Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Species Abstract

The North Atlantic right whale (Eubalaena glacialis) is a critically endangered marine mammal (300 to 350 individuals estimated in 2008) in the family Balaenidae, part of the order of cetaceans. The North Atlantic right whale is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans, and small fish.

North Atlantic Right Whales were hunted for at least 800 years, until they became so rare that it was no longer commercially viable to exploit them. Now numbering only in the hundreds, and showing no signs of recovery, Northern right whales are nearly extinct. Some populations have not shown any significant reproduction, even after becoming protected by law.

Today, the North Atlantic right whale is a rarely observed species, but its name derives from an era when they were more frequently sighted, when they swam slowly, close to shore, thus making them an easy target for whalers. Not only did this swimming behaviour make this whale the right one to hunt, but this whale also floats when dead and yielded vast quantities of valuable oil and baleen.

Despite its bulky size, the North Atlantic right whale is able to perform acrobatic acts such as jumping out of the water, known as breaching, violently slapping the water surface with the tail and/or a pectoral fin. Although the purpose of these behaviours is not fully understood, they may be used in communication. Similarly, the range of low frequency groans, moans and belches that the North Atlantic right whale makes are hypothesised to be used to communicate with other individuals, or signal aggression.

Remarkable for massive size, North Atlantic right whales feed chiefly on minute planktonic prey, including large copepods, the size of a grain of rice; krill, a shrimp-like crustacean; tiny planktonic snails and the drifting larval stages of barnacles and other crustaceans. North Atlantic right whales are skim feeders, meaning they consume prey by swimming forward with mouths open, allowing water to flow into the mouth and out through the baleen. Tiny prey are strained from the water as it becomes caught in the fringed baleen, where it is then dislodged by the tongue and swallowed. Although this whale often feeds at or immediately below the ocean surface, the North Atlantic right whale is also believed to sometimes feed close to the bottom, since it has been seen surfacing after a 10 to 20 minute dive with mud on its head.

After feeding at northern latitudes during the summer, the North Atlantic right whale migrates south for winter. Pregnant females head for the inshore calving grounds, whilst the location of the remaining majority of the population is not known. Wherever they move, this is the season at which mating takes place.

North Atlantic right whale females typically first calve at nine to ten years of age, therafter giving birth to a single young every three years. The gestation period lasts for about one year, and following birth, the mother and her young remain close until the calf is weaned at the age of one. During its first year of life the calf learns the location of critical feeding grounds from its mother, which it will continue to visit for the remainder of its life. The female then takes a third year to replenish her energy stores before breeding again.
  • * Encyclopedia of Earth. Author: Encyclopedia of Life. 2011. Topic ed. C.Michael Hogan. Ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment http://www.eoearth.org/article/North_Atlantic_Right_Whale?topic=49540
  • * D.W.Macdonald. 2006. The Encyclopedia of Mammals. Oxford University Press, Oxford.
  • * C.A.Mayo and M.K.Marx. 1990. Surface foraging behavior of the North Atlantic right whale, Eubalaena glacialis, and associated zooplankton characteristics. Canadian Journal of Zoology, (68), pp. 2214-20.
  • ARKive. 2008. North Atlantic right whale (Eubalaena glacialis)
  • * A.R.Martin and F.J.Walker. 1997. Sighting of a right whale (Eubalaena glacialis) with calf off S. W. Portugal. Marine Mammal Science 13(1): 139-141.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Description

"Northern right whales were hunted for at least 800 years, until they became so rare that it was no longer commercially viable to hunt them. Biology made them and southern right whales the ""right"" whales to hunt, especially when whaling was less sophisticated than it is today. They are absolutely massive, weighing up to 100 tons in a package less than 20 m long. Their bodies provide lots of oil and high quality baleen. They are slow swimmers, often found in coastal waters, and they float when killed, so they were easy to chase, kill, and tow to port. Now numbering only in the hundreds, and showing no signs of recovery, northern right whales are nearly extinct. Some populations have not shown any significant reproduction, even after becoming protected by law. Northern right whales live long lives: some animals have been studied for years and one was known to be at least 67 years old when she was seen in 1992. They skim-feed on small marine crustaceans.

The North Atlantic right whale differs in skin color from the North Pacific right whale and the cold waters of the Arctic Circle are a natural impediment to the mingling of these two groups."

Adaptation: This skull of a Right whale  (Eubalaena) is shown with the mandible dropped into the open position, illustrating how the baleen plates hang like a curtain of filters to strain and separate food from a mouthful of water.

Links:
Mammal Species of the World
Visit ARKive for more images of the North Atlantic right whale  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:75, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The North Atlantic right whale is currently one of the rarest large whales in the world, having been drastically reduced to critically low numbers by years of exploitation (2). Its robust, somewhat rotund, body is mostly black, with a large head that measures up to one third of the total body length. Some individuals may also bear white patches on the underside, while others have a more mottled appearance. More often, the only conspicuous feature of this great whale are the irregular patches of thickened tissue, called callosites, on the head. These callosites are inhabited by many small amphipods, known as cyamids or whale lice, and form a pattern unique to each individual whale, thus providing a means of identification (2). The North Atlantic right whale lacks a dorsal fin (2), but has large, paddle-like pectoral fins used for steering (2) (5), and an enormous tail that provides propulsion with powerful vertical strokes (2) (5). The downward-curved mouth of the North Atlantic right whale contains between 200 and 270 baleen plates on each side of the upper jaw (2). These plates, each measuring around two metres long and fringed with fine hairs (2), replace teeth in Balaenidae whales, and are central to their method of feeding (5). The North Atlantic right whale has two blowholes situated on top of its head through which it breathes, producing a distinctive, bushy, v-shaped cloud of spray when it exhales at the surface (5) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Remarkable for their large size, North Atlantic right whales feed only on tiny planktonic prey, including large copepods, the size of a grain of rice; krill, a shrimp-like crustacean; tiny planktonic snails and the drifting larval stages of barnacles and other crustaceans (2). North Atlantic right whales are 'skim feeders', which feed by swimming forward with their mouth open, allowing water to flow into the mouth and out through the baleen (2). Tiny prey is strained from the water as it becomes caught in the fringed baleen, where it is then dislodged by the tongue and swallowed (5). Although they often feed at the ocean surface, or just below, the North Atlantic right whale is also believed to feed close to the bottom, as it has been seen surfacing after a 10 to 20 minute dive with mud on its head (2). After feeding at northern latitudes during the summer, the North Atlantic right whale migrates south for winter. Pregnant females head for the inshore calving grounds, whilst the location of the remaining majority of the population is not known. Wherever they head, this is the time at which mating takes place (2). North Atlantic right whale females typically first calve at nine to ten years of age, and then give birth to a single young every three years. The gestation period lasts for about one year, and following birth, the mother and her young remain close until the calf is weaned at the age of one (2). During its first year of life the calf learns the location of critical feeding grounds from its mother, which it will continue to visit for the remainder of its life. The female then takes a third year to replenish her energy stores before breeding again (2). Today, the North Atlantic right whale is a rarely seen animal, but its name refers to a time when they were more frequently observed, when they swam slowly, close to shore, thus making them an easy target for whalers. Not only did this swimming behaviour make this whale the 'right' one to hunt, but it also floated when dead and yielded vast quantities of valuable oil and baleen (2). Despite its bulky size, the North Atlantic right whale is able to perform acrobatic acts such as jumping out of the water, known as breaching, violently slapping the water surface with the tail and slapping the surface with a pectoral fin (2). Although the purpose of these behaviours is not fully understood, they may be used in communication. Similarly, the range of low frequency groans, moans and belches that the North Atlantic right whale makes are hypothesized to be used to communicate with other individuals, or signal aggression (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

Description

 Eubalaena glacialis is a baleen whale and can be recognised as such by the plates of baleen (rather than teeth) suspended from the upper jaw and the two blowholes on the upper body. It has an arched upper jaw and a smooth lower jaw without pleats. The northern right whale is robust bodied and can reach up to 17 m in length. With no similar species in British and Irish waters, the northern right whale is easily recognisable at close range. It has distinct roughened areas of skin, known as callosities, on its large head. Callosities are present above the eye, on the upper jaw, and a line of small callosities is present on each side of the lower jaw leading to a large callosity at the front of the jaw.Northern right whales are usually found alone or in pairs, although in feeding areas up to a dozen have been seen together. It occasionally breeches, and when diving, it will often show the tail flukes. Slapping of the flippers and tail flukes has been observed. Dives may last up to 40 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North Atlantic Right Whales (Eubalaena glacialis) inhabit the Atlantic Ocean, especially between 20o and 60o N latitude. Most individuals in the western North Atlantic population range from wintering and calving areas in coastal waters off the southeastern United States to summer feeding and nursery grounds in New England waters and north to the Bay of Fundy and Scotian Shelf. In 1991, five "high use" areas were identified by the National Marine Fisheries Service: (1) coastal Florida and Georgia, (2) Great South Channel, (3) Massachusetts Bay and Cape Cod Bay, (4) Bay of Fundy, and (5) Scotian Shelf (NOAA Fisheries Office of Protected Resources Website, accessed 10 December 2009, http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/rightwhale_northatlantic.htm).

The eastern North Atlantic population may originally have migrated along the coast from northern Europe to the northwest coast of Africa. Historical records suggest these animals were heavily exploited by whalers from the Bay of Biscay (off southern Europe) and Cintra Bay (off the northwestern coast of Africa), as well as off coastal Iceland and the British Isles. During the early to mid 1900s, right whales were intensely harvested in the Shetlands, Hebrides, and Ireland. Recent surveys suggest right whales no longer frequent Cintra Bay or northern European waters. Due to a lack of sightings, current distribution and migration patterns of the eastern North Atlantic right whale population are unknown (NOAA Fisheries Office of Protected Resources Website, accessed 10 December 2009, http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/rightwhale_northatlantic.htm).

What was long treated as a single right whale species is now recognized as three distinct species by both scientists and federal regulatory agencies (Rosenbaum et al. 2000; Gaines et al. 2005; http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/). The North Pacific right whale (Eubalaena japonica), which inhabits the Pacific Ocean, especially between 20o and 60o N latitude, is now widely recognized as a species distinct from the North Atlantic right whale. Similarly, the Southern right whale (Eubalaena australis) is now recognized as a distinct species occurring in the southern hemisphere between around 20o and 60o S latitude.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Range

Historically, the North Atlantic right whale was far more widespread than it is now, and was once common on both sides of the Atlantic (1), from Labrador, Greenland, Iceland and Norway south to Florida and north-western Africa (2). Today, this whale appears to be effectively extinct in the eastern North Atlantic (1), and it survives only in the western North Atlantic, from Florida to Nova Scotia (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Mozambique, North West Atlantic, Portuguese Exclusive Economic Zone, Seychelles, Spanish Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern and Western North Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The right whale was formerly common on both sides of the North Atlantic. It appears to be effectively extinct in the eastern North Atlantic but in the past probably ranged from a calving ground in the Golfo de Cintra (23°N) off Western Sahara, through the Azores, Bay of Biscay, western British Isles, and the Norwegian Sea to the North Cape (hence the Dutch name Noordkaper). In the western North Atlantic the species migrates from a calving ground off Florida and Georgia along the eastern seaboard of North America, to summering grounds in the Gulf of Maine, Bay of Fundy, and Scotian Shelf, with some individuals reaching the Gulf of St Lawrence, the Davis and Denmark Straits and occasionally Iceland and Norway. It is unclear whether in the past the animals in the northern part of the range (off Iceland and Norway) belonged mainly to the western or eastern breeding stocks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Northern right whales were once found throughout the Northern Hemisphere. These whales inhabit the temperate and subpolar waters of the north Atlantic and north Pacific oceans. In the North Pacific they are found from about 25 to 60 degrees north and in the North Atlantic from about 30 to 75 degrees north. Northwest Atlantic populations occur from Iceland to the Gulf of Mexico, with largest concentrations occurring between Nova Scotia, Canada, and Florida. Winter calving grounds occur off the coasts of Florida and Georgia.

Right whales move from subpolar regions with the onset of winter to lower latitudes, staying near land masses. Some good areas to see them are from Cape Cod north to the Bay of Fundy, Nova Scotia and Grand Manan Island, New Brunswick.

Northern Pacific populations are isolated from Northern Atlantic populations and are genetically distinct. These populations are sometimes referred to as Eubalaena japonica, Northern Pacific right whales, and occur from the southeastern Bering Sea to the Okhotsk Sea off western Russia. Northern Pacific populations may be more closely related to southern right whales, Eubalaena australis, than to Northern Atlantic populations of northern right whales (Northern Atlantic right whales).

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Rosenbaum, H., R. Brownell, M. Brown, C. Schaeff, V. Portway, B. White, S. Malik, L. Pastene, N. Patenaude, C. Baker, M. Goto, P. Best, P. Clapham, P. Hamilton, M. Moore, R. Payne, V. Rowntree, C. Tynan, J. Bannister, R. DeSalle. 2000. World-wide genetic differentiation of Eubalaena: questioning the number of right whale species.. Molecular Ecology, 9: 1793-1802. Accessed December 01, 2003 at http://www.nefsc.noaa.gov/psb/pubs/rosenbaummolecol.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

temperate and subpolar waters of North Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Remnant populations occur in the North Atlantic (mainly Florida and Gulf of Mexico to Labrador). Very rare in the eastern North Atlantic (fewer than 10 reliable sightings within the past 50 years, but including a female and calf were observed off Portugal in 1995 (Martin and Walker 1997). North Atlantic high-use areas include coastal Florida and Georgia (winter calving); Great South Channel east of Cape Cod, Massachusetts (spring feeding); Massachusetts Bay and Cape Cod Bay (winter-spring feeding); Bay of Fundy (summer and fall feeding and nursery area); and Browns and Baccaro banks south of Nova Scotia (Roseway Basin, summer and fall feeding) (Right Whale Recovery Team 1990, Malik et al. 1999). See Right Whale Recovery Team (1990) and IUCN (1991) for further details. The Bay of Fundy is the important nursery area, but at least one other nursery area (as yet unidentified) must exist (Schaeff et al. 1993, Malik et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

From 30° to 62° North latitude in the North Atlantic Ocean. Northern Atlantic, North Pacific, and Southern populations do not appear to mix.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eubalaena glacialis is typically uniformly dark in color except for scars, belly patches, parasites and head excrescences or callosities, most of which are light. Callosities are prominent on the rostrum, near blowholes, near eyes, and on the chin and lower lip. These large crusty growths often harbor crustaceans called whale lice, and may therefore appear white, orange, yellow, or pink. Hair can be found on the tips of the chin and upper jaw and is also associated with the callosities. Right whales have no dorsal fin, nor do they have the grooved throat. The flippers are very broad and short.

Compared to other mysticetes, right whales are very large in girth relative to their length giving them a rotund appearance. The jaws are greatly arched in order to fit the exceptionally long baleen. Baleen can reach a maximum length of 5 m with an average of 300 plates on either side. The head is enormous, close to one-third the body length. There is sexual dimorphism; females are larger than males. Young are 4.5 to 6m long at birth. Adults can be up to 17m long and weigh up to 100 tons.

The blowholes are well partitioned on the exterior surface, resulting in a vertical V-shaped blow that may be up to 5m high. The largest amount of blubber found in whales is that of right whales. The average thickness is 20 inches and can be as thick as 28 inches. It comprises 36-45% of the total body weight. All seven cervical vertebrae are fused into one osseous unit. They are extremely slow swimmers, swimming at an average of 2 knots and rarely exceeding 5 knots.

(Cummings 1985, Slijper 1979).

Range mass: 55000 to 95000 kg.

Range length: 17 (high) m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 1400 cm

Weight: 2.3E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Female maximum length 16.5 - 18 m (depending on measurement method used). Females are larger than males.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Average: 17 m
Range: up to 18 m

Weight:
Range: 60,000-100,000kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: craggy patches on head called "callosities" used to identify individuals. Lift large, all black tail when diving. Blow readily visible-6 m (20') v-shaped. No dorsal fin. Large lower lips, narrow rostrum, broad throat without throat pleats. Black to mottled grey, white scarring, white belly patches in 30% of individuals.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Right whales differ from other large whales in having callosities on the head; also, the absence of a dorsal fin distinguishes right whales from many other large whales. Lacks the knuckled ridge along the spine and the more elongate body and flippers of the gray whale. There are no known external morphological differences between E. GLACIALIS and E. AUSTRALIS, though it has been suggested that callosities along the upper surface of the lower lips are present more consistently in AUSTRALIS (see Leatherwood and Reeves 1983); of course, the two taxa cannot be mistaken in the field since their ranges are far apart.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Eubalaena glacialis (Muller, 1776)
Catalog Number: USNM 301637
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull; Skeleton; Photograph
Collector(s): G. Davidson
Year Collected: 1861
Locality: Delaware River, Near Philadelphia On Coast Of New Jersey, *, New Jersey, United States, Delaware Bay, North America, North Atlantic Ocean
  • Type: Cope, E. D. 1865. Proc. Acad. Nat. Sci. Philadelphia. 1865: 168.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Right whales feed on calanoid copepods and other small invertebrates (smaller copepods, krill, pteropods, and larval barnacles), generally by slowly skimming through patches of concentrated prey at or below the surface. The most common prey species is the copepod Calanus finmarchicus (Perry et al. 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depending on the time of year and which hemisphere they're found, right whales will spend much of their time near bays and peninsulas and in shallow, coastal waters. This can provide shelter, food abundance, and security for females rearing young or avoiding the mating efforts of males. Four critical habitats for northern right whales are the Browns-Baccaro Bank, Bay of Fundy, Great South Channel, and the Cape Cod Bay. Each of these is distinguished by high densities of copepod populations. The first three have deep basins (150 m) flanked by relatively shallow water. Copepods are concentrated here because of convergences and upwellings driven by tidal currents. This also occurs in the Cape Cod Bay even though a deep basin isn't present.

(Cummings 1985, Katona 1999)

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

inshore and offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 853 specimens in 1 taxon.
Water temperature and chemistry ranges based on 433 samples.

Environmental ranges
  Depth range (m): 0 - 8
  Temperature range (°C): 3.976 - 26.026
  Nitrate (umol/L): 0.286 - 4.522
  Salinity (PPS): 31.523 - 36.280
  Oxygen (ml/l): 4.690 - 7.680
  Phosphate (umol/l): 0.092 - 0.673
  Silicate (umol/l): 0.868 - 3.669

Graphical representation

Depth range (m): 0 - 8

Temperature range (°C): 3.976 - 26.026

Nitrate (umol/L): 0.286 - 4.522

Salinity (PPS): 31.523 - 36.280

Oxygen (ml/l): 4.690 - 7.680

Phosphate (umol/l): 0.092 - 0.673

Silicate (umol/l): 0.868 - 3.669
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Inhabits nearshore and offshore waters. Mainly coastal in the North Atlantic, occurs over the continental shelf in the North Pacific (Right Whale Recovery Team 1990). Tynan et al. (2001) found a few of the remaining North Pacific animals concentrated in relatively warm (10.4 C SST), shallow (50 to 80 m deep), well-stratified water in an extensive coccolithophore bloom of Emiliania huxleyi. Mother-calf pairs generally concentrate their summer feeding activities in relatively secluded areas away from sites frequented by other whales (Schaeff et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The northern right whale is an open ocean whale, not often seen near the coast in north-west Europe. It can be found at the surface or diving down to a few hundred metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Warm and cold marine waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This marine mammal migrates between two vital habitats: feeding grounds and calving grounds (2). Its feeding grounds are in the north of its range, where a combination of factors such as temperature, ocean bottom topography and currents interact to aggregate zooplankton into dense concentrations (2). The North Atlantic right whale's calving grounds are situated in warmer waters in the south of its range, in shallow coastal waters or bays (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates seasonally between high latitudes (summer) and lower latitudes (winter), though migrations are less regular and coherent than those of humpback or gray whale (Leatherwood and Reeves 1983).

North Atlantic: generally most spend early summer off the coast of New England, move to waters off southern Canada (lower Bay of Fundy or area between Browns and Baccaro banks) in late summer and fall; some remain in northern waters in winter but most leave (beginning as early as October); pregnant females move south to winter calving areas off Georgia and Florida; wintering area for the rest of the population is unknown; northward movement occurs in late winter and early spring; perhaps most of the population moves through the Cape Cod-Massachusetts Bay area and Great South Channel March-May (Right Whale Recovery Team 1990). Females usually and males commonly return to their natal area in subsequent summers (Schaeff et al. 1993).

North Pacific: may be nomadic in summer, movements depending on where food resources are abundant; winter range is largely unknown (Right Whale Recovery Team 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Northern right whales tend to skim near the surface of the water feeding on small copepods, krill, and euphausiids. The whales swim along the surface, or just below, with their mouth open, skimming the zooplankton from the water. The water passes through a series of large baleen plates which filter out the food. The whale will skim the surface for a while, then close its mouth and push its tongue against the baleen to collect its meal. Whales tend not to feed until they find large concentrations of food. When they find these concentrations, they swim through the mass, making accurate adjustments to their course in order to maximize their intake (Slijper 1979, Evans 1987).

Animal Foods: aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mainly calanoid copepods and juvenile euphausiids. Feeds by skimming--swims with mouth open usually below the surface, sometimes at the surface. Depends on concentrations of zooplankton. In Bay of Fundy, appeared to exploit patches of copepods at densities greater than about 820 per cubic m (Murison and Gaskin 1989). In Cape Cod Bay, rarely fed where total zooplankton density was less than 1000 organisms per cubic meter (Mayo and Marx 1990). In the southeastern Bering Sea, fed primarily on later copepodite stages of the calanoid copepod Calanus marshallae. Historically (1940s-1960s), this population had concentrated on the oceanic copepod Neocalanus cristatus in deeper waters (Tynan et al. 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feed almost exclusively on calanoid copepods, concentrating on aggregations of these copepods.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Baleen whales, like northern right whales, are important as predators on krill and other planktonic invertebrates in marine environments.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Although they typically don't live together in groups, they may temporarily cluster together to form a defensive circle when threatened by a potential predator. In those circumstances, the whales form a circle with flailing tails pointed outwards. They may also move into shallow waters to attempt to overt the predator but sharks and killer whales (orcas) are able to continue to stalk in these depths. The right whale was hunted by man easily because it comes close to shore, is slow-moving and floats when killed (Evans 1987).

These whales are protected from most predators by their formidable size, calves may be targeted by killer whales (orcas) and sharks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Eubalaena glacialis is prey of:
Chondrichthyes
Homo sapiens
Orcinus orca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Eubalaena glacialis preys on:
zooplankton
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Probably fewer than five nursery areas; only three or four populations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

250 - 1000 individuals

Comments: Total population is estimated at 200-350 in the North Atlantic (NMFS 1987, Right Whale Recovery Team 1990, Mayo and Marx 1990). North Atlantic population produced 8-13 calves per year in the 1980s (Matthews and Moseley 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Travels singly or in small groups of 2-3, though may aggregate in areas with high concentration of food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Right whales make simple and complex low-frequency noises and a "belch-like utterance" that is their most common sound. These low-frequency sounds are chacteristic of balleen whales while high-frequency sounds are more typical of toothed whales. Other sounds are described as grunting, mooing, moaning, sighing, and bellowing. The maximum energy (Hz) recorded in southern right whales ranged from 50-500 and the duration ranged from 0.5 to 6.0 seconds. (Slijper 1979)

Communication Channels: tactile ; acoustic

Perception Channels: acoustic ; ultrasound

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 67 years (wild) Observations: There is one anecdotal report, which could turn out to be true, of a mature female being spotted for 60 years, which would make it at least 67 years old. One female at least 65 years-old was possibly reproductively senescent (Hamilton et al. 1998).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Lifespan/Longevity

Data on mean longevity are not yet available. An indication that potential longevity can be very long was obtained by serendipity. A picture was taken of a female and her calf in 1935 in Florida. The animal was seen in 1959 off Cape Cod and irregularly until the summer of 1995. Assuming it was her first calf in the original picture and she was at the age of sexual maturity or eight years old, she would have been 67 years old when last seen.

Their close relatives, bowhead whales, have been recorded with lifespans approaching 200 years, so it's likely that right whales have very long lifespans.

(Katona 1999)

Range lifespan

Status: wild:
67 (high) years.

Average lifespan

Status: captivity:
67 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Eubalaena glacialis copulates from December to March, when most of the young are born. After much nuzzling and caressing, mating right whales roll about randomly exposing flippers, flukes, backs, bellies, and portions of their heads. It has been noted that the male would sometimes begin precopulatory behavior by placing his chin on the exposed hindquarters of the female. It is believed that most right whales are polygamous and no permanent pair bonds are formed. Females probably mate with multiple males. No aggression has been observed between competing males, which is a rare behavior in mammals. Courting bouts may last for an hour or two, after which participants go their own way. Both males and females are seen on their back at the water's surface but females may show this posture to move her genitalia away from a pursuing male. Males tend to have the largest testes of an living mammal (weighing up to about 525 kg.), suggesting that sperm competition may play a significant role in determining mating success.

Mating System: polygynandrous (promiscuous)

Northern right whales mate in the winter and give birth in the spring to a single young. Females give birth to up to one calf every three to four years. Young are typically born in winter.

Males are sexually mature at a length of 15 m and females at 15.5 m, these sizes may be reached between 5 and 10 years of age.

Breeding interval: Females give birth to a single calf every 3 to 4 years.

Breeding season: Mating and births occur in the winter.

Average number of offspring: 1.

Average gestation period: 12 months.

Range age at sexual or reproductive maturity (female): 5 to 10 years.

Range age at sexual or reproductive maturity (male): 5 to 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (Internal ); viviparous

Average gestation period: 350 days.

Average number of offspring: 1.

Right whales are 4.5 to 6 meters in length when they are born. They grow rapidly thereafter, attaining a size of 12 meters by 18 months old. The length of lactation and dependence are not well known.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation may be about 16 months (Right Whale Recovery Team 1990) (also reported as 11-12 months and 13-14 months). Peak in calving apparently occurs from December through March off the southeastern U.S. (Right Whale Recovery Team 1990). Young nurse for at least 9 months (Right Whale Recovery Team 1990) (another report: weaned in 6-7 months). During their first year, calves accompany their mothers during the spring migration and summer feeding (Schaeff et al. 1993). Sexually mature in 5-9 years. Mean age of first parturition is 7.6 years (Knowlton et al. 1994). One calf is produced generally every 3-5 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Calving takes place from December to April in the North Atlantic. Calves are approximately 6 m at birth. Females are extremely attached to their calves.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Systematics and Taxonomy

What was long treated as a single right whale species is now recognized as three distinct species by both scientists and federal regulatory agencies (Rosenbaum et al. 2000; Gaines et al. 2005; http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/). The North Pacific right whale (Eubalaena japonica), which inhabits the Pacific Ocean, especially between 20o and 60o N latitude, is now widely recognized as a species distinct from the North Atlantic right whale. Similarly, the Southern right whale (Eubalaena australis) is now recognized as a distinct species occurring in the southern hemisphere betwen around 20o and 60o S latitude.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eubalaena glacialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCTTATATTTATTATTTGGCGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAACTAGGTCAGCCTGGCACACTAATCGGAGAC---GATCAAGTCTACAACGTATTAGTAACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTAATACCCATTATAATCGGTGGATTTGGAAACTGACTAGTTCCCTTAATAATTGGAGCACCTGACATGGCTTTCCCCCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCCTACTACTAATAGCATCCTCAATGGTCGAAGCCGGTGCAGGCACAGGCTGAACTGTATATCCCCCTCTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTCGACCTTACCATTTTCTCTCTACACCTAGCTGGCGTATCCTCTATCCTCGGAGCCATTAACTTTATCACAACTATCATTAACATAAAACCACCTGCCATAACCCAATACCAAACACCTCTTTTCGTATGATCAGTCCTAGTCACGGCAGTGCTGCTCCTACTATCACTACCTGTCCTAGCAGCTGGAATCACCATGCTATTAACTGACCGAAACCTAAATACAACTTTCTTCGACCCTGCAGGTGGAGGAGACCCAATCCTGTATCAACACCTATTCTGATTTTTTGGTCACCCTGAAGTATATATCTTAATCCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGCTATATAGGAATAGTCTGAGCTATGGTATCTATCGGATTCTTAGGCTTCATCGTATGGGCACACCACATATTTACAGTAGGAATAGACGTTGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eubalaena glacialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
D

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
The major decline occurred more than three generations ago. The number of reproductively active females was determined to be 70 animals in 1998. Even allowing for the possibility that some mothers have been missed in the identification catalogue, this means that the total number of mature (i.e. reproductively active) individuals is well below the Endangered threshold of 250. The eastern North Atlantic subpopulation, if it still exists, is clearly extremely small (fewer than 50 mature individuals). If listed separately, it would be classified as Critically Endangered, Possibly Extinct (CR PE).

History
  • 1996
    Endangered
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern right whales tend to move through the ocean at a fairly slow pace for an animal of their size, they feed near the surface, and they float when killed; thus they were considered the "right" catch for whalers. Hunting of right whales began as early as the 10th century. These whales were hunted extensively during the 19th century, with as many as 100,000 whales slaughtered during this time. Right whales were driven close to extinction early in the 20th century and were one of the first whales to be given international protection in 1935. At the first international Convention for the Regulation of Whaling in 1935, a total ban on hunting right whales was established. The protection of this species was broadened in 1972 with the passing of the Marine Mammal Protection Act. A major issue revolving around the conservation of the right whale is habitat modification. Especially since they use shallow coastal lagoons and bays for breeding. Their numbers are stable and may even be increasing slightly in the Northwest Atlantic and off South Africa. The most current population estimate of 295 whales may represent the approximate carrying capacity. The carrying capacity could be increased though if collisions with ships and entanglement in fishing gear was decreased. It may be decades before the health of the right whale population is recovered. A recovery plan has been established with the difficult duty of managing a species that is hard to track. Luckily, activity modifications are taking place by people like the U.S. Coast Guard, U.S. Navy, ship traffic controllers in major shipping lanes, and others. Funding is always a major obstacle but support is being seen by individual institutions, states, and relevant sectors of the federal government (Cummings 1985, Katona 1999).

Northern Atlantic right whales are the most critically endangered great whale, with fewer than 300 individuals estimated. Populations of this species don't show significant signs of increasing in number, despite a ban on hunting. At the current population numbers species extinction is expected in 190 years.

Current threats to right whales include collisions with boats, since they tend to rest and feed at the surface frequently, pollution, becoming entangled in fish nets, and sonic pollution and disruption caused by military practices.

The history of research and conservation of northern right whales provides a number of lessons that may be applicable to other endangered species. First, sufficient funding must be provided to carry out an effective management program. Second, persistence and patience is needed to develop and implement a slow moving research program. Third, studies may not meet traditional scientific standards of proof because sample sizes are so small. Fourth, effective conservation will require cooperation from federal and state agencies as well as nongovernmental groups. Fifth, incidental take of a species is much harder to regulate than directed take like hunting. Lastly, we should never become complacent about the state of our knowledge (Katona 1999).

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G1 - Critically Imperiled

Reasons: Remnant populations occur in the North Atlantic; extremely low numbers; populations have failed to increase significantly even with protection; threats include collisions with boats, entanglement in fishing gear, disturbance by human activity, and general marine environmental deterioration.

Intrinsic Vulnerability: Highly vulnerable

Comments: Slow to mature, reproduces infrequently.

Other Considerations: Low reproductive rate; lack of recovery despite full protection.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Balaena glacialis, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is extremely endangered. The ESA and IUCN both list the Northern Right Whale as an endangered species. Most commercial exploitation of this species was halted by the 1920?s, and it is now protected in more than 120 countries. Entanglement and ship-strikes are still major concerns. Unfortunately, the population is showing little signs of recovering.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) by the IUCN Red List (1) and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Northwest Atlantic

Historic
It is not clear when Basque whaling began in the northwestern North Atlantic, but it had been established no later than 1530. It has long been thought that large numbers (tens of thousands) of right whales were taken off Labrador and Newfoundland by the Basques between 1530 and 1610 (Aguilar 1986, Reeves 2001) but recent genetic evidence suggest that many if not most of these were bowheads (Rastogi et al. 2004). Shore-based whaling along the US east coast began in the mid 17th century and continued at least sporadically over the next two and a half centuries (Reeves et al. 1999, IWC 2001a). Reeves et al. (2007) estimated as a lower bound that some 5,500 right whales (and “possibly twice that number”) were removed by whaling in the western North Atlantic between 1634-1951.

Current
The current population is of about 300–350 individuals off the east coast of North America. IWC (2001a) obtained a minimum estimate of 263 in 1996 from identified animals known to be alive at that time, and indicated that the true population was probably not much higher. Kraus et al. (2001) provided a minimum estimate of 299 in 1998 based on animals presumed to be alive at that time (and not missing for more than 5 years). Preliminary analysis of more recent data have yielded estimates similar to those above. The whales are regularly surveyed in the winter calving ground off Florida and Georgia, and in spring/summer feeding grounds in Cape Cod Bay, the Great South Channel off Massachusetts, the Gulf of Maine, the Scotian Shelf, and the Bay of Fundy, but not all the whales using the wintering ground are seen in these major summering areas (IWC 2001b). There have been a few sightings in recent years in the Gulf of St Lawrence, two off Iceland in 2003, and one in the former whaling ground off Cape Farewell in 2004 (IWC 2005). A sighting off Norway in 1999 was identified as a well-known animal from the western North Atlantic population (Jacobsen et al. 2004).

Calf counts have been collected since 1980 but counts in the 1980s were probably underestimates, due to non-coverage of the winter calving grounds. Calf production has fluctuated, possibly linked to environmental conditions (Greene et al. 2003). It was low during 1998-2000 (av. 3 per year, with an associated calving interval of 5.7 years, Kraus et al. 2001) but high during 2001-2005 (av. 23 per year) (Clapham 2005). Nineteen calves were recorded in 2006, and the average interbirth interval of the mothers concerned was 3.2 years (Anon. 2006).

An analysis of survival and reproductive rates (Caswell et al. 1999) concluded that survival rates had declined and that, as of 1995, the population was in decline. However, the finding of population decline was based on the assumption that only 38% of mature females were reproductively active, whereas the true figure appears to be over 70% (IWC 2001b). A subsequent review of survival rates concluded that survival rates probably were lower in the 1990s than in the 1980s (Clapham 2003). No more recent data on survival rates have been published to date; while reproduction has noticeably increased in this population, mortality has remained high and is a source of serious concern (IWC 2006).

Increase, if any, in this population is at a much lower rate than in the southern right whale. Per capita calf production and calving intervals have been highly variable over the last decade. The occurrence of skin lesions, of a kind not seen in Southern Hemisphere right whales, was recorded during the period 1995 to 2002, and appeared to be correlated with the failure to reproduce of females that would normally be ready to calve (Reeves et al. 2001; Rolland et al. 2007). Over the same period, body condition as measured by blubber thickness was poorer in the North Atlantic than in Southern Hemisphere right whales (IWC 2001c). Mortality rates are higher than in Southern Hemisphere right whales, due largely to human-caused deaths (IWC 2001b) (see Threats below).

Northeast Atlantic

Historic
The first records of Basque whaling in the Bay of Biscay are from the 11th century. At least dozens of whales were taken each year in the Bay of Biscay until a marked decline was evident by 1650, and whaling declined during the 18th century. Basque whalers arrived in Iceland as early as 1412, and participated in the right whale fishery around the British Isles and Norway from the 14th to the 18th century, but probably many more whales were taken by Dutch, Danish, British and Norwegian whalers. Quantitative estimates of catches are not available. Historic right whale catches as far north as Iceland and Norway appear to have been mainly E. glacialis, with Balaena mysticetus (bowhead) being the main species only in the far north (Greenland and Svalbard) (Aguilar 1986). Smith et al. (2006) documented extensive whaling for E. glacialis in the North Cape area (northern Norway) in the 17th century. Right whaling in the northeastern Atlantic seems to have declined from the mid-17th century and all but disappeared by the mid-18th century, but there was a brief period of right whale catches by modern whalers operating from shore stations in the British Isles and off Iceland, with at least 120 right whales were taken during 1881-1924 (Collett 1909, Brown 1986). The last recorded catch was a cow-calf pair off Madeira in 1967, accompanied by a third individual that escaped.

Current
It is not clear whether there is a remnant Northeast Atlantic population or whether the animals seen there in modern times are strays from the west. There have been only eight confirmed sightings from 1960 to 1999, including the animal sighted in Norway in 1999, which was matched with the western north Atlantic population (IWC 2001b). A possible right whale was sighted in the Bay of Biscay in 1977 (Aguilar 1981) and a cow-calf pair was sighted off Cape Vincent, Portugal in 1995 (Martin and Walker 1997). A recent survey of the former Cintra Bay calving ground off Western Sahara failed to locate any right whales (Notarbartolo di Sciara et al. 1998), although survey conditions were often poor.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Global Long Term Trend: Decline of >90%

Comments: Formerly abundant, but hunted to near-extinction. North Atlantic population thought to have increased somewhat after the cessation of whaling, but apparently began declining once more after about 1990 (Caswell et al. 1999, Fugiwara and Caswell 2001).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Right whales in the North Atlantic are no longer hunted, and the most serious current threat is death or injury from entanglements in fishing gear and collisions with ships off the eastern coast of North America (Knowlton and Kraus 2001; Kraus and Rolland 2007).

During 1999-2003, the recorded human-caused mortality and serious injury averaged 2.6 animals per year, of which 1.6 per year were fishery entanglements and 1.0 vessel collisions. A further 11 deaths (8 ship strikes, 1 entanglement and two of unknown cause) were reported between 2004 and the end of 2006. Based on scarring from fishing gear it is estimated that at least 72% of the right whale population had been involved in an entanglement event at some point in their lives, and that 10-30% of the population is entangled each year (Clapham 2005). Because some anthropogenic deaths probably pass undetected, reported rates are considered minimal.

Hypotheses that have been advanced to explain the low reproductive rates observed for several years include: genetic factors, poor nutrition, chemical contaminants, biotoxins, disease. (IWC 2001c, Reeves et al. 2001). However, reproduction has increased in recent years.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: A : Very threatened throughout its range communities directly exploited or their composition and structure irreversibly threatened by man-made forces, including exotic species

Comments: Initial large decline due primarily to hunting that occurred through the mid-1930s. Lack of population recovery has been attributed to mortality caused by collisions with ships and entanglement in fishing gear, degradation of feeding habitat (e.g., through effects of pollution on zooplankton), human disturbance (ships) (Right Whale Recovery Team 1990). Fujiwara and Caswell's (2001) analysis points to mortality of adult females caused by collisions as the primary factor in the decline. In fact, they suggest that reducing the death rate by only two adult females per year would reverse the decline. MtDNA data, in conjunction with behavioral and population data that indicate that the North Atlantic population may be suffering from reduced fertility, fecundity, and juvenile survivorship, support the hypothesis that inbreeding depression is also a cause of the lack of recovery (Schaeff et al. 1997). However, the data analysis and modelling of Fujiwara and Caswell (2001) do not support this hypothesis.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

With, as of 2008, between just 300 and 350 North Atlantic right whales remaining, this species' existence lies in an extremely precarious situation (1). Years of whaling, starting in the 11th century and becoming a modern industrial practice in the early 20th century, have left North Atlantic right whale stocks seriously depleted in the western Atlantic (2), and virtually extinct in the eastern Atlantic (1). They were killed in their thousands for their valuable oil and baleen (2), until commercial whaling was prohibited by the International Whaling Commission in 1935 (1). Whilst the North Atlantic right whale is no longer hunted (1), decades of exploitation have left a tragic legacy. The small, remaining population, concentrated along the heavily industrialised coast of north-eastern America (7), is highly vulnerable to the impacts of human activities. Collision with ships is currently the most serious source of mortality threatening the North Atlantic right whale, and was the cause of 16 North Atlantic right whale deaths between 1970 and 1999. This is closely followed by the threat of entanglement in commercial fishing gear, either active gear or nets that have been lost or damaged. Known as 'ghost gear', this fishing equipment continues to wreak havoc on marine species, with three North Atlantic right whales known to have died from entanglement since 1970 and a further eight known to have been seriously injured, most likely with fatal consequences (2). These numbers may sound small, but in a population of just 300 or so individuals, the consequences can be enormous. A number of other threats may also be impacting this imperilled species, including a loss of habitat due to human activity, oil spills, man-made noise which may interfere with communication, intensive commercial fishing having knock-on effects on prey availability, and global climate change (2). As the North Atlantic right whale has a relatively narrow range of prey on which it can feed, and relies on a specific combination of water currents and temperatures to create suitable feeding grounds, changes to ocean temperatures and currents caused by global climate change could have devastating affects (2) (8). Indeed, climate change may be the final factor that pushes this species over the brink to extinction (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The right whale has been protected from hunting by the IWC and its predecessor since 1935, and is also protected in Canada, a non-member of the IWC.

Efforts are underway in both the US and Canada aimed at limiting deaths and injuries due to ship strikes and entanglements. In both countries, recovery plans have been developed involving collaboration among the various stakeholders.

Regulations are in place in the US requiring modifications to fishing gear and restrictions on certain types of gear in areas and times where right whales are common (Clapham 2005). A Mandatory Ship Reporting Scheme has been in place since 1999 in two areas in the right whale calving and summering grounds to enable vessels to be warned of right whales in the area. Regulations specify minimum approach distances for whale-watching and other vessels.

Shipping lanes in the Bay of Fundy have been moved, with the approval of the International Maritime Organization (IMO), to take them away from the major summer concentrations of right whales. A regulatory proposal to enforce maximum transit speeds on vessels passing through right whale habitats off the US east coast was still under review in 2007.

There is as yet no indication of a decrease in the rate of anthropogenic mortality, hence it is unclear whether the measures taken to date are sufficient.

The species is listed in Appendix I of both CITES and CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Restoration Potential: No signs of recovery despite over 60 years of protection.

Management Requirements: In 1996, NMFS proposed rules that would prohibit vessels from approaching a right whale closer than 460 m (Federal Register, 7 August 1996). To avoid jeopardy to right whales, NMFS (Federal Register, 3 November 1997) proposed closing the Mid-Atlantic and Northeast Coastal segments of the Atlantic pelagic drift gillnet fishery for swordfish, tuna, and shark through 31 July 1998.

Biological Research Needs: Determine reasons for lack of recovery.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Many to very many (13 to >40) occurrences appropriately protected and managed

Comments: Species has had almost complete protection since 1937; but needs more protected habitat. NMFS (Federal Register, 3 June 1994, p. 28793) designated Critical Habitat as follows: portions of Cape Cod Bay and Stellwagen Bank, and Great South Channel (off coast of Massachusetts) and waters adjacent to the coast of Georgia and the east coast of Florida.

Needs: Continue to protect from hunting; protect habitat; promote and enforce regulations that reduce collisions with vessels. See recovery plan (1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Since the North Atlantic right whale was protected from hunting in 1935 by the International Whaling Commission (IWC), and also protected in Canada, which is not a member of the IWC (1), the most important conservation need for this species is the reduction, or elimination, of deaths and injuries from ship collisions and entanglement in fishing gear (3). Both the US and Canada have developed recovery plans for this species, with the aim of addressing these issues, and a number of measures have already been implemented. These include regulations in the US to restrict the use of certain types of fishing gear in areas and times where North Atlantic right whales are common, as well as regulations that specify the distance with which a whale-watching vessel or other ship may approach a whale (1). Since 1999, a scheme has been in place in two areas in calving and summering grounds to warn vessels when there are right whales in the area, and in the Bay of Fundy, shipping lanes have been moved to divert them away from the major summer concentrations of right whales (1). As of yet, there is no data to indicate whether such measures have been successful or not (1), and recovery of this species continues to be slow, or even absent (3). If these measures have not been sufficient, the outlook for the North Atlantic right whale is grim. As it is a long lived species, extinction may not occur in the near future, but the extinction of this great whale in the next century is a very real possibility (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative effects of northern right whales on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

At least 1,000 years ago, the exploitation of this species began by hunters. Mainly, these whales were taken for blubber, used for oil for illumination, and for meat. No longer is this the primary threat to right whales. The main economic gain comes from eco-tourism which continues to be a fast growing industry (Katona 1999).

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Tens of thousands were harvested during the past few centuries; main exploitation ended around the 1920s; see IUCN (1991) for a review of exploitation history.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Endangered (EN)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

North Atlantic right whale

The North Atlantic right whale (Eubalaena glacialis, which means "good, or true, whale of the ice"), is a baleen whale, one of three right whale species belonging to the genus Eubalaena,[1] all of which were formerly classified as a single species. With about 400 in existence in the western North Atlantic Ocean, and possibly extinct in the eastern North Atlantic, these whales are among the most endangered whales in the world.[6] They are protected under the US Endangered Species Act of 1973 and the Marine Mammal Protection Act of 1972. Vessel strikes and entanglement in fixed fishing gear are the two greatest threats to their recovery.[7] They migrate between feeding grounds in the Gulf of Maine and their winter calving areas off Georgia and Florida, an ocean area with heavy shipping traffic.

Contents

Description [edit]

Like other right whales, the North Atlantic right whale, also known as the northern right whale or black right whale,[2] is readily distinguished from other whales by the callosities on its head, a broad back without a dorsal fin, and a long arching mouth that begins above the eye. The body of the whale is very dark grey or black, occasionally with white patches on the belly. The right whale's callosities appear white due to large colonies of cyamids or whale lice.

Adult North Atlantic right whales average 13–16 m (43–52 ft) in length and weigh approximately 40,000 to 70,000 kg (44 to 77 short tons), they are slightly smaller on average than the North Pacific species.[8] The largest measured specimens have been 18.2 m (60 ft) long and 106,000 kg (230,000 lb).[citation needed] Females are larger than males.

Forty percent of a right whale's body weight is blubber, which is of relatively low density. Consequently, unlike many other species of whale, dead right whales float.

There is little data on their life span, but it is believed to be at least fifty years, and some may live more than a century.

Behavior [edit]

Vocalization [edit]

North Atlantic right whales recordings are available online.[9][10]

Reproduction [edit]

They first give birth at age nine or ten after a year-long gestation; the interval between births seems to have increased in recent[when?] years and now averages three to six years. Calves are 13–15 feet (4.0–4.6 m) long at birth and weigh approximately 3,000 pounds (1,400 kg).[11]

Feeding [edit]

Right whales feed mainly on copepods and other small invertebrates such as krill, pteropods, and larval barnacles, generally by slowly skimming through patches of concentrated prey at or below the ocean surface.[2]

Taxonomy [edit]

The cladogram is a tool for visualizing and comparing the evolutionary relationships between taxa. The point where a node branches off is analogous to an evolutionary branching – the diagram can be read left-to-right, much like a timeline. The following cladogram of the Balaenidae family serves to illustrate the current scientific consensus as to the relationships between the North Atlantic right whale and the other members of its family.

Family Balaenidae
 Family Balaenidae 
  Eubalaena (right whales)  

 E. glacialis North Atlantic right whale




 E. japonica North Pacific right whale



 E. australis Southern right whale




 Balaena (bowhead whales) 

 B. mysticetus bowhead whale



The right whale family, Balaenidae[12]


Another species of right whale, so-called the "Swedenborg whale" which was proposed by Emanuel Swedenborg in the 18th century, was once thought to be a North Atlantic right whale by scientific consensus. However based on later DNA analysis of those fossil bones to be claimed as of "Swedenborg whales", it was confirmed to be actually from Bowhead Whales.[13]

Whaling [edit]

Right whales were so-named because whalers thought they were the "right" whale to hunt. As the "right" whale continued to float long after being killed, it was possible to 'flech' or strip the whale of blubber without having to take it onboard ship. Combined with the right whale's lack of speed through water, feeding habits, and coastal habitat, they were easy to catch, even for whalers equipped only with wooden boats and hand-held harpoons.[14]

Whaling in small wooden boats with hand harpoons was a hazardous enterprise, even when hunting the "right" whale.
North Atlantic right whale skeleton found on the Thames in 2010 at Bay Wharf, Greenwich

Basques were the first to commercially hunt this species. They began whaling in the Bay of Biscay as early as the eleventh century.[15] The whales were hunted initially for whale oil but, as meat preservation technology improved, their value as food increased. Basque whalers reached eastern Canada by 1530.[16] The last Basque whaling voyages were made prior to the commencement of the Seven Years' War (1756–1763). A few attempts were made to revive the trade, but they failed. Shore whaling continued sporadically into the 19th century. It had previously been assumed that Basque whaling in eastern Canada had been the primary cause for the depletion of the sub-population in the western North Atlantic, but later genetic studies disproved this.[17][18]

Setting out from Nantucket and New Bedford in Massachusetts and from Long Island, New York, Americans took up to one hundred right whales each year, with the records including one report of 29 whales killed in Cape Cod Bay in a single day during January 1700.[19] By 1750, the North Atlantic right whale population was, for commercial purposes, depleted. Yankee whalers moved into the South Atlantic before the end of the 18th century. The population was so low by the mid-19th century that the famous Whitby whaler Rev. William Scoresby, son of the successful British whaler William Scoresby senior (1760–1829), claimed to have never seen a right whale (although he mainly hunted bowhead whales off eastern Greenland, outside the normal range of right whales).[20]

Based on back calculations using the present population size and growth rate, the population may have numbered fewer than 100 individuals by 1935.[19] As it became clear that hunting right whales was unsustainable, international protection for right whales came into effect, as the practice was banned globally in 1937. The ban was largely successful, although violations continued for several decades. Madeira took its last two right whales in 1968.

Threats [edit]

Reconstitution of a North Atlantic right whale.

For the period of 1970 to October 2006, humans have been responsible for 48% of the 73 documented mortalities of the North Atlantic right whale.[21] A 2001 forecast showed a declining population trend in the late 1990s, and indicated a high probability that North Atlantic right whales would go extinct within 200 years if the then-existing anthropogenic mortality rate was not curtailed.[22] The combined factors of small population size and low annual reproductive rate of right whales mean that a single death represents a significant increase in mortality rate. Conversely, significant reduction in mortality rate can be obtained by preventing just a few deaths. It was calculated that preventing the deaths of just two females per year would enable the population to stabilize.[22] The data suggests, therefore, that human sources of mortality may have a greater effect relative to population growth rates of North Atlantic right whales than for other whales. The principal factors believed to be retarding growth and recovery of the population are ship strikes and entanglement with fishing gear.[19]

Ship strikes [edit]

The single greatest danger to this species is injury sustained from ship strikes.[23] Between 1970 and October 2006, 37% of all recorded North Atlantic right whale deaths were attributed to collisions.[14][21] During the years 1999–2003, incidents of mortality and serious injury attributed to ship strikes averaged 1 per year. For the years 2004–2006, that number increased to 2.6.[2] Additionally, it is possible that the official figures actually underestimate the actual ship-strike mortality rates, since whales struck in offshore areas may never be sighted due to low search effort.[21]

In 2002, the International Maritime Organization shifted the location of the Traffic Separation Scheme (TSS, i.e. shipping lanes) in the Bay of Fundy (and approaches) from an area with the highest density of North Atlantic right whales to an area of lower density.[24] This was the first time the IMO had changed a TSS to help protect marine mammals.[25] In 2006, the US National Oceanic and Atmospheric Administration (NOAA) established a set of recommended vessel routes to reduce ship strikes in four important eastern-US right whale habitats.[26] In 2007, and again on June 1, 2009, NOAA changed the TSS servicing Boston to reduce vessel collisions with right whales and other whale species.[27] NOAA estimated that implementing an "Area To Be Avoided" (ATBA) and narrowing the TSS by 1 nautical mile (1.9 km) would reduce the relative risk of right whale ship strikes by 74% during April–July (63% from the ATBA and 11% from the narrowing of the TSS).[28]

Fishing gear entanglement [edit]

The next greatest source of human-induced mortality is entanglement in fixed fishing gear such as bottom-set groundfish gillnet gear, cod traps and lobster pots. Between 1970 and October 2006, there have been 8 instances where entanglements have been the direct cause of death of North Atlantic right whales. This represents 11% of all deaths documented during that period. From 1986 to 2005, there were a total of 61 confirmed reports of entanglements, including the aforementioned mortalities. It is likely that official figures underestimate the actual impacts of entanglement. It is believed that chronically entangled animals may in fact sink upon death, due to loss of buoyancy from depleted blubber reserves, and therefore escape detection.[21]

Beyond direct mortality, it is believed that whales that survive entanglement episodes may suffer other negative effects that may weaken it, reduce fertility, or otherwise affect it so that it is more likely to become vulnerable to further injury. Because whales often free themselves of gear following an entanglement event, scarring may be a better indicator of fisheries interaction than entanglement records. Recent[when?] analysis of the scarification of right whales showed that over 75% of whales examined during 1980-2002 were scarred at least once by fishing gear. Further research has indicated that between 14% and 51% of right whales are involved in entanglement each year.[19]

In 2007, so as to protect northern right whales from serious injury or mortality from entanglement in gillnet gear in their calving area in Atlantic Ocean waters off the southeast United States, the National Marine Fisheries Service (NMFS) revised regulations implementing the Atlantic Large Whale Take Reduction Plan (ALWTRP). This plan expands the restricted area to include the waters off of South Carolina, Georgia, and Northern Florida. It also prohibits gillnet fishing or even gillnet possession in those waters for a period of five months, beginning on November 15 of each year, which coincides with the annual right whale calving season.[29]

When entanglement prevention efforts fail, disentanglement efforts occasionally succeed, despite the fact that such efforts are more frequently impossible or unsuccessful. Nevertheless, they do in fact make a significant difference. During the period 2004-2008 there were at least four documented cases of entanglements for which the intervention of disentanglement teams averted a likely death of a right whale.[19] For the first time in 2009 and again in 2011, scientists successfully used chemical sedation of an entangled whale to reduce stress on the animal and to reduce the time spent working with it. After disentangling the whale, scientists attached a satellite tracking tag, administered a dose of antibiotics to treat entanglement wounds and then another drug to reverse the sedation.[7] Despite concerns that the trauma might impair reproduction, researchers confirmed in January 2013 that three disentangled whales had given birth.[30]

Noise [edit]

A 2011 analysis of data collected in the Bay of Fundy has shown that exposure to low-frequency ship noise may be associated with chronic physiological stress in North Atlantic right whales.[31]

Naval training near calving grounds [edit]

Recently,[when?] the US Navy proposed plans to build a new undersea naval sonar training range immediately adjacent to northern right whale calving grounds in shallow waters off the Florida/Georgia border. In September 2012, legal challenges by leading environmental groups including the Natural Resources Defense Council were denied in federal court, allowing the Navy to proceed.[32][33]

Population and distribution [edit]

According to census of individual whales identified using photo-identification techniques, the latest available stock assessment data (August 2012) indicates that a minimum of 396 recognized individuals were known to be alive in the western North Atlantic in 2010, up from 361 in 2005.[6][19] In the eastern North Atlantic, the right whale population likely numbers in the low tens at best, with little known regarding their distribution and migration pattern. Scientists believe that this population may be functionally extinct.[6]

In spring, summer and autumn, the western North Atlantic population feeds in a range stretching from New York to Nova Scotia. Particularly popular feeding areas are the Bay of Fundy, the Gulf of Maine and Cape Cod Bay.[34] In winter, they head south towards Georgia and Florida to give birth.

There have been a few sightings further east over the past few decades, with several sightings close to Iceland in 2003. There was speculation that these could be the remains of a virtually extinct Eastern Atlantic stock, but examination of old whalers' records suggest that they are more likely to be strays from further west.[16] A few are sighted regularly in waters adjacent to Norway, Ireland, Spain, Portugal, and the Canary Islands.

In January 2009, one animal was sighted off Pico Island, Azores, the first confirmed appearance there since 1888. This animal was later identified as "Pico", a female from the western Atlantic group.[35] Right whales have also on rare occasion been observed in the Mediterranean Ocean. In May 1991, a petty officer of the Italian Navy happened to be in the water with his camera about 13 km (8.1 mi) off the small island of Sant' Antioco (southwestern Sardinia), when a right whale happened to swim by – his photos comprise the only confirmed sighting in the 20th century. Earlier known occurrences of right whales in the Mediterranean include the stranding of a juvenile near Taranto (southeastern Italy) in 1877 and the sighting of two (one of which was later captured) in the bay of Castiglione (Algiers) in 1888.[36] [37] and Portugal.[38] The Norway sightings appear to be of vagrants, or strays from the western Atlantic stock.[39] In 2009, right whales appeared in waters around Greenland[40] although their origin was not confirmed.[41] Prior to this, no right whales had been killed or confirmed present off the coast of Greenland for around two hundred years.[42]

In early 2009, scientists recorded a record number of births among the western North Atlantic population. 39 new calves were recorded, born off the Atlantic coast of Florida and Georgia:

"Right whales, for the first time in a long time, are doing their part: they're having the babies; they're having record numbers of babies. We need to be vigilant and still do our part to prevent the whales from being killed."

Monica Zani, New England Aquarium, Endangered right whales appear to be on the rebound, CNN.com[11]

In contrast, 2012 appears to have been the worst calving season since 2000, with only seven calves sighted – and one of those is believed to have died. This is significantly below the annual average of 20 calves per year over the last decade.[6] As the gestation period for right whales is a year long, researchers believe that a lack of food in the whales' summer feeding grounds in the Bay of Fundy during the summer of 2010 may be linked to the poor season in 2012.[43]

Conservation status [edit]

In the United States, this species is listed as “endangered” by the NMFS under the Endangered Species Act. It is also listed as “depleted” under the Marine Mammal Protection Act.

On a global level, the Convention on the Conservation of Migratory Species of Wild Animals (CMS, or the “Bonn Convention”) is a multilateral treaty specializing in the conservation of migratory species, their habitats and migration routes. CMS has listed the North Atlantic right whale on Appendix I, which identifies it as a migratory species threatened with extinction.[44] This obligates member nations to strive towards strict protection of these animals, habitat conservation or restoration, mitigation of obstacles to migration, and control of other factors that might endanger them.

Additionally, CMS encourages concerted action among the range states of many Appendix I species.[45] To that end, a small portion of the eastern Atlantic population's range is covered by the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS).[46] The Atlantic area bounded on the west by a line running from Cape St. Vincent in southwest Portugal to Casablanca, Morocco, and on the east by the Straight of Gibraltar.

Another multilateral treaty, the Convention on International Trade in Endangered Species of Wild Fauna and Flora, (CITES, or the “Washington Convention”), also lists the North Atlantic right whale on its own Appendix I. Being so listed prohibits international trade (import or export) in specimens of this species or any derivative products (e.g. food or drug products, bones, trophies), except for scientific research and other exceptional cases with a permit specific to that specimen.[3]

See also [edit]

References [edit]

  1. ^ a b Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G., Urbán, J. & Zerbini, A.N. (2012). "Eubalaena glacialis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 18 January 2013. 
  3. ^ a b "Appendices I, II and III". Convention on International Trade in Endangered Species of Wild Fauna and Flora. CITES. 15 September 2012. http://www.cites.org/eng/app/appendices.php. Retrieved 20 January 2013.
  4. ^ "ITIS Standard Report: Eubalaena glacialis (Müller, 1776)". ITIS on-line database. Integrated Taxonomic Information System. Retrieved 6 September 2012. 
  5. ^ Perrin, W.F. (2012). "Eubalaena glacialis Müller, 1776". World Cetacea Database. Retrieved 29 September 2012. 
  6. ^ a b c d "North Atlantic right whale (Eubalaena glacialis) 5-year review: Summary and Evaluation" (PDF). Gloucester, MA: National Oceanic and Atmospheric Administration Fisheries Service. August 2012. Retrieved 9 December 2012. "The western North Atlantic population numbered at least 361 individuals in 2005 and at least 396 in 2010 (Waring et al. 2012)." 
  7. ^ a b National Oceanic and Atmospheric Administration (2011-01-23). "Scientists Successfully Use Sedation to Help Disentangle North Atlantic Right Whale". ScienceDaily. Retrieved 2011-01-27. 
  8. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  9. ^ Right Whale's "Up-Calls" - Cornell Bioacoustics Research
  10. ^ More Right Whale calls - "moans", "screams" and "gunshot" - Cornell Bioacoustics Research
  11. ^ a b John D. Sutter (April 3, 2009). "Endangered right whales appear to be on the rebound". CNN. Retrieved 2009-12-29. 
  12. ^ Rosenbaum, H. C., R. L. Brownell Jr.; M. W. Brown C. Schaeff, V. Portway, B. N. White, S. Malik, L. A. Pastene, N. J. Patenaude, C. S. Baker, M. Goto, P. Best, P. J. Clapham, P. Hamilton, M. Moore, R. Payne, V. Rowntree, C. T. Tynan, J. L. Bannister and R. Desalle (2000). "World-wide genetic differentiation of Eubalaena: Questioning the number of right whale species" (PDF). Molecular Ecology 9 (11): 1793–802. doi:10.1046/j.1365-294x.2000.01066.x. PMID 11091315. 
  13. ^ "Whale bones found in highway were not from mystery whale". ScienceNordic.com. February 7, 2013. Retrieved March 26, 2013. 
  14. ^ a b Ward-Geiger, L.I.; Silber, G.K., Baumstark, R.D., & Pulfer, T.L. (3 March 2005). "Characterization of Ship Traffic in Right Whale Critical Habitat" (PDF). Coastal Management (Taylor & Francis Inc.) 33 (3): 263–278. doi:10.1080/08920750590951965. ISSN 0892-0753. Retrieved 22 August 2009. 
  15. ^ Aguilar A (1986). "A review of old Basque whaling and its effect on the right whales (Eubalaena glacialis) of the North Atlantic". Rep. Int. Whal. Commn (Special Issue 10): 191–99. 
  16. ^ a b Kenney, Robert D. (2002). "North Atlantic, North Pacific and Southern Right Whales". In William F. Perrin, Bernd Wursig and J. G. M. Thewissen. The Encyclopedia of Marine Mammals. Academic Press. pp. 806–813. ISBN 0-12-551340-2. 
  17. ^ Rastogi, T., Brown, M. W., Mcleod, B. A., Frasier, T. R., Grenier, R., Cumbaa, S. L., Nadarajah, J. and White, B. N. 2004. Genetic analysis of 16th-century whale bones prompts a revision of the impact of Basque whaling on right and bowhead whales in the western North Atlantic. Canadian Journal of Zoology, 2004 - 8(10): pp.1647-1654, 10.1139/z04-146
  18. ^ Frasier, T. R., Mcleod, B. A., Bower, R., Brown, M., and White, B. N.(2007) "Right Whales Past and Present as Revealed by their Genes" in: Urban Whale: North Atlantic Right Whales at the Crossroads pp. 200-231, edited by Kraus, S. and Rolland, R.
  19. ^ a b c d e f Waring, G.T.; Josephson E, Maze-Foley K, Rosel, PE, Editors (December 2010). "NORTH ATLANTIC RIGHT WHALE (Eubalaena glacialis): Western Atlantic Stock" (PDF). U.S. Atlantic and Gulf of Mexico Marine Mammal Stock Assessments. NOAA Tech Memo (National Marine Fisheries Service). NMFS NE 219: 8–18. 
  20. ^ Scarff JE (1986b). "Occurrence of the barnacles Coronula diadema, C. reginae and Cetopirus complanatus (Cirripedia) on right whales" (PDF). Scientific Reports of the Whale Research Institute 37: 129–153. 
  21. ^ a b c d Fisheries and Oceans Canada (2007). "Recovery potential assessment for right whale (Western North Atlantic population)" (PDF). Canadian Science Advisory Secretariat Science Advisory Report 2007/027. Retrieved 17 June 2011. 
  22. ^ a b Fujiwara, M.; Caswell, H. (29 November 2001). "Demography of the endangered North Atlantic right whale" (PDF). Nature 414 (6863): 537–541. doi:10.1038/35107054. PMID 11734852. Retrieved 17 June 2011. 
  23. ^ Vanderlaan & Taggart (2007). "Vessel collisions with whales: the probability of lethal injury based on vessel speed" (PDF). Mar Mam. Sci. Retrieved 2008-05-10. 
  24. ^ http://www.nmri.go.jp/safe/imo/nav48/3/NAV48-3-5.pdf
  25. ^ http://www.coastalstudies.org/what-we-do/public-policy/bay-of-fundy.htm
  26. ^ http://www.nmfs.noaa.gov/pr/shipstrike/routes.htm
  27. ^ "North Atlantic Right Whale Ship Strike Reduction". Office of Protected Resources – NOAA Fisheries. Retrieved 2009-08-22. 
  28. ^ National Oceanic and Atmospheric Administration (2009-05-26). "Changes in Vessel Operations May Reduce Risk of Endangered Whale Shipstrikes". Retrieved 2009-08-22. 
  29. ^ NOAA (June 25, 2007). "NOAA announces rule to protect North Atlantic right whales from gillnet entanglement in Southeast U.S.". Retrieved 17 June 2011. 
  30. ^ "3 endangered right whales rescued from fishing gear reach rare milestone of motherhood". Associated Press (FOX News). January 24, 2013. 
  31. ^ Rolland et al. "Evidence that ship noise increases stress in right whales". Proceedings of the Royal Society B. The Royal Society. Retrieved 11 February 2012. 
  32. ^ Whale Defenders Lose Navy Training Challenge, courthousenews.com, accessed on 9/20/2012
  33. ^ "Right Whales Wronged: Judge allows Navy to expand sonar use in calving ground". Natural Resources Defense Council. September 10, 2012. 
  34. ^ "Endangered whale begins to recover after Bay of Fundy shipping lanes moved". Retrieved 6 July 2012. 
  35. ^ "First North Atlantic right whale sighting in Azores since 1888". WildlifeExtra.com. 
  36. ^ Marine Mammal Society Newsletter, Winter 1996 (Vol 4, No 4).
  37. ^ Notarbartolo di Sciara, G., E. Politi, A. Bayed, P.-C. Beaubrun and A. Knowlton (1998). "A winter cetacean survey off Southern Morocco, with a special emphasis on suitable habitats for wintering right whales". Sci. Rep. Int. Whaling Commission, SC/49/O3, 48: 547–550. 
  38. ^ Martin AR, Walker FJ (1996-05-16). "SIGHTING OF A RIGHT WHALE (EUBALAENA GLACIALIS) WITH CALF OFF S. W. PORTUGAL". Marine Mammal Science 13 (1): 139. doi:10.1111/j.1748-7692.1997.tb00617.x. Retrieved 2006-10-26. 
  39. ^ Jacobsen KO, Marx M, Øien N (2003-05-21). "TWO-WAY TRANS-ATLANTIC MIGRATION OF A NORTH ATLANTIC RIGHT WHALE (EUBALAENA GLACIALIS)". Marine Mammal Science 20 (1): 161. doi:10.1111/j.1748-7692.2004.tb01147.x. Retrieved 2006-10-26.  More than one of |work= and |journal= specified (help)
  40. ^ National Oceanic and Atmospheric Administration (May 20, 2009). "NOAA Expedition Hears Endangered North Atlantic Right Whales off Greenland". 
  41. ^ Newman, Dennis (May 20, 2009). "OSU Researchers Discover 'Extinct' Whales". Natural Oregon. 
  42. ^ SaraJean (2009-05-25). "Greenland: New Home for Right Whales". Retrieved 2009-12-29. 
  43. ^ Poor Calving Season for Right Whales, Savannah Morning News Savannahnow.com, April 1, 2012
  44. ^ "Appendices I and II". Convention on the Conservation of Migratory Species of Wild Animals (CMS). Amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005, 2008 and 2011. Effective 23 February 2012. pp. 1. http://www.cms.int/documents/appendix/appendices_e.pdf. Retrieved February 20, 2013.
  45. ^ Official website of the Convention on the Conservation of Migratory Species of Wild Animals (CMS or Bonn Convention)
  46. ^ Official website of the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 1 person

Average rating: 3.0 of 5

Names and Taxonomy

Taxonomy

Comments: Bowhead whales and right whales often have been included in the same genus (Balaena) (e.g., Rice 1998), but most recent classifications recognize them as distinct genera (Balaena for bowhead whale, Eubalaena for right whales) (e.g., Baker et al. 2003; Mead and Brownell, in Wilson and Reeder 2005). MtDNA data are consistent with recognition of Balaena and Eubalaena as distinct genera (Rosenbaum et al. 2000).

A strong consensus does not exist regarding the taxonomic status of the various populations of right whales. Based on mtDNA data, Rosenbaum et al. (2000) proposed that the North Atlantic, North Pacific, and Southern Hemisphere populations could be recognized as distinct species (E. glacialis, E. japonica, and E. australis, respectively). Baker et al. (2003) argued against this proposal, noting among other things that no other consistent differences have been found among the three populations. The recovery plan for this species and Mead and Brownell (in Wilson and Reeder 1993) regarded the southern right whale (E. australis) as a distinct species, but Rice (1998) and Baker et al. (2003) included australis in Eubalaena (or Balaena) glacialis. Mead and Brownell (in Wilson and Reeder 2005) cited Rosenbaum et al. (2000) in recognizing E. glacialis, E. australis, and E. japonica as distinct species.

Sighting and mtDNA data indicate that western North Atlantic right whales segregate between separate nursery areas but probably represent a single breeding population (Schaeff et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!