Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Polar Bears prey mostly on Ringed Seals. In the spring, the pups are easy prey. They also hunt Bearded and Harp Seals, Walruses, Beluga, Narwhals, and sea ducks, and very occasionally eat small amounts of plant matter. They travel long distances to stay with pack ice, and fast for long periods of time if food is not available. In Hudson Bay, the ice melts by late July and the bears fast until November, when it freezes again. They do not drink water or urinate the whole time. Pregnant females, who enter dens to give birth, continue fasting for another four months, living only on stored fat for eight months. Cubs are born in December, and are ready to follow their mother out of the den and learn to hunt by March or April. They are independent when they are about two-and-a-half years old, at which point the female mates again.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the polar bear  More images, video and sound
  • Original description: Phipps, C.J., 1774.  A voyage towards the North Pole, p., 185.  J. Nourse, London, 253 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Polar bears are solitary mammals throughout most of the year, with the exception of breeding pairs and family groups (3). Populations, or stocks, of polar bears are distributed throughout the Arctic and have overlapping home ranges which are not defended, and may vary in size from a few hundred to over 300,000 square kilometres (3) (4). The main food source is ringed seals P. hispida, and, to a lesser degree, bearded seals (Erignathus barbatus). The polar bears capture seals when they surface to breathe, or hunt them in their lairs, where young seals are nurtured (3). Polar bears show some amazing adaptations to their Arctic life and are able to detect prey that are almost a kilometre away and up to a metre under the compacted snow, using their heightened sense of smell (2). They also feed opportunistically on walruses, belugas, narwhals, waterfowl and seabirds (2). When food is available these bears have a remarkable ability to devour large amounts of food rapidly, and are also metabolically unique in their ability to switch from a normal state to a slowed-down, hibernation-like condition at any time of year when there is less food available (3). For example, in Hudson Bay the ice melts completely by mid-July and, as it does not re-freeze until mid-November, pregnant females do not feed for 8 months. During this fasting time, they metabolise their fat and protein stores and recycle metabolic by-products. During periods of particularly cold weather polar bears may also fast, and are known to conserve energy by occupying temporary dens (3). Polar bears breed from late March to late May (2). Females nurse and care for their cubs for 2.5 years and are therefore only available for mating once the cubs are independent, every three years. As this means that only a third of females can breed each season there is intense competition by the males for females, which may explain why males are so large in size (3). Females must mate many times over a period of several weeks before ovulation and fertilisation are stimulated (induced ovulation), and breeding pairs remain together for one to two weeks to ensure successful mating. If the female's partner is displaced she may mate with more than one male at this time. Implantation of the fertilised egg is delayed until mid-September to mid-October, and the female gives birth to the young in a snow den some two to three months later (3). Two-thirds of litters are twins, and single litters and triplets are also born (3). Though the polar bear has low reproductive potential, individuals do live for a long time, and have been known to live for up to 30 years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The polar bear is the largest living land carnivore in the world today, with adult males growing up to 2.6 meters in length (2). The most well known of all bears, the polar bear is immediately recognisable from the distinctive white colour of its thick fur (2). The only unfurred parts of the body are the foot pads and the tip of its nose, which are black, revealing the dark colour of the skin underneath the pelt (3). The neck of the polar bear is longer than in other species of bears, and the elongated head has small ears. Polar bears have large strong limbs and huge forepaws which are used as paddles for swimming (3). The toes are not webbed, but are excellent for walking on snow as they bear non-retractable claws which dig into the snow like ice-picks (3). The soles of the feet also have small projections and indents which act like suction cups and help this bear to walk on ice without slipping (2). Females are about half the size of males, although a pregnant female with stored fat can exceed 500 kg in weight. Polar bear cubs weigh up to 0.7 kilograms at birth. They look similar in appearance to adults, though they have much thinner fur (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description of Ursus maritimus

Ursus maritimus is one scientific name for the polar bear. These white bears are native largely within the Arctic Circle encompassing the Arctic Ocean, its surrounding seas and surrounding land masses. It is the world\'s largest land carnivore along with the omnivorous Kodiak Bear. An adult male weighs around 350–680 kg (770–1,500 lb), while an adult female is about half that size. It can interbreed with the brown bear, leading some to conclude that this is not a separate species but falls inside Ursos arctos (brown or grizzly bears). Polar bears occupy a distinctive narrow ecological niche, well adapted to cold temperatures, for moving across snow, ice, and open water, and for hunting the seals which make up most of its diet. Although most polar bears are born on land, they spend most of their time at sea. Polar bears can hunt their preferred food of seals from the edge of sea ice, often living off fat reserves when no sea ice is present. The polar bear is classified as a vulnerable species, with eight of the nineteen polar bear subpopulations in decline. For decades, large scale hunting raised international concern for the future of the species but populations rebounded after controls and quotas began to take effect. For thousands of years, the polar bear has been a key figure in the material, spiritual, and cultural life of Arctic indigenous peoples, and polar bears remain important in their cultures.
Creative Commons Attribution 3.0 (CC BY 3.0)

David

Source: BioPedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White with black eyes, nose and lips; Long-legged, with prominent snout, and short ears
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Biology

A circumpolar white marine bear
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

Polar bears live throughout the ice-covered waters of the circumpolar Arctic, and their range is limited by the southern extent of sea ice. Although some occur in the permanent multi-year pack ice of the central Arctic basin, they are most common in the annual ice over the continental shelf and inter-island archipelagos that surround the polar basin. Polar bears that have continuous access to sea ice are able to hunt throughout the year. However, in those areas where the sea ice melts completely each summer, polar bears are forced to spend several months on land fasting on stored fat reserves until freeze-up. Use of land by polar bears during the ice-free season appears to be increasing in certain locations.

The species is found in Canada (Manitoba, Newfoundland, Labrador, Nunavut, Northwest Territories, Quebec, Yukon Territory, Ontario), Greenland/Denmark, Norway (including Svalbard), Russian Federation (North European Russia, Siberia, Chukotka, Sakha (Yakutia), Krasnoyarsk), United States (Alaska). Also, vagrants occasionally reach Iceland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Polar bears have a circumpolar distribution. They range throughout the arctic region surrounding the North Pole. The limits of their range are determined by the ice pack of the Arctic Ocean and the landfast ice of surrounding coastal areas. Bears have been reported as far south as the southern tips of Greenland and Iceland. During the winter, polar bears will range along the southern edge of the ice pack or northern edge of ice formed off the coasts of the continents. Pregnant females will overwinter on the coastlines where denning habitat is available for bearing young. During the summer, bears will remain at the edge of the receding ice pack or on islands and coastal regions that retain landfast ice. Six different populations are recognized as: Wrangel Island and western Alaska, northern Alaska, the Canadian Arctic archipelago, Greenland, Svalbard-Franz Josef Land, and Central Siberia.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native )

Other Geographic Terms: holarctic

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore and London: The Johns Hopkins University Press.
  • DeMaster, D., I. Stirling. 1981. *Ursus maritimus*. Mammalian Species, 145: 1-7.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circumpolar in Northern Hemisphere
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

European waters (ERMS scope), North West Atlantic, Spitsbergen
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Polar bears have a circumpolar distribution in the northern hemisphere, including the East Siberian, Laptev, Kara, and Barents seas of Russia; Fram Strait (the narrow strait between northern Greenland and Svalbard), Greenland Sea and Barents Sea of northern Europe (Norway and Greenland); Baffin Bay, which separates Canada and Greenland, through most of the Canadian Arctic archipelago and the Canadian Beaufort Sea; and the Chukchi and Beaufort seas west and north of Alaska (Amstrup 2003, USFWS 2008). The range encompasses portions of northern Canada (Northwest Territories to Labrador and Newfoundland), Greenland, Norway, northern Russian Federation (Krasnoyarsk, North European Russia, West Siberia, Yakutiya), Svalbard and Jan Mayen, and the United States (northern Alaska). Distribution in most areas changes with the seasonal extent of sea-ice cover. The species in now excluded by humans from some parts of the historical southern portion of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (AK), Canada, Russia, Denmark (Greenland), Norway

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This bear is found throughout the circumpolar Arctic on ice-covered waters, from Canada, to Norway, parts of the US, the former USSR and Greenland (Denmark). The furthest south the polar bears occur all year round is James Bay in Canada, which is about the same latitude as London (2). During the winter, when the ice extends further south, polar bears move as far south as Newfoundland and into the northern Bering Sea (2). They rarely enter the zone of the central polar basin as there is thick ice all year round and there is little to eat (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The body of a polar bear is large and stocky, similar to that of a brown bear, except it lacks the shoulder hump. The head is relatively smaller than the heads of other bears and the neck is elongated. At the shoulder a polar bear can measure 1.6 m in height. Adult males weigh between 300-800 kg (660-1760 lbs) and can reach 2.5 m in length from tip of nose to tip of tail. Females are smaller, weighing 150 to 300 kg (330 to 660 lbs) and measuring 1.8 to 2 m in length. The pelage generally has a white appearance, but it can be yellowish in the summer due to oxidation or may even appear brown or gray, depending on the season and light conditions. Polar bear skin is black and the fur is actually clear, lacking in pigment. The white appearance is the result of light being refracted from the clear hair strands. The forepaws are broad and make excellent paddles while swimming. The soles of both hind and fore feet are furred for insulation and traction while walking on ice and snow. Polar bears have a plantigrade gait. Females have four functional mammae.

Range mass: 150 to 800 kg.

Range length: 180 to 250 cm.

Other Physical Features: endothermic ; heterothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Males are about twice the size of females.

Length:
Range: 2,300-2,600 mm males; 1,900-2,100 mm females

Weight:
Range: "400-600 kg males; 175-300 kg females (350-500 kg when pregnant) "
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 285 cm

Weight: 800000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Polar bears occur at low densities throughout their range and are most abundant in shallow water areas near shore or where currents or upwellings increase biological productivity near ice areas associated with open water, polynyas or lead systems. Polar bears are not as abundant in the high central arctic over deeper waters of the polar basin.

Seasonally, in the summer open water season in the Canadian arctic islands and Svalbard, and in recent years during the fall in northern Alaska and Russian Chukotka, polar bears may be found on land in higher densities.

Breeding occurs in March to May, implantation is delayed until autumn, and birth is generally thought to occur from late November to mid-January. Although some cubs are born in earth dens, most births occur in snow dens that may be occupied between 5?6 months during the maternal event. In Alaska the maternal dens are located on the offshore sea ice. Only pregnant female polar bears den for this protracted period of time, during which time they rely on fat stores for energy and sustenance. The average litter size is less than two. Cubs are dependent upon mothers until after the start of their third year of life. Age of first reproduction is normally 5?6 years for females. These factors contribute to the low reproductive potential for the species.

Systems
  • Terrestrial
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Polar bears are considered by many to be marine mammals. The name Ursus maritimus means maritime bear. Their preferred habitat is the pack ice of the Arctic Ocean. The ice edge and pressure ridges where fractures and refreezing occur provide the best hunting ground. Bears will travel as much as 1,000 km north and south, as the ice melts and freezes. During summer bears may remain on islands or coastlines with landfast ice, drift on ice flows, or get stranded on land where they are forced to endure warm weather.

Range elevation: 0 (low) m.

Average elevation: 0 m.

Habitat Regions: polar ; terrestrial ; saltwater or marine

Terrestrial Biomes: tundra ; icecap

Aquatic Biomes: coastal

  • Stirling, I., E. McEwan. 1975. The caloric value of whole ringed seals (*Phoca hispida*) in relation to polar bear (*Ursus maritimus*) ecology and hunting behavior. Canadian Journal of Zoology, 53: 1021-1027.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 25 specimens in 1 taxon.
Water temperature and chemistry ranges based on 10 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 0.297 - 0.745
  Nitrate (umol/L): 0.703 - 2.388
  Salinity (PPS): 32.124 - 32.916
  Oxygen (ml/l): 7.926 - 8.105
  Phosphate (umol/l): 0.529 - 0.576
  Silicate (umol/l): 1.929 - 4.631

Graphical representation

Temperature range (°C): 0.297 - 0.745

Nitrate (umol/L): 0.703 - 2.388

Salinity (PPS): 32.124 - 32.916

Oxygen (ml/l): 7.926 - 8.105

Phosphate (umol/l): 0.529 - 0.576

Silicate (umol/l): 1.929 - 4.631
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Polar bears are closely tied to arctic pack ice. They prefer areas with ice that is periodically active, such as at the interface of landfast ice and drifting pack ice along the arctic coasts or near polynyas. Polar bears show a preference for sea ice located over and near the continental shelf, likely due to higher biological productivity in these areas and greater accessibility to prey in near-shore shear zones and polynyas (areas of open sea surrounded by ice) compared to deep-water regions in the central polar basin; they are most abundant near the shore in shallow-water areas, and also in other areas where currents and ocean upwelling increase marine productivity and serve to keep the ice cover from becoming too consolidated in winter (see USFWS 2008 for specific sources of this information).

Sometimes polar bears wander inland as much as 150 km from the coast. In the Bering and Chukchi Seas, Alaska, where sea ice melts in summer, bears migrate up to 1,000 km to remain with the southern ice boundary (Garner et al. 1990, 1994 in Amstrup 2003); in Hudson Bay, James Bay and parts of the Canadian Arctic, bears may be forced onto land for up to several months when sea ice melts in summer (Jonkel et al. 1976, Lunn et al. 1997 in Amstrup 2003). During ice-free period along western Hudson Bay, adult males occupy the coast while family groups and pregnant females occur farther inland. Pregnant females remain on or near land in dens through winter while males and non-breeders winter on sea ice. On land, range of subadults overlaps that of adult males (Derocher and Stirling 1990).

Female denning habitat may be found in mountain, fjord, or even relatively flat tundra areas, but generally it is near the coast and contains microhabitats which catch and collect snow in fall and early winter (Amstrup 2003). While most denning occurs on coastlines, bears may also den on drifting pack ice and on land-fast ice adjacent to shore (Amstrup and Gardner 1994). Females typically dig maternity dens in a hillside snowbank (in southwestern Hudson Bay, however, pregnant females commonly overwinter in earth dens 20-100 km from the coast). Dens often are built within 8 km of coast and rarely more than 48 km offshore (though sometimes in active offshore pack ice as much as 550 km north of Alaskan coast). Polar bears exhibit a general fidelity to denning areas and even after months of long-distance passive transportation on sea ice females often return to specific den habitats (Amstrup 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pan-Arctic, associated with sea ice; Seasonal movement (north with receding ice edge)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The preferred habitat is the annual ice near the coastlines of continents and islands, where there are large numbers of ringed seals (Phoca hispida), on which these bears feed (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Movements associated with distribution and movement of sea ice. In some areas makes extensive north-south migrations (DeMaster and Stirling 1981) that are dependent on seasonal melting and freezing of nearshore ice (Amstrup 2003). Moves south with drifting ice flows in spring/summer, north along shore in summer after ice breakup. See Amstrup (1995) for extensive information on movements in the Chukchi and Beaufort Seas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Polar bears are carnivores. In the summer, they may consume some vegetation but gain little nutrition from it. Their primary prey are ringed seals (Pusa hispida). They also hunt bearded seals (Erignathus barbatus), harp seals (Pagophilus groenlandicus), hooded seals (Cystophora cristata), walruses (Odobenus rosmarus), sea birds and their eggs, small mammals, fish and scavenge on carrion of seals, walruses, or whales. Bears often leave a kill after consuming only the blubber. The high caloric value of blubber relative to meat is important to bears for maintaining an insulating fat layer and storing energy for times when food is scarce. Polar bears do not store or cache unconsumed meat as other bears do.

Polar bears have two hunting strategies. Still-hunting is used predominately. This involves finding a seal's breathing hole in the ice and waiting for the seal to surface to make the kill. When a bear sees a seal basking out of the water it will use a stalking technique to get close, then make an attempt at catching it. One stalking technique is crouching and staying out of sight while creeping up on the seal. Another technique is to swim through any channels or cracks in the ice until it is close enough to catch the seal. Using this technique a bear may actually dive under the ice and surface through the breathing hole in order the surprise the seal and eliminate its escape route. Feeding usually occurs immediately after the kill has been dragged away from the water. Polar bears consume the skin and blubber first and the rest is often abandoned. Other polar bears or arctic foxes then scavenge these leftovers. After feeding, polar bears will wash themselves by licking and rinsing their fur.

Animal Foods: birds; mammals; fish; eggs; carrion

Plant Foods: leaves

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Seals are primary food source; especially ringed, also bearded and harp seals. May hunt larger animals such as beluga whales and walruses and consumes fish, small mammals, bird eggs and sometimes vegetation, especially in summer when other food is unavailable. Pregnant females may fast for 8 months while in maternal dens (Derocher et al. 1992, Amstrup 2003). Reportedly are surplus killers, but do not normally cache prey they have killed. They consume the highest-fat portions of seals first and young or smaller bears may be driven away from kills by larger bears (Amstrup 2003). This species apparently digests fat more easily than protein and uses metabolic water released from fat metabolism, an efficient adaptation to the arctic environment where energy is otherwise required to melt ice and snow to make water available (Amstrup 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Carnivore, eats seals, predominantly the ringed & bearded
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Polar bears are a top carnivore of the arctic. The remains of seal kills left unconsumed by bears are likely an important source of food for younger, less-experienced polar bears and for Artic foxes.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Humans and other polar bears are the only predators of Ursus maritimus. Male polar bears may prey on cubs if they come into contact. Females with cubs tend to avoid other bears for this reason. Historically, polar bears have been hunted by the native peoples of the arctic for fur and meat. Commercial and sport hunting of polar bears increased in the 1900s as the price of pelts reached as much as $3000.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Ursus maritimus is prey of:
Homo sapiens
Ursus maritimus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Ursus maritimus preys on:
Phocidae
Actinopterygii
Aves
Mammalia
Delphinapterus leucas
Monodon monoceros
Ursus maritimus
Phoca largha

Based on studies in:
Norway: Spitsbergen (Coastal)

This list may not be complete but is based on published studies.
  • V. S. Summerhayes and C. S. Elton, Contributions to the ecology of Spitsbergen and Bear Island, J. Ecol. 11:214-286, from p. 232 (1923).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Based on movement patterns and spatial segregation with limited interchange, the IUCN/SSC Polar Bear Specialist Group and USFWS (2008) recognized 19 relatively discrete (but variously overlapping) populations or management units (Stirling 1991, Amstrup 2003), which correspond with major occupied ecogeographic units.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 - 100,000 individuals

Comments: Total population is 20,000-25,000 (see USFWS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Generally solitary or in female-offspring groups; aggregations of adult males occur during ice-free period along western Hudson Bay. Sometimes wanders long distances but usually stays in one general area from one year to the next (Reeves et al. 1992). Few predators except man, sometimes killer whale. Unlike other bears, only pregnant females winter in dens; denning is seen as a reproductive strategy (providing a protective environment for young) as opposed to a foraging strategy as it is with other bears, since seal prey is available year-round (Amstrup 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like other bear species, polar bears have a keen sense of smell and use their sensitive lips and whiskers to explore objects. They vision and hearing are not exceptionally well developed. Polar bears use a "chuffing" sound as a form of greeting.

Communication Channels: tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Most active during the first third of the day (DeMaster and Stirling 1981). Pregnant females are dormant in winter dens from autumn to spring, when young are able to survive outside. Variable snow and ice conditions determine when females enter and exit den sites (Amstrup 2003). In the Beaufort Sea, den entry dates averaged mid-November and den exit dates were late March/early April (Amstrup and Gardner 1994 in Amstrup 2003). Mean den entry for the Canadian Arctic was September 17 and mean den exit March 21 (Messier et al. 1994, in Amstrup 2003). Molting commences in April to May and shorter summer coats are achieved by late summer (Amstrup 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

0.3m (10 inch) at birth, 0.5-1kg (1-2 lbs); Sexually mature at 4-8 years; Cubs born in dens midwinter; 28 months lactation; Longevity 25-30 years; Behavior; Usually solitary, except female-cub groups; Pregnant females den in winter; Dive to approach basking seals at floe edge
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild polar bears are estimated to live 25 to 30 years. Annual adult mortality is estimated to be 8-16%. In captivity a female was still alive at 45 years in old at the Detroit Zoo in 1999.

Range lifespan

Status: wild:
25 to 30 years.

Average lifespan

Status: wild:
30.0 years.

Average lifespan

Status: captivity:
38.2 years.

Average lifespan

Status: wild:
25.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43.8 years (captivity) Observations: Like in other species of bears, there is a delayed implantation of the fertilized eggs. That extends the pregnancy to 195-265 days (Ronald Nowak 1999). A wild born female kept in captivity at the Detroit Zoo was about 43.8 years of age when she died (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Polar bears have a sequential polygynous mating system. Male and female breeding pairs remain together for a short time while females are in estrus (3 days).

Mating System: polygynous

Mating occurs in late winter and early spring, from March to June. Delayed implantation extends gestation to 195 to 265 days. Pregnant females establish a winter den on land dug into the snow usually within 8 km of the coast in October or November. An average of 2 cubs are born in the mother's den between November and January, litter sizes can range from 1 to 4. She remains in hibernation, nursing her cubs until April. The mortality rate for cubs is estimated to be 10-30%. The average annual rate of reproduction calculated by DeMaster and Stirling (1981) was 0.274 females per adult female.

Breeding interval: Females breed yearly.

Breeding season: Breeding occurs from March to June.

Range number of offspring: 1 to 4.

Average number of offspring: 2.

Range gestation period: 195 to 265 days.

Range weaning age: 24 to 36 months.

Range age at sexual or reproductive maturity (female): 3.5 (low) years.

Average age at sexual or reproductive maturity (female): 5-6 years.

Range age at sexual or reproductive maturity (male): 3.5 (low) years.

Average age at sexual or reproductive maturity (male): 5-6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 665 g.

Average number of offspring: 2.

Cubs are born with their eyes closed; they have a good coat of fur and weigh about 600 grams. They will emerge from the den in spring weighing 10 to 15 kg. Mothers provide all parental care of their offspring. The cubs remain with their mother for 2 to 3 years. They will not reach sexual maturity until 5 to 6 years old.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Nowak, R. 1999. Walker's Mammals of the World. Baltimore and London: The Johns Hopkins University Press.
  • DeMaster, D., I. Stirling. 1981. *Ursus maritimus*. Mammalian Species, 145: 1-7.
  • Ramsey, M., I. Stirling. 1988. Reproductive biology and ecology of female polar bears (*Ursus maritimus*). Journal of Zoology, 214: 601-634.
  • Stirling, I., E. McEwan. 1975. The caloric value of whole ringed seals (*Phoca hispida*) in relation to polar bear (*Ursus maritimus*) ecology and hunting behavior. Canadian Journal of Zoology, 53: 1021-1027.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males reach sexual maturity at 3 years in Alaska, at age 4 in many parts of the Canadian Arctic, and at age 5 in the Beaufort Sea, but these younger males may not actually breed due to competition with prime males (>10 years old) (Stirling et al. 1976, 1977b, 1980, 1984 in Amstrup 2003); few males breed successfully until about 6 years old. Females generally are sexually mature in 3-6 years. Breeding occurs from late March to mid-May, with implantation delayed until autumn; gestation period is 195-265 days (DeMaster and Stirling 1981). Two cubs (sometimes 1 or 3) are born December-January (mid-November to mid-December along western Hudson Bay). Newborn cubs are totally helpless, among the least developed of placental mammal young, weighing 600-700 grams. Emergence from maternity dens occurs toward the end of March in Hudson and James bays, in April in Alaska. Young are weaned at approximately 24-28 months. Reproductive rate is low; adult females produce young every 3 years in most areas, in alternate years at lower Hudson Bay (Stirling 1991). Along western Hudson Bay, there was a high degree of reproductive failure; 33% of females classified as pregnant were not accompanied by cubs the following year; annual pregnancy rate of solitary females was 82-100%; pregnancy rates drop off for most females of 21 years or older, but some older females retain reproductive competency through life (Derocher et al. 1992). Generation time is about 15 years (see USFWS 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Fur provides insulation: polar bear
 

Hair of polar bear insulates it from cold because it has low emissivity in infrared.

     
  "Polar bears are masters at conserving energy. During their eight-month fast, breeding females can lose as much as 45 percent of their weight. So heat retention is important, to avoid spending too much energy to keep warm. The bears' fur is dense, made of clear hairs that scatter light, creating a white effect. Underneath the fur lies black skin that absorbs the sun's rays…polar bears are nearly invisible in the far infrared, the frequency range in which bodies radiate heat. Researchers from Berkeley's Department of Mechanical Engineering, led by professors Boris Rubinsky and Ralph Greif, found that the conventional explanation, that the bears are so well-insulated that their surfaces are the same temperature as the snow, is correct but incomplete: the hair's emissivity in the infrared is also nearly equal to that of snow and that this low emissivity could help to insulate the bears by lowering the amount of infrared heat that the bears radiate away." (Courtesy of the Biomimicry Guild)
  Learn more about this functional adaptation.
  • Preciado JA; Rubinsky B; Otten D; Nelson B; Martin MC; Greif R. 2002. Radiative properties of polar bear hair. Proceedings of the ASME International Mechanical Engineering Congress and Exposition. BED-53: 1-2.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Functional adaptation

Paws have non-slip grip: polar bears
 

The paws of polar bears grip ice well due to the rough surface of their pads.

     
  "A polar bear spends the winter living on sea ice—ice formed when the ocean freezes. But the bear has no trouble keeping its footing on slippery ground. Its paws are perfect for getting around on a slick, cold surface. Rough pads give it a nonslip grip, and thick fur between the pads keeps the bear’s feet warm. It uses the sharp, curved claws on its front paws like hooks to climb onto the ice from the water. Polar bears' claws also help them dig in the ice when they hunt seals." (Kranking 2001)
  Learn more about this functional adaptation.
  • Kathy Kranking. 2001. Bear Necessities: How Polar Bears Survive the Deep Freeze. National Geographic Kids Magazine [Internet], Accessed 9/24/2007.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ursus maritimus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGGTGATTATTCTCTACGAACCATAAAGACATTGGCACCCTTTATCTTCTGTTCGGTGCATGAGCCGGAATAGTGGGCACTGCCCTCAGCCTTTTAATTCGTGCCGAGCTGGGTCAGCCCGGGGCTCTGTTGGGGGATGATCAGATCTACAATGTAGTCGTAACTGCCCATGCATTCGTGATAATCTTCTTCATAGTTATGCCTATTATAATTGGGGGATTCGGGAACTGATTAGTGCCTTTGATGATCGGTGCCCCCGACATAGCGTTCCCTCGAATAAATAACATAAGCTTCTGGTTGCTGCCACCATCTTTCTTACTGCTTCTGGCCTCCTCTATGGTAGAAGCAGGTGCAGGGACTGGATGAACTGTCTACCCTCCTCTAGCGGGTAATCTGGCCCATGCAGGAGCATCAGTAGACTTAACAATCTTTTCTCTGCACCTAGCAGGCATCTCTTCTATTCTGGGGGCTATCAATTTCATCACTACTATTATTAACATGAAACCCCCTGCAATATCTCAATATCAAACCCCTCTGTTTGTATGATCAGTCCTAATCACAGCAGTACTTCTTCTTTTATCTCTGCCAGTCTTAGCAGCTGGGATTACTATACTACTTACAGATCGAAACCTTAACACTACCTTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACACTTGTTCTGATTCTTCGGACACCCTGAGGTTTACATTCTAATCCTTCCTGGGTTCGGAATGATCTCTCACATTGTTACTTATTATTCAGGAAAAAAAGAACCTTTTGGCTATATAGGAATAGTCTGAGCGATAATATCCATTGGATTCTTAGGATTTATCGTGTGAGCTCATCATATGTTTACCGTAGGTATAGACGTTGACACACGAGCTTACTTCACTTCAGCTACCATAATTATTGCTATCCCGACAGGAGTCAAAGTATTTAGCTGACTAGCCACTCTGCACGGAGGGAATATTAAATGATCTCCCGCTATGATGTGAGCCCTGGGCTTTATTTTCCTGTTTACAGTAGGAGGCCTTACGGGAATTGTCCTAGCTAATTCATCTCTAGACATCGTTCTCCATGACACGTACTATGTGGTAGCCCATTTTCACTACGTGCTGTCAATGGGAGCTGTTTTCGCCATCATAGGAGGATTTGTCCACTGATTCCCACTATTCTCAGGCTACACACTTAATAACACATGAGCAAAAATTCACTTTATAATTATATTCATTGGGGTTAATATGACATTCTTTCCTCAGCATTTTCTAGGCCTGTCAGGAATACCTCGGCGATATTCCGACTATCCAGATGCCTATACAACATGAAACACAGTATCTTCTATAGGCTCATTTATTTCACTAACAGCAGTTATGCTAATAATTTTCATGATTTGGGAGGCCTTCGCATCAAAACGAGAGGTGGCAGTGGTAGAACTTACCTCAACCAACATTGAATGACTACACGGATGCCCTCCTCCATATCACACATTCGAAGAACCTGCCTACGTTACACTAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ursus maritimus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 29
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A3c

Version
3.1

Year Assessed
2008

Assessor/s
Schliebe, S., Wiig, Ø., Derocher, A. & Lunn, N. (IUCN SSC Polar Bear Specialist Group)

Reviewer/s
Derocher, A.E. & Born, E.W. (Polar Bear Red List Authority)

Contributor/s

Justification
The assessment is based on a suspected population reduction of >30% within three generations (45 years) due to decline in area of occupancy (AOO), extent of occurrence (EOO) and habitat quality.

Polar bears rely almost entirely on the marine sea ice environment for their survival so that large scale changes in their habitat will impact the population (Derocher et al. 2004). Global climate change posses a substantial threat to the habitat of polar bears. Recent modeling of the trends for sea ice extent, thickness and timing of coverage predicts dramatic reductions in sea ice coverage over the next 50?100 years (Hassol 2004). Sea ice has declined considerably over the past half century. Additional declines of roughly 10?50% of annual sea ice are predicted by 2100. The summer sea ice is projected to decrease by 50?100% during the same period. In addition the quality of the remaining ice will decline. This change may also have a negative effect on the population size (Derocher et al. 2004). The effects of sea ice change are likely to show large differences and variability by geographic location and periods of time, although the long term trends clearly reveal substantial global reductions of the extent of ice coverage in the Arctic and the annual time frames when ice is present.

While all bear species have shown adaptability in coping with their surroundings and environment, polar bears are highly specialized for life in the Arctic marine environment. Polar bears exhibit low reproductive rates with long generational spans. These factors make facultative adaptation by polar bears to significantly reduced ice coverage scenarios unlikely. Polar bears did adapt to warmer climate periods of the past. Due to their long generation time and the current greater speed of global warming, it seems unlikely that polar bear will be able to adapt to the current warming trend in the Arctic. If climatic trends continue polar bears may become extirpated from most of their range within 100 years.

There is little doubt that polar bears will have a lesser AOO, EOO and habitat quality in the future. However, no direct relation exists between these measures and the abundance of polar bears. While some have speculated that polar bears might become extinct within 100 years from now, which would indicate a population decrease of >50% in 45 years based on a precautionary approach due to data uncertainty. A more realistic evaluation of the risk involved in the assessment makes it fair to suspect population reduction of >30%.

Other population stress factors that may also operate to impact recruitment or survival include toxic contaminants, shipping, recreational viewing, oil and gas exploration and development. In addition to this comes a potential risk of over-harvest due to increased quotas, excessive quotas or no quotas in Canada and Greenland and poaching in Russia.

This assessment was reviewed by all the participants at the 14th Working Meeting of the IUCN SSC Polar Bear Specialist Group held in Seattle, Washington, USA during June 20-24, 2005.

History
  • 2006
    Vulnerable
    (IUCN 2006)
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
  • 1982
    Vulnerable
    (Thornback and Jenkins 1982)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Polar bear populations were recently considered to be stable or growing in some areas. In 1993, the estimated world population was 21,470 to 28,370 bears. In 1972, the United States Marine Mammal Protection Act prohibited all hunting, except for subsistence, of polar bears in the U.S. In 1973 the United States, Russia, Norway, Canada, and Denmark came to an agreement to protect polar bear habitat, limit hunting, and cooperate on research. Polar bear populations are currently threatened by trends in global warming, which continues to decrease the extent of their habitat (pack ice) and their prey base. In 2008 the U.S. Fish and Wildlife Service listed polar bears as threatened. The IUCN lists Ursus maritimus as vulnerable.

US Federal List: threatened

CITES: appendix ii

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Restricted to high northern latitudes; total population size 20,000-25,000, in about 19 relatively discrete major populations; global warming effects on sea ice are projected to result in major declines in polar bear distribution and abundance over the foreseeable future.

Intrinsic Vulnerability: Highly vulnerable

Environmental Specificity: Narrow. Specialist or community with key requirements common.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Threatened
Date Listed: 05/15/2008
Lead Region:   Alaska Region (Region 7) 
Where Listed:


Population detail:

Population location: entire
Listing status: T

For most current information and documents related to the conservation status and management of Ursus maritimus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are nineteen hypothesized subpopulations or stocks which number in total 20,000 to 25,000 bears. Considerable overlap of putative populations occurs and genetic differences among them are small.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: USFWS (2008) reviewed available trend data and concluded that two polar bear populations are increasing (Viscount Melville Sound and M'Clintock Channel; both were severely reduced in the past and are recovering under conservative harvest limits); six populations are stable (Northern Beaufort Sea, Southern Hudson Bay, Davis Strait, Lancaster Sound, Gulf of Bothia, Foxe Basin); five populations are declining (Southern Beaufort Sea, Norwegian Bay, Western Hudson Bay, Kane Basin, Baffin Bay); and six populations are designated as data deficient (Barents Sea, Kara Sea, Laptev Sea, Chukchi Sea, Arctic Basin, East Greenland) with no estimate of trend. The two populations with the most extensive time series of data, Western Hudson Bay and Southern Beaufort Sea, were both considered to be declining.

Within the foreseeable future (determined by USFWS 2008 to be 45 years, which is equivalent to three generations), the polar bear is likely to experience a significant decline, primarily as a result of loss of sea ice (USFWS 2008). The projected rate of decline is uncertain but likely will exceed 30 percent over three generations (IUCN SSC Polar Bear Specialist Group).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The Intergovernmental Panel on Climate Change and the Arctic Climate Impact Assessment have both predicted that the Arctic is extremely vulnerable to projected climate change. Polar bears will likely be shifted pole-ward if the sea ice retreats. According to new scenarios presented by the Nansen Environmental and Remote Sensing Centre and others, the polar ice cap will disappear almost entirely during summer in the next 100 years.

The increasing changes in the sea ice that affect access to prey will have a negative effect on the bears. With less food, polar bears will fail to reproduce more often and give birth to smaller young that have higher mortality rates.

Polar bears may be forced on shore for extended periods and rely on fat reserves deposited the previous spring for survival. In such a situation they will be increasingly vulnerable to hunting if not regulated. If these periods become excessively long, mortality will increase. Sea ice is also used for access to den areas and if ice patterns change, existing den areas may be unreachable. Warmer temperatures and higher winds may reduce ice thickness and increase ice drift. Because polar bears must walk against the moving ice (like walking the wrong way on an escalator) increased ice movements will increase energy use and reduce growth and reproduction.

Polar bears are the apex predator and are exposed to high levels of pollutants that are magnified with each step higher in the food web. A key characteristic of the pollutants is that they tend to persist in the environment and resist degradation. Many of the organochlorine pollutants are lipophilic or "fat loving" and bond tightly to fat molecules. Polar bears are particularly vulnerable to organochlorines because they eat a fat rich diet. Ringed, bearded, and harp seals comprise the main food of polar bears and the blubber layer is preferentially eaten by the bears and subsequently, the intake of pollutants is high.

Certain areas of the Arctic, such as northeastern Greenland, the Barents Sea and the Kara Sea, have higher levels of pollutants. Based on studies in other species, it is reasonable to believe that the pollutant load of polar bears in some areas are negatively affecting the immune system, hormone regulation, growth patterns, reproduction, and survival rates of polar bears. Recent studies have suggested that the immune system is weaker in polar bears with higher levels of PCBs. A major concern with polar bears pertains to their reproductive system. There are suggestions that species with delayed implantation are more vulnerable to the effects of pollution through endocrine (hormone) disruption. Further, female polar bears are food deprived during gestation their pollution loads increase because as they use their fat stores, where pollutants are stored, for energy. Because the cubs are nursed on fat rich milk, the cubs are exposed to very high pollution loads from their mother.

Oil development in the Arctic poses a wide range of threats to polar bears ranging from oil spills to increased human-bear interactions. It is probable that an oil spill in sea ice habitat would result in oil being concentrated in leads and between ice floes resulting in both polar bears and their main prey (ringed and bearded seals) being directly exposed to oil. Another concern is that seals covered in oil may be a major source of oil to polar bears. Other studies suggest that polar bears are sensitive to disturbance at maternity den sites. Disturbance could occur both when a pregnant female is selecting a den site and during the winter-spring after the cubs are born. If exploration or development occurred sufficiently close to a den, the mother may abandon the den prematurely or abandon her offspring.

Over-harvest is an ongoing concern for some polar bear populations: particularly in areas where there is no information on population size (e.g., Québec, east Greenland, and the Chukchi Sea) and no quotas. It is important that population estimates and projections are based on substantiated scientific data. An additional concern is that population inventory programs occur relatively infrequently in some areas so if the harvest rate is above the sustainable level, the population may be reduced before the next inventory is made. Recent development of co-management agreements and greater involvement of local people and hunters is improving the management of polar bears in some areas.

Utilisation
The principle use of polar bears in the circumpolar arctic is for subsistence purposes. These include consumption of meat; use of hides in the construction of clothing such as mittens, boots (mukluks), fur ruffs for parkas, and fur pants; and small scale creation of items of handicraft. The US (Alaska), Canada and Greenland manage a subsistence harvest. Norway and Russia prohibit harvest of polar bears. In Russia during the early 1990s an unsanctioned harvest of polar bears began following dissolution of the Soviet Union. Levels of harvest are not quantified.

In Canada a portion of the annual harvest is by sports hunters employing native guides utilizing traditional harvest methods such as dog-teams. The harvest levels are regulated and based on principles of sustainable resource management. Greenland introduced a quota system which came into force on January 1, 2006 and plans to start sport hunting in the near future.

A small number of orphaned cubs are placed in zoos and public display facilities.

Research activities: live capture and release of polar bears.

Public viewing and photography are another form of utilization and occur locally at Churchill, Canada, and other remote areas, at specific locals in Svalbard, Norway, and to a limited extent in location on the north coast of Alaska.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Loss of the polar bear's primary habitat (sea ice) is the primary threat. Sea ice is rapidly diminishing throughout the Arctic, and the best available evidence is that Arctic sea ice will continue to be affected by climate change for the foreseeable future (see USFWS 2008 for extensive discussion).

USFWS (2008) determined that harvest is likely exacerbating the effects of habitat loss in several populations. In addition, polar bear mortality from harvest and negative bear-human interactions may in the future approach unsustainable levels for several populations, especially those experiencing nutritional stress or declining population numbers as a consequence of habitat change. Continued efforts are necessary to ensure that harvest or other forms of removal do not exceed sustainable levels. However, USFWS (2008) concluded that overutilization does not currently threaten the polar bear throughout all or a significant portion of its range.

USFWS (2008) evaluated the best available scientific information on disease and predation and determined that disease and predation (including intraspecific predation) do not threaten the species throughout all or any significant portion of its range. Potential for disease outbreaks, an increased possibility of pathogen exposure from changed diet or the occurrence of new pathogens that have moved northward with a warming environment, and increased mortality from cannibalism all warrant continued monitoring and may become more significant threat factors in the future for polar bear populations experiencing nutritional stress or declining population numbers.

Industrial development may hinder natural movement, feeding and breeding patterns, and could expose bears to chemical contaminants. Persistent organic pollutants, such as PCBs, may be adversely affected bear immune systems, thyroid function, and reproduction (Siegel and Cummings 2005: Appendix D). However, USFWS (2008) determined that contaminants, ecotourism, and shipping do not threaten the polar bear throughout all or any significant portion of its range. Some of these, particularly contaminants and shipping, may become more significant threats in the future for polar bear populations experiencing declines related to nutritional stress brought on by sea ice and environmental changes.

Low reproductive rate makes this species slow to recover from declines (Stirling 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Polar bears are not endangered, though if hunting was not regulated they would be, due to their slow rates of population growth. They do face threats however, that must be constantly monitored (4). The Polar Bear Specialist Group reported in their 2005 meeting that the greatest challenge to the conservation of polar bears may be large-scale ecological change resulting from climatic warming, if the trend documented in recent years continues (5). Other threats to this species include pollution, poaching, and disturbances from industrial activities (4) (5). While the effects of climate change are not certain, it is recognised that even minor climate changes can have profound effects on polar bears and their sea-ice habitat (4). For example, if climate change results in increased snow in the Arctic, polar bears may be less able to hunt prey by entering seal birth lairs, which will affect the survival of both polar bear adults and cubs. On the other hand, if there is reduced snow and increased seasonal rain, seal productivity may be reduced as the lairs may not be thick enough to protect the pups as they develop, or lairs may collapse and kill the seals. In turn this would reduce prey for the polar bears. Unusual warm weather could also impact the polar bear's denning activity (6). Persistent Organic Pollutants (POP) also pose a threat to polar bears. Studies on the accumulation of organochlorines (caused by pollutants) through food chains have shown that polar bears, as top predators, are at risk of accumulating elevated levels of these compounds. These levels are associated with a range of effects, including neurological, reproductive and immunological changes, which may, for example, reduce ability to fight diseases and reproduce (6). In the 1960s and 1970s, extensive hunting of polar bears had pushed them to the brink of extinction. This threat had a considerable impact on polar bear populations, and, though hunting is now controlled, populations are still recovering (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation actions vary by jurisdiction. The International Agreement on the Conservation of Polar Bears provides guidance, and Article II of the Agreement states that each contracting party "shall manage polar bear populations in accordance with sound conservation practices based on the best available scientific information," and according to Article VII, "The Contracting Parties shall conduct national research programs on polar bears" and "..consult with each other on the management of migrating polar bear populations". These articles have been important for stimulating governments to support applied research to answer management questions regarding polar bears throughout their range. This work is coordinated through the IUCN SSC Polar Bear Specialist Group (PBSG). Resolutions from the PBSG are developed and directed toward ensuring that the terms and intentions of the Agreement are being met.

Coordinated research is ongoing, management actions reviewed for consistency, and legislation to effect bilateral management for internationally shared populations such as between the US-Russia is being pursued. Additional cooperative management agreements between Canada and Greenland are desirable and currently being developed.

Additional details of the Global Status and Management of Polar Bears are contained in the IUCN "Status Survey and Conservation Action Plan: Bears" (Servheen et al. 1999).

It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: The following management needs were identified in "Alaska's Western Arctic: a summary and synthesis of resources" (Schoen and Senner 2002): Cooperative management between USFWS, Alaska Natives, and other nations, including joint international studies with Canada and Russia would facilitate more complete conservation efforts. Management should endeavor to fully implement the International Polar Bear Agreement, the Habitat Conservation Strategy for Polar Bears in Alaska (USFWS 1995a), and the pending U.S. and Russia Polar Bear Agreement. Polar Bear and human interactions should be minimized. Important habitats should be protected, including "ice-edge" habitats and polynyas, barrier beaches, and denning sites.


Harvest management should focus on protecting females (Armstrup et al. 1986).

See Herrero (1985) for prevention of attacks on humans.

See USFWS (1997) for information on application requirements and permit procedures for the issuance of permits to import trophies of polar bears sport hunted in Canada.

Biological Research Needs: Research is needed on movements of male bears; currently, no satisfactory method for long-term attachment of radio transmitters has been designed. Better estimates of abundance and harvest are also necessary, especially harvest counts for Russia and Greenland.

Relationships between polar bears, seals, and sea ice needs study (Amstrup and DeMaster 1988). Effects of industry should be assessed, particularly the effects of seismic exploration on denning bears. An evaluation of direct and indirect effects of marine oil spills should be conducted.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: See "Final environmental assessment for the conservation of polar bears in the Chukchi/Bering seas," available in 1997 (U.S. Fish and Wildlife Service, Marine Mammals Management Office, 101 East Tudor Road, Anchorage, AK 99503.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Following the drastic population losses of polar bears in the 1960s and 1970s, an international accord was reached between the five nations with polar bears (Canada, Norway, US, the former USSR and Denmark, which governed Greenland at that time) (4). These nations signed the 'International Agreement on the Conservation of Polar Bears', and agreed to prohibit unregulated hunting and to outlaw the hunting of the bears from aircrafts and icebreakers (4). The agreement also obliged each nation to protect polar bear denning sites and migration routes, as well as undertake and share information on polar bear research (4). This was one of the first and most successful international conservation measures of the 21st century and was responsible for the recovery of the polar bear (4). The threats caused by climate change are now the main concern, especially as the rate at which environmental changes could occur may be faster than the rate at which many species can adapt. More than ever, the complexity of these issues and their global nature will demand international cooperation if this species and other wildlife is to survive (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Polar bears are viewed as potentially dangerous to humans. Contact between humans and bears is rare due to the large home range of individual bears and the sparse human population throughout their distribution. Two deaths resulting from polar bear encounters have been reported.

Negative Impacts: injures humans (bites or stings)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Polar bear materials have historically been used by native people of the arctic for fur, meat, and medicines. Hunting by those groups is still allowed in the United States, Canada, and Greenland (Denmark). Trophy and commercial hunters have taken bears for pelts that sold for $3000 in the past.

Positive Impacts: food ; ecotourism ; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted and trapped for meat and hides for thousands of years; mainly subsistence havest by native arctic peoples. Harvested by natives in Canada, principally within the Northwest Territories; the present annual harvest is about 700, which is probably close to the maximum sustainable yield (Stirling 1991). See USFWS (Federal Register, 17 July 1995) for information on sport harvest in Canada. Subsistence hunting by natives also continues in Alaska. Subjected to sport hunting, mostly by non-natives, in Alaska from the late 1940s to 1972 (Reeves et al. 1992).

Some believe that study of polar bear fur could lead to improvements in solar panels for homes and industry; reportedly the fur is excellent at absorbing ultraviolet radiation (Boston Globe, 4 June 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Polar bear

The polar bear (Ursus maritimus) is a carnivorous bear native largely within the Arctic Circle encompassing the Arctic Ocean, its surrounding seas and surrounding land masses. It is the world's largest bear, together with the omnivorous Kodiak bear, which is approximately the same size.[3] A boar (adult male) weighs around 350–700 kg (770–1,500 lb),[4] while a sow (adult female) is about half that size. Although it is closely related to the brown bear, it has evolved to occupy a narrower ecological niche, with many body characteristics adapted for cold temperatures, for moving across snow, ice, and open water, and for hunting the seals which make up most of its diet.[5] Although most polar bears are born on land, they spend most of their time at sea. Their scientific name means "maritime bear", and derives from this fact. Polar bears hunt their preferred food of seals from the edge of sea ice, often living off fat reserves when no sea ice is present.

The polar bear is classified as a vulnerable species, with eight of the nineteen polar bear subpopulations in decline.[6] For decades, large scale hunting raised international concern for the future of the species but populations rebounded after controls and quotas began to take effect.[citation needed] For thousands of years, the polar bear has been a key figure in the material, spiritual, and cultural life of Arctic indigenous peoples, and polar bears remain important in their cultures.

Contents

Naming and etymology[edit]

Constantine John Phipps was the first to describe the polar bear as a distinct species in 1774.[7] He chose the scientific name Ursus maritimus, the Latin for 'maritime bear',[8] due to the animal's native habitat. The Inuit refer to the animal as nanook[9] (transliterated as nanuq in the Inupiat language).[10] The Yupik also refer to the bear as nanuuk in Siberian Yupik.[11] The bear is umka in the Chukchi language. In Russian, it is usually called бе́лый медве́дь (bélyj medvédj, the white bear), though an older word still in use is ошку́й (Oshkúj, which comes from the Komi oski, "bear").[12] In French, the polar bear is referred to as ours blanc ("white bear") or ours polaire ("polar bear").[13] In the Norwegian-administered Svalbard archipelago, the polar bear is referred to as Isbjørn ("ice bear").

The polar bear was previously considered to be in its own genus, Thalarctos.[14] However, evidence of hybrids between polar bears and brown bears, and of the recent evolutionary divergence of the two species, does not support the establishment of this separate genus, and the accepted scientific name is now therefore Ursus maritimus, as Phipps originally proposed.[15]

Taxonomy and evolution[edit]

Polar bears have evolved unique features for Arctic life. Large furry feet and short, sharp, stocky claws giving it good traction on ice are evolutionary adaptations to this environment.

The bear family, Ursidae, is believed to have split off from other carnivorans about 38 million years ago. The Ursinae subfamily originated approximately 4.2 million years ago. The oldest known polar bear fossil is a 130,000 to 110,000-year-old jaw bone, found on Prince Charles Foreland in 2004.[16] Fossils show that between ten to twenty thousand years ago, the polar bear's molar teeth changed significantly from those of the brown bear. Polar bears are thought to have diverged from a population of brown bears that became isolated during a period of glaciation in the Pleistocene.[17]

The evidence from DNA analysis is more complex. The mitochondrial DNA (mtDNA) of the polar bear diverged from the brown bear, Ursus arctos, roughly 150,000 years ago.[16] Further, some clades of brown bear, as assessed by their mtDNA, are more closely related to polar bears than to other brown bears,[18] meaning that the polar bear would not be a true species according to some species concepts.[19] The mtDNA of Irish brown bears is particularly close to polar bears.[20] A comparison of the nuclear genome of polar bears with that of brown bears revealed a different pattern, the two forming genetically distinct clades that diverged approximately 603,000 years ago,[21] although the latest research is based on analysis of the complete genomes (rather than just the mitochondria or partial nuclear genomes) of polar, brown and black bears, and establishes the divergence of polar and brown bears at 4-5 million years ago.[22]

However, the two species have mated intermittently for all that time, most likely coming into contact with each other during warming periods, when polar bears were driven onto land and brown bears migrated northward. Most brown bears have about 2 percent genetic material from polar bears, but one population residing in the Alexander Archipelago has between 5 percent and 10 percent polar bear genes, indicating more frequent and recent mating.[23] Polar bears can breed with brown bears to produce fertile grizzly–polar bear hybrids,[17][24] rather than indicating that they have only recently diverged, the new evidence suggests more frequent mating has continued over a longer period of time, and thus the two bears remain genetically similar.[23] However, because neither species can survive long in the other's ecological niche, and because they have different morphology, metabolism, social and feeding behaviors, and other phenotypic characteristics, the two bears are generally classified as separate species.[25]

When the polar bear was originally documented, two subspecies were identified: Ursus maritimus maritimus by Constantine J. Phipps in 1774, and Ursus maritimus marinus by Peter Simon Pallas in 1776.[26] This distinction has since been invalidated. One fossil subspecies has been identified. Ursus maritimus tyrannus — descended from Ursus arctos — became extinct during the Pleistocene. U.m. tyrannus was significantly larger than the living subspecies.[17]

Population and distribution[edit]

Polar bears investigate the submarine USS Honolulu 450 kilometres (280 mi) from the North Pole.

The polar bear is found in the Arctic Circle and adjacent land masses as far south as Newfoundland Island. Due to the absence of human development in its remote habitat, it retains more of its original range than any other extant carnivore.[27] While they are rare north of 88°, there is evidence that they range all the way across the Arctic, and as far south as James Bay in Canada. They can occasionally drift widely with the sea ice, and there have been anecdotal sightings as far south as Berlevåg on the Norwegian mainland and the Kuril Islands in the Sea of Okhotsk. It is difficult to estimate a global population of polar bears as much of the range has been poorly studied; however, biologists use a working estimate of about 20,000 to 25,000 polar bears worldwide.[1][28]

There are 19 generally recognized, discrete subpopulations.[28][29] The subpopulations display seasonal fidelity to particular areas, but DNA studies show that they are not reproductively isolated.[30] The thirteen North American subpopulations range from the Beaufort Sea south to Hudson Bay and east to Baffin Bay in western Greenland and account for about 70% of the global population. The Eurasian population is broken up into the eastern Greenland, Barents Sea, Kara Sea, Laptev Sea, and Chukchi Sea subpopulations, though there is considerable uncertainty about the structure of these populations due to limited mark and recapture data.

Polar bears play-fighting

The range includes the territory of five nations: Denmark (Greenland), Norway (Svalbard), Russia, the United States (Alaska) and Canada. These five nations are the signatories of the International Agreement on the Conservation of Polar Bears, which mandates cooperation on research and conservations efforts throughout the polar bear's range.

Modern methods of tracking polar bear populations have been implemented only since the mid-1980s, and are expensive to perform consistently over a large area.[31] The most accurate counts require flying a helicopter in the Arctic climate to find polar bears, shooting a tranquilizer dart at the bear to sedate it, and then tagging the bear.[31] In Nunavut, some Inuit have reported increases in bear sightings around human settlements in recent years, leading to a belief that populations are increasing. Scientists have responded by noting that hungry bears may be congregating around human settlements, leading to the illusion that populations are higher than they actually are.[31] The Polar Bear Specialist Group of the IUCN takes the position that "estimates of subpopulation size or sustainable harvest levels should not be made solely on the basis of traditional ecological knowledge without supporting scientific studies."[32]

Of the 19 recognized polar bear subpopulations, eight are declining, three are stable, one is increasing, and seven have insufficient data, as of 2009.[6][28]

Habitat[edit]

A polar bear in a synthetic arctic zoo environment

The polar bear is often regarded as a marine mammal because it spends many months of the year at sea.[33] Its preferred habitat is the annual sea ice covering the waters over the continental shelf and the Arctic inter-island archipelagos. These areas, known as the "Arctic ring of life", have high biological productivity in comparison to the deep waters of the high Arctic.[27][34] The polar bear tends to frequent areas where sea ice meets water, such as polynyas and leads (temporary stretches of open water in Arctic ice), to hunt the seals that make up most of its diet.[35] Polar bears are therefore found primarily along the perimeter of the polar ice pack, rather than in the Polar Basin close to the North Pole where the density of seals is low.[36]

Annual ice contains areas of water that appear and disappear throughout the year as the weather changes. Seals migrate in response to these changes, and polar bears must follow their prey.[34] In Hudson Bay, James Bay, and some other areas, the ice melts completely each summer (an event often referred to as "ice-floe breakup"), forcing polar bears to go onto land and wait through the months until the next freeze-up.[34] In the Chukchi and Beaufort seas, polar bears retreat each summer to the ice further north that remains frozen year-round.

Biology and behavior[edit]

Physical characteristics[edit]

Skull, as illustrated by N. N. Kondakov.
Polar bear skeleton

The polar bear is the largest terrestrial carnivore, being more than twice as large as the Siberian tiger.[37] It shares this title with the Kodiak bear.[38] Adult males weigh 350–700 kg (770–1,500 lb) and measure 2.4–3 m (8–10 ft) in length.[39] The Guinness Book of World Records listed the average male as having a body mass of 386 to 408 kg (850 to 900 lb) and a shoulder height of 133 cm (4 ft 4 in).[40] Adult females are roughly half the size of males and normally weigh 150–250 kg (330–550 lb), measuring 1.8–2.4 metres (6–8 ft) in length. When pregnant, however, they can weigh as much as 500 kg (1,100 lb).[39] The polar bear is among the most sexually dimorphic of mammals, surpassed only by the pinnipeds.[41] The largest polar bear on record, reportedly weighing 1,002 kg (2,210 lb), was a male shot at Kotzebue Sound in northwestern Alaska in 1960.[40] This specimen, when mounted, stood 3.39 m (11 ft 1 in) tall.[40] The shoulder height of an adult polar bear is 122 to 160 cm (48 to 63 in).[40][42]

Compared with its closest relative, the brown bear, the polar bear has a more elongated body build and a longer skull and nose.[25] As predicted by Allen's rule for a northerly animal, the legs are stocky and the ears and tail are small.[25] However, the feet are very large to distribute load when walking on snow or thin ice and to provide propulsion when swimming; they may measure 30 cm (12 in) across in an adult.[43] The pads of the paws are covered with small, soft papillae (dermal bumps) which provide traction on the ice.[25] The polar bear's claws are short and stocky compared to those of the brown bear, perhaps to serve the former's need to grip heavy prey and ice.[25] The claws are deeply scooped on the underside to assist in digging in the ice of the natural habitat. Research of injury patterns in polar bear forelimbs found injuries to the right forelimb to be more frequent than those to the left, suggesting, perhaps, right-handedness.[44] Unlike the brown bear, polar bears in captivity are rarely overweight or particularly large, possibly as a reaction to the warm conditions of most zoos.

The 42 teeth of a polar bear reflect its highly carnivorous diet.[25] The cheek teeth are smaller and more jagged than in the brown bear, and the canines are larger and sharper.[25] The dental formula is 3.1.4.23.1.4.3[25]

Polar bear swimming.

Polar bears are superbly insulated by up to 10 cm (4 in) of blubber,[43] their hide and their fur; they overheat at temperatures above 10 °C (50 °F), and are nearly invisible under infrared photography.[45] Polar bear fur consists of a layer of dense underfur and an outer layer of guard hairs, which appear white to tan but are actually transparent.[43] The guard hair is 5–15 cm (2–6 in) over most of the body.[46] Polar bears gradually moult from May to August,[47] but, unlike other Arctic mammals, they do not shed their coat for a darker shade to camouflage themselves in the summer conditions. The hollow guard hairs of a polar bear coat were once thought to act as fiber-optic tubes to conduct light to its black skin, where it could be absorbed; however, this theory was disproven by recent studies.[48]

The white coat usually yellows with age. When kept in captivity in warm, humid conditions, the fur may turn a pale shade of green due to algae growing inside the guard hairs.[49] Males have significantly longer hairs on their forelegs, that increase in length until the bear reaches 14 years of age. The male's ornamental foreleg hair is thought to attract females, serving a similar function to the lion's mane.[50]

The polar bear has an extremely well developed sense of smell, being able to detect seals nearly 1.6 km (1 mi) away and buried under 1 m (3 ft) of snow.[51] Its hearing is about as acute as that of a human, and its vision is also good at long distances.[51]

The polar bear is an excellent swimmer and individuals have been seen in open Arctic waters as far as 300 km (200 mi) from land. With its body fat providing buoyancy, it swims in a dog paddle fashion using its large forepaws for propulsion.[52] Polar bears can swim 10 km/h (6 mph). When walking, the polar bear tends to have a lumbering gait and maintains an average speed of around 5.6 km/h (3.5 mph).[52] When sprinting, they can reach up to 40 km/h (25 mph).[53]

Hunting and diet[edit]

The long muzzle and neck of the polar bear help it to search in deep holes for seals, while powerful hindquarters enable it to drag massive prey.[54]

The polar bear is the most carnivorous member of the bear family, and throughout most of its range, its diet primarily consists of ringed and bearded seals.[55] The Arctic is home to millions of seals, which become prey when they surface in holes in the ice in order to breathe, or when they haul out on the ice to rest.[54] Polar bears hunt primarily at the interface between ice, water, and air; they only rarely catch seals on land or in open water.[56]

The polar bear's most common hunting method is called still-hunting:[57] The bear uses its excellent sense of smell to locate a seal breathing hole, and crouches nearby in silence for a seal to appear. When the seal exhales, the bear smells its breath, reaches into the hole with a forepaw, and drags it out onto the ice. The polar bear kills the seal by biting its head to crush its skull. The polar bear also hunts by stalking seals resting on the ice: Upon spotting a seal, it walks to within 90 m (100 yd), and then crouches. If the seal does not notice, the bear creeps to within 9 to 12 m (30 to 40 ft) of the seal and then suddenly rushes forth to attack.[54] A third hunting method is to raid the birth lairs that female seals create in the snow.[57]

A widespread legend tells that polar bears cover their black noses with their paws when hunting. This behavior, if it happens, is rare – although the story exists in native oral history and in accounts by early Arctic explorers, there is no record of an eyewitness account of the behavior in recent decades.[52]

Polar bear at a whale carcass

Mature bears tend to eat only the calorie-rich skin and blubber of the seal, whereas younger bears consume the protein-rich red meat.[54] Studies have also photographed polar bears scaling near-vertical cliffs, to eat birds' chicks and eggs.[58] For subadult bears which are independent of their mother but have not yet gained enough experience and body size to successfully hunt seals, scavenging the carcasses from other bears' kills is an important source of nutrition. Subadults may also be forced to accept a half-eaten carcass if they kill a seal but cannot defend it from larger polar bears. After feeding, polar bears wash themselves with water or snow.[52]

The polar bear is an enormously powerful predator. It can kill an adult walrus, although this is rarely attempted. A walrus can be more than twice the bear's weight,[59] and has up to 1-metre (3 ft)-long ivory tusks that can be used as formidable weapons. Most attacks on walruses occur when the bear charges a group and either targets the slower moving walruses, usually either young or infirm ones, or a walrus that is injured in the rush of walruses trying to escape. They will also attack adult walruses when their diving holes have frozen over or intercept them before they can get back to the diving hole in the ice. Since an attack on a walrus tends to be an extremely protracted and exhausting venture, bears have been known to abandon the hunt after making the initial injury.[60] Polar bears have also been seen to prey on beluga whales, by swiping at them at breathing holes. The whales are of similar size to the walrus and nearly as difficult for the bear to subdue. Polar bears very seldom attack full-grown adult whales. Most terrestrial animals in the Arctic can outrun the polar bear on land as polar bears overheat quickly, and most marine animals the bear encounters can outswim it. In some areas, the polar bear's diet is supplemented by walrus calves and by the carcasses of dead adult walruses or whales, whose blubber is readily devoured even when rotten.[61]

Some characteristic postures:
1. - at rest;
2. - at an estimated reaction;
3. - when feeding

With the exception of pregnant females, polar bears are active year-round,[62] although they have a vestigial hibernation induction trigger in their blood. Unlike brown and black bears, polar bears are capable of fasting for up to several months during late summer and early fall, when they cannot hunt for seals because the sea is unfrozen.[62] When sea ice is unavailable during summer and early autumn, some populations live off fat reserves for months at a time.[45] Polar bears have also been observed to eat a wide variety of other wild foods, including muskox, reindeer, birds, eggs, rodents, shellfish, crabs, and other polar bears. They may also eat plants, including berries, roots, and kelp, however none of these are a significant part of their diet.[59] The polar bear's biology is specialized to require large amounts of fat from marine mammals, and it cannot derive sufficient caloric intake from terrestrial food.[63][64]

Being both curious animals and scavengers,[59][65] polar bears investigate and consume garbage where they come into contact with humans.[59] Polar bears may attempt to consume almost anything they can find, including hazardous substances such as styrofoam, plastic, car batteries, ethylene glycol, hydraulic fluid, and motor oil.[59][65] The dump in Churchill, Manitoba was closed in 2006 to protect bears, and waste is now recycled or transported to Thompson, Manitoba.[66][67]

Behavior[edit]

Polar bear males frequently play-fight. During the mating season, actual fighting is intense and often leaves scars or broken teeth.

Unlike grizzly bears, polar bears are not territorial. Although stereotyped as being voraciously aggressive, they are normally cautious in confrontations, and often choose to escape rather than fight.[68] Satiated polar bears rarely attack humans unless severely provoked, whereas hungry polar bears are extremely unpredictable and are known to kill and sometimes eat humans.[61] Polar bears are stealth hunters, and the victim is often unaware of the bear's presence until the attack is underway.[69] Whereas brown bears often maul a person and then leave, polar bear attacks are more likely to be predatory and are almost always fatal.[69] However, due to the very small human population around the Arctic, such attacks are rare.

In general, adult polar bears live solitary lives. Yet, they have often been seen playing together for hours at a time and even sleeping in an embrace,[61] and polar bear zoologist Nikita Ovsianikov has described adult males as having "well-developed friendships."[68] Cubs are especially playful as well. Among young males in particular, play-fighting may be a means of practicing for serious competition during mating seasons later in life.[70] Polar bears have a wide range of vocalisations, including bellows, roars, growls, chuffs and purrs.[71]

In 1992, a photographer near Churchill took a now widely circulated set of photographs of a polar bear playing with a Canadian Eskimo Dog a tenth of its size.[72][73] The pair wrestled harmlessly together each afternoon for ten days in a row for no apparent reason, although the bear may have been trying to demonstrate its friendliness in the hope of sharing the kennel's food.[72] This kind of social interaction is uncommon; it is far more typical for polar bears to behave aggressively towards dogs.[72]

Reproduction and lifecycle[edit]

Cubs are born helpless, and typically nurse for two and a half years.

Courtship and mating take place on the sea ice in April and May, when polar bears congregate in the best seal hunting areas.[74] A male may follow the tracks of a breeding female for 100 km (60 mi) or more, and after finding her engage in intense fighting with other males over mating rights, fights which often result in scars and broken teeth.[74] Polar bears have a generally polygynous mating system; recent genetic testing of mothers and cubs, however, has uncovered cases of litters in which cubs have different fathers.[75] Partners stay together and mate repeatedly for an entire week; the mating ritual induces ovulation in the female.[76]

After mating, the fertilized egg remains in a suspended state until August or September. During these four months, the pregnant female eats prodigious amounts of food, gaining at least 200 kg (440 lb) and often more than doubling her body weight.[74]

Maternity denning and early life[edit]

A female emerging from her maternity den

When the ice floes break up in the fall, ending the possibility of hunting, each pregnant female digs a maternity den consisting of a narrow entrance tunnel leading to one to three chambers.[74] Most maternity dens are in snowdrifts, but may also be made underground in permafrost if it is not sufficiently cold yet for snow.[74] In most subpopulations, maternity dens are situated on land a few kilometers from the coast, and the individuals in a subpopulation tend to reuse the same denning areas each year.[27] The polar bears that do not den on land make their dens on the sea ice. In the den, she enters a dormant state similar to hibernation. This hibernation-like state does not consist of continuous sleeping; however, the bear's heart rate slows from 46 to 27 beats per minute.[77] Her body temperature does not decrease during this period as it would for a typical mammal in hibernation.[45][78]

Between November and February, cubs are born blind, covered with a light down fur, and weighing less than 0.9 kg (2.0 lb),[76] but in captivity they might be delivered in the earlier months. The earliest recorded birth of polar bears in captivity was on 11 October 2011 in the Toronto Zoo.[79] On average, each litter has two cubs.[74] The family remains in the den until mid-February to mid-April, with the mother maintaining her fast while nursing her cubs on a fat-rich milk.[74] By the time the mother breaks open the entrance to the den, her cubs weigh about 10 to 15 kilograms (22 to 33 lb).[74] For about 12 to 15 days, the family spends time outside the den while remaining in its vicinity, the mother grazing on vegetation while the cubs become used to walking and playing.[74] Then they begin the long walk from the denning area to the sea ice, where the mother can once again catch seals.[74] Depending on the timing of ice-floe breakup in the fall, she may have fasted for up to eight months.[74]

A cub nursing

Cubs may fall prey to wolves or to starvation. Female polar bears are noted for both their affection towards their offspring[citation needed], and their valiance in protecting them[citation needed]. One case of adoption of a wild cub has been confirmed by genetic testing.[75] Adult male bears occasionally kill and eat polar bear cubs,[80] for reasons that are unclear.[81] As of 2006, in Alaska, 42% of cubs now reach 12 months of age, down from 65% 15 years ago.[82] In most areas, cubs are weaned at two and a half years of age,[74] when the mother chases them away or abandons them. The western coast of Hudson Bay is unusual in that its female polar bears sometimes wean their cubs at only one and a half years.[74] This was the case for 40% of cubs there in the early 1980s; however by the 1990s, fewer than 20% of cubs were weaned this young.[83] After the mother leaves, sibling cubs sometimes travel and share food together for weeks or months.[61]

Later life[edit]

Females begin to breed at the age of four years in most areas, and five years in the Beaufort Sea area.[74] Males usually reach sexual maturity at six years; however, as competition for females is fierce, many do not breed until the age of eight or ten.[74] A study in Hudson Bay indicated that both the reproductive success and the maternal weight of females peaked in their mid-teens.[84]

Polar bears appear to be less affected by infectious diseases and parasites than most terrestrial mammals.[81] Polar bears are especially susceptible to Trichinella, a parasitic roundworm they contract through cannibalism,[85] although infections are usually not fatal.[81] Only one case of a polar bear with rabies has been documented, even though polar bears frequently interact with Arctic foxes, which often carry rabies.[81] Bacterial Leptospirosis and Morbillivirus have been recorded. Polar bears sometimes have problems with various skin diseases which may be caused by mites or other parasites.

Life expectancy[edit]

Polar bears rarely live beyond 25 years.[86] The oldest wild bears on record died at age 32, whereas the oldest captive was a female who died in 1991, age 43.[87] The causes of death in wild adult polar bears are poorly understood, as carcasses are rarely found in the species's frigid habitat.[81] In the wild, old polar bears eventually become too weak to catch food, and gradually starve to death. Polar bears injured in fights or accidents may either die from their injuries or become unable to hunt effectively, leading to starvation.[81]

Ecological role[edit]

The polar bear is the apex predator within its range. Several animal species, particularly Arctic Foxes and Glaucous Gulls, routinely scavenge polar bear kills.[52]

The relationship between ringed seals and polar bears is so close that the abundance of ringed seals in some areas appears to regulate the density of polar bears, while polar bear predation in turn regulates density and reproductive success of ringed seals.[56] The evolutionary pressure of polar bear predation on seals probably accounts for some significant differences between Arctic and Antarctic seals. Compared to the Antarctic, where there is no major surface predator, Arctic seals use more breathing holes per individual, appear more restless when hauled out on the ice, and rarely defecate on the ice.[52] The baby fur of most Arctic seal species is white, presumably to provide camouflage from predators, whereas Antarctic seals all have dark fur at birth.[52]

Polar bears rarely enter conflict with other predators, though recent brown bear encroachments into polar bear territories have led to antagonistic encounters. Brown bears tend to dominate polar bears in disputes over carcasses,[88] and dead polar bear cubs have been found in brown bear dens.[89] Wolves are rarely encountered by polar bears, though there are two records of wolf packs killing polar bear cubs.[90] Polar bears are sometimes the host of arctic mites such as Alaskozetes antarcticus.[52]

Long distance swimmer[edit]

The Canadian Journal of Zoology tracked 52 sows in the southern Beaufort Sea off Alaska with GPS system collars; no boars were involved in the study due to males' necks being too thick for the GPS-equipped collars. Fifty long-distance swims were recorded; the longest at 354 kilometres (220 mi), with an average of 155 kilometres (96 mi). The length of these swims ranged from most of a day to ten days. Ten of the sows had a cub swim with them and after a year six cubs survived. The study did not determine if the others lost their cubs before, during, or some time after their long swims. Researchers do not know whether or not this is a new behavior; before polar ice shrinkage, they opined that there was probably neither the need nor opportunity to swim such long distances.[91]

Hunting[edit]

Indigenous people[edit]

Skins of hunted polar bears in Ittoqqortoormiit, Greenland

Polar bears have long provided important raw materials for Arctic peoples, including the Inuit, Yupik, Chukchi, Nenets, Russian Pomors and others. Hunters commonly used teams of dogs to distract the bear, allowing the hunter to spear the bear or shoot it with arrows at closer range.[92] Almost all parts of captured animals had a use.[93] The fur was used in particular to sew trousers and, by the Nenets, to make galoshes-like outer footwear called tobok; the meat is edible, despite some risk of trichinosis; the fat was used in food and as a fuel for lighting homes, alongside seal and whale blubber; sinews were used as thread for sewing clothes; the gallbladder and sometimes heart were dried and powdered for medicinal purposes; the large canine teeth were highly valued as talismans.[94] Only the liver was not used, as its high concentration of vitamin A is poisonous.[95] Hunters make sure to either toss the liver into the sea or bury it in order to spare their dogs from potential poisoning.[94] Traditional subsistence hunting was on a small enough scale to not significantly affect polar bear populations, mostly because of the sparseness of the human population in polar bear habitat.[96]

History of commercial harvest[edit]

In Russia, polar bear furs were already being commercially traded in the 14th century, though it was of low value compared to Arctic Fox or even reindeer fur.[94] The growth of the human population in the Eurasian Arctic in the 16th and 17th century, together with the advent of firearms and increasing trade, dramatically increased the harvest of polar bears.[45][97] However, since polar bear fur has always played a marginal commercial role, data on the historical harvest is fragmentary. It is known, for example, that already in the winter of 1784/1785 Russian Pomors on Spitsbergen harvested 150 polar bears in Magdalenefjorden.[94] In the early 20th century, Norwegian hunters were harvesting 300 bears a year at the same location. Estimates of total historical harvest suggest that from the beginning of the 18th century, roughly 400 to 500 animals were being harvested annually in northern Eurasia, reaching a peak of 1,300 to 1,500 animals in the early 20th century, and falling off as the numbers began dwindling.[94]

In the first half of the 20th century, mechanized and overpoweringly efficient methods of hunting and trapping came into use in North America as well.[98] Polar bears were chased from snowmobiles, icebreakers, and airplanes, the latter practice described in a 1965 New York Times editorial as being "about as sporting as machine gunning a cow."[98] The numbers taken grew rapidly in the 1960s, peaking around 1968 with a global total of 1,250 bears that year.[99]

Contemporary regulations[edit]

A road sign on Svalbard, warning about the presence of polar bears.

Concerns over the future survival of the species led to the development of national regulations on polar bear hunting, beginning in the mid-1950s. The Soviet Union banned all hunting in 1956. Canada began imposing hunting quotas in 1968. Norway passed a series of increasingly strict regulations from 1965 to 1973, and has completely banned hunting since then. The United States began regulating hunting in 1971 and adopted the Marine Mammal Protection Act in 1972. In 1973, the International Agreement on the Conservation of Polar Bears was signed by all five nations whose territory is inhabited by polar bears: Canada, Denmark, Norway, the Soviet Union, and the United States. Member countries agreed to place restrictions on recreational and commercial hunting, ban hunting from aircraft and icebreakers, and conduct further research.[100] The treaty allows hunting "by local people using traditional methods". Norway is the only country of the five in which all harvest of polar bears is banned. The agreement was a rare case of international cooperation during the Cold War. Biologist Ian Stirling commented, "For many years, the conservation of polar bears was the only subject in the entire Arctic that nations from both sides of the Iron Curtain could agree upon sufficiently to sign an agreement. Such was the intensity of human fascination with this magnificent predator, the only marine bear."[101]

Agreements have been made between countries to co-manage their shared polar bear subpopulations. After several years of negotiations, Russia and the United States signed an agreement in October 2000 to jointly set quotas for indigenous subsistence hunting in Alaska and Chukotka.[102] The treaty was ratified in October 2007.[103]

Russia[edit]

The Soviet Union banned the harvest of polar bears in 1956, however poaching continued and is believed to pose a serious threat to the polar bear population.[29] In recent years, polar bears have approached coastal villages in Chukotka more frequently due to the shrinking of the sea ice, endangering humans and raising concerns that illegal hunting would become even more prevalent.[104] In 2007, the Russian government made subsistence hunting legal for Chukotka natives only, a move supported by Russia's most prominent bear researchers and the World Wide Fund for Nature as a means to curb poaching.[104]

Greenland[edit]

In Greenland, hunting restrictions were first introduced in 1994 and expanded by executive order in 2005.[29] Until 2005 Greenland placed no limit on hunting by indigenous people. However, in 2006 it imposed a limit of 150, while also allowed recreational hunting for the first time.[105] Other provisions included year-round protection of cubs and mothers, restrictions on weapons used, and various administrative requirements to catalogue kills.[29]

Canada[edit]

Dogsleds are used for recreational hunting of polar bears in Canada. Use of motorized vehicles is forbidden.

About 500 bears are killed per year by humans across Canada,[106] a rate believed by scientists to be unsustainable for some areas, notably Baffin Bay.[28] Canada has allowed sport hunters accompanied by local guides and dog-sled teams since 1970,[107] but the practice was not common until the 1980s.[108] The guiding of sport hunters provides meaningful employment and an important source of income for native communities in which economic opportunities are few.[31] Sport hunting can bring CDN$20,000 to $35,000 per bear into northern communities, which until recently has been mostly from American hunters.[109]

The territory of Nunavut accounts for the location 80% of annual kills in Canada.[106] In 2005, the government of Nunavut increased the quota from 400 to 518 bears,[109] despite protests from some scientific groups.[110] In two areas where harvest levels have been increased based on increased sightings, science-based studies have indicated declining populations, and a third area is considered data-deficient.[111] While most of that quota is hunted by the indigenous Inuit people, a growing share is sold to recreational hunters. (0.8% in the 1970s, 7.1% in the 1980s, and 14.6% in the 1990s)[108] Nunavut polar bear biologist, Mitchell Taylor, who was formerly responsible for polar bear conservation in the territory, insists that bear numbers are being sustained under current hunting limits.[112] In 2010, the 2005 increase was partially reversed. Government of Nunavut officials announced that the polar bear quota for the Baffin Bay region would be gradually reduced from 105 per year to 65 by the year 2013.[113] The Government of the Northwest Territories maintain their own quota of 72 to 103 bears within the Inuvialuit communities of which some are set aside for sports hunters.[citation needed] Environment Canada also banned the export from Canada of fur, claws, skulls and other products from polar bears harvested in Baffin Bay as of 1 January 2010.[113]

Because of the way polar bear hunting quotas are managed in Canada, attempts to discourage sport hunting would actually increase the number of bears killed in the short term.[31] Canada allocates a certain number of permits each year to sport and subsistence hunting, and those that are not used for sport hunting are re-allocated to Native subsistence hunting. Whereas Native communities kill all the polar bears they are permitted to take each year, only half of sport hunters with permits actually manage to kill a polar bear. If a sport hunter does not kill a polar bear before his or her permit expires, the permit cannot be transferred to another hunter.[31]

United States[edit]

The Marine Mammal Protection Act of 1972 afforded polar bears some protection in the United States. It banned hunting (except by indigenous substinence hunters), banned importing of polar bear parts (except polar bear pelts taken legally in Canada), and banned the harassment of polar bears. On 15 May 2008, the United States department of Interior listed the polar bear as a threatened species under the Endangered Species Act and banned all importing of polar bear trophies. Importing products made from polar bears had been prohibited from 1972 to 1994 under the Marine Mammal Protection Act, and restricted between 1994 and 2008. Under those restrictions, permits from the United States Fish and Wildlife Service (FWS) were required to import sport-hunted polar bear trophies taken in hunting expeditions in Canada. The permit process required that the bear be taken from an area with quotas based on sound management principles.[114] Since 1994, more than 800 sport-hunted polar bear trophies have been imported into the U.S.[115]

Conservation status, efforts and controversies[edit]

This map from the U.S. Geological Survey shows projected changes in polar bear habitat from 2001 to 2010 and 2041 to 2050. Red areas indicate loss of optimal polar bear habitat; blue areas indicate gain.

As of 2008, the World Conservation Union (IUCN) reports that the global population of polar bears is 20,000 to 25,000, and is declining.[1] In 2006, the IUCN upgraded the polar bear from a species of least concern to a vulnerable species.[116] It cited a "suspected population reduction of >30% within three generations (45 years)", due primarily to climate change.[7] Other risks to the polar bear include pollution in the form of toxic contaminants, conflicts with shipping, stresses from recreational polar-bear watching, and oil and gas exploration and development.[7] The IUCN also cited a "potential risk of over-harvest" through legal and illegal hunting.[7]

According to the World Wildlife Fund, the polar bear is important as an indicator of arctic ecosystem health. Polar bears are studied to gain understanding of what is happening throughout the Arctic, because at-risk polar bears are often a sign of something wrong with the arctic marine ecosystem.[117]

Climate change[edit]

The IUCN, Arctic Climate Impact Assessment, United States Geological Survey and many leading polar bear biologists have expressed grave concerns about the impact of climate change, including the belief that the current warming trend imperils the survival of the species.[27][118][119][120][121][122]

The key danger posed by climate change is malnutrition or starvation due to habitat loss. Polar bears hunt seals from a platform of sea ice. Rising temperatures cause the sea ice to melt earlier in the year, driving the bears to shore before they have built sufficient fat reserves to survive the period of scarce food in the late summer and early fall.[83] Reduction in sea-ice cover also forces bears to swim longer distances, which further depletes their energy stores and occasionally leads to drowning.[123] Thinner sea ice tends to deform more easily, which appears to make it more difficult for polar bears to access seals.[56] Insufficient nourishment leads to lower reproductive rates in adult females and lower survival rates in cubs and juvenile bears, in addition to poorer body condition in bears of all ages.[27]

Mothers and cubs have high nutritional requirements, which are not met if the seal-hunting season is too short.

In addition to creating nutritional stress, a warming climate is expected to affect various other aspects of polar bear life: Changes in sea ice affect the ability of pregnant females to build suitable maternity dens.[24] As the distance increases between the pack ice and the coast, females must swim longer distances to reach favored denning areas on land.[27] Thawing of permafrost would affect the bears who traditionally den underground, and warm winters could result in den roofs collapsing or having reduced insulative value.[27] For the polar bears that currently den on multi-year ice, increased ice mobility may result in longer distances for mothers and young cubs to walk when they return to seal-hunting areas in the spring.[27] Disease-causing bacteria and parasites would flourish more readily in a warmer climate.[56]

Problematic interactions between polar bears and humans, such as foraging by bears in garbage dumps, have historically been more prevalent in years when ice-floe breakup occurred early and local polar bears were relatively thin.[118] Increased human-bear interactions, including fatal attacks on humans, are likely to increase as the sea ice shrinks and hungry bears try to find food on land.[118][124]

A polar bear swimming

The effects of climate change are most profound in the southern part of the polar bear's range, and this is indeed where significant degradation of local populations has been observed.[122] The Western Hudson Bay subpopulation, in a southern part of the range, also happens to be one of the best-studied polar bear subpopulations. This subpopulation feeds heavily on ringed seals in late spring, when newly weaned and easily hunted seal pups are abundant.[111] The late spring hunting season ends for polar bears when the ice begins to melt and break up, and they fast or eat little during the summer until the sea freezes again.[111]

Due to warming air temperatures, ice-floe breakup in western Hudson Bay is currently occurring three weeks earlier than it did 30 years ago, reducing the duration of the polar bear feeding season.[111] The body condition of polar bears has declined during this period; the average weight of lone (and likely pregnant) female polar bears was approximately 290 kg (640 lb) in 1980 and 230 kg (510 lb) in 2004.[111] Between 1987 and 2004, the Western Hudson Bay population declined by 22%.[125]

In Alaska, the effects of sea ice shrinkage have contributed to higher mortality rates in polar bear cubs, and have led to changes in the denning locations of pregnant females.[82][126] In recent years, polar bears in the Arctic have undertaken longer than usual swims to find prey, resulting in four recorded drownings in the unusually large ice pack regression of 2005.[123]

Pollution[edit]

Polar bears accumulate high levels of persistent organic pollutants such as polychlorinated biphenyl (PCBs) and chlorinated pesticides. Due to their position at the top of the food pyramid, with a diet heavy in blubber in which halocarbons concentrate, their bodies are among the most contaminated of Arctic mammals.[127] Halocarbons are known to be toxic to other animals, because they mimic hormone chemistry, and biomarkers such as immunoglobulin G and retinol suggest similar effects on polar bears. PCBs have received the most study, and they have been associated with birth defects and immune system deficiency.[128]

The most notorious of these chemicals, such as PCBs and DDT, have been internationally banned. Their concentrations in polar bear tissues continued to rise for decades after the ban as these chemicals spread through the food chain. But the trend seems to have abated, with tissue concentrations of PCBs declining between studies performed from 1989 to 1993 and studies performed from 1996 to 2002.[129]

Oil and gas development[edit]

German stamp depicting Knut and the slogan "Preserve nature worldwide"

Oil and gas development in polar bear habitat can affect the bears in a variety of ways. An oil spill in the Arctic would most likely concentrate in the areas where polar bears and their prey are also concentrated, such as sea ice leads.[7] Because polar bears rely partly on their fur for insulation and soiling of the fur by oil reduces its insulative value, oil spills put bears at risk of dying from hypothermia.[62] Polar bears exposed to oil spill conditions have been observed to lick the oil from their fur, leading to fatal kidney failure.[62] Maternity dens, used by pregnant females and by females with infants, can also be disturbed by nearby oil exploration and development. Disturbance of these sensitive sites may trigger the mother to abandon her den prematurely, or abandon her litter altogether.[7]

Predictions[edit]

The U.S. Geological Survey predicts two-thirds of the world's polar bears will disappear by 2050, based on moderate projections for the shrinking of summer sea ice caused by climate change.[56] The bears would disappear from Europe, Asia, and Alaska, and be depleted from the Arctic archipelago of Canada and areas off the northern Greenland coast. By 2080, they would disappear from Greenland entirely and from the northern Canadian coast, leaving only dwindling numbers in the interior Arctic archipelago.[56]

Predictions vary on the extent to which polar bears could adapt to climate change by switching to terrestrial food sources. Mitchell Taylor, who was director of Wildlife Research for the Government of Nunavut, wrote to the U.S. Fish and Wildlife Service arguing that local studies are insufficient evidence for global protection at this time. The letter stated, "At present, the polar bear is one of the best managed of the large Arctic mammals. If all Arctic nations continue to abide by the terms and intent of the Polar Bear Agreement, the future of polar bears is secure ... Clearly polar bears can adapt to climate change. They have evolved and persisted for thousands of years in a period characterized by fluctuating climate."[112] Ken Taylor, deputy commissioner for the Alaska Department of Fish and Game, has said, "I wouldn't be surprised if polar bears learned to feed on spawning salmon like grizzly bears."[31]

However, many scientists consider these theories to be naive;[31] it is noted that black and brown bears at high latitudes are smaller than elsewhere, because of the scarcity of terrestrial food resources.[111] An additional risk to the species is that if individuals spend more time on land, they will hybridize with brown or grizzly bears.[122] The IUCN wrote:

Polar bears exhibit low reproductive rates with long generational spans. These factors make facultative adaptation by polar bears to significantly reduced ice coverage scenarios unlikely. Polar bears did adapt to warmer climate periods of the past. Due to their long generation time and the current greater speed of climate change, it seems unlikely that polar bear will be able to adapt to the current warming trend in the Arctic. If climatic trends continue polar bears may become extirpated from most of their range within 100 years.[7]

Controversy over species protection[edit]

Polar bear at Central Park Zoo, New York City, USA

Warnings about the future of the polar bear are often contrasted with the fact that worldwide population estimates have increased over the past 50 years and are relatively stable today.[130][131] Some estimates of the global population are around 5,000 to 10,000 in the early 1970s;[132] other estimates were 20,000 to 40,000 during the 1980s.[34][45] Current estimates put the global population at between 20,000 and 25,000.[29]

There are several reasons for the apparent discordance between past and projected population trends: Estimates from the 1950s and 1960s were based on stories from explorers and hunters rather than on scientific surveys.[133][134] Second, controls of harvesting were introduced that allowed this previously overhunted species to recover.[133] Third, the recent effects of climate change have affected sea ice abundance in different areas to varying degrees.[133] Finally, the prediction methods used to predict the decline in the future population of bear bears excluded key forecasting principles and included unquestionable assumptions.[135]

Debate over the listing of the polar bear under endangered species legislation has put conservation groups and Canada's Inuit at opposing positions;[31] the Nunavut government and many northern residents have condemned the U.S. initiative to list the polar bear under the Endangered Species Act.[136][137] Many Inuit believe the polar bear population is increasing, and restrictions on sport-hunting are likely to lead to a loss of income to their communities.[31][138]

U.S. endangered species legislation[edit]

On 14 May 2008 the U.S. Department of the Interior listed the polar bear as a threatened species under the Endangered Species Act, citing the melting of Arctic sea ice as the primary threat to the polar bear.[139] While listing the polar bear as a threatened species, the Interior Department added a seldom-used stipulation to allow oil and gas exploration and development to proceed in areas inhabited by polar bears, provided companies continue to comply with the existing restrictions of the Marine Mammal Protection Act. The main new protection for polar bears under the terms of the listing is that hunters will no longer be able to import trophies from the hunting of polar bears in Canada.[140]

The ruling followed several years of controversy. On 17 February 2005 the Center for Biological Diversity filed a petition asking that the polar bear be listed under the Endangered Species Act. An agreement was reached and filed in Federal district court on 5 June 2006. On 9 January 2007, the United States Fish and Wildlife Service proposed to list the polar bear as a threatened species. A final decision was required by law by 9 January 2008, at which time the agency said it needed another month. On 7 March 2008, the inspector general of the U.S. Department of the Interior began a preliminary investigation into why the decision had been delayed for nearly two months. The investigation is in response to a letter signed by six environmental groups that United States Fish and Wildlife Director Dale Hall violated the agency's scientific code of conduct by delaying the decision unnecessarily, allowing the government to proceed with an auction for oil and gas leases in the Alaska's Chukchi Sea, an area of key habitat for polar bears. The auction took place in early February 2008.[141] An editorial in The New York Times said that "these two moves are almost certainly, and cynically, related."[31][142] Hall denied any political interference in the decision and said that the delay was needed to make sure the decision was in a form easily understood.[141] On 28 April 2008, a Federal court ruled that a decision on the listing must be made by 15 May 2008;[143] the decision came on 14 May to make the polar bear a protected species.[140]

On 18 July 2011, Charles Monnett, whose work was cited by the United States Fish and Wildlife Service in its decision to list the polar bear as threatened under the Endangered Species Act, was suspended from his work at the Bureau of Ocean Energy Management, Regulation and Enforcement.[144] Investigators are reviewing Monnett's research methods as well as the significance he attached to his discovery in 2004 of polar bear carcasses in the Arctic, but supporters argue that the investigation is essentially "a smear campaign" against Monnett.[145]

Upon listing the polar bear under the Endangered species act, the Department of the Interior immediately issued a statement that the listing could not be used to regulate greenhouse gas emissions,[139] although some policy analysts believe that the Endangered Species Act can be used to restrict the issuing of federal permits for projects that would threaten the polar bear by increasing greenhouse gas emissions.[139] Environmental groups have pledged to go to court to have the Endangered Species Act interpreted in such a way.[139] On 8 May 2009, the new administration of Barack Obama announced that it would continue the policy.[146] The polar bear is only the third species, after the elkhorn coral and the staghorn coral protected under the Endangered Species Act due to climate change.[citation needed] On 4 August 2008, the state of Alaska sued U.S. Interior Secretary Dirk Kempthorne, seeking to reverse the listing of the polar bear as a threatened species out of concern that the listing would adversely affect oil and gas development in the state. Alaska Governor Sarah Palin said that the listing was not based on the best scientific and commercial data available, a view rejected by polar bear experts.[147] In March 2013, a United States Appeals Court ruling upheld the "threatened" status of the polar bear against a challenge led by the State of Alaska.[148]

Canadian endangered species legislation[edit]

In Canada, the Committee on the Status of Endangered Wildlife in Canada recommended in April 2008 that the polar bear be assessed as a species of special concern under the federal Species at Risk Act (SARA). A listing would mandate that a management plan be written within five years, a timeline criticized by the World Wide Fund for Nature as being too long to prevent significant habitat loss from climate change.[149]

In culture[edit]

This engraving, made by Chukchi carvers in the 1940s on a walrus tusk, depicts polar bears hunting walrus.

Indigenous folklore[edit]

For the indigenous peoples of the Arctic, polar bears have long played an important cultural and material role.[93][94] Polar bear remains have been found at hunting sites dating to 2,500 to 3,000 years ago[96] and 1,500 year old cave paintings of polar bears have been found in the Chukchi Peninsula.[94] Indeed, it has been suggested that Arctic peoples' skills in seal hunting and igloo construction has been in part acquired from the polar bears themselves.[94]

The Inuit and Eskimos have many folk tales featuring the bears including legends in which bears are humans when inside their own houses and put on bear hides when going outside, and stories of how the constellation which is said to resemble a great bear surrounded by dogs came into being.[92] These legends reveal a deep respect for the polar bear, which is portrayed as both spiritually powerful and closely akin to humans.[92] The human-like posture of bears when standing and sitting, and the resemblance of a skinned bear carcass to the human body, have probably contributed to the belief that the spirits of humans and bears were interchangeable.[92] Eskimo legends tell of humans learning to hunt from the polar bear. For the Inuit of Labrador, the polar bear is a form of the Great Spirit, Tuurngasuk.[150]

Among the Chukchi and Yupik of eastern Siberia, there was a longstanding shamanistic ritual of "thanksgiving" to the hunted polar bear. After killing the animal, its head and skin were removed and cleaned and brought into the home, a feast was held in the hunting camp in its honor. In order to appease the spirit of the bear, there were traditional song and drum music and the skull would be ceremonially fed and offered a pipe.[151] Only once the spirit was appeased would the skull be separated from the skin, taken beyond the bounds of the homestead, and placed in the ground, facing north.[94] Many of these traditions have faded somewhat in time, especially in light of the total hunting ban in the Soviet Union (and now Russia) since 1955.

The Nenets of north-central Siberia placed particular value on the talismanic power of the prominent canine teeth. They were traded in the villages of the lower Yenisei and Khatanga rivers to the forest-dwelling peoples further south, who would sew them into their hats as protection against brown bears. It was believed that the "little nephew" (the brown bear) would not dare to attack a man wearing the tooth of its powerful "big uncle" (the polar bear).[94] The skulls of killed polar bears were buried at specific sacred sites and altars, called sedyangi, were constructed out of the skulls. Several such sites have been preserved on the Yamal Peninsula.[94]

Symbols and mascots[edit]

Coat of arms of the Chukotka Autonomous Okrug in the Russian Federation.
Coat of arms of the Greenlandic Self-Rule government (Kalaallit Nunaat).

Their distinctive appearance and their association with the Arctic have made polar bears popular icons, especially in those areas where they are native. The Canadian Toonie (two-dollar coin) features the image of a polar bear and both the Northwest Territories and Nunavut license plates in Canada are in the shape of a polar bear. The polar bear is the mascot of Bowdoin College in Maine and the University of Alaska Fairbanks (see also Alaska Nanooks) and was chosen as mascot for the 1988 Winter Olympics held in Calgary.

Companies such as Coca-Cola, Polar Beverages, Nelvana, Bundaberg Rum or Good Humor-Breyers have used images of the polar bear in advertising,[152] while Fox's Glacier Mints have featured a polar bear named Peppy as the brand mascot since 1922.

Literature[edit]

Polar bears are also popular in fiction, particularly in books aimed at children or young adults. For example, The Polar Bear Son is adapted from a traditional Inuit tale.[153] Polar bears feature prominently in East (also released as North Child) by Edith Pattou, The Bear by Raymond Briggs, and Chris d'Lacey's The Fire Within series. The panserbjørne of Philip Pullman's fantasy trilogy His Dark Materials are sapient, dignified polar bears who exhibit anthropomorphic qualities, and feature prominently in the 2007 film adaptation of The Golden Compass.

Video Games[edit]

See also[edit]


Notes[edit]

  1. ^ a b c Schliebe et al. (2008). Ursus maritimus. IUCN Red List of Threatened Species. Retrieved 5 January 2010.
  2. ^ Phipps, pg. 185
  3. ^ "Polar bear, (Ursus maritimus)" (PDF). United States Fish and Wildlife service. Retrieved 9 September 2009. "Appearance. The polar bear is the largest member of the bear family, with the exception of Alaska's Kodiak brown bears, which equal polar bears in size."  (Overview page)
  4. ^ Kindersley, Dorling (2001, 2005). Animal. New York City: DK Publishing. ISBN 0-7894-7764-5. 
  5. ^ Gunderson, Aren (2007). "Ursus Maritimus". Animal Diversity Web. University of Michigan Museum of Zoology. Retrieved 27 October 2007. 
  6. ^ a b IUCN Polar Bear Specialist Group, 2009.15th meeting of PBSG in Copenhagen, Denmark 2009: Press Release. Retrieved 10 January 2010.
  7. ^ a b c d e f g IUCN SSC Polar Bear Specialist Group (2008). "Ursus maritimus". IUCN Red List of Threatened Species. Version 2010.3. International Union for Conservation of Nature. Retrieved 25 August 2010.  Database entry includes a lengthy justification of why this species is listed as vulnerable.
  8. ^ Kidd, D.A. (1973). Collins Latin Gem Dictionary. London: Collins. ISBN 0-00-458641-7. 
  9. ^ The Marine Mammal Center
  10. ^ The Arctic Sounder[dead link]
  11. ^ The fourth world: the heritage of the Arctic and its destruction, Sam Hall, Vintage Books, 1988, pp. 29, 232.
  12. ^ "Этимологический Словарь — Piotr Czerwinski — Oshkuy". Nicomant.fils.us.edu.pl. Retrieved 20 March 2011. [dead link]
  13. ^ "Grand Quebec". Grand Quebec. Retrieved 20 March 2011. 
  14. ^ This combines the Ancient Greek words thalassa/θαλασσα 'sea', and arctos/αρκτος 'bear' and also, with reference to Ursa Major, 'northern' or 'of the north pole' Liddell, Henry George and Robert Scott (1980). A Greek-English Lexicon (Abridged Edition). United Kingdom: Oxford University Press. ISBN 0-19-910207-4. 
  15. ^ "IUCN Red List: Ursus maritimus". Retrieved 15 February 2008. 
  16. ^ a b Lindqvist, Charlotte; Schuster, Stephan C.; Sun, Yazhou; Talbot, Sandra L.; Qi, Ji; Ratan, Aakrosh; Tomsho, Lynn P.; Kasson, Lindsay et al. (2010). "Complete mitochondrial genome of a Pleistocene jawbone unveils the origin of polar bear". Proceedings of the National Academy of Sciences 107 (11): 5053–5057. doi:10.1073/pnas.0914266107. PMC 2841953. PMID 20194737. 
  17. ^ a b c DeMaster, Douglas P.; Stirling, Ian (8 May 1981). "Ursus Maritimus". Mammalian Species 145 (145): 1–7. doi:10.2307/3503828. JSTOR 3503828. OCLC 46381503. 
  18. ^ Lisette P. Waits, Sandra L. Talbot, R. H. Ward and G. F. Shields (April 1998). "Mitochondrial DNA phylogeography of the North American brown bear and implications for conservation". Conservation Biology. pp. 408–417. Retrieved 1 August 2006. 
  19. ^ Marris, E. (2007). "Linnaeus at 300: The species and the specious". Nature 446 (7133): 250–253. doi:10.1038/446250a. PMID 17361153. 
  20. ^ Edwards CJ, Suchard MA, Lemey P, Welch JJ, Barnes I et al. (2011). "Ancient hybridization and an Irish origin for the modern polar bear matriline". Current Biology 21 (15): 1251–8. doi:10.1016/j.cub.2011.05.058. PMID 21737280. 
  21. ^ Hailer F, Kutschera V, Hallström BM, Klassert D, Fain SR, Leonard JA, Arnason U, Janke A (2012). "Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage". Science 336 (6079): 344–347. doi:10.1126/science.1216424. PMID 22517859. 
  22. ^ Miller W, Schuster SC, Welch AJ, et al. (July 2012). "Polar and brown bear genomes reveal ancient admixture and demographic footprints of past climate change". Proc Natl Acad Sci U S A. doi:10.1073/pnas.1210506109. PMID 22826254. 
  23. ^ a b Gorman J (23 July 2012). "Brown bears and polar bears split up, but continued coupling". The New York Times. Retrieved 24 July 2012. 
  24. ^ a b Schliebe, Scott; Evans, Thomas; Johnson, Kurt; Roy, Michael; Miller, Susanne; Hamilton, Charles; Meehan, Rosa; Jahrsdoerfer, Sonja (21 December 2006). Range-wide status review of the polar bear (Ursus maritimus) (PDF). Anchorage, Alaska: United States Fish and Wildlife Service. Retrieved 31 October 2007. 
  25. ^ a b c d e f g h Stirling, Ian (1988). "The First Polar Bears". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  26. ^ Rice, Dale W. (1998). Marine Mammals of the World: Systematics and Distribution. Special Publications of the Society for Marine Mammals 4. Lawrence, Kansas: The Society for Marine Mammalogy. ISBN 1-891276-03-4. 
  27. ^ a b c d e f g h Derocher, Andrew E.; Lunn, Nicholas J.; Stirling, Ian (2004). "Polar bears in a Warming Climate". Integrative and Comparative Biology 44 (2): 163–176. doi:10.1093/icb/44.2.163. PMID 21680496. 
  28. ^ a b c d Polar Bears and Conservation and "Polar bear FAQ". Polar Bears International. Retrieved 14 July 2009. 
  29. ^ a b c d e Aars, pp. 33–55.
  30. ^ Paetkau, S.; Amstrup, C.; Born, E. W.; Calvert, W.; Derocher, AE; Garner, GW; Messier, F; Stirling, I et al. (1999). "Genetic structure of the world's polar bear populations" (PDF). Molecular Ecology 8 (10): 1571–1584. doi:10.1046/j.1365-294x.1999.00733.x. PMID 10583821. Archived from the original on 3 March 2010. Retrieved 17 November 2007. 
  31. ^ a b c d e f g h i j k Campbell, Colin; Lunau, Kate (25 January 2008). "The war over the polar bear: Who's telling the truth about the fate of a Canadian icon?". Maclean's. Retrieved 9 March 2008. 
  32. ^ Aars, pp. 61–62
  33. ^ Stirling, Ian (1988). "Introduction". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  34. ^ a b c d Stirling, Ian (1988). "Distribution and Abundance". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  35. ^ Stirling, Ian (January 1997). "The importance of polynyas, ice edges, and leads to marine mammals and birds". Journal of Marine Systems 10 (1–4): 9–21. doi:10.1016/S0924-7963(96)00054-1. 
  36. ^ Matthews, p. 15
  37. ^ Davids, Richard C.; Guravich, Dan (1982). "Lords of the Arctic". Lords of the Arctic: A Journey Among the Polar Bears. New York: MacMillan Publishing Co., Inc. ISBN 0-02-529630-2. 
  38. ^ "Polar bear, (Ursus maritimus)" (PDF). United States Fish and Wildlife service. Archived from the original on 5 June 2008. Retrieved 22 March 2008. "Appearance. The polar bear is the largest member of the bear family, with the exception of Alaska's Kodiak brown bears, a brown bear subspecies, which equal polar bears in size."  (Overview page)
  39. ^ a b Hemstock, p. 4
  40. ^ a b c d Wood, G.L. (1983). The Guinness Book of Animal Records. p. 240. ISBN 978-0-85112-235-9. 
  41. ^ Perrin, William F.; Bernd Würsig, J. G. M. Thewissen (2008). Encyclopedia of Marine Mammals (2 ed.). San Diego, CA: Academic Press. p. 1009. ISBN 978-0-12-373553-9. 
  42. ^ Polar bear Ursus maritimus - Appearance/Morphology: Measurement and Weight (Literature Reports). Wildlife1.wildlifeinformation.org. Retrieved 15 September 2011.
  43. ^ a b c Lockwood, pp. 10–16
  44. ^ "Fractures of the radius and ulna secondary to possible vitamin 'D' deficiency in captive polar bears (Ursus maritimus)". Retrieved 25 November 2007. 
  45. ^ a b c d e Stirling, Ian (1988). Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  46. ^ Uspenskii, S. M. (1977). The Polar Bear. Moscow: Nauka. 
  47. ^ Kolenosky G. B. 1987. Polar bear. pp. 475–485 in Wild furbearer management and conservation in North America (M. Novak, J. A. Baker, M. E. Obbard, and B. Malloch, eds.). Ontario Fur Trappers Association, North Bay, Ontario, Canada.
  48. ^ Koon, Daniel W. (1998). "Is polar bear hair fiber optic?". Applied Optics 37 (15): 3198–3200. doi:10.1364/AO.37.003198. PMID 18273269. 
  49. ^ In unusually warm conditions, the hollow tubes provide an excellent home for algae. While the algae is harmless to the bears, it is often a worry to the zoos housing them, and affected animals are sometimes washed in a salt solution, or mild peroxide bleach to make the fur white again.
  50. ^ Derocher, Andrew E.; Magnus Andersen, and Øystein Wiig (2005). "Sexual dimorphism of polar bears" (PDF). Journal of Mammalogy 86 (5): 895–901. doi:10.1644/1545-1542(2005)86[895:SDOPB]2.0.CO;2. ISSN 1545-1542. JSTOR 4094434. 
  51. ^ a b Rosing, pp. 20–23
  52. ^ a b c d e f g h Stirling, Ian (1988). "Behavior". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  53. ^ Polar Bears: VI. Behavior., SeaWorld. Retrieved 21 January 2011.
  54. ^ a b c d Matthews, pp. 73–88
  55. ^ "Arctic Bears". PBS Nature. 17 February 2008. http://www.pbs.org/wnet/nature/arcticbears/index.html.
  56. ^ a b c d e f Amstrup, Steven C.; Marcot, Bruce G.; Douglas, David C. (2007). Forecasting the range-wide status of polar bears at selected times in the 21st Century (PDF). Reston, Virginia: U.S. Geological Survey. Retrieved 29 September 2007. 
  57. ^ a b Hemstock, pp. 24–27
  58. ^ "In pictures: Rock climbing polar bears". BBC News. 20 April 2010. 
  59. ^ a b c d e Clarkson, Peter L.; Stirling, Ian (1994). "Polar Bears". In Hygnstrom, Scott E.; Timm, Robert M.; Larson, Gary E. Prevention and Control of Wildlife Damage. Lincoln: University of Nebraska. pp. C–25 to C–34. Retrieved 13 November 2007. 
  60. ^ Calvert, Wendy and Stirling, Ian (1990). "Interactions between Ppolar bears and overwintering walruses in the Central Canadian High Arctic". Bears: Their Biology and Management 8: 351–356. doi:10.2307/3872939. JSTOR 3872939.  More than one of |work= and |journal= specified (help)
  61. ^ a b c d Bruemmer, pp. 25–33
  62. ^ a b c d Stirling, Ian (1988). "What Makes a Polar Bear Tick?". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  63. ^ Ramsay, M. A.; Hobson, K. A. (May 1991). "Polar bears make little use of terrestrial food webs: evidence from stable-carbon isotope analysis". Oecologia 86 (4): 598–600. doi:10.1007/BF00318328. 
  64. ^ Best, R. C. (1985). "Digestibility of ringed seals by the polar bear". Canadian Journal of Zoology 63 (5): 1033–1036. doi:10.1139/z85-155. 
  65. ^ a b Manning, T. H. (March 1961). "Comments on 'Carnivorous walrus and some Arctic zoonoses'" (PDF). Arctic 14 (1): 76–77. ISSN 0004-0843. Retrieved 13 November 2007. 
  66. ^ Lunn, N. J.; Stirling, Ian (1985). "The significance of supplemental food to polar bears during the ice-free period of Hudson Bay". Canadian Journal of Zoology 63 (10): 2291–2297. doi:10.1139/z85-340. 
  67. ^ Eliasson, Kelsey (May 2004). "Hudson Bay Post — Goodbye Churchil Dump". Retrieved 9 June 2008. 
  68. ^ a b Matthews, pp. 27–29
  69. ^ a b Stirling, Ian (1988). "Distribution and Abundance". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  70. ^ Matthews, p. 95
  71. ^ Bear Behaviour and Activities from Gary Brown's The Great Bear Almanac, Lyons & Burford, Publishers, 1993
  72. ^ a b c Rosing, pp. 128–132
  73. ^ Why Didn't the Wild Polar Bear eat the Husky? The National Institute for Play
  74. ^ a b c d e f g h i j k l m n o Stirling, Ian (1988). "Reproduction". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  75. ^ a b Carpenter, Tom (November/December 2005). "Who's Your Daddy?". Canadian Geographic (Ottawa: The Royal Canadian Geographic Society): 44–56. 
  76. ^ a b Rosing, pp. 42–48
  77. ^ Lockwood, pp.17–21
  78. ^ Bruce, D. S.; Darling, N. K.; Seeland, K. J.; Oeltgen, P. R.; Nilekani, S. P.; Amstrup, S. C. (1990). "Is the polar bear (Ursus maritimus) a hibernator?: Continued studies on opioids and hibernation". Pharmacology Biochemistry and Behavior 35 (3): 705–711. doi:10.1016/0091-3057(90)90311-5. 
  79. ^ "Rejected by their mother, polar cubs now under intensive care at Toronto Zoo". 13 October 2011. 
  80. ^ Derocher, AE and Wiig, Oe; Infanticide and Cannibalism of Juvenile Polar Bears (Ursus maritimus) in Svalbard Arctic [Arctic]. Vol. 52, no. 3, pp. 307–310. Sep 1999
  81. ^ a b c d e f "Polar bears in depth: Survival". Polar Bears International. Retrieved 20 October 2008. 
  82. ^ a b Regehr, Eric V.; Amstrup, Steven C.; Stirling, Ian (2006). Written at Anchorage, Alaska. Polar bear population status in the Southern Beaufort Sea (PDF). Reston, Virginia: U.S. Geological Survey. Open-File Report 2006-1337. Retrieved 15 September 2007. 
  83. ^ a b Stirling, Ian; Lunn, N. J.; Iacozza, J. (September 1999). "Long-term trends in the population ecology of polar bears in Western Hudson Bay in relation to climatic change" (PDF). Arctic 52 (3): 294–306. ISSN 0004-0843. Retrieved 11 November 2007. 
  84. ^ Maternal success appeared to decline after this point, possibly because of an age-related impairment in the ability to store the fat necessary to rear cubs. Derocher, A.E.; Stirling, I. (1994). "Age-specific reproductive performance of female polar bears (Ursus maritimus)". Journal of Zoology 234 (4): 527–536. doi:10.1111/j.1469-7998.1994.tb04863.x. Retrieved 15 February 2008. 
  85. ^ Larsen, Thor; Kjos-Hanssen, Bjørn (1983). "Trichinella sp. in polar bears from Svalbard, in relation to hide length and age". Polar Research 1 (1): 89–96. doi:10.1111/j.1751-8369.1983.tb00734.x. 
  86. ^ Hemstock, pp. 29–35
  87. ^ Wrigley, Robert E. (Spring 2008). "The Oldest Living Polar Bear" (PDF). Polar Bears International Newsletter. Polar Bears International. Archived from the original on 26 June 2008. Retrieved 9 June 2008. 
  88. ^ Dough O'Harra Polar bears, grizzlies increasingly gather on North Slope. Anchorage Daily News. 24 April 2005
  89. ^ "ABC News: Grizzlies encroaching on polar bear Country". ABC News. Retrieved 10 October 2009. 
  90. ^ "Wolf (Canis lupus) predation of a polar bear (Ursus maritimus) cub on the sea ice off Northwestern Banks Island, Northwest Territories, Canada. ARCTIC Vol. 59, No. 3 (September 2006) p. 322–324" (PDF). Retrieved 20 March 2011. 
  91. ^ Rosen, Yereth (1 May 2012). "Polar bears can swim vast distances, study finds". Reuters. Retrieved 8 May 2012. 
  92. ^ a b c d Stirling, Ian (1988). "The Original Polar Bear Watchers". Polar Bears. Ann Arbor: University of Michigan Press. ISBN 0-472-10100-5. 
  93. ^ a b Lockwood, pp. 6–9
  94. ^ a b c d e f g h i j k Uspensky, Savva Mikhailovich (1977). Белый Медведь (tr: Belyi Medved') — (in Russian). Moscow: Nauka. 
  95. ^ As a carnivore which feeds largely upon fish-eating carnivores, the polar bear ingests large amounts of vitamin A, which is stored in their livers. The resulting high concentrations cause Hypervitaminosis A, Rodahl, K.; Moore, T. (1943). "The vitamin A content and toxicity of bear and seal liver". The Biochemical Journal 37 (2): 166–168. PMC 1257872. PMID 16747610. 
  96. ^ a b Lockwood, pp. 31–36
  97. ^ "Polar Bear Management". Government of the Northwest Territories. Archived from the original on 4 May 2008. Retrieved 14 March 2008. 
  98. ^ a b Bruemmer, pp. 93–111
  99. ^ "Proceedings of the 2nd Working Meeting of Polar Bear Specialists". Polar Bears. Morges, Switzerland: IUCN. February 1970. Archived from the original on 4 May 2008. Retrieved 24 October 2007. 
  100. ^ International Agreement on the Conservation of Polar Bears, 15 November 1973, Oslo
  101. ^ Stirling, Ian Foreword in Rosing, Norbert (1996). The World of the Polar Bear. Willowdale, ON: Firefly Books Ltd. ISBN 1-55209-068-X. 
  102. ^ "U.S. and Russia sign pact to protect the polar bear". The New York Times. 17 October 2000. Retrieved 12 April 2008. 
  103. ^ "US-Russia Polar Bear Treaty Ratified". ScienceDaily. 18 October 2007. Retrieved 12 April 2008. 
  104. ^ a b Steven Lee Myers (16 April 2007). "Russia tries to save polar bears with legal hunt". The New York Times. Retrieved 12 April 2008. 
  105. ^ Naomi A. Rose Hitting Polar Bears When They Are Down. The Humane Society of the United States. 16 February 2006
  106. ^ a b Aaars, pp. 101–116
  107. ^ Freeman, M.M.R.; Wenzel, G.W. (March 2006). "The nature and significance of polar bear conservation hunting in the Canadian Arctic". Arctic 59 (1): 21–30. 
  108. ^ a b Wenzel, George W. (September 2004). "Polar bear as a resource: An overview" (PDF). Yellowknife: 3rd NRF Open Meeting. Retrieved 3 December 2007. 
  109. ^ a b "Nunavut hunters can kill more polar bears this year". CBC News. 10 January 2005. Retrieved 15 September 2007. 
  110. ^ "Rethink polar bear hunt quotas, scientists tell Nunavut hunters". CBC News. 4 July 2005. Retrieved 20 March 2011. 
  111. ^ a b c d e f Stirling, Ian; Derocher, Andrew E. (2007). "Melting under pressure: The real scoop on climate warming and polar bears" (PDF). The Wildlife Professional (Fall 2007) 1 (3): 24–27, 43. Retrieved 17 November 2007. 
  112. ^ a b Taylor, Mitchell K. (6 April 2006). Review of CBD Petition (PDF). Letter to the U.S. Fish and Wildlife Service. Retrieved 8 September 2007. 
  113. ^ a b George, Jane (April 2010). "Nunavut hunters still enraged over bear quotas". Iqaluit. Retrieved 4 April 2010. 
  114. ^ "Bear Facts: Harvesting/Hunting". Polar Bears International. Retrieved 14 March 2008. 
  115. ^ The Humane Society of the United States "Support the Polar Bear Protection Act"
  116. ^ "Release of the 2006 IUCN Red List of Threatened Species reveals ongoing decline of the status of plants and animals". World Conservation Union. Archived from the original on 12 May 2006. Retrieved 1 February 2006. 
  117. ^ WWF: A Leader in Polar Bear Conservation . Retrieved 29 June 2009, from WFF – Polar Bear Web site: http://www.worldwildlife.org/species/finder/polarbear/polarbear.html#
  118. ^ a b c Stirling, Ian; and Claire L. Parkinson (September 2006). "Possible effects of climate warming on selected populations of polar bears (Ursus maritimus) in the Canadian Arctic" (PDF). Arctic 59 (3): 261–275. ISSN 0004-0843. Retrieved 15 September 2007. 
  119. ^ Stirling, Ian; N.J. Lunn, John Iacozza, Campbell Elliott and Martyn Obbard (March 2004). "Polar bear distribution and abundance on the Southwestern Hudson Bay coast during open water season, in relation to population trends and annual ice patterns" (PDF). Arctic 57 (1): 15–26. ISSN 0004-0843. Retrieved 15 September 2007. 
  120. ^ Barber, D.G.; J. Iacozza (March 2004). "Historical analysis of sea ice conditions in M'Clintock Channel and the Gulf of Boothia, Nunavut: implications for ringed seal and polar bear habitat" (PDF). Arctic 57 (1): 1–14. ISSN 0004-0843. 
  121. ^ T. Appenzeller and D. R. Dimick, "The Heat is On," National Geographic 206 (2004): 2–75. cited in Flannery, Tim (2005). The Weather Makers. Toronto, Ontario: HarperCollins. pp. 101–103. ISBN 0-00-200751-7. 
  122. ^ a b c Arctic Climate Impact Assessment (2004). Impact of a Warming Arctic: Arctic Impact Climate Assessment. Cambridge: Cambridge University Press. ISBN 0-521-61778-2. OCLC 56942125. . The relevant paper is Key Finding 4
  123. ^ a b Monnett, Charles; Gleason, Jeffrey S. (July 2006). "Observations of mortality associated with extended open-water swimming by polar bears in the Alaskan Beaufort Sea". Polar Biology 29 (8): 681–687. doi:10.1007/s00300-005-0105-2. 
  124. ^ Mitchell Taylor, a former polar bear researcher for the Nunavut government, believes that arctic warming has been caused by natural phenomena and is not a long-term threat to the polar bear. After his retirement, he was not re-appointed to the international Polar Bear Specialist Group (PBSG), giving rise to speculation that he was excluded from the group because of his views on climate change. According to the PBSG chair, appointments to the PBSG are given to scientists who are currently active in polar bear research, and that as a retired researcher Taylor did not qualify. (References: Booker, Christopher (27 June 2009). "Polar bear expert barred by global warmists". The Daily Telegraph (London). Retrieved 12 August 2009. )
  125. ^ Regehr, E. V.; Lunn, N. J.; Amstrup, N. C.; Stirling, I. (2007). "Effects of earlier sea ice breakup on survival and population size of polar bears in western Hudson Bay". Journal of Wildlife Management 71 (8): 2673–2683. doi:10.2193/2006-180. 
  126. ^ The proportion of maternity dens on sea ice has changed from 62% between the years 1985 through 1994, to 37% over the years 1998 through 2004. Thus now the Alaskan population more resembles the world population in that it is more likely to den on land. Fischbach, A. S.; Amstrup, S. C.; Douglas, D. C. (2007). "Landward and eastward shift of Alaskan polar bear denning associated with recent sea ice changes". Polar Biology 30 (11): 1395–1405. doi:10.1007/s00300-007-0300-4. 
  127. ^ "Polar Bears at the Top of POPs". The Science and the Environment Bulletin. Environment Canada. May/June 2000. Retrieved 20 October 2008. 
  128. ^ Skaare, Janneche Utne et al. (2002). "Ecological risk assessment of persistent organic pollutants in the arctic" (PDF). Toxicology. 181–182: 193–197. doi:10.1016/S0300-483X(02)00280-9. PMID 12505309. Archived from the original on 3 March 2010. Retrieved 17 November 2007. 
  129. ^ Verreault, Jonathan et al. (2005). "Chlorinated hydrocarbon contaminants and metabolites in polar bears (Ursus maritimus) from Alaska, Canada, East Greenland, and Svalbard: 1996–2002" (PDF). Science of the Total Environment. 351–352: 369–390. doi:10.1016/j.scitotenv.2004.10.031. PMID 16115663. Archived from the original on 3 March 2010. Retrieved 17 November 2007. 
  130. ^ "Marine Mammals Management: Polar Bear". U.S. Fish and Wildlife Service, Alaska. Retrieved 9 June 2008. 
  131. ^ "WWF — Polar bear status, distribution & population". World Wildlife Foundation. Retrieved 22 March 2010. 
  132. ^ Krauss, Clifford (27 May 2006). "Bear hunting caught in global warming debate". The New York Times. Retrieved 11 March 2008. 
  133. ^ a b c Derocher, Andrew. "Ask the experts: Are polar bear populations increasing?". Polar Bears International. Retrieved 9 March 2008. 
  134. ^ Bruemmer, p. 101. In a meeting of the five circumpolar nations on 6 September 1965, estimates of the worldwide population ranged from 5,000 to 19,000. "The truth was, no one knew... Scientific research had been sketchy and knowledge of the polar bear was based largely on stories brought back by explorers and hunters."
  135. ^ J. Scott Armstrong and Kesten C. Greene and Willie Soon (2008). "Polar bear population forecasts: A public-policy forecasting audit". Interfaces (INFORMS) 38 (5): 382–405. 
  136. ^ "Nunavut MLAs condemn U.S. proposal to make polar bears threatened species". CBC News. 4 June 2007. Retrieved 15 September 2007. 
  137. ^ "Inuit reject U.S. polar bear proposal". CBC News. 21 June 2007. Retrieved 15 September 2007. 
  138. ^ Northern Research Forum. Polar bear as a resource. A position paper presented for the 3rd NRF Open Meeting in Yellowknife and Rae Edzo, Canada. 15–18 September 2004
  139. ^ a b c d Hassett, Kevin A (23 May 2008). "Bush's polar bear legal disaster". National Post. Archived from the original on 29 May 2008. Retrieved 7 June 2008. 
  140. ^ a b Barringer, Felicity (15 May 2008). "Polar bear is made a protected species". The New York Times. Retrieved 7 June 2008. 
  141. ^ a b Hebert, H. Josef (8 March 2008). "Delay in polar bear policy stirs probe". San Francisco Chronicle. Retrieved 9 March 2008. 
  142. ^ Editorial (15 January 2008). "Regulatory Games and the Polar Bear". The New York Times. Retrieved 20 October 2008. 
  143. ^ Biello, David (30 April 2008). "Court obrders U.S. to stop keeping polar bear status on ice". Scientific American News. Retrieved 8 June 2008. 
  144. ^ Efstathiou, Jim (28 July 2011). "Scientist who reported polar bears drowning is suspended by U.S. agency". Bloomberg News. Retrieved 14 August 2011. 
  145. ^ Goldenberg, Suzanne (29 July 2011). "Arctic scientist suspended over 'integrity issues'". The Guardian. Retrieved 14 August 2011. 
  146. ^ U.S. to keep Bush administration rule on polar bears, McClatchy Newspapers, 8 May 2009
  147. ^ Joling, Dan (5 August 2008). "Alaska sues over listing polar bear as threatened". The Globe and Mail. Retrieved 29 August 2008. 
  148. ^ Kendall, Brent (2–3 March 2013). "Court upholds polar bears as 'threatened' species". The Wall Street Journal (paper). p. A2. 
  149. ^ Brach, Bal (25 April 2008). "Experts seek more protection for polar bears". Canwest News Service. Retrieved 9 May 2008. 
  150. ^ balisunset, (2008, 8 22). The Bear in Myth, Mythology and Folklore. Retrieved 29 June 2009
  151. ^ Kochnev AA, Etylin VM, Kavry VI, Siv-Siv EB, Tanko IV (17–19 December 2002). Ritual Rites and Customs of the Natives of Chukotka connected with the Polar Bear. Preliminary report submitted for the meeting of the Alaska Nanuuq Commission (Nome, Alaska, USA). pp. 1–3. 
  152. ^ "Bundaberg Rum Web site — history section". Bundaberg Rum Web site. Retrieved 26 March 2008. 
  153. ^ Dabcovich, Lydia (1997). The polar bear son: An Inuit tale. New York: Clarion Books. ISBN 0-395-72766-9. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Ursus maritimus tyrannus

Ursus maritimus tyrannus!<-- This template has to be "warmed up" before it can be used, for some reason -->

Bilateria

Ursus maritimus tyrannus was a very large fossil subspecies of polar bear, descended from an Arctic population of brown bears. Its name in Latin means tyrannt sea bear. The species is mentioned by Björn Kurtén, who assigned it to a Polar bear subspecies, U. m. tyrannus.[1] Its bones have been found in contemporary England.

Contents

Evolution

U. m. tyrannus was the first polar bear and evolved sometime in the Middle Pleistocene. While the oldest fossil is 100,000 years old, the species is thought to have evolved between 100,000 and 250,000 years ago from a population of brown bear likely isolated by glaciation. That population is believed to have diminished in numbers quickly into a much smaller population, with selection pressures favouring those individuals who adapted better to the changed environment. Over time, subject to intense selective pressures, the small population evolved the characteristics of the first polar bears.

Appearance

Initially the isolated brown bears displayed the same traits as brown bears of that time period. Because litters of cubs can show significant variations in hair color and hair thickness, this gave certain individuals a survival advantage passed on with each generation. Eventually skull changes and even changes in dentition occurred, leading to the smooth and rather quick evolution of U. m. tyrannus.

Size

The few bones that had been found of U. m. tyrannus were very similar to the brown bear bones, but were considerably larger in dimensions. If everything is scaled out correctly from its remains, it would have been 1.83 m (6 ft 0 in) at the shoulders, 3.7 m (12 ft 2 in) long, more than 4 m (13 ft 1 in) on the hind legs and with an average weight of 1.2 tons or more. These measurements would make U. m. tyrannus the largest bear ever to live, as well as the largest mammalian carnivore to ever hunt on land.[2]

Hunting and diet

The diet and hunting behaviour of U. m. tyrannus are virtually unknown, though the similarity of its anatomy to that of the brown bears may suggest that its diet and hunting behaviour were more like those of brown bears than polar bears.[3]The development of the dentition displayed by modern polar bears began as late as 10,000 years ago, as polar bears' diets became more specialized and carnivorous; the process may have started with U. m. tyrannus. In the Pleistocene much of Europe, including England, was covered with ice sheets, and large herbivores such as the woolly mammoth would have been abundant. The prevalence of these prey species, and the general lack of plant material in its environment, might have forced U. m. tyrannus to adopt a more carnivorous diet. The similarity of U. m. tyrannus's build to that of modern brown and polar bears, and its distinctness from species like Arctodus simus, would have made the animal much more suitable for taking on very large prey species, using its massive forelimbs to grab and wrestle down prey. Modern polar bears have been observed to wrestle down and kill animals much heavier than themselves, such as bull walruses.[4].

However, its diet as well as its behaviour remains a great mystery, so searching for further fossils may help shed more light on this extinct bear.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ursus maritimus appears to share a common ancestor with the present-day grizzly/brown bear (Ursus arctos), branching off the brown bear lineage during the late Pleistocene (Amstrup 2003). Various evidence sources indicate these species are sister taxa, more closely related to each other than either is to the black bear (Ursus americanus); mtDNA sequences of brown bears from the Alexander Archipelago, southeast Alaska, were even found to be more closely related to mtDNA of polar bears than of other brown bears (Cronin et al. 1991). Cronin et al. (1991) found low divergence in mtDNA haplotypes among polar bear populations from Alaska and Canada.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!