L.P., et al. (1998). "Mitochondrial DNA Phylogeography of the North American Brown Bear and Implications for Conservation". Conservation Biology 12 (2): 408–417. doi:10.1111/j.1523-1739.1998.96351.x. 
  16. ^ Wozencraft, W. C. (2005). "Ursus arctos". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 588–589. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  17. ^ Ursus arctos, ITIS
  18. ^ a b c d e f g h i j k l m n o p q r Heptner, "Sirenia and carnivora (Sea cows; Wolves and Bears)",
  19. ^ a b c d e f g h i j k l m n o p q r s t Bear Anatomy and Physiology from Gary Brown's The Great Bear Almanac, Lyons & Burford, Publishers, 1993
  20. ^ a b Ursus arctos alascensis. Mammal Species of the World. Bucknell University.
  21. ^ a b c Murtskhvaladze, M.; Gavashelishvili, A.; Tarkhnishvili, D. (2010). "Geographic and genetic boundaries of brown bear (Ursus arctos) population in the Caucasus". Molecular Ecology 19 (9): 1829–1841. doi:10.1111/j.1365-294X.2010.04610.x. PMID 20345670.  edit
  22. ^ Ursus arctos alascensis Merriam, 1896. Integrated Taxonomic Information System (ITIS). 
  23. ^ Burt. Henry W. A Field Guide to the Mammals. Pg. 42.
  24. ^ a b Bear Conservation UK. "Stickeen Brown Bear". Retrieved 15 June 2013. 
  25. ^ Busch, Robert H. The Grizzly Almanac. New York, 2000, pg 122.
  26. ^ "Wild find: Half grizzly, half polar bear: Hunter bags what expert 'never thought would happen' in wild". MSNBC.MSN.com. May 11, 2006. Retrieved 2006-05-14. 
  27. ^ James Mallet (2008). "Hybridization, ecological races and the nature of species: empirical evidence for the ease of speciation". Philosophical Transactions of the Royal Society B 363 (1506): 2971–2986. doi:10.1098/rstb.2008.0081. PMC 2607318. PMID 18579473. 
  28. ^ Barnosky, Anthony D. (2009). Heatstroke: Nature in an Age of Global Warming. Washington, DC: Island Press/Shearwater Books. ISBN 1-59726-197-1. 
  29. ^ a b "La recuperació del rei dels boscos" (in Basque, Catalan, Galician, Spanish). Retrieved 2010-11-19. 
  30. ^ a b Valdiosera, C. E.; García, N.; Anderung, C.; Dalén, L.; Crégut-Bonnoure, E.; Kahlke, R. D.; Stiller, M.; Brandström, M.; Thomas, M. G. (2007). "Staying out in the cold: Glacial refugia and mitochondrial DNA phylogeography in ancient European brown bears". Molecular Ecology 16 (24): 5140–5148. doi:10.1111/j.1365-294X.2007.03590.x. PMID 18031475.  edit
  31. ^ Cuántos osos hay y dónde viven. Fundación Oso Pardo – distribution maps and population from 2008 (in Spanish)
  32. ^ DEPANA – detailed distribution maps and census information from 2009 (in Catalan).
  33. ^ The Cantabrian Brown Bear Ursus arctos arctos. picos-accommodation.co.uk.
  34. ^ a b c d e f g h i j k l m n o p q r s t Carnivores of the World by Dr. Luke Hunter. Princeton University Press (2011), ISBN 9780691152288
  35. ^ a b Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. ISBN 978-0-85112-235-9. 
  36. ^ a b ''The living animals of the world; a popular natural history with one thousand illustrations'' Volume 1: Mammals, by Cornish, C. J. (Charles John), 1858–1906; Selous, Frederick Courteney, 1851–1917; Johnston, Harry Hamilton, Sir, 1858–1927; Maxwell, Herbert, Sir, published by New York, Dodd, Mead and Company. Archive.org. Retrieved 2011-09-15.
  37. ^ John M. Rensberger (1999). "Enamel microstructural specialization in the canine of the spotted hyena, Crocuta crocuta". Scanning Microscopy 13 (2–3): 343–361. 
  38. ^ Brown bear. zoo.org
  39. ^ "Brown Grizzly or Brown Bear (Ursus arctos)". Mammals of Texas- Online Edition. Retrieved 2012-06-14. 
  40. ^ "Ursus arctos- Brown Bear species". Wildpro. Retrieved 2012-06-14. 
  41. ^ Busch, Robert H. The Grizzly Almanac. New York, 2000, Lyons Press. ISBN 1-59228-320-9.
  42. ^ a b c d e Macdonald, D.W.; Barrett, P. (1993). Mammals of Europe. New Jersey: Princeton University Press. p. 107. ISBN 0-691-09160-9. 
  43. ^ "Kodiak Bear Fact Sheet". Alaska Department of Fish and Game, Division of Wildlife Conservation. 2008. Archived from the original on 2010-03-10. Retrieved 2008-10-27. 
  44. ^ "Ancient bear made early migration". BBC News. November 12, 2004. Retrieved January 2, 2010. 
  45. ^ "Brown Bear | Species | WWF". WWF. 
  46. ^ "Brown Bear". Rolling Hills Wildlife Adventure. 
  47. ^ "Neixen quatre cries d'ós bru als Pirineus". elperiodico.cat (in Catalan; Spanish). 2 August 2010. Retrieved 2010-11-19. 
  48. ^ "Situació preocupant de l'ós bru als Pirineus". ecologistasenaccion.org (in Catalan). May 2010. Retrieved 2010-11-19. 
  49. ^ "Osos, el desafío de una población creciente". Abc.es (in Spanish). 
  50. ^ "Proact Local Campaigns: Carpathian Brown Bear". Archived from the original on 2004-03-24. Retrieved 2010-11-19. 
  51. ^ "Carpathian Brown Bear Management Plan [in Poland]". carpathianbear.pl. Archived from the original on 2011-08-13. Retrieved 2010-11-19. 
  52. ^ "Brown Bear – Population & Distribution: A Truly International Species". wwf.panda.org. Retrieved 2010-11-19. 
  53. ^ "Karhu". suurpedot.fi (in finnish). Retrieved 2010-10-22. 
  54. ^ Bear Online Information System for Europe. Kora.ch. Retrieved 2011-09-15.
  55. ^ "Brown Bear Research in Alaska". Alaska Department of Fish and Game. Retrieved April 2012. 
  56. ^ "Brown Bear Hunting in Russia". Russianbearhunt.com. Retrieved 2009-10-10. 
  57. ^ "Brown / Grizzly Bear Facts". North American Bear Center. 
  58. ^ Egbert, Allan L.; Stokes, Allen W.; Egbert, A. L. (1974). "The social behaviour of brown bears on an Alaskan salmon stream" (PDF). International Conference Bear Res. and Manage 3: 41–56. JSTOR 3872753. 
  59. ^ Stonorov, Derek and Stokes, Allen W. (1972) "Social Behavior of the Alaska Brown Bear" Panel 4: Bear Behaviour
  60. ^ Types of Bears – Information on Specific Bear Species (2009)
  61. ^ "Brown Bear Reproduction". Shadowofthebear.com. Archived from the original on May 1, 2008. Retrieved 2009-10-10. 
  62. ^ Bellemain, Eva; Swenson, Jon E.; Taberlet, Pierre (2006). "Mating Strategies in Relation to Sexually Selected Infanticide in a Non-Social Carnivore: The Brown Bear". Ethology 112 (3): 238–246. doi:10.1111/j.1439-0310.2006.01152.x. 
  63. ^ "Brown/Grizzly Bear Hunting in Alaska". Alaska Department of Fish and Game. 
  64. ^ "Alaska is bear territory!". Alaska Office of Economic Development. Dced.state.ak.us. Archived from the original on 2009-04-15. Retrieved 2009-10-10. 
  65. ^ "Yellowstone Grizzly Bears Eat 40,000 Moths a Day In August". Yellowstonepark.com. Retrieved 2009-10-10. 
  66. ^ Brown, Susan, A. "Inherited behavior traits of the domesticated ferret". weaselwords.com. Retrieved 29 January 2010. 
  67. ^ French, S. P.; French, M. G. (1990). "Predatory behavior of grizzly bears feeding on elk calves in Yellowstone National Park, 1986–1988" (PDF). International Conf. Bear Res. and Manage 8: 335–341. 
  68. ^ Jimenez, Michael D.; Asher, Valpa J.; Bergman, Carita; Bangs, Edward E. and Woodruff, Susannah P. (2008). "Gray Wolves, Canis lupus, Killed by Cougars, Puma concolor, and a Grizzly Bear, Ursus arctos, in Montana, Alberta, and Wyoming". The Canadian Field-Naturalist 122 (1): 76.  PDF.
  69. ^ Downey, Betsy. "Personal Encounter. Wolf-Grizzly interaction in Yellowstone National Park". International Wolf Center. Archived from the original on 2008-02-27. 
  70. ^ Murphy, Kerry M.; Felzien, Gregory S.; Hornocker, Maurice G. and Ruth, Toni K. (1998). "Encounter Competition between Bears and Cougars: Some Ecological Implications". Ursus. A Selection of Papers from the Tenth International Conference on Bear Research and Management, Fairbanks, Alaska, July 1995, and Mora, Sweden, September 1995: 55–60. JSTOR 3873109. 
  71. ^ ADW: Ursus arctos: Information. Arlis.org. Retrieved 2012-08-09.
  72. ^ Hornocker, M., and S. Negri (Eds.). (2009). Cougar: ecology and conservation. University of Chicago Press. Chicago, IL, ISBN 0226353443.
  73. ^ "Cougar vs Bears Accounts". Everything about the Cougar / Mountain Lion. 
  74. ^ "When the Lion fought the Bear: Interspecies Cage Fighting on the Mexican Border". History Banter. 
  75. ^ Sørensen, Ole; Mogens Totsås; Tore Solstad; Robin Rigg (2008). Predation by a Golden Eagle on a Brown Bear Cub 19 (2). pp. 190–193. doi:10.2192/08SC008.1. 
  76. ^ "Our Alaska: Grizzly vs. moose". Alaska Dispatch. Retrieved July 17, 2011. 
  77. ^ "Moose Moms Prefer Traffic to Grizzly Bears, Study Says". National Geographic. Retrieved October 12, 2007. 
  78. ^ Matthiessen, Peter; Hornocker, Maurice (2001). Tigers In The Snow. North Point Press. ISBN 0-86547-596-2. 
  79. ^ a b Kerley, Linda; Goodrich, John, and Miquelle, Dale. "Bears and tigers in the Far East" International Bear News. 5 (2): p. 4.
  80. ^ Mazak, Vratislav (2004) Der Tiger. Nachdruck der 3. Auflage von 1983. Westarp Wissenschaften Hohenwarsleben, ISBN 3-89432-759-6
  81. ^ Heptner, pp. 670–1
  82. ^ a b Heptner, p. 177
  83. ^ "Food habits of Amur tigers in the Sikhote-Alin Zapovednik and the Russian Far East, and implications for conservation". Journal of Wildlife Research 1: 138–147. 1996. 
  84. ^ Seryodkin, I. V., J. M. Goodrich, A. V. Kostyrya, B. O. Schleyer, E. N. Smirnov, L. L. Kerley, and D. G. Miquelle. 2005. Relationship between tigers, brown bears, and Himalayan black bears. pp. 156–163 in D. G. Miquelle, E. N. Smirnov, and J. M. Goodrich (eds.), Tigers of Sikhote-Alin Zapovednik: Ecology and Conservation. Vladivostok, Russia: PSP.
  85. ^ Heptner
  86. ^ Gunther, Kerry A.; Biel, Mark J.; Anderson, Neil and Watts, Lisette (2002). "Probable grizzly bear predation on an American black bear in Yellowstone National Park" (PDF). Ursus 13: 372–374. 
  87. ^ Seryodkin, Ivan V.; Kostyria, A. V.; Goodrich, J. M.; Miquelle, D. G.; Smirnov, E. N.; Kerley, L. L.; Quigley, H. B.; Hornocker, M. G. (2003). "Denning ecology of brown bears and Asiatic black bears in the Russian Far East". Ursus 14 (2): 153–161. JSTOR 3873015. 
  88. ^ The Intellectual observer: review of natural history, microscopic research, and recreative science, Groombridge, 1865
  89. ^ Adams, Andrew Leith Wanderings of a naturalist in India: the western Himalayas, and Cashmere, Edmonston and Douglas, 1867
  90. ^ Dough O'Hara Polar bears, grizzlies increasingly gather on North Slope. Anchorage Daily News. April 24, 2005
  91. ^ "ABC News: Grizzlies Encroaching on Polar Bear Country". Abcnews.go.com. Retrieved 2009-10-10. 
  92. ^ "Relocation". Get Bear Smart Society. Archived from the original on 2006-05-13. 
  93. ^ Native American Animal Symbols – The Bear. Support-native-american-art.com (2004-01-22). Retrieved 2011-09-15.
  94. ^ Folklore and Legends of the North American Indian compiled by Joshua B Lippincott, published by Abela Publishing Ltd, 2009, ISBN 0-9560584-6-9
  95. ^ Averkieva, Julia P. and Sherman, Mark A. (1992) Kwakiutl String Figures UBC Press, ISBN 0-7748-0432-7
  96. ^ Herrero, Stephen (2002) Bear Attacks: Their Causes and Avoidance, revised edition, Lyons Press, ISBN 158574557X.
  97. ^ a b Smith, Tom S. and Herrero, Steven. "Ursus arctos californicus". Alaska Science Center – Biological Science Office. Retrieved April 12, 2008. 
  98. ^ Why are grizzly bears more aggressive than our black bears?. Digital Collegian. April 27, 2004
  99. ^ Rogers, Lynn L. How Dangerous are Black Bears. bear.org
  100. ^ a b c d Herrero, Stepehen (1985) Bear Attacks: Their Causes and Avoidance, Hurtig Publishers Ltd./ Edmonton
  101. ^ Alaska bear attack: NOLS kids did a 'phenomenal job', Craig Medred, Alaska Dispatch, 26 July 2011
  102. ^ Bears besiege Russian mine after killing guards. The Times. 24 July 2008
  103. ^ Dinets, Vladimir. "Brown Bears of Russia". Archived from the original on 15 December 2012. Retrieved 2014-05-18. 
  104. ^ "Brown Bear (Ursus arctos))". Tooth & Claw. Archived from the original on 2008-05-16. Retrieved 2008-01-05. 
  105. ^ Bear Caused Human Injuries and Deaths In Yellowstone National Park. Yellowstone-bearman.com (2000-01-01). Retrieved 2011-09-15.
  106. ^ Smith, Herrero, DeBruyn, Wilde (2008). "Spray more effective than guns against bears: study". North American Bear Center. Archived from the original on 2011-01-01. Retrieved 2009-03-28. 
  107. ^ Smith, Tom S. "Brown Bear Projects at the Alaska Science Center". Alaska Science Center – Biological Science Office. Retrieved 2008-06-02. 
  108. ^ "Alaska State Troopers Press Release of Monday, November 19, 2007" (Case Number: 07-96958). Alaska Department of Public Safety. 2007-11-19. Archived from the original on April 17, 2008. Retrieved 2008-06-02. 
  109. ^ "Ursus arctos californicus Merriam, 1896". itis.gov. Retrieved April 1, 2008. 
  110. ^ "History and Culture – State Symbols". California State Library. Retrieved 23 September 2011. 

Bibliography[edit]

  • Heptner V.G. and Sludskii, A.A. (1992). Mammals of the Soviet Union, Volume II, Part 2. Leiden u.a.: Brill. ISBN 90-04-08876-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: GENERAL: Recent genetic studies of brown bears indicate that the traditional morphology-based taxonomy of brown bears is highly discordant with bear phylogeny as indicated by geographic patterns of mtDNA variation. Based on recent and permafrost-preserved Pleistocene material, there is no genetic (mtDNA) support for the validity of any of the commonly recognized North American subspecies (e.g., horribilis, middendorffi), and North American brown bears do not represent a distinct lineage with respect to brown bears in Northern Asia and Europe (Waits et al. 1998, Leonard et al. 2000, Barnes et al. 2002). If a subspecific name is to be applied to North American brown bears, it should be Ursus arctos arctos, a taxon whose range encompasses both North America and parts of Eurasia. This name has been adopted for North American brown bears by ITIS (http://www.itis.usda.gov/index.html), which lists U. a. horribilis and U. a. nelsoni as invalid because they are junior synonyms of U. a. arctos.

SPECIFICS: Based on electrophoretic data indicating that the Kodiak Island population is reproductively isolated from the mainland Alaska population, Allendorf et al. (1992) concluded that the Kodiak Island population may warrent subspecific recognition (i.e., as subspecies middendorffi). However, subsequent studies have revealed that the mtDNA sequence observed in all individuals from Kodiak Island is identical to sequences observed in brown bears from many regions in mainland Alaska and from northern Asia and Europe (Waits et al. 1998). MtDNA data also provide no support for a distinct taxonomic group on the Kenai Peninsula; all sequences from individuals sampled in this region group with other mainland Alaska bears. Cronin et al. (1991) also found that the two morphological forms of U. arctos, grizzly and coastal brown bears, do not cluster as distinct mtDNA lineages. Waits et al. (1998) suggested that the morphological differences used to define brown bear subspecies may represent phenotypic plasticity in differing environments rather than long-term genetic isolation.

Recent studies of mtDNA from permafrost-preserved material indicate that the Beringian brown bear population of 36,000 years ago included mtDNA sequences from three clades now restricted to local regions in North America (Leonard et al. 2000). Thus the geographical partitioning of mtDNA haplotypes in extant North American populations is a relatively recent event (a consequence of founder effects and lineage partitioning) rather than evidence of long history of isolation. Waits et al. (1998) had suggested that the North American clades of brown bears likely are evolutionarily significant units that should be managed separately for conservation, but the genetic data from the perma-frost preserved material raise doubts about this (Leonard et al. 2000).

Bears from Yellowstone National Park have less allozyme variation than do all other North American populations except for the Kodiak Island population. There are significant genetic differences between Cabinet-Yaak-Selkirk and Northern Continental Divide Ecosystem bears, but not between Yellowstone and Northern Continental Divide populations (Allendorf et al. 1992).

Western and eastern populations of brown bears in Europe comprise two distinct lineages that diverged about 850,000 years ago (Dorozynski, 1994, Science 263:175).

Various kinds of evidence (fossils, protein, mitochondrial DNA) indicate that the brown bear and polar bear are sister taxa, more closely related to each other than either is to the black bear (see Shields and Kocher 1991, Cronin et al. 1991). In fact, recent mtDNA data indicate that the brown bear is paraphyletic with respect to the polar bear (i.e., brown bears from certain areas are genetically more closely related to the polar bear than they are to other brown bears) (e.g, Waits et al. 1998, Barnes et al. 2002, and other sources cited therein).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!