Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Species Abstract

The Bowhead whale (Balaena mysticetus) is one of four species of marine mammal in the family Balaenidae, part of the order of cetaceans. The bowhead whale is the second largest whale in the world, second only to the blue whale. Bowheads live in icy Arctic seas. To insulate against the cold Arctic waters, bowhead blubber may be 70 centimetres thick and the whales can break through ice of a foot deep to make breathing holes. They were hunted to the brink of extinction during the 1800s, and have been slow to recover. There are likely 20,000 to 40,000 bowheads alive today, living in four or five populations. Amazingly, this whale is known to live to over 100 years of age, a fact established by the discovery of stone harpoon heads (out of use since the late 1800s) in the flesh of specimens. If this high longevity is correct, the bowhead whale may be the longest living mammal.

A smooth back with no dorsal fin, a blowhole placed in a high crown at the top of the head, and a thick layer of blubber for insulation equip them for this icy environment.

Bowheads skim-feed tiny crustaceans. A whale draws a huge amount of water into its mouth, then raises its tongue, which forces the water back out through baleen filters. The tongue then sweeps the trapped food back toward the throat. The diet consists of planktonic crustaceans, which are filtered through the baleen plates. Bowhead whales often skim-feed on the surface of the sea but also gather food from the sea floor.

Bowheads are social animals, and communicate through long-distance vocalizations, some carrying five to ten kilometres. Males become involved in showy bouts of breaching and fluke-slapping, probably because they are competing with one another for access to females. Bowheads are slow breeders, and sexual maturity may not be reached for 20 years. A single calf is born every three or four years after a gestation period of about 13 months.
  • * Encyclopedia of Earth. Author: Encyclopedia of Life. "Bowhead whale". Topic editor: C.Michael Hogan. Ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC http://www.eoearth.org/article/Bowhead_Whale
  • * S.E.Cosens. 2004. Baffin Bay-Davis Strait and Hudson Bay-Foxe Basin Bowheads: Update on Research 2003/04. International Whaling Commission Scientific Committee.
  • * K.J.Finley. 1990. Isabella Bay, Baffin Island: an important historical and present-day concentration area for the endangered bowhead whale (Balaena mysticetus) of the eastern Canadian arctic. Arctic 43(2): 137-152.
  • * K.J.Finley. 2000. Natural history and conservation of the Greenland whale, or Bowhead whale, in the Northwest Atlantic. Arctic 54: 55-76.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 2 people

Average rating: 4.5 of 5

Description

Bowheads live in icy Arctic seas. A smooth back with no dorsal fin, a blowhole placed in a high crown at the top of the head, and a thick layer of blubber for insulation equip them for this environment. They can smash through ice as thick as 60 cm to create breathing holes. Bowheads skim-feed tiny crustaceans. A whale draws a huge amount of water into its mouth, then raises its tongue, which forces the water back out through baleen filters. The tongue then sweeps the trapped food back toward the throat. Bowheads are social animals, and communicate through long-distance vocalizations, some carrying 5-10 km. Males get involved in showy bouts of breaching and fluke-slapping, probably because they are competing with one another for access to females. There are probably fewer than 10,000 bowheads alive today, living in four or five populations. They were hunted to the brink of extinction during the 1800s, and have been slow to recover.

Links:
Mammal Species of the World
Visit ARKive for more images of the bowhead whale  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition.  Laurentii Salvii, Stockholm, 1:75, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Amazingly, this whale is known to live to over 100 years of age, a fact established by the discovery of stone harpoon heads (out of use since the late 1800s) in the flesh of specimens. The diet consists of planktonic crustaceans, which are filtered through the baleen plates (7). Bowhead whales often skim-feed on the surface of the sea but also gather food from the sea floor. To insulate against the cold Arctic waters, bowhead blubber may be 70 centimetres thick and the whales can break through ice of a foot deep to make breathing holes (3). Bowheads are slow breeders and maturity may not be reached for 20 years. A single calf is born every three or four years after a gestation period of about 13 months (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 2.0 of 5

Comprehensive Description

Black with white chin patch and white on tail base; No dorsal fin - V-shaped, bushy, high blow; Massive head with large baleen in upper, arching jaw
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The bowhead whale is so-called because of its bow-shaped mouth (7) and is black in colour with a whitish chin patch (6), broken by a 'necklace' of black spots (8). This whale lacks a dorsal fin and is usually visible as two bumps from above water, which correspond to the head and the back (8). The blow (or spout) is produced from the two widely spaced blowholes, and is a bushy V shape reaching seven metres in height (8). The baleen is dark grey to black in colour (6) and is the longest of any whale; sometimes measuring well over three metres in length (3). Females are larger than males, but otherwise the two sexes are generally of similar appearance (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Bowhead Whale: A slow swimming plankton-feeder with the longest baleen of all whales
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Range Description

Sea of Okhotsk from Shantarskiye Zaliv east to Zaliv Shelikova, Gizhiginskaya Guba and Penzhinskaya Guba (Moore and Reeves 1993, Rice 1998). The absence of bowhead sightings on any of the Japanese-Russian systematic surveys of cetaceans in the Okhotsk Sea conducted in 1989, 1990, 1998, 1999, 2000 and 2003 (Miyashita and Dorosehnko 1990; Miyahsita and Berzin 1991; Miyashita et al. 2000, 2001; Miyashita 1999, 2004) tends to confirm that animals from this subpopulation are rarely found outside those four known areas of concentration.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Bowhead whales are found only in Arctic and subarctic regions. They spend much of their lives in and near the pack ice, migrating to the high Arctic in summer, and retreating southward in winter with the advancing ice edge (Moore and Reeves 1993).

The International Whaling Commission recognises five stocks: Bering-Chukchi-Beaufort Seas (US (Alaska), Canada, and Russian Federation); Hudson Bay-Foxe Basin (Canada); Davis Strait-Baffin Bay (Denmark (Greenland) and Canada); Svalbard-Barents Sea (Spitsbergen) (Denmark (Greenland), Norway, and Russian Federation); and the Okhotsk Sea (Russian Federation and Japan) (Rugh et al. 2003).

The Bering-Chukchi-Beaufort Seas stock occurs from Chaunskaya Guba (Russian Federation) in the western Chukchi Sea east to Amundsen Gulf (Canada), and the northern Bering Sea south to Karaginskiy Zaliv (Russian Federation), St. Matthew Island, and Norton Sound (US (Alaska)) (Rice 1998).

Recent evidence of movements of tagged whales indicating overlapping ranges, and inconclusive analyses of genetic differences, have called into doubt the traditional distinction between the Hudson Bay-Foxe Basin and the Davis Strait-Baffin Bay stocks (Heide-Jørgensen et al. 2006, IWC 2007).

The range of the Hudson Bay-Foxe Basin stock was traditionally taken to include northern Hudson Bay, Hudson Strait, Foxe Channel and Foxe Basin. Tracking of satellite-tagged whales in 2002 and 2003 confirm movement from Foxe Basin through Fury and Hecla Strait into the Gulf of Boothia and Prince Regent Inlet (Cosens 2004).

The Baffin Bay-Davis Strait stock is centred in summer in the eastern Canadian High Arctic archipelago and along eastern Baffin Island. The whales move out of the summering areas as ice forms in autumn to wintering areas in polynyas (Holst and Stirling 1999), unconsolidated pack ice, and open water near the ice edge off West Greenland (Reeves and Heide-Jørgensen 1996) and eastern Baffin Island. The summering grounds include Cumberland Sound, the well-studied late summer and autumn feeding ground in Isabella Bay (Finley 1990), Lancaster Sound, Admiralty Inlet, and Eclipse Sound.

Animals satellite-tagged in Cumberland Sound in southeast Baffin Island in 2004 and 2005 moved into Prince Regent Inlet and the Gulf of Boothia and also into Foxe Basin and the Hudson Strait (Dueck et al. 2006). Animals tagged in West Greenland also moved to Prince Regent Inlet and Hudson Strait. There is thus no clear geographical division between the two putative stocks. The genetic evidence is inconclusive, and the IWC Scientific Committee currently regards the stock identity question as open (IWC 2007).

The Svalbard-Barents Sea (Spitsbergen) stock (see separate listing) occurs from the east coast of Greenland across the Greenland Sea, the Barents Sea and the Kara Sea as far as Severnaya Zemlya (Russian Federation), and as far south as the ice front, exceptionally reaching Iceland and the coast of Finnmark (Norway).

The Okhotsk Sea stock (see separate listing) occurs in the Sea of Okhotsk from Shantarskiye Zaliv east to Zaliv Shelikova, Gizhiginskaya Guba and Penzhinskaya Guba (Moore and Reeves 1993, Rice 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

East coast of Greenland (Denmark) across the Greenland Sea, the Barents Sea, and the Kara Sea to Severnaya Zemlya (Russian Federation), and south at least occasionally to northern Iceland and the coast of Finnmark (Norway) and Jan Mayen (Norway) (Rice 1998).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bowhead whales (Balaena mysticetus) once inhabited oceans throughout the northern hemisphere. Over the last hundred years the population of bowhead whales has been greatly reduced into five geographically secluded stocks. These stocks are: the Spitsbergen stock, which inhabit the north Atlantic; the Davis Strait and Hudson Bay stocks, which both inhabit the west-northern Atlantic; the Okhotsk stock, which are found in the Okhotsk Sea; and Bering Sea stock, found in the area of the Bering Sea (Shelden and Rugh 1995). Bowhead whales inhabit the Arctic Ocean and associated seas. They are rarely found below 45 degrees north latitude (Nowak 1999).

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Subarctic area
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Arctic and subarctic waters between 55 and 80 degrees N. Fi ve apparently discrete populations. 1. Western arctic group winters along pack ice in Bering Sea, summers in Beaufort Sea, mainly east of Barrow to Amundsen Gulf (IUCN 1991). 2. Davis Strait population: summer along the east and north coasts of Baffin Island, in Baffin Bay, and the Canadian Arctic Archipelago; winter in the Daviis Strait (Moore and Reeves 1993, Finley 2000). 3. Hudson Bay population: summer in northwestern Hudson Bay, northern Foxe Basin; winter in Hudson Strait and Davis Strait (Finley 2000). 4. Spitsbergen population (Svalbard-Barents Sea): east coast of Greenland, Iceland, and Jan Mayen area in winter; mostly between Greenland, Spitsbergen, and the Barents Sea, north to 80 degrees N in summer). 5. Sea of Okhotsk.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic (north latitudes only)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Davis Strait and Hudson Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Distribution

Arctic Ocean, European waters (ERMS scope), Greenlandic Exclusive Economic Zone, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Range

This species was once found throughout the high latitudes of the northern hemisphere seas (7). Only a few populations remain today, in Arctic seas following the retreat and advance of the pack ice (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Physical Description

Morphology

Physical Description

Balaena mysticetus is the second largest whale in the world, second only to the blue whale (Balaenoptera musculus) . The name "bowhead" comes from their bow-shaped mouth. The lower jaw makes a U-shape around the upper jaw. This lower jaw is usually marked with white spots, contrasting with the rest of the whale's black body (Nowak 1999). Baleen in the bowhead whale's mouth is the largest of any cetacean with 300 baleen plates measuring 300-450 centimeters in vertical length. The skull makes up almost one-third of the total body length, is curved and asymetric (Lanier 1998). Bowhead whales, on average, are sixty feet in length and weigh around 100 tons. Contributing to the whale's mass is a two foot thick layer of insulating blubber (Nicklen 2000). Balaena mysticetus also has a small pectoral fin for its size, less than 200 centimeters in length (Nowak 1999). Bowhead whale females measure between 16 and 18 meters in length, males measure between 14 and 17 meters in length. Bowhead whales weigh from 75,000 to 100,000 kg.

Range mass: 75000 to 100000 kg.

Range length: 14 to 18 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 2000 cm

Weight: 1.0E8 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 14-17 m males; 16-18 m females

Weight:
Range: 7,500-10,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

in pack ice regions
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Habitat and Ecology

Habitat and Ecology

Little is known about the specific ecology of the OkhotskSea bowhead whale subpopulation. Unlike other bowhead whale subpopulations, this one inhabits an area that is ice-free in summer.

The seasonal distribution of bowhead whales in general is strongly influenced by pack ice (Moore and Reeves 1993). During the winter bowhead whales occur in areas near the ice edge, in polynyas, and in areas of unconsolidated pack ice. During the spring these whales use leads and cracks in the ice to penetrate areas that were inaccessible during the winter due to heavy ice coverage. During the summer and autumn they concentrate in areas where zooplankton production is high or where large-scale biophysical processes create local concentrations of calanoid copepods (Finley 1990, Finley et al. 1998).

Small to medium-sized crustaceans, especially krill and copepods, form the bulk of the bowhead's diet (Lowry et al. 2004). They also feed on mysids and gammarid amphipods, and the diet includes at least 60 species. Bowheads skim feed at the surface and feed in the water column. It has recently been suggested that they also feed near the bottom, but probably do not directly ingest sediments as gray whales routinely do.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The seasonal distribution is strongly influenced by pack ice (Moore and Reeves 1993). During the winter bowhead whales occur in areas near the ice edge, in polynyas, and in areas of unconsolidated pack ice. During the spring these whales use leads and cracks in the ice to penetrate areas that were inaccessible during the winter due to heavy ice coverage. During the summer and autumn they concentrate in areas where zooplankton production is high or where large-scale biophysical processes create local concentrations of calanoid copepods (Finley 1990, Finley et al. 1998).

Small to medium-sized crustaceans, especially krill and copepods, form the bulk of the bowhead's diet (Lowry et al. 2004). They also feed on mysids and gammarid amphipods, and the diet includes at least 60 species. Bowheads skim feed at the surface and feed in the water column. It has recently been suggested that they also feed near the bottom, but probably do not directly ingest sediments as gray whales routinely do.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

The seasonal distribution is strongly influenced by pack ice (Moore and Reeves 1993). During the winter bowhead whales occur in areas near the ice edge, in polynyas, and in areas of unconsolidated pack ice. During the spring these whales use leads and cracks in the ice to penetrate areas that were inaccessible during the winter due to heavy ice coverage. During the summer and autumn they concentrate in areas where zooplankton production is high or where large-scale biophysical processes create local concentrations of calanoid copepods (Finley 1990, Finley et al. 1998).

Small to medium-sized crustaceans, especially krill and copepods, form the bulk of the bowhead's diet (Lowry et al. 2004). They also feed on mysids and gammarid amphipods, and the diet includes at least 60 species. Bowheads skim feed at the surface and feed in the water column. It has recently been suggested that they also feed near the bottom, but probably do not directly ingest sediments as gray whales routinely do.


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Balaena mysticetus lives in the colder waters of the northern hemisphere. Of the current total population, approximately 700 are found in the north Atlantic while 7,000 are located in the north Pacific. Balaena mysticetus usually follow the receding ice drifts (Shelden and Rugh 1995). During summer they can be found in bays, straits, and estuaries (Nowak 1999).

Average depth: 100 m.

Habitat Regions: polar ; saltwater or marine

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Favors close packs and patches of ice; not often observed in extensive areas of open water (Ellis 1985). Adept at finding and using open crevices (leads) in ice, even if these are far from usual migration routes (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic to subarctic shelves, often near sea ice; Circumpolar but discontinuous distribution
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The bowhead whale is often found close to the edge of the Arctic ice shelf (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between northern summer range and southern winter range. Moves north as ice cover breaks up, south just before ice forms in fall (Leatherwood and Reeves 1983).

Western Arctic (summarized in DeMaster et al. 2000): From April through June, Bowheads migrate north and east, following leads in the sea ice in the eastern Chukchi Sea until they pass Point Barrow where they travel east toward the southeastern Beaufort Sea. During early fall (early September to mid-October), bowheads migrate west out of the Beaufort Sea. From mid-September to mid-October they are seen in the northeast Chukchi Sea, some as far north as latitude 72|N; when they reach the Siberian coast, they follow it southeast to the Bering Strait. They begin passing Cape Netten on the Chukchi Peninsula in mid-October to mid-November. By late October and November they arrive in the Bering Sea, where they overwinter.

Eastern Arctic (Summarized in Finley 2000): Spring: Appear at the Cumberland Sound floe edge in April and May, reaching northern Baffin Bay and the Northwest Passage/Lancaster Sound in May and June. Historically, individuals migrating to Hudson Bay arrived off southwest Southampton Island in May and June, then moved north through Roes Welcome Sound and into Foxe Basin. They may also move directly from Hudson Strait into Foxe Basin, arriving at the Igloolik floe edge by late June. Autumn: Migration from north of 70 degrees N is a more casual affair, beginning in late August/September, and lasting two to three months. Migration past northeast Baffin Island peaks in late September/early October; they eventually reach Cumberland Sound (southeast Baffin Island) in late October/November. At Cape Hopes Advance in Hudson Strait, peak movement occurs in late November. In winter, they are generally found within the margin of pack ice fields and polynyas between 60 and 70 degrees N.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Balaena mysticetus is a baleen whale, which means that they filter water through baleen plates, feeding on the organisms caught in the plates and pushing the rest of the water out. Balaena mysticetus can sometimes feed opportunistically during the spring migration, but mostly feed during the winter months on their feeding grounds. They eat crustacean zooplankton, epibenthic organisms, and some benthic organisms. Crustacean zooplankton, such as copepods, are not important food sources for young B. mysticetus, but increase in importance with age (Shelden and Rugh 1995). Copepods are small crustaceans, which a bowhead whale can filter at approximately 50,000 per minute (Stover 2001). Balaena mysticetus sometimes form groups of up to fourteen individuals, in which they make a V-shape formation. In this formation they travel at the same speed and filter feed together (Nowak 1999).

Foods commonly eaten include: euphausiids, copepods, mysids, gammarid amphipods, other benthic organisms

Animal Foods: aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds primarily on swarms of small to medium zooplankton (euphausiids, amphipods, copepods, mysids, pteropods). Feeds by skimming at surface; also forages in water column and near or at bottom, at least in shallows. (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic and near-bottom filter-feeder; Swims through zooplankton with mouth agape targetting copepods, euphausids, and amphipods; Near bottom foraging sometimes results in mud on head and back
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Barnacles use B. mysticetus as both a mode of transportation and a way to encounter fresh food supplies (Lanier 1998). Bowhead whales play an important role as predators of plankton in the arctic ocean.

Commensal/Parasitic Species:

  • barnacle species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Bowhead whales are protected from predators by their large size. They are also known to take shelter under ice drifts. As the oceanic waters of the polar regions become frozen, bowhead whales will swim beneath the extending polar ice cap. In order to survive under the ice cap, B. mysticetus can break through the ice in order to breathe without making themselves accessible to other marine predators (Stover 2001). In a study in 1995, it was found that one-third of the animals of the Davis Strait stock showed scars from killer whale attacks (Shelden and Rugh 1995).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Balaena mysticetus is prey of:
Homo sapiens
Orcinus orca

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Balaena mysticetus preys on:
non-insect arthropods
zooplankton
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 1 - 5

Comments: Only five discrete populations exist: the largest is that in the western Arctic (Bering, Chukchi, and Beaufort Seas); others are in the Davis Strait, Hudson Bay, Spitsbergen region (Svalbard-Barents Sea), and Sea of Okhotsk (DeMaster et al. 2000). There has been doubt that the Davis Strait and Hudson Bay stocks were actually separate populations, but genetic evidence shows that they are not only separate, but that the Hudson Bay stock is actually more closely related to the western Arctic population (Maiers et al. 1999). The small population in the Sea of Okhotsk may be separable into two groups: those that summer in the northeastern Okhotsk Sea and those that are found in the Shantarskiye region (DeMaster et al. 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

2500 - 100,000 individuals

Comments: Total population now on the order of 11,000-12,000, including nonbreeding individuals. In 2001, the western Arctic (Bering-Chukchi-Beaufort) population was estimated at about 10,000 (95% C.L. 7700-12,600) (George et al. 2002), and the other populations were estimated to be only in the tens or hundreds of individuals (DeMaster et al. 2000).

In the mid-1990s, total population size was 6000-9000 (D. DeMaster, pers. comm., 1995). The number of mature individuals would have been considerably fewer, probably 3000-6000. Earlier in the 1990s, the total population was estimated at 7,800 and increasing (Science 263:26, IUCN 1991).

Individual stock numbers: 1. Western Arctic: about 10,000 (see above). 2. Hudson Bay: unknown, but certainly under 1000 (IUCN 2000) and most likely in the 'low hundreds (Finley 2000); surveys in mid-1990s estimated about 250-280 in the northern Foxe Basin (Cosens et al. 1997) and about 75 and northwestern Hudson Bay (Cosens and Innes 2000), but these conclusions are disputed (Finley 2000). 3. Davis Strait: fewer than 250 breeding individuals (IUCN 2000); in the 'low hundreds (Finley 2000). 4. Spitsbergen: fewer than 100, probably fewer than 50 mature individuals (IUCN 2000). 5. Sea of Okhotsk: Berzin et al. (1990) estimated this population to be at least 250-300 animals., and Vladimirov (1994) estimated 300-400. However, both these estimates are not backed up by quantitative data (Berzin et al. 1995; Brownell et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Not strongly gregarious; usually travels alone or in groups of 6 or less, though larger aggregations may occur on feeding grounds or when ice restricts movements (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Length at birth 3-4.5m (10-15 feet); Sexual maturity at 12-20 years; Females have calves every 3-7 years; Longevity over 200 years; Behavior; Swims slowly; Capable of breaking through 60 cm (2 feet) of ice; Usually single or in small groups, sometimes in aggregations during
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Balaena mysticetus has a remarkable lifespan. The average age of animals captured during whaling is estimated at 60 to 70 years old, based on examination of changes in the nucleus of the eye over time. However, several individuals have been discovered with ancient ivory and stone harpoon heads in their flesh and examination of their eye nucleus has resulted in estimated lifespans up to 200 years (George et al. 1999), making bowhead whales the longest lived mammalian species. There is little knowlege of diseases in B. mysticetus that would effect the average lifespan (Stover 2001).

Range lifespan

Status: wild:
200 (high) years.

Typical lifespan

Status: wild:
0.01 to 0.02 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 211 years (wild) Observations: These animals exhibit slow growth and high survival. Growth may be faster in females than in males, and it slows down markedly at around 40-50 years of age. Sexual maturity is probably reached at age 20-25. Using an indirect method for age estimation based on aspartic acid racemization, the bowhead whale has been recorded as the longest-lived mammal thanks to one male estimated to be 211 years-old. The same study found three other male specimens estimated to be over 100 years of age. Very few obvious signs of pathology were found in old bowheads. The 211 year-old specimen was reported to appear old with though meat and blubber. One of the centenarian males exhibited a spondylitic lesion on the vertebra. Reproductive senescence has not been reported, though detailed studies are lacking (George et al. 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males attract female B. mysticetus through songs. It is unknown how long these pair bonds last or how many matings male bowhead whales take part in during mating season.

Mating in Balaena mysticetus usually occurs during late winter and early spring. Spring migration takes place soon after this and the female gives birth between April and June, with most births occurring in May. It takes twenty years for a Bowhead whale calf to reach sexual maturity. At this time, they can be between 12.3 and 14.2 m in length (Shelden and Rugh 1995). Females usually reach sexual maturity before males and are also 1 to 2 meters larger than males at this time (George et al. 1999). In some cases pseudohermaphroditism can occur, leaving a whale to appear female, but also having male sex organs (Shelden and Rugh 1995).

Breeding interval: Typical calving intervals are every 3 to 4 years in bowhead whales.

Breeding season: Breeding occurs in late winter to early spring.

Average number of offspring: 1.

Range gestation period: 12 to 16 months.

Average gestation period: 13-14 months.

Range weaning age: 9 to 15 months.

Average age at sexual or reproductive maturity (female): 20 years.

Average age at sexual or reproductive maturity (male): 20 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 900000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
9125 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
9125 days.

When a calf is born, its average length is 4.25 to 5.25 m. Calves grow approximately 1.5 cm a day. The calf is fed with its mother's milk until it is weaned, which occurs between nine and fifteen months after birth. After weaning, growth rate decreases. After births occur, whales segregate into groups in order to migrate. Calves and mothers are in the front group. Perhaps this is to allow them to be the first to feed on food aggregations that are encountered. For the most part it seems that females take care of the young, although there have been some cases of Balaena mysticetus travelling in groups of three: a mature male, a mature female, and a calf (Shelden and Rugh 1995).

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation apparently lasts between one and two years. Most births (single calf) reportedly occur in spring or early summer (Leatherwood and Reeves 1983), with peak in May near Alaska; typical calving interval probably is 3-4 years (Rugh et al., 1992, J. Mamm. 73:487-490).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaena mysticetus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0119-06|AJ554051|Balaena mysticetus| AACCGCTGACTATTCTCAACCAACCACAAAGATATTGGCACCTTATATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATCCGCGCTGAACTAGGTCAGCCTGGCACACTAATCGGAGAC---GATCAAGTCTACAATGTATTAGTAACAGCCCACGCCTTCGTAATAATCTTCTTCATAGTAATACCCATTATAATTGGCGGATTTGGAAACTGACTAGTTCCCTTAATA---ATTGGAGCACCTGACATGGCTTTCCCCCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCCTACTGCTAATAGCATCCTCAATGGTCGAAGCCGGTGCAGGCACAGGCTGAACTGTATATCCCCCTCTAGCCGGAAACCTAGCACATGCAGGAGCTTCAGTCGACCTT---ACCATCTTCTCTCTACACCTAGCTGGCGTATCCTCTATCCTCGGAGCCATCAACTTTATCACAACTATCATTAACATAAAACCACCCGCCATAACCCAATATCAAACACCTCTTTTCGTATGATCAGTTCTAGTCACAGCAGTACTACTCCTACTATCACTACCTGTCCTAGCGGCT---GGAATCACCATGCTATTAACTGACCGAAACCTAAACACAACTTTCTTCGACCCTGCAGGTGGAGGAGACCCAATCCTGTATCAACACCTATTCTGATTTTTTGGTCACCCTGAAGTATACATCTTAATCCTCCCTGGGTTCGGAATAATCTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTCTGAGCTATGGTATCTATTGGATTCTTAGGCTTCATCGTATGGGCACACCACATATTCACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaena mysticetus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Species: 8
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
D

Version
3.1

Year Assessed
1996

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
The available, albeit tentative information on abundance suggests that the mature population size is below 250 individuals.

History
  • 1996
    Endangered
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
The global population appears to be increasing, due primarily to the increase in the large Bering-Chukchi-Beaufort subpopulation, even though the trends in the remaining populations are unclear. The BCB subpopulation size is well above the Vulnerable threshold for a non-declining population, and current assessments suggest that this stock has recovered to close to its pre-whaling level. The estimate of over 7,000 animals for part of the range of the Hudson Bay-Foxe Basin and Baffin Bay-Davis Strait stocks combined is still provisional, but it is unlikely that the final numbers would be so low that these subpopulations (or the single combined subpopulation) would qualify for a threatened category. Bowhead whale numbers in eastern Canada and West Greenland are probably still below their pre-whaling levels, although the main reductions occurred before the three-generation time window that would trigger the population reduction (A) criterion. For all these reasons, the species is listed as Least Concern.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
D

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
There is no quantitative estimate of current population size, but the largest sighting in recent decades was of “about 66 animals” in 1983. Given the tendency of bowhead whales to aggregate for concentrated food sources, this sighting could have involved much of the total population. The lack of any calf sightings in recent decades, together with the general paucity of sightings overall (seven sightings totalling 17-20 individuals during a systematic survey in 2006), indicates that CR remains appropriate.

History
  • 2000
    Critically Endangered
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LR/cd
Lower Risk/conservation dependent

Red List Criteria

Version
2.3

Year Assessed
1996
  • Needs updating

Assessor/s
Cetacean Specialist Group

Reviewer/s
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Primary conservation efforts for Balaena mysticetus involve reducing or ending the hunting of this species. Agencies who are playing parts in the conservation of the species are the Alaskan Eskimo Whaling Commission (AEWC) and the National Oceanic and Atmospheric Administration (NOAA) (Shelden and Rugh 1995). Native people have been allowed to take only one whale every two years (Nicklen 2000). Whale populations plummeted as a result of a huge expansion in the whaling industry from the 1600s to the early 1900s (Shelden and Rugh 1995).

US Migratory Bird Act: no special status

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N1 - Critically Imperiled

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Reduced more than 80 percent by commercial whaling in 18th and 19th centuries. Now numbers about 10,000-12,000 individuals in only five discrete populations. Western arctic population, the largest group, has has been increasing 1-3 percent annually in recent years; other populations much smaller and show no evidence of increase. Harvest regulations in place. Potentially threatened by global warming and loss of Arctic ice, and by marine pollution.

Intrinsic Vulnerability: Highly vulnerable

Comments: Species is slow to mature and has low fecundity, but can survive to a very old age.

Environmental Specificity: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Balaena mysticetus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

#The Spitsbergen population is Critically Endangered; the Baffin Bay and Okhotsk Sea populations are Endangered; and the group in Hudson Bay-Foxe Basin is Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Appendix I of CITES (4), and Appendix I of the Convention on Migratory Species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Bowhead whales have been seen regularly during Russian surveys in the northeast and southwest Sea of Okhotsk. Berzin et al. (1991) reported bowhead sightings every year from 1982 through 1990, except 1985, with up to 72 whales apparently seen on one day. Doroshenko and Ivannikov (2003) reported 48 bowhead whales sighted during a not especially intensive survey conducted in 2001.

However, there are no reliable estimates of abundance. Berzin et al. (1990) believed the individuals in the southwest OkhotskSea to number at least 250–300 animals, while Vladimirov (1994) estimated the subpopulation at 300–400 whales for the entire OkhotskSea. These values appear to be based primarily on the numbers seen, without evaluation of effective search effort. The proportion of the subpopulation that comprises mature animals is unknown. A value of 44% has been estimated for the Bering-Chukchi-BeaufortSea stock of bowhead whales. The absence of bowhead sightings on any of the Japanese-Russian systematic surveys of cetaceans in the OkhotskSea (referred to above) tends to suggest that the subpopulation is small.

The subpopulation was subject to intensive commercial whaling during the short period 1852–1860 and apparently had been depleted by 1860, although some catching continued until 1900. Woodby and Botkin (1993) estimated a minimum initial subpopulation size of about 3,000 based on catch records. In the late 1960s, Soviet ship-based whalers took an unknown number of bowheads in the OkhotskSea illegally (Doroshenko 1996). The subpopulation thus appears to still be at a small fraction of its pre-whaling abundance, and there is no direct information to assess whether or not the subpopulation is increasing.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Current Population sizes
The range-wide abundance is not known with precision but numbers over 10,000 individuals, with 10,500 (8,200–13,500) (in 2001) in the Bering- Chukchi-Beaufort Seas (Zeh and Punt 2005), and provisional estimates of 3,633 (1,382-9,550) (Koski et al. 2006) and 7,300 (3,100–16,900) for parts of the range of the Hudson Bay-Foxe Basin and Baffin Bay-Davis Strait stocks (Cosens et al. 2006).

There are no reliable abundance estimates for the small Okhotsk Sea and Svalbard-Barents Sea (Spitsbergen) stocks (see separate listings).

Population trends
The Bering-Chukchi-Beaufort (BCB) subpopulation has been monitored for more than 30 years and has been increasing over this period at an estimated rate of 3.4% (1.7–5%) per year in the presence of subsistence hunting (Zeh and Punt 2005). No quantitative estimates of trends in the other bowhead populations are available, but Inuit hunters and elders report that they are observing more bowheads in the eastern Canadian Arctic and West Greenland than they did in the 1960s–1970s, and that the geographic distribution of the whales has expanded in recent years (Koski et al. 2006).

No estimates of subpopulation trend are available for the Svalbard-Barents Sea (Spitsbergen) and Okhotsk Sea stocks (see separate listing).

Pre-whaling population sizes
All bowhead subpopulations were severely depleted by commercial whaling, which had begun in the northeastern Atlantic by 1611 (Ross 1993). Basque whalers took bowheads in the northwest Atlantic (Labrador in Canada) in the 16th century, but ambiguities over the species identity of whales taken in early commercial whaling make pre-1600 catch records difficult to interpret.

Minimum pre-whaling subpopulation sizes are estimated to have been 24,000 for the Svalbard-Barents Sea (Spitsbergen) stock, 12,000 for the Hudson Bay-Foxe Basin and Baffin Bay-Davis Strait subpopulation(s), and 3,000 for the Okhotsk Sea stock (Woodby and Botkin 1993). Brandon and Wade (2004) estimate the initial abundance of the BCB subpopulation at 10–20,000.

The BCB stock may be approaching its pre-whaling levels (IWC 2005). The Svalbard-Barents Sea (Spitsbergen) and Okhotsk Sea stocks are each at a small fraction of their pre-whaling levels (see separate listings), while the status of the Hudson Bay-Foxe Basin and Baffin Bay-Davis Strait animals relative to pre-whaling levels is unclear.

Demographic parameters
A high longevity (>100 years) is suggested by biochemical methods and the finding of old-fashioned stone harpoon heads in hunter-killed animals (George et al. 1999). If this high longevity is confirmed, it would be among the longest known for a mammal.

For the BCB subpopulation, an estimated 44% (SE 1%) of the total population consists of reproductively mature animals, given that the age at maturity is at least 20 years (Koksi et al. 2004). The calving interval is 3–4 years (Rugh et al. 1992). No specific data are available for other subpopulations.

Taylor et al. (2007) estimate the generation time for bowhead whales to be around 52 years.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Pre-whaling subpopulation size:

This subpopulation was originally by far the most abundant of the bowhead whale subpopulations, but was heavily depleted by pre-modern commercial whaling from 1611 to the last recorded capture in 1911 (Ross 1993). The only record of catches by modern whaling refers to four taken by modern whaling near Svalbard in 1932 (Ruud 1937). Based on the catch record, a minimum initial subpopulation size was estimated by Woodby and Botkin (1993) at 24,000 whales. A modeling exercise (Allen and Keay 2006) resulted in an estimate of 52,000 but this may be too high given it assumed a net reproductive rate considerably lower than that currently observed in the Bering-Chukchi-Beaufort Seas subpopulation (see global assessment for this species).

Current subpopulation size

There is no quantitative estimate of current subpopulation size, but the available evidence suggests that it is small. Jonsgård (1982) reported no live sightings on surveys between Greenland and Svalbard and around Svalbard in 1980, but one dead probable bowhead. Based on post-war sightings of only seven individuals in Norwegian and adjacent waters up to 1990, Christensen et al. (1992) suggested that the subpopulation numbered “in the tens”. However, the Norwegian record may have given a somewhat exaggerated impression of rarity, due to lack of coverage within the pack ice.

Moore and Reeves (1993) list 37 sightings between 1940 and 1990, mainly near Svalbard and Franz Josef Land (Russian Federation). The records include two sightings (Belikov et al. 1989) of apparently quite large winter aggregations near Franz Josef Land in 1981 (“several tens of individuals”) and 1983 (“about 66 animals”). Gilg and Born (2005) list 23 definite and probable sightings off East Greenland during 1940–2004, including a probable sighting of ten individuals in 2003. Seven sightings totalling about 20 individuals were reported in the Greenland Sea in April 2006 (Wiig et al. 2007). While the number of sightings records has increased over time this may reflect increased effort rather than increasing abundance. Among the recently reported observations, no calves or small individuals have been reported. The proportion of the subpopulation that comprises mature animals is unknown. A value of 44% has been estimated for the Bering-Chukchi-BeaufortSeas stock.

Anecdotal evidence from historical whaling accounts suggests the possibility of whales from a stock to the east, possibly the Bering-Chukchi-BeaufortSeas stock, entering into these waters at times (Shelden et al. 1995), which would complicate the interpretation of the sightings data with respect to the size of the remnant Svalbard stock. Whether the current subpopulation is a remnant of the original Svalbard stock, a recolonization, or a mixture of both, is currently unclear, but ongoing analyses of DNA from old bones might throw light on this question (Borge et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to increase of 25%

Comments: Western arctic (Bering/Chukchi/Beaufort sea) population was increasing at 3.3 percent per year, 1978-2001 (IWC 1997, Shelden et al. 2003). Other, much smaller populations show no sign of increase (IUCN 2000, Finley 2000), although it is difficult to assess trend because of the paucity of sightings. Some populations may not be viable. A nursery aggregation observed in the Foxe Basin (Cosens and Blouw 1999) "is the most promising evidence that the Hudson Bay population is recovering" (Finley 2000).

Global Long Term Trend: Decline of 30-70%

Comments: Bowhead numbers were severely reduced by commercial whaling prior to the 20th century, probably on the order of 80 percent. Woodby and Botkin (1993) estimated a minimum total population prior to whaling of about 50,000; this subsequently declined to perhaps 5000 individuals. Western arctic population formerly 10,400-23,000 (Woodby and Botkin 1993), now about 10,000; Hudson Bay population formerly 580 (Woodby and Botkin 1993), now unknown size, but smaller than this (Finley 2000); Davis Strait population >11,700, now "almost certainly less than 5 %" of this number; Spitsbergen population about 24,000, now numbering only in the tens (Woodby and Botkin 1993); Sea of Okhotsk population 3000-6500, now probably in the low hundreds (Mitchell 1977, Ross 1993). Total population thus declined to fewer than 8,000 from roughly 50,000 initially.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This population is not currently subject to hunting. At least one case of fatal entrapment of an OkhotskSea bowhead whale in fishing gear has been documented (Brownell 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Heavy commercial hunting, beginning in the 1500s, depleted all populations of bowheads. The Bering-Chukchi-Beaufort Seas stock has recovered substantially since the end of commercial whaling in the early 20th century, while recent provisional estimates of the Hudson Bay-Foxe Basin and Baffin Bay-Davis Strait stocks also suggest significant recovery. There is no reliable evidence of recovery of the Svalbard-Barents Sea (Spitsbergen) and Okhotsk Sea stocks.

Limited aboriginal subsistence whaling on the BCB stock (by native peoples of Alaska, and the Russian Federation (Chukotka) is permitted by the IWC on the basis of advice from its Scientific Committee (most recently under its new aboriginal subsistence whaling management procedure). These takes have not impeded the recovery of the stock. Very small takes by aboriginal hunters are allowed in Canadian waters. So far these have been too few to impede recovery of the stocks, but there will be pressure to increase take levels given the recent, higher population estimates in the eastern Canadian Arctic.

There has been concern since the 1970s that disturbance from oil and gas exploration and extraction activities in the Arctic region might affect bowhead whales. There is also evidence of incidental mortality and serious injury caused by entanglement in fishing gear and ship strikes (Philo et al. 1992, 1993; Finley 2000). Environmental threats, such as pollution (Bratton et al. 1993) and disturbance from tourist traffic (Finley 2000), may affect bowhead whales but the impacts have not yet been well characterized or quantified.

During this century, a profound reduction in the extent of sea ice in the Arctic is expected, and possibly a complete disappearance in summer, as mean Arctic temperatures rise faster than the global average (Anonymous 2005). The implications of this for bowhead whales are unclear but warrant monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This subpopulation is not hunted. Incidental mortality or serious injury from entanglement in fishing gear and ship strikes has not been reported. There are no known specific threats to this subpopulation. For a discussion of general threats see the global assessment for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: All populations were seriously depleted by commerical whaling. Limited harvest by native peoples currently is not a significant threat to western Arctic population, but activities and possible oil spills associated with industrial/resource development are a concern (IUCN 1991). Potential loss of Arctic ice and other oceanographic changes through global warming may be a serious future threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The main threat to this species has been hunting, particularly following the expansion of the whaling industry after the 1600s (7). Other current threats include entanglement in fishing nets and collisions with ships (8). Pollution, climate change and disturbance by tourists are also likely to be having a detrimental effect on this whale (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The International Whaling Commission has protected bowhead whales from commercial whaling since its inception in 1946 and there is no aboriginal subsistence whaling exemption for OkhotskSea bowhead whales. The species, including this population, is protected under Russian law through its inclusion on the Russian national Red List. This species has been included in CITES Appendix I since 1975. The species listed in Appendix I of CMS.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
The International Whaling Commission has protected bowhead whales from commercial whaling since its inception in 1946; all range states except Canada are members of the IWC. Limited aboriginal subsistence whaling is allowed by the IWC on bowhead whales from the BCB stock on the basis of scientific advice (see above). Aboriginal hunting in Canada is co-managed by the national government and regional bodies created under land-claim agreements. This species has been included in CITES Appendix I since 1975; Canada had a reservation against this listing until 1978. The species is listed in CMS Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
The International Whaling Commission has protected bowhead whales from commercial whaling since its inception in 1946 and there is no aboriginal subsistence whaling exemption for Spitsbergen bowhead whales. No specific mechanisms are currently in place to protect bowhead habitat or to prevent incidental mortality in fishing gear. More general measures taken for environmental protection of the waters off northeast Greenland, Svalbard and Franz Joseph Land may have some beneficial effects on the habitat of bowheads. The species is listed in CITES Appendix I and CMS Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: See IUCN (1991) for a brief discussion of international and national protection measures.

Needs: Ensure that subsistence harvest does not interfere with recovery. Maintain high quality marine ecosystem.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1986 the worldwide moratorium on whaling came into effect, although small-scale hunting of this whale by the Inuit of Alaska continues under the guidance of the International Whaling Commission (IWC) (9). The population of bowhead whales appears able to absorb this low-level pressure however, and numbers are increasing in some areas (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

The only way in which Balaena mysticetus may interfere with humans is in marine fishing. The large bowhead whale has been known to collide with sailing vessels on rare occassions as well as get caught in nets fishing for other oceanic life (Shelden and Rugh 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Balaena mysticetus is a benefit to the whaling industry. Because of their large size, one whale can bring a large bounty of whale meat, massive baleen, and the blubber for which it is primarily hunted. In fact, B. mysticetus is the most economically valuable of all cetaceans (Nowak 1999). Many native people such as Eskimos also depend on these resources for the survival of their communities economically by using baleen for tools, blubber for fuel, and whale meat for food and trade (Nicklen 1995).

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: A traditional source of food for native arctic peoples; this use still allowed (though restricted, and for maintenance of cultural continuity) in Alaska by U.S. marine mammal laws; IWC set an annual aboriginal catch limit of 41 landed or 44 struck for the years 1989-1991 (IUCN 1991). Evidently a few are killed each year by Inuit in Canada and Asia (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Okhotsk Sea bowhead whale : Endangered (EN)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

subpopulation Svaalbard-Barents Sea bowhead whale : Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

subpopulation Bering-Beaufort-Chukchi Sea bowhead whale : Lower Risk/conservation dependent (LR/cd)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bowhead whale

The bowhead whale (Balaena mysticetus) is a baleen whale of the right whale family Balaenidae in suborder Mysticeti. A stocky dark-colored whale without a dorsal fin, it can grow to 20 m (66 ft) in length. This thick-bodied species can weigh 75 tonnes (74 long tons; 83 short tons) to 100 tonnes (98 long tons; 110 short tons),[3] second only to the blue whale, although the bowhead's maximum length is less than several other whales. It lives entirely in fertile Arctic and sub-Arctic waters, unlike other whales that migrate to feed or reproduce to low latitude waters. It is also known as Greenland right whale or Arctic whale. American whalemen called it the Steeple-top, Polar whale,[4] or Russia or Russian whale. The bowhead is perhaps the longest-living mammal, and has the largest mouth of any animal.[5]

The bowhead was an early whaling target. Modern commercial whaling severely reduced its numbers before a 1966 moratorium was imposed. The population has rebounded to an estimated to be 10,000 ~ 24,900+[citation needed] or more worldwide, down from an estimated 50,000 before whaling. (See under #population section).

Quoting number figures for the bowhead is particularly cumbersome, since recent census have broad error margins, and have not been taken in the same years. Worlwide historic numbers prior to commercial whaling also requires speculative reconstruction of whale stocks that collapsed centuries ago in the Atlantic.

In the Scandinavian seas, the population is still in a dwindled state. But the Bering-Chukchi-Beaufort (BCB) stock has recovered to such a level such that an IWC opinion (2005) stated it may be approaching pre-whaling populations[2]. The indigineous people of Russia in these seas, as well as Eskimos and natives in Alaska, and Canada (both west and east) have been granted quotas to resume subsistence whaling. (See under #Subsistence whaling section).

Contents

Taxonomy

Carl Linnaeus described the bowhead whale in the 10th edition of his Systema Naturae (1758).[6]

The bowhead whale currently occupies a monotypic genus, separate from the other right whales, as it has done since the work of Gray in 1821. Little genetic evidence supports this two-genera categorization. Indeed, the members of Balaenoptera show greater differences than do the bowhead and the right whales. All four species will likely be placed in one genus in some future review.[7]

It is thought Balaena prisca, one of the five Balaena fossils from the late Miocene (~10 Mya) to early Pleistocene (~1.5 Mya), may be the same as the modern bowhead whale. The earlier fossil record shows no related cetacean after Morenocetus, found in a South American deposit dating back 23 million years.

Description

The bowhead whale has a robust, dark-colored body, no dorsal fin and a strongly bowed lower jaw and narrow upper jaw. Its baleen, the longest of any whale at 3 m (9.8 ft), strains tiny prey from the water. The whale has a massive bony skull which it uses to break through the Arctic ice to breathe. Inuit hunters have reported them surfacing through 60 cm (24 in) of ice. The bowhead may reach up to 20 m (66 ft). The largest yet reported was 21.2 m (70 ft) m for an unweighed giant caught off Spitsbergen, Norway.[8] Females are larger than males. Its blubber is the thickest of any animal, averaging 43–50 cm (17–20 in).

Life history

Drawing of long backbone, 13 ribs (2 vestigial) large, curved upper and lower jawbones that occupy 1/3 of the body, 4 multi-jointed "fingers" inside pectoral fin and connecting bone, enclosed in body outline
Skeleton of a bowhead whale

The bowhead is social and nonaggressive, and retreats under the ice when threatened.

Swimming

The bowhead is a slow swimmer and usually travels alone or in small herds of up to six. Though it may remain submerged as long as 40 minutes in a single dive, it is not thought to be a deep diver.

The whales' behavior can also include breaching, tail slapping, and spyhopping.

Vocalizations

The bowhead whale is highly vocal, and uses underwater sounds to communicate while traveling, feeding, and socializing. Some bowheads make long repetitive songs that may be mating calls.

Reproduction

Stamp showing drawing of mother and calf

Sexual activity occurs between pairs and in boisterous groups of several males and one or two females.

Breeding has been observed from March through August; conception is believed to occur primarily in March. Reproduction can begin when a whale is 10 to 15 years old. Females produce a calf once every 3 to 4 years, after a 13–14 month pregnancy. The newborn calf is about 4.5 m (15 ft) long and approximately 1,000 kg (2,200 lb), growing to 9 m (30 ft) by its first birthday.

Because of their long lifespans, females are believed to go through menopause. Observations of very large animals without calves support this hypothesis.[9]

Lifespan

Bowheads were once thought to live 60 to 70 years, similar to other whales. However, discoveries of 19th century ivory, slate, and jade spear points in freshly killed whales in 1993, 1995, 1999, and 2007[10] triggered research based on structures in the whale's eye, suggesting at least some individuals reached 150–200 years old (another report claimed a 90 year old female was still fertile).[11] The amino acid racemization process has provided the scientific basis for these claims. This process is controversial and has failed to correlate well with other dating methods.[12]

In May 2007, a 50 tonnes (49 long tons; 55 short tons) specimen caught off the Alaskan coast was discovered with the head of an explosive harpoon embedded deep under its neck blubber. The 3.5 inches (89 mm) arrow-shaped projectile was manufactured in New Bedford, Massachusetts, a major whaling center, around 1890, suggesting the animal may have survived a similar hunt more than a century ago.[13][14][15]

Ecology

Drawing of an adult in 1884.

Population

Stating the worldwide population succintly is tricky, and much parsing is required to faithfully state the availble data.

In the IUCN Red book data report as of 2008, the stated worldwide total of bowins is "above 10,000" (a conservative figure)[2]; but a crude sum of the average statistical populations of the three largest range groups amount to 20,00+ individuals[16]

The same IUCN report estimates pre-commercial whaling numbers at around 49,000-59,000[17], but here too, a minimum of 24,000 is all that can be stated definitetely[2], due to unavailable information such as whether the Basque hunting in the Western Atlantic included this species in substantial numbers[2].

Due to this uncertainty, some argue that with worldwide numbers at 10,000, only 1/5 of the historic level, whaling of the species should not be prevented at all. And this lowballing of prevailing population is not advanced just by propents for banning its hunt. The allowing of nations such as the United States and Canada is frequently cited by Japanese proponents of the whaling industry as the prime example of hypocrisy in the issue.

A "The countries opposed to the extension of the quota for bowhead whales harshly criticized the double standard of the United States"[18], or so has been quoted Masayuki Komatsu(ja), the former Fisheries Agency point man on whaling issues. In the article, Komatsu states that the formulat then prescribed to calculate Japan's catches of the minke whale at the time (2002) should translate to zero taking of bowfins.

The bowhead population around Alaska has increased since commercial whaling ceased. Alaska Natives continue to kill small numbers in subsistence hunts each year. This level of killing (25–40 animals annually) is not expected to affect the population's recovery. The population off Alaska's coast (the "Bering-Chukchi-Beaufort stock") appears to be recovering and was about 10,500 animals as of 2001. Researchers from the School of Fisheries and Ocean Sciences have been studying the whales feeding behavior in the Point Barrow area. The status of other populations is less well known. There were about 1,200 off West Greenland in 2006, while the Svalbard population may only number in the tens.

In March, 2008, Canada's Department of Fisheries and Oceans stated that previous estimates in the Eastern Arctic had undercounted, with a new estimate of 14,400 animals (r. 4,800–43,000).[19] These larger numbers correspond to pre-whaling estimates, indicating this population has fully recovered. However, should climate change substantially shrink sea ice, they could be threatened by increased shipping traffic.[20]

Range and habitat

The bowhead whale is the only baleen whale that spends its entire life in and around Arctic waters. The Alaskan population spends the winter months in the southwestern Bering Sea. The group migrates northward in the spring, following openings in the pack ice, into the Chukchi and Beaufort seas.

Feeding

Unlike most other baleen whales which primarily feed on concentrated shoals of prey species, it feeds in a manner similar to the basking shark by swimming forward with its mouth wide open, continuously filtering water through its baleen plates. Thus, it specializes in much smaller prey, such as copepods. Its mouth has a large upturning lip on the lower jaw that helps to reinforce and contain the baleen plates within its mouth, and prevents buckling or breakage of the plates due to the pressure of the water passing through them as it advances.

This is in contrast to the rorquals, which have distendable ventral pleats that they fill with prey-laden water, then expel the water while filtering out the prey through their baleen plates.

Predation

The principal predators of bowheads are humans. Occasionally, predatory attacks by orca pods have also been recorded.[21]

Whaling

Two whaleboats beached in foreground, 5 rowed and 4 sailing whaleboats chasing/attacking 5 whales, two larger whaling ships nearby, and sun peeking around snow-covered mountain in background
Eighteenth century engraving showing Dutch whalers hunting bowhead whales in the Arctic

The bowhead whale has been hunted for blubber, meat, oil, bones, and baleen. Like right whales, it swims slowly, and floats after death, making it ideal for whaling. Before commercial whaling, there were an estimated 50,000 bowheads.[citation needed]

Commercial bowhead whaling began in the 16th century, when the Basques killed them as they migrated south through the Strait of Belle Isle in the fall and early winter. In 1611, the first whaling expedition sailed to Spitsbergen. By mid-century, the population(s) there had practically been wiped out, forcing whalers to voyage into the "West Ice"—the pack ice off Greenland's east coast. By 1719, they had reached the Davis Strait, and by the first quarter of the 19th century, Baffin Bay.

In the North Pacific, the first bowheads were taken off the eastern coast of Kamchatka by the Danish whaleship Neptun, Captain Thomas Sodring, in 1845. In 1847 the first bowheads were caught in the Sea of Okhotsk, and the following year Captain Thomas Welcome Roys, in the bark Superior, of Sag Harbor, caught the first bowheads in the Bering Strait region. By 1849 there were fifty ships in each area hunting bowheads. By 1852 there were 220 ships cruising around the Bering Strait region, which killed over 2,600 whales. Between 1854 and 1857 the fleet shifted to the Sea of Okhotsk, where 100–160 ships cruised annually. During 1858–1860 the ships shifted back to the Bering Strait region, where the majority of the fleet would cruise during the summer up until the early 20th century. An estimated 18,600 bowheads were killed in the Bering Strait region between 1848 and 1914, with 60% of that total being reached within the first two decades. An estimated 18,000 bowheads were killed in the Sea of Okhotsk during 1847–1867, with 80% of that being reached by the first decade.

Bowheads were first taken along the pack ice in the northeastern Sea of Okhotsk, then in Tausk Bay and Northeast Gulf (Shelikhov Gulf). Soon ships expanded to the west, catching them around Iony Island and then around the Shantar Islands. In the Western Arctic they mainly caught them in the Anadyr Gulf, the Bering Strait, and around St. Lawrence Island. They later spread to the western Beaufort Sea (1854) and the Mackenzie River delta (1889).

Inuit woman and child standing on bowhead whale after a 2002 subsistence hunt

Commercial whaling, the principal cause of the population decline, is over. Bowhead whales are now hunted on a subsistence level by native peoples of North America.

Subsistence whaling

In the Arctic areas of the United States (Alaska) and Canada, indigenous peoples such as the Inupiat people eskimos [22] or the Yupik have been granted subsistence whaling permit quotas.

In Eastern Canada, the bowfin had all but disappeared by the early 20th century, but individual sightings began being reported, so that in Nunavut, whaling was resumed, starting with a one whale quote in 1996[23].

The Chukchi people of Russia also lobbied the IWC and obtained a 7 strike quota for the bowfin. [24].

The catch level (25~40 per year) is deemed not a hindrance to the recovery of the population.

Conservation

The bowhead is listed in Appendix I by CITES (that is, "threatened with extinction"). It is listed by the National Marine Fisheries Service as "endangered" under the auspices of the United States' Endangered Species Act. The IUCN Red List data are as follows:

The Bowhead whale is listed on Appendix I[25] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS) as this species has been categorized as being in danger of extinction throughout all or a significant proportion of their range and CMS Parties strive towards strictly protecting these animals, conserving or restoring the places where they live, mitigating obstacles to migration and controlling other factors that might endanger them.

See also

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300005. 
  2. ^ a b c d e Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaena mysticetus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2009-01-31.
  3. ^ Rugh, David J. and Kim E.W. Shelden (2008). "Bowhead Whale". In Perrin, W.; Wursig, B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 131. 
  4. ^ Scammon (1874).
  5. ^ Guinness World Records (2007-11-14). "Whale of a time!". Guinness World Records. http://www.guinnessworldrecords.com/news/2007/11/071114.aspx. Retrieved 2009-06-04. 
  6. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii).. p. 824. http://dz1.gdz-cms.de/index.php?id=img&no_cache=1&IDDOC=265100. 
  7. ^ Kenney, Robert D. (2002). "North Atlantic, North Pacific and Southern Right Whales". In William F. Perrin, Bernd Wursig and J. G. M. Thewissen. The Encyclopedia of Marine Mammals. Academic Press. pp. 806–813. ISBN 0-12-551340-2. 
  8. ^ Wood (1983). The Guinness Book of Animal Facts and Feats. Sterling Pub Co Inc. ISBN 978-0-85112-235-9. 
  9. ^ Rare Whales Can Live to Nearly 200, Eye Tissue Reveals. News.nationalgeographic.com (2010-10-28). Retrieved on 2011-09-15.
  10. ^ Eskimo Heritage Program Subsistence in Alaska Timeline. Kawerak.org. Retrieved on 2011-09-15.
  11. ^ Bowhead Whales May Be the World's Oldest Mammals. Gi.alaska.edu (2001-02-15). Retrieved on 2011-09-15.
  12. ^ Amino Acid Racemization. Pubs.acs.org. Retrieved on 2011-09-15.
  13. ^ John C. George, Jeffrey Bada, Judith Zeh, Laura Scott, Stephen E. Brown, Todd O'Hara, and Robert Suydam (1999). "Age and growth estimates of bowhead whales (Balaena mysticetus) via aspartic acid racemization". Can. J. Zool. 77 (4): 571–580. doi:10.1139/cjz-77-4-571. 
  14. ^ Conroy, Erin. (2007-12-06) Netted whale hit by lance a century ago – Science – MSNBC.com. MSNBC. Retrieved on 2011-09-15.
  15. ^ 19th-century weapon found in whale » Propeller[dead link]
  16. ^ IUCN 2008 report; BCB at 10,500 (8,200–13,500) (2001 population; published Zeh and Punt 2005), Hudson-Foxe bays 3,633 (1,382-9,550) (Koski et al. 2006) and Baffin bay - Davis Strait 7,300 (3,100–16,900)(Cosens et al. 2006). The Canadian waters are provisional and did not study entire habitat range. The total for the thee groups is 21,433
  17. ^ IUCN 2008 report, the total of Spitsbergen area 24,000; Hudson etc. 12,000; Ohkotsk 2000; BCB 10-20,000
  18. ^ Komatsu 2002 Isana, Dec. 2002
  19. ^ Eastern Arctic bowhead whales not threatened. Cbc.ca (2008-04-16). Retrieved on 2011-09-15.
  20. ^ Laidre, Kristin. "Foraging Ecology of Bowhead Whales in West Greenland." Monster Jam. Northwest Fisheries Science Center, Seattle. 22 January 2009.
  21. ^ Bowhead Whale. The Kids’ Times: Volume II, Issue 2. NOAA’s National Marine Fisheries Service, Office of Protected Resources (2011)
  22. ^ Hess 2003
  23. ^ Dahl, Hicks & Jull 2000, p.196-
  24. ^ Kerttula 2000,p.159. A strike is the number of harpoon attacks allowed. The same year, a grey whale quota of 120caught was obtained
  25. ^ "Appendix I" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Bowhead whales and right whales often have been included in the same genus (Balaena) (e.g., Rice 1998), but most recent classifications recognize them as distinct genera (Balaena for bowhead whale, Eubalaena for right whales) (e.g., Baker et al. 2003; Mead and Brownell, in Wilson and Reeder 2005). MtDNA data are consistent with recognition of Balaena and Eubalaena as distinct genera (Rosenbaum et al. 2000).

Five stocks currently recognized worldwide: Spitsbergen, Davis Strait, Hudson Bay, Okhotsk and Western Arctic, or Bering-Chukchi-Beaufort Seas (IWC 1992 in Rugh et al. 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!