Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Distribution

Range Description

The pygmy right whale probably has a circumpolar distribution in temperate waters of the Southern Hemisphere between about 30°S and 55°S (extending to 20°S in at least the Benguela system (southwestern African continental shelf) (Hoffmann and Best 2005). There are only a few confirmed records of live whales at sea, but strandings have been reported from Argentina, Falkland Islands (Malvinas), Namibia, South Africa, Chile, western, southern and eastern coasts of Australia, and North and South Islands of New Zealand (Cabrera et al. 2005; Hoffman and Best 2005; Kemper 2002a,b; Rice 1998; Ross et al. 1975). Two individuals were taken by a whaling vessel in the South Atlantic between 34°-35°S (Ivashin et al. 1972). An unusual sighting was made in 1992 of an aggregation of about 80 individuals 320 nm southwest of Cape Leeuwin, southwest Australia (Matsuoka et al. 1996). A group of 14 individuals was sighted in 2001 at 46°S in the South Pacific 450 km southeast of New Zealand (Matsuoka et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The pygmy right whale is found only in a narrow band of waters near the South Pole. The band circles Antarctica, covering area in both the Pacific and Atlantic Oceans.

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, New Zealand Exclusive Economic Zone, Southern Ocean, Subantarctic Waters, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The pygmy right whale is 5-6 meters in length. Distinguishing features include a small dorsal fin situated far back, and two throat grooves. Each of these features is uncharacteristic for all species of right whale, except the pygmy right whale.

Average mass: 4500 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The stomachs of the two individuals taken in Russian whaling operations (Ivashin 1972) and a juvenile immature stranded individual (Sekiguchi et al. 1992) contained mainly calanoid copepods.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pygmy right whales live in a pelagic aquatic habitat, in the cool to cold ocean waters surrounding Antarctica.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

coastal and oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 2.129 - 19.435
  Nitrate (umol/L): 0.606 - 23.025
  Salinity (PPS): 33.883 - 35.587
  Oxygen (ml/l): 5.311 - 7.560
  Phosphate (umol/l): 0.204 - 1.582
  Silicate (umol/l): 1.187 - 14.997

Graphical representation

Temperature range (°C): 2.129 - 19.435

Nitrate (umol/L): 0.606 - 23.025

Salinity (PPS): 33.883 - 35.587

Oxygen (ml/l): 5.311 - 7.560

Phosphate (umol/l): 0.204 - 1.582

Silicate (umol/l): 1.187 - 14.997
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The pygmy right whale, like most smaller baleen whales, feeds on krill. Its huge mouth takes in massive quantities of water and then filters the krill out through baleen plates, spitting the krill-free water out.

Animal Foods: aquatic crustaceans

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Reproduction

Little is known about the reproductive habits of the pygmy right whale. A mother bears one young per birth. If the reproductive habits of pygmy right whales resemble those of other right whales, one can infer that gestation period is probably about 10-12 months.

Average number of offspring: 1.

Range gestation period: 10 to 12 months.

Range weaning age: 6 to 12 months.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

The offspring stay with their mother until weaning, which may take place at 6 months to one year of age.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Caperea marginata

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0175-06|AP006475|Caperea marginata| AACCGCTGACTATTCTCAACCAATCACAAAGACATTGGCACCCTATACTTATTATTCGGCGCCTGAGCAGGAATAGTAGGTACTGGCCTA---AGTTTATTAATCCGCGCTGAACTAGGTCAGCCTGGCACACTAATCGGAGAC---GACCAAGTCTACAATGTGTTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATACCCATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCTTAATA---ATCGGAGCCCCTGATATAGCTTTTCCCCGTATAAATAACATAAGCTTCTGATTACTTCCTCCTTCTTTCTTACTATTAATAGCATCCTCAATAGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTATATCCCCCTTTAGCCGGAAACCTAGCCCATGCAGGAGCTTCAGTCGACCTT---ACCATTTTTTCTCTACACCTAGCTGGTGTATCCTCAATCCTCGGAGCTATTAATTTTATTACAACTATCATTAACATGAAACCACCTGCCATAACTCAATACCAGACGCCTCTCTTCGTATGATCAGTTCTAGTTACAGCAGTACTACTCCTACTATCACTACCAGTCCTAGCAGCT---GGAATCACTATGTTATTAACTGACCGAAACCTAAACACAACTTTCTTCGACCCCGCAGGTGGAGGAGACCCAATCCTGTACCAACACCTATTTTGATTTTTTGGTCACCCCGAGGTATATATTTTAATTCTCCCTGGATTCGGAATAATCTCACATATCGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTACATGGGAATGGTTTGAGCCATAGTATCTATCGGGTTCCTAGGCTTTATCGTATGAGCTCACCACATGTTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Caperea marginata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
The species is listed as Data Deficient because of the paucity of live records, the absence of a population size estimate, and the limited knowledge of the species range. Given the lack of known threats and the probably wide distribution, it is unlikely that the species would qualify for a threatened category if more data were available, but in the absence of any estimate of population size, it cannot be assessed against any of the criteria thresholds.

History
  • 1996
    Lower Risk/least concern
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The pygmy right whale is so rare and unstudied, we don't even know how rare it is. There is no accurate count of pygmy right whales.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The pygmy right whale is one of the least known baleen whale species, and there are too few records to attempt an estimate of population size, even to an order of magnitude. The single sighting of about 80 whales in the southeast Indian Ocean (Matsuoka et al. 1996) represents over half of the recorded sightings of live individuals. Apart from the two large schools mentioned above, most sightings have been of one or two individuals, sometimes in association with other species of whales and dolphins. The inconspicuous, small blow and quick, shallow surfacing of pygmy right whales make them difficult to spot and observe at sea. They are unlikely to be correctly identified by non-experts.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This poorly known species has never been hunted commercially. There is no evidence of any direct anthropogenic threats. The species may be naturally rare throughout its range, or simply difficult to detect or identify, or perhaps its areas of concentration have not yet been discovered.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No specific conservation measures exist for this rarely sighted species, but it is covered by generic whale protection measures both internationally and in the known range states. It is listed in Appendix I of CITES and Appendix II of CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pygmy right whale

The pygmy right whale (Caperea marginata) is a baleen whale, the sole member of the family Neobalaenidae.[3] First described by John Edward Gray in 1846, it is the smallest of the baleen whales, ranging between 6 metres (20 ft) and 6.5 metres (21 ft) in length and 3,000 and 3,500 kg in mass. Despite its name, the pygmy right whale may have more in common with the gray whale and rorquals than the bowhead and right whales.[3]

The pygmy right whale is found in the Southern Ocean in the lower reaches of the Southern Hemisphere, and feeds on copepods and euphausiids. Little is known about its population or social habits. Unlike most other baleen whales, it has rarely been subject to exploitation.

Contents

Taxonomy

During the 1839-43 voyage of James Clark Ross naturalists found bones and baleen plates resembling a smaller version of the right whale. In his Zoology of the Voyage of HMS Erebus and Terror (1846), John Edward Gray described the new species, naming it Balaena marginata. In 1864 Gray established a new genus (Caperea) after receiving a skull and some bones of another specimen. Six years later, in 1870, he added the name Neobalaena. He soon realized the three species were one and the same: Caperea marginata[4] (caperea means "wrinkle" in Latin, "referring to the wrinkled appearance of the ear bone"; while marginata translates to "enclosed with a border", which "refers to the dark border around the baleen plates of some individuals").[5]

Description

The pygmy right whale is rarely encountered and consequently little studied. However, it is known that the pygmy right is by far the smallest of the baleen whales. Calves are estimated to be about 1.6 metres (5 ft 3 in) to 2.2 metres (7 ft 3 in) at birth (a 2 metres (6 ft 7 in) fetus was reported from a 6 metres (20 ft) female).[6] By the time they are weaned they may be about 3 metres (9.8 ft) to 3.5 metres (11 ft) long. It is believed they become sexually mature at about 5 metres (16 ft) and physically mature at about 6 metres (20 ft).[3] The longest male was a 6.1 metres (20 ft) individual which had stranded in Cloudy Bay, Tasmania, while the longest female was a 6.45 metres (21.2 ft) individual which had stranded in Stanley, Tasmania.[7] Pygmy rights can weigh as much as 3,430 kg[3]—a 6.21 metres (20.4 ft) female weighed 3,200 kg and a 5.47 metres (17.9 ft) male weighed 2,850 kg.[8] Gestation and lactation periods and longevity are all unknown. Part of the reason for the paucity of data may be the relative inactivity of the whale, making location for study difficult. The blow is small and indistinct and the whale is usually a slow undulating swimmer, although capable of bursts of acceleration.

The coloring and shape of the pygmy right whale, dark gray dorsally and lighter gray ventrally, commonly with a pair of chevron-shaped lighter patches behind the eyes, is similar to that of the dwarf minke and Antarctic minke whales and at sea may easily be confused with these two species if the jaw and flippers are not carefully observed. The arched jawline is not as pronounced as other right whales and may not be sufficient to distinguish a pygmy right whale from a minke whale. The long, narrow cream-coloured baleen plates with a distinctive white gumline are the most effective discriminators. Unlike true right whales, pygmy rights do not have callosities. The dorsal fin is falcate (crescent-shaped) and located about three-quarters of the way along the back of the animal. Unlike the minke whales, occasionally the dorsal will not be seen on the whale surfacing. Like the minkes, though, it doesn't raise its flukes when it dives.

Analysis of the stomach contents of dead pygmy right whales indicates that it feeds on copepods and euphausiids. The social and mating structures are unknown. The whale is typically seen alone or in pairs, sometimes associated with other cetaceans (including dolphins, pilot whales, minke whales, and once a sei whale cow and calf).[3][6][9] Occasionally larger groups are seen — in 2001 a group of 14 were seen at 46°S in the South Pacific about 450 km southeast of New Zealand, while in 1992 a group of about 80 individuals were seen 320 nm southwest of Cape Leeuwin[2] and another group of over 100 individuals were sighted in June 2007 about 40 km southwest of Portland, Victoria.[10]

Population and distribution

The pygmy right whale is among the least studied cetaceans (as of 2008 fewer than 25 "at sea" sightings of the species have been made).[3] The species lives in the Southern Hemisphere and is believed to be circumpolar, living in a band from about 30°S to 55°S[2] in areas with surface water temperature between 5 and 20 °C (41 and 68 °F).[9] Individuals have been found on the coasts of Chile,[11] Tierra del Fuego, Namibia, South Africa, Australia and New Zealand. One group may be a year-round resident off Tasmania.[9] The total population is unknown.

Whaling and whale-watching

On account of its relatively small size and sparse distribution the pygmy right whale has rarely been taken by whalers. A 3.39 metres (11.1 ft) male was taken off South Africa in 1917, and it is likely that a few pygmy rights were taken opportunistically by whalers hunting minke whales. Also a few pygmy right whales are known to have been caught in fishing nets. However these factors are not believed to have had a significant impact on the population.

Most data about pygmy right whales come from individual specimens washed up on coastlines; they are rarely encountered at sea and so they are not the primary subject of any whale watching cruises.

Conservation

The Pygmy right whale is listed on Appendix II [12] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II [12] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

The Pygmy right whale is also covered by Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU).

References

Citations
  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300033. 
  2. ^ a b c Reilly S.B, Bannister J.L, Best P.B, Brown M., Brownell Jr. R.L, Butterworth D.S, Clapham P.J, Cooke J., Donovan G.P, Urbán J. & Zerbini A.N (2008). Caperea marginata. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2011-4-14.
  3. ^ a b c d e f Kemper, Catherine (2008). "Pygmy Right Whale". In Perrin, W.; Wursig, B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. pp. 939–41. 
  4. ^ Cousteau, Jacques, Whales (1986), p. 70.
  5. ^ Reeves, Randall, Guide to Marine Mammals of the World (2002), p. 202.
  6. ^ a b Klinowska, M. (1991). Dolphins, Porpoises and Whales of the World: The IUCN Red Data Book. Cambridge, U.K.: IUCN. 
  7. ^ Mead, James G. and Joy P. Gold (2002). Whales and Dolphins In Question: the Smithsonian Answer Book. Washington: Smithsonian Institution Press. 
  8. ^ Nowak, Ronald M. (1999). Walker’s Mammals of the World. Baltimore: Johns Hopkins University Press. 
  9. ^ a b c Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton Field Guides. pp. 43–45. ISBN 0-61-12757-2. 
  10. ^ Caperea alive!
  11. ^ Cabrera, E., Carlson, C., Galletti V.M., B., Cardenas, J.C. and Brownell Jr., R.L. 2005. A pygmy right whale (Caperea marginata) from Chiloe Island, Chile. SC/57/O20.
  12. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
General references
  • Pictures of pygmy right whales are rare. One picture is available at Cetacea.org's Pygmy Right page.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!