Articles on this page are available in 3 other languages: Spanish (32), Chinese (Simplified) (6), Dutch (1) (learn more)

Overview

Brief Summary

Description

The magnificent humpback whale is renowned for its impressive leaping displays and for the mysterious 'singing' of solitary males. The robust body is blue-black in colour, with pale or white undersides (6). The flippers may also be white and are the largest appendage of any animal; reaching up to five metres in length (2). On the underside of the mouth are 12 to 36 throat grooves, which can expand when filtering water during feeding (3). Humpbacks have characteristically knobbly heads, covered in many raised lumps ('tubercles') and barnacles (6) (7). There are two blowholes on the back and the spout of water can appear very bushy (6). The spreading tail flukes have a distinct indentation in the middle (8); as the whale undertakes a deep dive it usually arches its back (hence the common name) so that the tail flukes are raised above the water and clearly visible (7). The pattern on the underside of the flukes is unique and can be used to photo-identify and track individuals (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Biology

Humpbacks are baleen whales; they have large, sieve like plates of baleen (a similar material to human hair or nails) hanging down from the inside of their mouths which function to filter planktonic organisms from the water (2). Individuals can open their mouths widely, due to the throat grooves, and thus engulf large quantities of water (8). Humpbacks often lunge into a shoal of prey but have also been observed herding their prey into clusters or using a 'bubble net' to effectively trap greater numbers. During this process, a number of whales will circle underwater emitting a continuous stream of air which traps fish in the centre of the ring, the whales then surface up through their 'net' gorging on the contents within (2). During the summer months, humpbacks must feed intensely as they do not feed again during either the migration or the time spent in tropical breeding grounds (8). Males compete for females directly by escorting receptive mates and aggressively defending them, their famous 'song' is also thought to be a form of courtship (8). Solitary males sing highly complex songs that are similar within a population but evolve over successive seasons (8). Calves are born after a 10 to 12 month gestation period, they accompany their mother on the return migration to polar feeding grounds, and studies have shown that individuals return to the same feeding ground consistently year after year (8). Possibly one of the best-known aspects of humpback whale behaviour is their acrobatic aerial display; the most spectacular of which is breaching, when the body of the whale may completely leave the water, returning with an enormous splash (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 2 people

Average rating: 2.75 of 5

Humpback whales are surely the happiest animals in the sea. Just watch their fantastic acrobatic somersaults as they jump high out of the water! Since 2003, humpbacks have been spotted more often in the southern North Sea. You can recognize them easily by their large, somewhat clumsy body, long flippers, pockmarked flat head and typical fluked tail. Not necessarily what you would call mother's little beauty, but still very majestic. Male humpbacks produce lovely songs. They resonate for kilometers. The song consists of whistling, grunting, groaning, snorting and crying.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Species Abstract

The Humpback whale (Megaptera novaeangliae), is a very large marine mammal, in the family of Rorquals (Balaenoptera), part of the order of cetaceans. The Humpback is a baleen whale, so that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. All baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans and small fish.

The humpback whale is renowned for its impressive leaping displays and for the mysterious singing of solitary males. Humpback whales are among the best-studied cetaceans, and yet they are among the most mysterious. Their songs and the complex social behaviors that accompany them comprise some of the greatest incompletely understood phenomena. These songs are intricate, with up to nine musical themes. Males may sing for days, changing themes over time, but all the males from one population will sing a similar song. Humpbacks are popular subjects for whale-watching ecotourism. They are readily identified by enormous, wing-like flippers, which are far longer than in any other whale species. They are known for spectacular displays at the surface. They breach, leaping headfirst out of the water; slap the surface with a long flipper; or slam the tail flukes repeatedly. Humpbacks may be the only whales to trap or herd prey into a bunch to make feeding more efficient. They concentrate a school of fish into a stack by blowing columns of bubbles to form a circle around it, and then lunge into the mass to feed.

The robust body is blue-black in colour, with pale or white undersides. The flippers may also be white and are the largest appendage of any animal; reaching up to five metres in length. On the underside of the mouth are 12 to 36 throat grooves, which can expand when filtering water during feeding. Humpbacks have characteristically knobbly heads, covered in many raised lumps (or tubercles) and barnacles. There are two blowholes on the back and the spout of water can appear very bushy. The spreading tail flukes have a distinct indentation in the middle; as the whale undertakes a deep dive it usually arches its back (hence the common name) so that the tail flukes are raised above the water and clearly visible. The pattern on the underside of the flukes is unique to an individual and thus can be used to photo-identify and track individuals.
  • * C.Michael Hogan ed. Encyclopedia of Earth. Lead author: Encyclopedia of Life. 2011. Humpback whale. National Council for Science and the Environment.
  • * J.B.Reid, P.G.H.Evans, S.P.Northridge. eds. 2003. Atlas of Cetacean Distribution in North-west European Waters. Peterborough: Joint Nature Conservation Committee.
  • * Phillip J.Clapham and James J.Mead. 1999. Megaptera novaeangliae. Mammalian Species, no. 604. 1-9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 2 people

Average rating: 2.5 of 5

Description

Humpback whales are among the best-studied cetaceans, yet they are still among the most mysterious. Among the mysteries are the reasons for their songs and the complex social behaviors that accompany them. These songs are intricate, with up to nine musical themes. Males may sing for days, changing themes over time, yet all the males from one population will sing the same song. Humpbacks are popular subjects for ecotourism and the whale-watching business. They are easily identified by enormous, wing-like flippers, which are far longer than in any other whale. They are known for spectacular displays at the surface. They breach, leaping headfirst out of the water; slap the surface with a long flipper; or slam the tail flukes repeatedly. Humpbacks may be the only whales to trap or herd prey into a bunch to make feeding more efficient. They concentrate a school of fish into a stack by blowing columns of bubbles to form a circle around it, and then lunge into the mass to feed. Although endangered, humpback whale populations are making a good comeback.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the humpback whale  More images, video and sound
  • Original description: Borowski, G.H. 1781.  Gemeinnuzige Naturgeschichte des Thierreichs.  Gottlieb August Lange, Berlin, 1:21.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humpback whales according to MammalMAP

Known for their songs that travel to great distances, these massive 40 tonne mammals are one of the most easily recognised whale species.

Humpback whales have long flippers that are almost a third of their body size, a hump on their backs as their common name suggests and a black and white tail fluke.  The variation in tail fluke coloration helps scientist to identify individuals within the family group known as a pod.

Humpbacks are a widespread species, occurring in oceans around the world.  They migrate up to 25 000 km each year.  This migration is from the humpbacks feeding ground in the polar regions to tropical and subtropical waters where they give birth to their young.  How?  Humpback whales are powerful swimmers.  Their strong tail fluke propels them through the water and help the whales to propel itself out the water – a behaviour known as breaching.

Humpback whales feed on mostly krill and small schools of fish.  Humpbacks can hunt alone by hitting the water with its pectoral fins or its tail fluke in order to stun its prey.  It can also hunt by cooperating with other humpback whales using a method called bubble net feeding.  A group of whales will swim in a shrinking circle, blowing bubbles beneath a school of prey until they are confined into a concentrated column.  The whales then swim upward into the net of bubbles with their mouths open and swallow many fish in one gulp.

Female humpback whales only have one calf at a time.  These calves will be suckled by their mothers for approximately 5 months.  Mothers and calves swim close together, often touching one another with their flippers with what appear to be gestures of affection.

The IUCN has removed humpback whales from the Vulnerable species listing and currently lists these whales as a species of Least Concern.  However, there is information lacking on discrete populations.

For more information on MammalMAP, visit the MammalMAP virtual museum or blog.

Creative Commons Attribution 3.0 (CC BY 3.0)

© MammalMAP

Supplier: MammalMAP

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Description

 The humpback whale Megaptera novaeangliae is a baleen whale and can be recognised as such by the plates of baleen (rather than teeth) suspended from the upper jaw and the two blowholes on the upper body. The humback whale is relatively robust rorqual and can reach up to 16 m in length. It is a member of the rorqual family with the characteristic ventral pleats of skin under the eye and the relatively flat and broad jaw. At close range, it is one of the easiest whales to identify. It has extremely long distinctive flippers with a white colouration and knobs on the leading edge. The dorsal fin is low and usually sits on a hump. The head has a single ridge and is covered with numerous bumps. It is a grey-black colour dorsally and laterally, and is white underneath.Humpback whales are usually found in groups of two or three, although in feeding areas larger aggregations may develop. It is quite acrobatic and may perform full breaches, and when diving, it will often show the tail flukes. Dives may last up to 7 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range encompasses the world's oceans from the subtropics to high latitudes. All subpopulations (except the one in the Arabian Sea) migrate between mating and calving grounds in tropical/subtropical waters, usually near continental coastlines or island groups, and productive colder waters in temperate and high latitudes (Reilly et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

in all oceans
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Humpback Whale is a cosmopolitan species found in all the major ocean basins (Clapham and Mead 1999), and all but one of the subpopulations (that of the Arabian Sea) migrate between mating and calving grounds in tropical waters, usually near continental coastlines or island groups, and productive colder waters in temperate and high latitudes.

Humpbacks in the North Atlantic range in summer from the Gulf of Maine in the west and Ireland in the east, and up to but not into the pack ice in the north; the northern extent of the humpback's range includes the Barents Sea, Greenland Sea and Davis Strait, but not the Canadian Arctic. They occur mainly in specific feeding areas, as noted below. In the winter the great majority of whales migrate to wintering grounds in the West Indies, and an apparently small number use breeding areas around the Cape Verde Islands.

In the North Pacific their summer range covers shelf waters from southern California, to the Gulf of Alaska, Bering Sea and southern Chukchi Sea, the Aleutian chain and Kamchatka, Kurile Islands, Okhotsk Sea and northeastern Japan. Wintering grounds are off the coasts of Mexico and Central America, around the Hawaiian Islands, the Bonin Islands, Ryukyu Islands and the northern Philippines, and possibly around additional island groups in the western North Pacific.

Humpbacks are abundant throughout the Antarctic in summer south to the ice edge, but not within the pack ice zone. In the winter, Southern Hemisphere whales aggregate into specific nearshore breeding areas in the Atlantic, Indian Ocean and Pacific, two of which extend north of the equator, i.e. off Colombia in the eastern Pacific and in the Bight of Benin in the Atlantic. Some wintering grounds are fairly localized, e.g. around island groups, and some are more diffuse, e.g. along the western coast of southern Africa and the southern coast of West Africa.

There is a resident year-round population in the Arabian Sea, which is genetically distinct from that of the southern Indian Ocean.

Humpbacks rarely enter the Mediterranean and are considered only visitors there (Reeves and Notarbartolo di Sciara 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Humpback whales, Megaptera novaeangliae, live in polar and tropical waters, particularly those of the Atlantic, Arctic, and Pacific Oceans. Their range also includes the waters of the Bering Sea and the waters surrounding Antarctica.

Biogeographic Regions: arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Antarctic waters in all oceans.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic to Antarctic waters in all oceans.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Humpback whales are found throughout the world's oceans. They undertake yearly migrations of thousands of kilometres from summer feeding grounds in polar waters to winter breeding grounds near to the tropics (7). Indeed, individuals feeding south of Cape Horn undertake the longest known migration of any mammal, in order to breed in the warm waters off Columbia and Costa Rica (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The cerebellum of humpback whales constitutes about 20% of the total weight of the brain; the brain does not differ much from those of other mysticete whales.

The olfactory organs of humpback whales are greatly reduced and it is doubtful whether they have a sense of smell at all. Their eyes are small and adapted to withstand water pressure. Their external auditory passages are narrow, leading to a minute hole on the head not far behind the eye.

Humpback females are larger than males. They are one of the few species of mammals for which this is true.

The most distictive external features of humpbacks are the flipper size and form, fluke coloration and shape, and dorsal fin shape. Flippers are quite long and can be almost a third of the body length. They are largely white and have knobs on the leading edge. The butterfly-shaped tail flukes bear individually distinctive patterns of gray and white, and have a scalloped trailing edge. The dorsal fin can be a small triangle or sharply falcate, and often has a stepped or humped shape; this is one source of the name "humpback."

There are 14 to 35 ventral pleats or grooves.

Humpbacks have the greatest relative blubber thickness for their size of any rorqual. Megaptera novaeangliae is second only to blue whales in absolute thickness of blubber. Blubber thickness varies at different times of the year, as well as with age and physiological condition.

Baleen plates are usually all black with blackish bristles.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 3e+07 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The baleen plates are all or mostly black with 270 to 400 per side.

The ventral pleats 14-22 in number extend from the tip of the lower jaw to the umbilicus; these are fewer and wider than in other rorquals.

  • National Audubon Society Guide to Marine Mammals of the World
  • Authors:Randall R. Reeves, Brent Stewart, Phillip j. Clapham, James A. Powell
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Gale McCullough

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 1300 cm

Weight: 3.0E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 15 m (females are larger than males)
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Length: 15 m (females are larger than males)
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Females are usually about one meter longer than males.

Length:
Range: 14-17 m

Weight:
Range: 25,000-45,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from all other large whales in the very large and often white or partially white flippers, the knobs on the head, and the irregular rather than smooth rear margin of the tail fluke (Leatherwood and Reeves 1983). Dorsal fin varies such that it may resemble those of the blue whale, fin whale, or sei whale.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Morphology

Distinguishing characteristics: colour in the northern hemisphere is dark with white belly and on flippers, but southern hemisphere whales have more white. Sensory knobs on head. Lifts tail when diving. Variably curved dorsal fin midback on a hump. "Knuckles" or bumps along tail stock of thin whales. Flippers may reach length of 4.5 m (15'). Individuals recognized by underside of flukes and body scars/markings.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Megaptera novaeangliae (Borowski, 1781)
Catalog Number: USNM 301636
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull; Partial Skeleton; Photograph
Collector(s): A. Goes
Year Collected: 1870
Locality: Santo Domingo, Greater Antilles, Hispaniola, Haiti, Caribbean Sea, North America, North Atlantic Ocean
  • Type: Cope, E. D. 1871. Proc. Amer. Philos. Soc. 12: 103.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Habitat includes the open ocean and coastal waters, sometimes including inshore areas such as bays. Summer distribution is in temperate and subpolar waters. In winter, most humpbacks are in tropical/subtropical waters near islands or coasts.

In the western North Atlantic, humpbacks give birth mainly over shallow wide banks near islands. In Hawaii, they concentrate over shallower waters near islands (Tomich 1986); groups including a calf tend to occur in shallower waters than do groups lacking a calf (Smultea 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Inshore on feeding and calving grounds, but high seas in transit between them.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
With few exceptions, such as the Arabian Sea population, humpback whales undertake long migrations between breeding grounds in tropical coastal waters in winter to feeding grounds in middle and high latitudes, mainly in continental shelf waters (Clapham 2002).

In the Southern Hemisphere, humpbacks appear to feed mainly in the Antarctic, where the diet consists almost exclusively of krill (Euphausia superba) (Mackintosh 1970), although some feeding in the Benguela Current ecosystem on the migration route west of South Africa has been observed (Best et al. 1995; suspected prey species are: E. lucens and Themisto gaudichaudii).

Limited data on diet in other areas is available. Humpback Whales caught off Newfoundland and Labrador in the 1950s and 1960s were found to be consuming mainly Capelin (Mallotus villotus) (Mitchell 1973). Those caught off California in the early 20th century were eating mainly euphausiids and sardines (Clapham et al. 1997). In areas of Alaska and the North Atlantic, Humpback Whales have also been observed feeding co-operatively on schools of Herring (Clupea harengus), Sand Lance (Ammodytes spp.) and (more rarely) Mackerel (Scomber scombrus), by herding the school together with bubble nets, clouds or curtains (Hain et al. 1982).

The timing of acquisition of tooth rake marks attributable to Killer Whales (Orcinus orca) indicates that Humpback Whale calves, but usually not subadults and adults, are subject to predation by this species (Mehta et al. 2005).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The habitat of humpback whales consists of polar to tropical waters, including the waters of the Artic, Atlantic, and Pacific Oceans, as well as the waters surrounding Antartica and the Bering Strait. During migration, they are found in coastal and deep oceanic waters. Generally, they do not come into coastal waters until they reach the lattitudes of Long Island, New York, and Cape Cod, Massachessetts.

Humpbacks are divided into several populations. These are for the most part isolated, but with a little interchange in some cases. There are two stocks in the north Atlantic Ocean and two in the north Pacific. There are also seven isolated stocks in the southern hemisphere.

Habitat Regions: temperate ; tropical ; polar ; saltwater or marine

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 15141 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7774 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.581 - 29.319
  Nitrate (umol/L): 0.038 - 29.526
  Salinity (PPS): 30.132 - 37.870
  Oxygen (ml/l): 4.401 - 8.759
  Phosphate (umol/l): 0.034 - 1.983
  Silicate (umol/l): 0.494 - 87.357

Graphical representation

Temperature range (°C): -1.581 - 29.319

Nitrate (umol/L): 0.038 - 29.526

Salinity (PPS): 30.132 - 37.870

Oxygen (ml/l): 4.401 - 8.759

Phosphate (umol/l): 0.034 - 1.983

Silicate (umol/l): 0.494 - 87.357
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 The humpback whale is an coastal whale. It can be found at the surface or diving down to several hundred metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Warm and cold marine waters. Spends winter in tropical waters.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Warm and cold marine waters. Spends winter in tropical waters.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These whales are found in both tropical and polar areas depending on the season and are associated with shallow, coastal waters (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Pelagic Community

 

The species associated with this page are major players in the pelagic ecosystem of the Stellwagen Bank National Marine Sanctuary. Stellwagen Bank is an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachussets. Protected since 1993 as the region’s first National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

Massachusetts Bay, and Stellwagen Bank in particular, show a marked concentration of biodiversity in comparison to the broader coastal North Atlantic. This diversity is supported from the bottom of the food chain. The pattern of currents and bathymetry in the area support high levels of phytoplankton productivity, which in turn support dense populations of schooling fish such as sand lance, herring, and mackerel, all important prey for larger fish, mammals, and seabirds (NOAA 2010). Sightings of many species of whales and seabirds are best predicted by spatial and temporal distribution of prey species (Jiang et al 2007; NOAA 2010), providing support for the theory that the region’s diversity is productivity-driven.

Stellwagen Bank is utilized as a significant migration stopover point for many species of shorebird. Summer visitors include Wilson’s storm-petrel, shearwaters, Arctic terns, and red phalaropes, while winter visitors include black-legged kittiwakes, great cormorants, Atlantic puffins, and razorbills. Various cormorants and gulls, the common murre, and the common eider all form significant breeding colonies in the sanctuary as well (NOAA 2010). The community of locally-breeding birds in particular is adversely affected by human activity. As land use along the shore changes and fishing activity increases, the prevalence of garbage and detritus favors gulls, especially herring and black-backed gulls. As gull survivorship increases, gulls begin to dominate competition for nesting sites, to the detriment of other species (NOAA 2010). 

In addition to various other cetaceans and pinnipeds, the world’s only remaining population of North Atlantic right whales summers in the Stellwagen Bank sanctuary. Right whales and other baleen whales feed on the abundant copepods and phytoplankton of the region, while toothed whales, pinnipeds, and belugas feed on fish and cephalopods (NOAA 2010). The greatest direct threats to cetaceans in the sanctuary are entanglement with fishing gear and death by vessel strikes (NOAA 2010), but a growing body of evidence suggests that noise pollution harms marine mammals by masking their acoustic communication and damaging their hearing (Clark et al 2009).

General threats to the ecosystem as a whole include overfishing and environmental contaminants. Fishing pressure in the Gulf of Maine area has three negative effects. First and most obviously, it reduces the abundance of fish species, harming both the fish and all organisms dependent on the fish as food sources. Secondly, human preference for large fish disproportionately damages the resilience of fish populations, as large females produce more abundant, higher quality eggs than small females. Third, by preferentially catching large fish, humans have exerted an intense selective pressure on food fish species for smaller body size. This extreme selective pressure has caused a selective sweep, diminishing the variation in gene pools of many commercial fisheries (NOAA 2010). While the waters of the SBNMS are significantly cleaner than Massachusetts Bay as a whole, elevated levels of PCBs have been measured in cetaceans and seabird eggs (NOAA 2010). Additionally, iron and copper leaching from the contaminated sediments of Boston Harbor occasionally reach the preserve (Li et al 2010). 


  • Clark CW, Ellison WT, Southall BL, Hatch L, Van Parijs SM, Frankel A, Ponirakis D. 2009. Acoustic masking in marine ecosystems: intuitions, analysis and implication. Inter-Research Marine Ecology Progress Series 395:201-222.
  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Jiang M, Brown MW, Turner JT, Kenney RD, Mayo CA, Zhang Z, Zhou M. Springtime transport and retention of Calanus finmarchicus in Massachusetts and Cape Cod Bays, USA, and implications for right whale foraging. Marine Ecology 349:183-197.
  • Li L, Pala F, Mingshun J, Krahforst C, Wallace G. 2010. Three-dimensional modeling of Cu and Pb distributions in Boston Harbor, Massachusetts and Cape Cod Bays. Estuarine Coastal & Shelf Science. 88:450-463.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Stellwagen Bank Benthic Community

 

The species associated with this article partially comprise the benthic community of Stellwagen Bank, an undersea gravel and sand deposit stretching between Cape Cod and Cape Ann off the coast of Massachusetts. Protected since 1993 as part of the Stellwagen Bank National Marine Sanctuary, the bank is known primarily for whale-watching and commercial fishing of cod, lobster, hake, and other species (Eldredge 1993). 

The benthic community of Stellwagen Bank is diverse and varied, depending largely on the grain size of the substrate. Sessile organisms such as bryozoans, ascidians, tunicates, sponges, and tube worms prefer gravelly and rocky bottoms, while burrowing worms, burrowing anemones, and many mollusks prefer sand or mud surfaces (NOAA 2010). Macroalgae, such as kelps, are exceedingly rare in the area — most biogenic structure along the bottom is provided by sponges, cnidarians, and worms. The dominant phyla of the regional benthos are Annelida, Mollusca, Arthropoda, and Echinodermata (NOAA 2010). 

Ecologically, the Stellwagen Bank benthos contributes a number of functions to the wider ecosystem. Biogenic structure provided by sessile benthic organisms is critical for the survivorship of juveniles of many fish species, including flounders, hake, and Atlantic cod. The benthic community includes a greater than average proportion of detritivores — many crabs and filter-feeding mollusks — recycling debris which descends from the water column above (NOAA 2010). Finally, the organisms of the sea-bed are an important source of food for many free-swimming organisms. Creatures as large as the hump-backed whale rely on the benthos for food — either catching organisms off the surface or, in the whale’s case, stirring up and feeding on organisms which burrow in sandy bottoms (Hain et al 1995). 

As a U.S. National Marine Sanctuary, Stellwagen Bank is nominally protected from dredging, dumping, major external sources of pollution, and extraction of mammals, birds or reptiles (Eldredge 1993). The benthic habitat remains threatened, however, by destructive trawling practices. Trawl nets are often weighted in order that they be held against the bottom, flattening soft surfaces, destroying biogenic structure, and killing large numbers of benthic organisms. There is also occasional threat from contaminated sediments dredged from Boston harbor and deposited elsewhere in the region (NOAA 2010). The region benefits from close observation by NOAA and the Woods Hole Oceanographic Institute, however, and NOAA did not feel the need to make any special recommendations for the preservation of benthic communities in their 2010 Management Plan and Environmental Assessment. 

  • Eldredge, Maureen. 1993. Stellwagen Bank: New England’s first sanctuary. Oceanus 36:72.
  • Hain JHW, Ellis SL, Kenney RD, Clapham PJ, Gray BK, Weinrich MT, Babb IG. 1995. Apparent bottom feeding by humpback-whales on Stellwagen Bank. Marine Mammal Science 11, 4:464-479.
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Section IV: Resource States” pp. 51-143. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
  • National Oceanographic & Atmospheric Administration. 2010. Stellwagen Bank National Marine Sanctary Final Management Plan and Environmental Assessment. “Appendix J: Preliminary Species List for the SBNMS” pp. 370-381. http://stellwagen.noaa.gov/management/fmp/pdfs/sbnms_fmp2010_lo.pdf
Creative Commons Attribution 3.0 (CC BY 3.0)

© Peter Everill

Supplier: Peter Everill

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

In the western North Atlantic, most humpbacks depart breeding areas in late winter-early spring. They arrive in northern feeding areas in 1-2 months; in the southern Gulf of Maine, they commonly return to the same area in successive years (Clapham et al., 1993, Can. J. Zool. 71:440-443). Southward migration occurs in fall; individuals arrive in breeding areas in 1-2 months. This species occurs off Hawaii mainly January-March.

Resightings of photoidentified individuals indicate that individuals may winter in widely separated areas in different years; at least some individuals may occupy widely separated areas in a single spring-summer season (e.g., Hawaii and Mexico, Hawaii and Japan, Japan and British Columbia) (see Darling and Mori 1993; Marine Mammal Sci. 12:281-287, [1996]; Salden et al. 1999). The fastest documented migration from southeastern Alaska to Hawaii took 39 days (Marine Mammal Sci. 12:457-464).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: This species is primarily dependent upon schooling fishes and krill (essentially krill only in the Southern Hemisphere). Feeding occurs singly or in groups, at the surface or while submerged, mainly in high latitudes, though stranded individuals in Virginia and Georgia had eaten sciaenid fishes (Laerm et al. 19970.

Humpback whales employ a wide variety of foraging methods, including cooperative feeding on prey enclosed in "nets" of exhaled air bubbles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Like minke whales, and fin whales, humpbacks are generalized feeders. They are highly mobile and opportunistic. Humpbacks feed upon plankton, the plant and animal life at the surface of the ocean's water, or upon fish in large patches or schools. Because of this, humpbacks are classified as "swallowers" and not "skimmers." They do eat commercially exploited fishes. Feeding by humpbacks takes place during the summer.

Atka makerel and Pacific saury are the most commonly found fish prey of humpbacks in the eastern North Pacific Ocean. The former is considered one of the favorite foods of humpback whales in waters off the Western Aleutians and South of the Amchitka Islands. In addition, humpbacks in the North Pacific and the Bering Sea eat euphausiids (krill), mackerel, sand lance, Ammodytes americanus, capelin and herring.

Fishes comprise about 95% of the diet of North Atlantic humpbacks. Those humpbacks living in the Atlantic Ocean, specifically near Cape Cod and Greenland, also eat sand lance, herring and pollock.

Humpbacks near Australia and in the Antartic also feed on euphausiids.

Typically, these whales take both food and water into their mouths. Large volumes can be accomodated because the ventral grooves in the throat allow for expansion. Once the mouth is full, it is closed and the water is pressed out. Meanwhile, the food is caught in the baleen plates and is then swallowed. This process is aided by the internal mechanism of rorqual feeding--the tongue.

Humpbacks have five main feeding behaviors (the first three are more commonly observed than the last two):

  1. Ring of foam. Humpbacks have an elaborate feeding behavior in which they lie on the ocean's surface and swim in a circle. While doing so, they strike the water with their flukes forming a "ring of foam," which surrounds their prey. Then, they dive under the ring and resurface in the center with mouth open, allowing them to capture the prey within the ring.
  2. Lunging. Humpbacks feed by swimming vertically or obliquely up through aggregations of plankton or fish. This occurs only when their food is abundant. In addition, some variation may occur by means of lateral and/or inverted lunging.
  3. Bubble behavior. When these whales use underwater exhalation to create bubble clouds and bubble columns.

Bubble clouds are large inter-connected masses of bubbles formed by one underwater exhalation. Clouds concentrate or herd a mass of prey. Feeding is presumed to occur underwater. After that the humpback rises slowly to the surface within the bubble cloud. After several blows and some shallow diving, the manuever is repeated. Bubble clouds appear to assist in prey detection or capture by immobilizing or confusing prey. Bubble clouds may cause a jumping response among the prey, helping the whale to detect the prey, or it may disguise the whale from the prey.

Bubble columns are formed as a humpback swims underwater in a broad circle while exhaling. An individual column may form rows, semicircles, or complete circles. These circles act like a seive net, concentrating or herding the prey.

  1. Tail slashing. In this method of feeding, the individual whale swims in a large circle while slashing its tail through the water. The actual feeding takes place in the center of the turbulence.
  2. Inside loop behavior. A whale can make a shallow dive, while hitting the water with its fluke as it submerges. A 180 degree roll is then rapily executed as the animal makes a sharp U turn (the "inside loop") and then lunge feeds slowly through the turbulent area created by its flukes. The whale feeds beside the area of turbulence.
  3. Flick-feeding. this occurs only when whales eat euphausiids.

At times, humpbacks combine some of these methods, for example, combining bubble feeding and tail slapping (lobtailing), as they feed on sand lance.

It is important to note that no humpback younger than two years old uses the tail slapping method, although they are weaned from their mothers at one year. However, rudimentary lobtail feeding has been witnessed several times among older post-weaning young.

In addition, no difference has been noted in the frequency of lobtail feeding between the sexes.

Animal Foods: fish; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore ); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on crustaceans, fish, and some cephalopods.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds on crustaceans, fish, and some cephalopods.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

10,000 - 100,000 individuals

Comments: Population size based on counts in breeding areas is greater than 66,600. North Pacific: ~18,300 (2004-2006; Calambokidis et al. 2008); North Atlantic: 10,290-13,990 (early 1990s; Stevick et al. 2003); Southern Hemisphere: at least 36,763 (Reilly et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Humpback whales travel singly, in pairs or trios, or in groups of usually about 10-15. They may form stable feeding groups that stay together throughout the summer and that reform in subsequent summers.

This species sometimes has succumbed to local die-offs off the northeastern United States, due apparently to ingestion of prey containing red tide toxins (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

herring (Clupea harengus), sand lance (Ammodytes sp.) and other small fish, invertebrates (euphausiids)
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
77.0 years.

Average lifespan

Status: wild:
95.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 95 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the western North Atlantic, young are born from December or January through March. Gestation lasts 11-12 months. Most adult females bear a calf every 2-3 years (sometimes 1 or 4 years). Young are weaned in 5-12 months. Twelve females that were monitored since first being observed as calves produced their first calves at ages of 5-7 years (Can. J. Zool. 70:1470). In Alaska, the age of first calving is 8-16 years (average 11.8 years).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humpbacks appear to possess a polygynous/polygamous mating system, with males competing aggressively for access to oestrous females.

Mating System: polygynous

The reproductive habits of humpback whales are typically mammalian. The breeding season is during the winter, and breeding takes place in tropical waters.

There are few actual observations of copulation in this species. The male and the female first swim in a line; they then engage in rolling, flipping, and tail fluking. Next, both dive and then surface vertically, with ventral surfaces "in close contact." They emerge from the water to a point below their flippers. They then fall back onto the surface of the water together. The gestation period lasts 11 to 11.5 months. During that time the embryo grows approximately 17 to 35 cm per month.

Sexual maturity is usually reached between 4 to 5 years. In males, the length of the penis can be an indication of sexual maturity. However, in some cases, puberty may proceed sexual maturity by one year. In sexually mature males, the weight of the testes and the rate of spermatogenesis increase during the breeding season, coinciding with the ovulation of the females. In the females, after sexual maturity is reached, ovary weight remains fairly constant. As ovulation approaches, "resting" Graafian follicles on the surface of the ovaries enlarge. There generally is only one ovulation per breeding season.

Breeding usually takes place once every two years, but it may occur twice every three years. In the latter situation, lactation may last longer that 5 months.

If a female is impregnated shortly after parturition, pregnancy and lactation may proceed simultaneously.

Breeding interval: Females of this species typically produce offspring every two years, and can produce yound twice in three years.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 11 to 11.5 months.

Average weaning age: 5 months.

Range age at sexual or reproductive maturity (female): 4 to 5 years.

Range age at sexual or reproductive maturity (male): 4 to 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 1.35e+06 g.

Average number of offspring: 1.

Calves are born in the warm tropical waters and subtropical waters of each hemisphere. Newborns are usually 4 to 5 m long, and are suckled by their mothers for about 5 months. The females' milk is highly nutritive, containing high amounts of fat, protein, lactose and water. There is no parental investment on the part of the males.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Reaches sexual maturity around 4-5 years old. Total length of time devoted to calf, from gestation to end of lactation, is about 2 years.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reaches sexual maturity around 4-5 years old. Total length of time devoted to calf, from gestation to end of lactation, is about 2 years.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bubbles enclose prey: humpback whale
 

Blowholes of humpback whales corral prey by creating spiraling nets of air bubble underwater.

       
    

  

 "Behaviourally, humpback whales capture prey by engaging in complex feeding manoeuvres that are often accompanied by the apparently directed use of air bubbles. The ability of bubble barriers to corral or herd fish has been reported by a number of authors (e.g., Smith, 1961; Blaxter & Batty, 1985; Sharpe & Dill, 1997). Bubble use by humpback whales has been observed in many of their feeding habitats and is reported to occur in a variety of configurations. These bubble-feeding behaviours appear to vary in nature among both individuals and regions; for example, bubble clouds (the production of a single or multiple bursts of seltzer-sized bubbles) are commonly observed from humpback whales in the Gulf of Maine, but never in Alaskan waters.

"Of the various bubble configurations reported, the most complex appears to be the bubble net (Jurasz & Jurasz, 1978; Watkins & Schevill, 1979; Hain et al., 1982). Existing descriptions of this unique and complex behavior are currently derived only from surface observations, predominately Jurasz & Jurasz (1979) and Hain et al. (1982). As described by Jurasz & Jurasz (1979), bubble nets are rings of distinctive bubbles that appear at the surface in a closed circle or figure '9'. In the Gulf of Maine, bubble nets have been further described by Hain et al. (1982) as a ring formed by a series of discrete bubble columns, blown at 3–5 m depth, by a whale that is rotated inward with the flippers in a vertical plane. The nets were described as incorporating 1.25–2 revolutions with smaller bubbles grading into larger bubbles as the net was closed. In both descriptions, whales fed in the centre of the completed bubble net at or near the surface. (Wiley et al. 2011: 576-577)


Watch Videos on Bubble Feeding
  Learn more about this functional adaptation.
  • Wiley D; Ware C; Bocconcelli A; Cholewiak D; Friedlaender A; Thompson M; Weinrich M. 2011. Underwater components of humpback whale bubble-net feeding behavior. Behaviour. 148: 575-602.
  • Hain JHW; Carter GD; Kraus SD; Mayo CA; Winn HE. 1982. Feeding behavior of the humpback whale, Megaptera novaeangliae, in the western North Atlantic. Fishery Bulletin. 80: 259-268.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Flippers provide lift, reduce drag: humpback whale
 

The flippers of the humpback whale channel flow and increase aerodynamic efficiency due to tubercles or bumps.

   
  "The humpback whale (Megaptera novaeangliae) is reported to use its elongate pectoral flippers during swimming maneuvers. The morphology of the flipper from a 9.02-m whale was evaluated with regard to this hydrodynamic function. The flipper had a wing-like, high aspect ratio plan- form. Rounded tubercles were regularly interspersed along the flipper's leading edge. The flipper was cut into 71 2.5-cm cross-sections and photographed. Except for sections near the distal tip, flipper sections were symmetrical with no camber. Flipper sections had a blunt, rounded leading edge and a highly tapered trailing edge. Placement of the maximum thickness placement for each cross-section varied from 49% of chord at the tip to 19% at mid-span. Section thickness ratio averaged 0.23 with a range of 0.20-0.28. The humpback whale flipper had a cross-sectional design typical of manufactured aerodynamic foils for lift generation. The morphology and placement of leading edge tubercles suggest that they function as enhanced lift devices to control flow over the flipper and maintain lift at high angles of attack. The morphology of the humpback whale flipper suggests that it is adapted for high maneuverability associated with the whale's unique feeding behavior." (Fish and Battle 1995:51)

"The humpback whale Megaptera novaeangliae is exceptional among the baleen whales in its ability to undertake acrobatic underwater maneuvers to catch prey. In order to execute these banking and turning maneuvers, humpback whales utilize extremely mobile flippers. The humpback whale flipper is unique because of the presence of large protuberances or tubercles located on the leading edge which gives this surface a scalloped appearance. We show, through wind tunnel measurements, that the addition of leading-edge tubercles to a scale model of an idealized humpback whale flipper delays the stall angle by approximately 40%, while increasing lift and decreasing drag." (Miklosovic et al. 2004:L39)

Watch Video of Whales' Hunting Technique

  Learn more about this functional adaptation.
  • Fish, F. E.; Battle, J. M. 1995. Hydrodynamic design of the humpback whale flipper. J Morphol. 225(1): 51-60.
  • Miklosovic, D. S.; Murray, M. M.; Howle, L. E.; Fish, F. E. 2004. Leading-edge tubercles delay stall on humpback whale (Megaptera novaeangliae) flippers. PHYSICS OF FLUIDS. 16(5):
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 1 person

Average rating: 2.5 of 5

Functional adaptation

Powerful tail used for swimming: humpback whale
 

The tail of a humpback whale drives the whale through the water using powerful horizontal flukes that move up and down.

   
  "The huge tail flukes of a humpbacked whale break water as the animal dives. One of the largest living mammals, the whale uses its tail for swimming. The tail with its horizontal flukes is moved up and down to drive the animal through the water, while its small flippers, the vestiges of its forelimbs, are used for balancing and steering." (Foy and Oxford Scientific Films 1982:44)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Megaptera novaeangliae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATATTTATTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAGCTAGGTCAGCCTGGCACACTAATCGGAGATGACCAAGTCTACAACGTATTAGTAACAGCCCATGCCTTCGTGATAATTTTCTTCATGGTTATACCTATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCTGACATAGCTTTTCCTCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCTTATTATTAATAGCATCCTCAATGGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTATATCCCCCCTTAGCCGGAAACCTAGCACATGCAGGAGCTTCAGTTGACCTTACCATCTTCTCCCTACACCTAGCCGGCGTGTCCTCAATCCTCGGGGCTATCAACTTCATCACAACCATTATTAACATAAAACCACCTGCCATGACCCAATATCAGACCCCTCTTTTCGTATGATCAGTCCTAGTCACAGCAGTATTACTCCTACTATCATTACCCGTTTTAGCAGCCGGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCGGGTGGAGGAGACCCAATTCTGTACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTATACATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCCTTCGGCTATATAGGAATAGTCTGAGCCATGGTATCCATTGGGTTCTTAGGTTTTATCGTATGGGCCCACCATATATTTACAGTAGGTATAGACGTTGATACACGAGCATATTTCACATCAGCCACTATAATTATTGCTATTCCCACAGGGGTAAAAGTCTTCAGTTGACTAGCAACACTACACGGGGGTAATATTAAATGATCTCCTGCCCTAATATGAGCCCTAGGTTTCATTTTCCTCTTCACAGTGGGCGGTCTAACTGGTATCGTCCTAGCCAACTCATCACTAGACATTGTCCTACATGATACTTACTATGTAGTTGCTCACTTCCACTATGTCCTATCAATAGGAGCAGTCTTCGCCATTATAGGAGGCTTTGTCCACTGATTTCCACTATTCTCAGGATACACACTTAACACAACATGAACAAAAATTCACTTCATAATCATGTTCGTAGGTGTAAATCTAACATTCTTTCCACAACATTTCTTAGGCCTGTCCGGTATACCTCGACGATACTCCGATTACCCAGATGCCTACACAACATGAAATACTATTTCATCTATAGGCTCATTTATCTCACTAACAGCAGTCATACTAATAATCTTCATTATCTGAGAAGCATTTACATCCAAACGAGAAGTGCTAGCAGTAGACCTCACCTCTACCAACCTTGAATGACTAAATGGGTGTCCTCCACCATACCATACATTCGAAGAACCAGCATTTGTCAACCCAAAATGATCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Megaptera novaeangliae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large worldwide range extends throughout all oceans; depleted by past overharvesting; population size now exceeds 60,000 and has increased over the past several decades; vulnerable to marine pollution, disturbance by boat traffic, and entanglement in fishing gear, but these are not major threats, and the species is now apparently secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
Although no final assessment of the current global population relative to its 1940 level is available, it seems, based on the recent rates of increase, unlikely that it is below the threshold (50% of the 1940 level) that would qualify the species for inclusion in the Vulnerable category under criterion A, The available population estimates total more than 60,000 animals, well above the C and D criteria thresholds for the Vulnerable category. The range of the humpback whale is not restricted, and therefore the species does not qualify for inclusion under Criterion B. The species is therefore listed as Least Concern. Completion of the ongoing Comprehensive Assessment by the IWC Scientific Committee will enable a more accurate determination of the level of recovery of the species.

The reasons for the change to Least Concern from the previous classification of Vulnerable (VU A1abd) are threefold:
(i) in the areas for which data are available, the population has continued to increase in the 10 years since the previous assessment;
(ii) abundance and trend data are available for more areas than were available for the previous assessment;
(iii) the criteria for Vulnerable have been changed: the threshold reduction for the A1 criterion has been changed from 20% to 50%.

Despite the encouraging global status, concern remains about apparently discrete and small subpopulations of humpback whales for which information about status is lacking. These include the Arabian Sea (isolated from the southern Indian Ocean), the western North Pacific, the west coast of Africa, and the South Pacific subpopulations in portions of Oceania (breeding stocks E and F) that likely feed in Antarctic Areas V and VI.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: Entire


Population detail:

Population location: Entire
Listing status: E

For most current information and documents related to the conservation status and management of Megaptera novaeangliae , see its USFWS Species Profile

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As of 1999, listed as an endangered species in the ESA. Humpbacks were heavily exploited commercially until 1963 when IWC protection started. Now protected by IWC, CITES, and CRW (mothers and calves, specifically). Population estimated around 25,000 worldwide.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As of 1999, listed as an endangered species in the ESA. Humpbacks were heavily exploited commercially until 1963 when IWC protection started. Now protected by IWC, CITES, and CRW (mothers and calves, specifically). Population estimated around 25,000 worldwide.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Appendix I of CITES (4), and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, there are an estimated 6,000 humpbacks in the earth's waters, with possibly 1,000 to 3,000 more. The healthiest populations occur in the western north Atlantic Ocean. A few other areas in which there are small populations include the waters near Beguia, Cape Verde, Greenland, and Tonga. Global humpback populations have begun to strengthen, although this species is still a conservation concern.

Humpback whales received some protection in 1985 when the International Whaling Commission instituted a moratorium on commercial whaling. In the early part of the twentieth century, during the modern whaling era, humpback whales were highly vulnerable due to their tendency to aggregate on the tropical breeding grounds and to come close to the shore on the northern feeding grounds.

More than 60,000 humpbacks were killed between 1910 to 1916 in the southern hemisphere, and there were other peaks of exploitation in the 1930's and 1950's. In the North Pacific, there were peak catches of over 3,000 in 1962 to 1963.

In order to combat the problem of depletion, catching humpback whales was prohibited in the Antartic in 1939, although that plan was abandoned in 1949. In the southern hemisphere, hunting was banned in 1963. In the North Atlantic, hunting was banned in 1956. Finally hunting was banned in the North Pacific in 1966.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: Populations have increased in the North Pacific, North Atlantic, and Southern Hemisphere over the past several decades (Stevick et al. 2003, Calambokidis et al. 2008, Reilly et al. 2008).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The Humpback Whale is better studied than other balaenopterid species, and migratory destinations are well known for some subpopulations.

North Atlantic
A comprehensive assessment of North Atlantic Humpback Whales was completed by the IWC Scientific Committee in 2002, from which most of the information below is drawn (IWC 2002, 2003).

There is a distinct but relatively small winter aggregation in the east around the Cape Verde Islands – the site of fairly extensive 19th century Yankee whaling (Reeves et al. 2002). The major present-day North Atlantic breeding and calving area in the West Indies extends from Cuba in the west down the island chain as far as Venezuela; the largest breeding aggregations occur on Silver and Navidad Banks near the Dominican Republic, with much lower concentrations in Samana Bay (Dominican Republic), off the northwest coast of Puerto Rico, and around the Virgin Islands and the eastern Antilles. Some humpback whales have also been sighted in high-latitude waters during the winter, indicating that not all individuals migrate to the southern wintering grounds every year.

Six distinct feeding aggregations have been identified: Gulf of Maine, Gulf of St Lawrence, Newfoundland/Labrador, West Greenland, Iceland, North Norway (including Bear Island and Jan Mayen). Genetic and photo-identification data indicate that the six feeding aggregations represent relatively discrete subpopulations, fidelity to which is determined matrilineally. However, because whales from different feeding grounds all mix in a common breeding area in the West Indies, there is male-mediated nuclear gene flow between the subpopulations.

The best available abundance estimate for the West Indies group of breeding aggregations is 10,752 in 1992-93 (CV 0.068) with an estimated annual rate of increase of 3.1% (SE 0.5%) (Stevick et al. 2003). There is no estimate of abundance for the Cape Verde Islands breeding aggregation, but to date a total of 72 individuals have been identified there (J. Allen pers. comm. 2007). As of 2007, only one photographic match has been made from the Cape Verde Islands to a feeding ground (off Iceland), but the matching exercise is only partially complete.

Animals from the West Indies breeding area are found in all six known feeding aggregations. However, genetic evidence suggests that part of the Icelandic and Norwegian feeding aggregations consists of whales that winter outside the West Indies. Though some of these likely migrate to the Cape Verde Islands, the population found there in winter is too small relative to the number of animals thought to be breeding somewhere other than the West Indies, and at present the identity of this additional breeding area (or areas) remains unresolved.

Higher rates of increase have been estimated in some feeding areas (e.g. 6.5% for the Gulf of Maine; Barlow and Clapham 1997).

Humpbacks were heavily exploited in the past by pre-modern whaling in their breeding grounds in both the West Indies and the Cape Verde Islands, and by modern whaling in their feeding grounds, especially off Iceland and Norway in the late 19th and early 20th centuries. Catches by pre-modern whaling are estimated primarily from logbook and trade records. Catches by early modern whaling also need to be estimated because most of the catch records during the first few decades were not divided by species.

Catches in the West Indies (including Bermuda) are documented from 1664 to the present day, but the main period was 1826-1928, during which about 8,600 whales were estimated to have been killed. Whaling in the Cape Verde Islands occurred primarily during 1850-1912 with a total estimated kill of about 3,000 animals. An estimated 3,200 were taken from Iceland and 2,000 from northern Norway during 1880-1916. About 1,500 Humpback Whales are reported killed in the North Atlantic since 1916, from a variety of areas including the British Isles, Faeroes, Norway, Iceland, Greenland, and eastern Canada, as well as Norwegian pelagic catches.

Population modelling exercises show that the recent abundance and increase rate of humpback whales in the North Atlantic are too large to represent a recovery from depletion by the estimated past kills. This suggests that either:

(i) past kills have been substantially underestimated; or
(ii) there has been some increase in the environmental carrying capacity for humpback whales; or
(iii) whaling had a negative impact on the population, over and above the effects of the actual removals, in ways that are not understood; or
(iv) some combination of the above factors.

Whichever of the above hypotheses pertain, the increase rate of 3% per annum implies that humpbacks are considerably more abundant in the North Atlantic today than they were in 1940. This is consistent with anecdotal evidence of the relatively low numbers observed prior to 1960.

North Pacific
The following subpopulations have been identified (Calambokidis et al. 2001, 2008):
  • Eastern North Pacific. Winters off the coast of Mexico (Baja California, Gulf of California, mainland) and summers off the coasts of California, Oregon, and Washington.
  • Central North Pacific. Winters in the central North Pacific and Hawaiian Islands; summers in Alaska (Prince William Sound) and British Columbia.
  • Western North Pacific. Winters in the western North Pacific, in the Bonin Islands, Ryukyu Islands and the Philippines, and possibly in other island areas in the southwestern North Pacific; summers off Kamchatka, in the Bering Sea and along the Aleutian Islands, west of the Kodiak Archipelago.

There are two additional subpopulations, one that winters off Central America and summers off California, the other that winters around the Revillagigedo Islands and summers in unknown areas but possibly in the Bering Sea or near the Aleutian Islands (Urbán et al. 2000)

Some interchange of individuals between the known North Pacific breeding grounds has been documented (Calambokidis et al. 2001, 2008).

Abundance: Eastern North Pacific. Recent information is summarized in the NOAA stock assessment report (Anon. 2005a). The abundance of humpbacks was estimated from shipboard line transect surveys in the waters of California, Oregon and Washington during 1996-2001 to be 1,314 (CV 0.30) animals. Mark-recapture from photo-identification in the same area yielded an estimate of 1,391 whales in 2002/03, with an increase of about 8% per year over the period 1991-2003. Mark-recapture from photo-identification in the Mexican Pacific yielded an estimate of 1,813 (CI: 918-2505) for the Mainland Mexico and Baja California subpopulation, and 914 (CI: 590-1193) for the Revillagigedo subpopulation (Urbán et al. 1999). The recently completed SPLASH (Structure of Populations, Levels of Abundance and Status of Humpback Whales in the North Pacific) project resulted in estimates by various methods of ~1,400-1,700 for the California-Oregon feeding area and ~6,000-7,000 for the Mexican wintering areas (Calambokidis et al. 2008).

Abundance: Central North Pacific. Based on mark-recapture analysis of photo-identification data in the Hawaiian wintering ground, the abundance was estimated at 4,005 (CV 0.095) whales in 1993 (Calambokidis et al. 1997). Older mark-recapture estimates for this stock exist, but their lack of comparability renders their use for estimating an increase rate questionable. Aerial surveys designed to be comparable across years yielded a trend estimate of 7% per year from 1993-2000 (Angliss and Outlaw 2005). SPLASH yielded wintering estimates for the Hawaii wintering ground by various methods of 7,120-10,425 (Calambokidis et al. 2008).

Summer feeding areas for this stock have been identified in Prince William Sound (Alaska), southeastern Alaska and off British Columbia, but the abundance estimates for the known feeding grounds total only about 2,000 (Angliss and Outlaw 2005a). This suggests that more feeding areas are yet to be found. In view of their current high abundance in the Hawaiian Islands, the sparseness of historical accounts of humpback whales in Hawaii prior to the 20th century is surprising. It may be a relatively new wintering ground (Herman 1979). The SPLASH estimates for the combined Southeast Alaska and British Columbia feeding areas are around 3,000-5,000 (Calambokidis et al. 2008)

Abundance: Western North Pacific. Abundance in 1991-93 was estimated at 394 (CV 0.084) from photo-identification data (Angliss and Outlaw 2005b). Humpback whale sightings from Japanese cetacean surveys in the western North Pacific, including those conducted in conjunction with the Japanese scientific whaling programme (JARPN), have not yet been analyzed to provide abundance estimates. The recent SPLASH survey covered the range more broadly and resulted in estimates by various methods of 938-1,107 (Calambokidis et al. 2008)

Humpback Whales were severely depleted by whaling throughout the North Pacific until they were protected by the IWC from 1966 onwards. Illegal Soviet catches continued until 1971 (Doroshenko 2000). Humpbacks were taken by pre-modern whalers in Japan before the 20th century, but so far no series of catch estimates have been compiled for the pre-modern period. About 21,000 humpback whales are recorded caught by modern whaling in the North Pacific in the 20th century, of which about 14,000 were in the eastern North Pacific and 7,000 in the west (IWC 2006a). Included in these figures are about 2,500 humpbacks taken illegally by USSR fleets during 1961-65, that were concealed at the time, mainly in the Gulf of Alaska and the Bering Sea (Doroshenko 2000). In addition, nearly 20,000 unspecified whales were caught in the early 20th century, of which a substantial number probably were humpbacks. The latter were taken primarily in the eastern North Pacific, except that the locations of about 9,000 unspecified whales taken by American pelagic whalers during 1911-1919 have not yet been ascertained.

No comprehensive assessment of North Pacific humpback whales has been conducted by the IWC Scientific Committee. The evidence suggests that North Pacific Humpback Whales have been increasing, following depletion by whaling, but that this recovery is not yet complete. Given catches of nearly 7,500 during 1961-65, a minimum estimate for the 1960 population would be about 8,000, but the population level in 1940 was probably lower than today. A large-scale international collaboration (the SPLASH project) involving photo-identification and genetic sampling was conducted across the entire North Pacific in 2004-06. The results have been recently analyzed and yielded a best estimate for the entire North Pacific of 18,302 (average of estimates of 17,558 for wintering and 19,056 for summer feeding areas). A 4.9% annual increase is suggested for the period since 1991-93.

The low SPLASH population estimate for the western North Pacific subpopulation of around 1,000 is a cause for concern.

Northern Indian Ocean
A resident stock, which apparently does not migrate, is found in the Arabian Sea. Genetic differences, and the lack of photographic matches with other areas, suggest that this is an isolated subpopulation; in addition, analysis of illegal Soviet catch data from the 1960s indicates that this population has a distinctly boreal reproductive cycle (Mikhalev 1997). A population estimate of 56 animals (95% CI 35-255) from photo-identification data may be negatively biased due to incomplete coverage (IWC 2005). A total of 242 whales was taken illegally by Soviet whalers in 1965-66 (Mikhalev 1997).

Southern Hemisphere
A comprehensive assessment of Southern Hemisphere Humpback Whales by the IWC Scientific Committee is nearing completion (IWC 2005, 2006b, 2007). Traditionally the IWC managed humpback whale stocks on the basis of the six Antarctic Areas (I through VI) but the Scientific Committee now recognizes seven major breeding stocks, A through G, some of which are tentatively further subdivided into substocks.

The wintering grounds of these are:

A (Southwest Atlantic): coast of Brazil
B (Southeast Atlantic): the coast of West Africa from the Gulf of Guinea down to South Africa
C (southwestern Indian Ocean): coasts of eastern South Africa, Mozambique, Madagascar (southern, western and eastern coasts), Mayotte, the Comoros and other western Indian Ocean island groups;
D (southeastern Indian Ocean): northwestern Australia
E (southwest Pacific) northeastern Australia, New Caledonia, Tonga and Fiji.
F (central South Pacific): Cook Islands and French Polynesia
G (southeast Pacific): Ecuador, Galápagos, Colombia, Panama and Costa Rica.

Apart from stocks A and D, there is evidence of substructure within the stocks, with subunits that are spatially and genetically isolated to varying degrees.

The extent of mixing of the C stock wintering off the coasts of Mozambique (the C1 substock), Madagascar (the C3 substock) and the western Indian Ocean island groups (the C2 substock) remains unclear.

The structure of stocks E and F is particularly unclear: there appear to be at least six separate subpopulations (eastern Australia, New Caledonia, Fiji, Tonga, Cook Islands, and islands further east), and it is unclear how these should be grouped if at all.

The structure of stock B is also unclear: there appears to a northern substock (B1) wintering off the coast off Gabon, the Congos and Cabinda (Angola) and in the Bight of Benin, and a southern substock (B2) with a diffuse or ill-defined wintering area off southern Angola, Namibia, and western South Africa, although animals seen in the southern area may include those on migration to and from wintering grounds to the north. Feeding occurs in the Benguela Current area; this may include animals wintering there but also animals stopping to feed during their migration.

The winter distribution of the G stock extends into the Northern Hemisphere, and may overlap with the distribution of North Pacific stocks; several photo-id matches have been made between the Antarctic Peninsula and Central America, although whether there is temporal overlap between these whales and their northern conspecifics is unclear. Tourist observations of mother-calf pairs around the Galápagos during January to March, if confirmed, suggest that North Pacific animals may also use this area. Phylogenetic analyses (Baker et al. 1994) reveal that maternal lineages in the eastern Pacific cross between the Northern and Southern Hemisphere populations, such that there has been some interchange between the hemispheres, but not necessarily in recent times.

For most of the breeding stocks, recent estimates of abundance on their wintering grounds have been obtained from line-transect surveys and/or capture-recapture analyses using photo-identification data. For some stocks, direct estimates of the rate of increase are available from recent time-series of abundance data. The available estimates of recent abundance and trends for wintering grounds are listed in Table 1 (see attached PDF). The total estimate of 36,600 for the Southern Hemisphere is negatively biased, because no abundance estimate is available for stock F, and the estimate for stock B covers only part of the wintering range for a discrete period. Furthermore, it is possible that the entire population does not migrate to the wintering grounds, as evidenced by, for example, an apparent excess of males in winter censuses. Rate of increase estimates are available for five stocks, ranging from 4.6% p.a. to 10.5% p.a.

The abundance of Humpback Whales during summer in the Antarctic south of 60°S has also been estimated from data from the International Decade of Cetacean Research (IDCR) (later Southern Ocean Whale and Ecosystem Research, SOWER) programme surveys. A part of the Antarctic has been surveyed each year since 1978/79, yielding 3 sets of circumpolar surveys. The abundance estimates for each circumpolar survey are listed in Table 2 (see attached PDF). All three circumpolar estimates are probably underestimates of the hemispheric population, because not all humpback whales will have been south of 60°S during the surveys, and major summer concentration areas north of 60°S in the South Atlantic (to the east of South Georgia and in the vicinity of the South Sandwich Islands and around Bouvet Island) are not included.

The summer feeding areas of each stock cannot be delineated with much precision, but a combination of photo-identification, genetic, satellite tracking and old Discovery mark data suggest the following relationships: Breeding stock A (Brazil) feeds in the South Georgia/South Sandwich area in Area II (Zerbini et al. 2006); breeding stock D (W. Australia) feeds in Antarctic Area IV ands perhaps eastern Area III; breeding stock G (southeast Pacific) feeds along the Antarctic Peninsula and around the South Shetlands, and in the Magellan Strait; breeding stock E (eastern Australia and at least some island groups of western Oceania) feeds in Antarctic Area V. The feeding areas of the other stocks could not be delineated at this stage.

Humpback Whale stocks were heavily depleted throughout most the Southern Hemisphere in the early 20th century by a combination of coastal catches in their wintering grounds and catches from land stations and by pelagic fleets in their Antarctic feeding grounds. Approximately 220,000 Humpback Whales were taken in total, of which about 100,000 since 1940; almost half of these latter consisted of illegal takes by the USSR (Zemsky et al. 1996, Allison 2006).

During 1908-1963, recorded catches outside the Antarctic (north of 40°S) have been: about 30,000 off the western coasts of southern Africa (primarily Gabon and Angola); nearly 20,000 off the eastern coasts of southern Africa (Natal, Mozambique and Madagascar) and in the western Indian Ocean; 28,000 off western Australia; about 15,000 off eastern Australia, New Zealand and southwest Pacific Islands; and about 2,000 each from the western and eastern coasts of South America. After 1904, a further approximately 27,000 whales were taken from land stations in South Georgia and over 12,000 from the South Shetlands. Pelagic whaling fleets operated during 1925-66, taking over 83,000 humpbacks. This includes more than 48,000 animals taken by the USSR, of which all but 2,710 were taken illegally (primarily from Areas IV and V); of this total, some 25,000 Soviet catches were taken in just two whaling seasons (1959/60 and 1960/61).

Due partly to the difficulties of assigning feeding areas, and hence past catches, to breeding stocks, the IWC Scientific Committee has completed population assessments only for stocks A, D, and G. The assessment of D was considered preliminary due to likely mixing in the feeding grounds with stock E and possibly other stocks.

The A stock (southwest Atlantic) is estimated to have been depleted rapidly from an initial level of 25,000 in 1904 to less than 2,000 in the 1920s, by catches from South Georgia land stations. Continued catches from South Georgia and pelagic fleets further depleted the stock to a few hundred animals by the mid-1960s when whaling ceased. The stock has recovered strongly since then to over 6,500 today.

The B stock (southeast Atlantic) was depleted by large catches in its wintering grounds off Gabon, Congo, Angola, Namibia and western South Africa, with open-boat whaling beginning in the 19th century and modern whaling beginning in 1909. Catches in Gabon and Congo were not continuous, but occurred in bursts as the stock(s) apparently began to recover between periods of intensive whaling. Nearly 30,000 humpbacks are recorded caught off the western coasts of sub-Saharan Africa during 1909-1960. The last large catches were made by Norwegian and French whalers off Gabon and São Tomé who took over 4,000 humpbacks during 1951-54. A final attempt at commercial exploitation in 1959 off Gabon caught just 160 whales.

After an initial burst of heavy catching off Mozambique and South Africa totalling nearly 8,000 whales during 1908-15, the C stock (southwest Indian Ocean) was subject to continuous but relatively low catches from Natal, South Africa between 1920 and 1962 and two discrete episodes (1937-39 and 1949-50) off Madagascar (Angot 1951). While catches off Natal remained relatively low after 1915, catches were far higher during the two episodes off Madagascar. Catches by pelagic expeditions in and outside the Antarctic probably also had an impact on this stock.

The D stock (southeast Indian Ocean) is estimated to have been reduced from a pre-whaling population of about 20,000 in 1910 to about half this level by 1940, mainly by catches from and off western Australia. Following a brief respite during WWII, the stock was further depleted (notably by illegal Soviet catches) to perhaps fewer than 1,000 animals by the mid-1960s, but recovered to about 10,000 by 1999. The current population size is very likely more than the 1940 level, and very likely more than half the pre-whaling level, subject to a caveat over the potential for mixing of stock D and other stocks in the feeding grounds (IWC 2007).

The E stock (eastern Australia/western Oceania) was heavily affected not only by catches totalling nearly 15,000 during 1909-62 from shore-station whaling in eastern Australia and elsewhere, but also by Soviet illegal pelagic catches of over 30,000, taken in Area V during the late 1950s and early 1960s.

The F stock (Oceania) was not subject to whaling in its wintering grounds but was probably affected by illegal Soviet catches in Areas V and VI. However, because the migratory destinations of this stock are unclear, assignment of these catches to the F stock has been difficult.

The G stock (southeast Pacific) is estimated to have been rapidly depleted from a pre-whaling level of about 10,000 animals in 1910 to a few hundred animals by the mid 1920s, mainly by catches from land stations on the South Shetland Islands. Pelagic catches in the putative feeding ground of this stock (Antarctic Area I) were relatively few, because of its distance from ports of approach, and because pelagic whaling was prohibited in Antarctic Areas I and VI (the then-Sanctuary) from 1935-55. The stock is estimated to have increased during 1925-55, but to have been knocked back down to the low hundreds by a new wave of pelagic catching that followed the opening of the Sanctuary in 1955. The stock is estimated to have increased since the end of humpback whaling in the mid-1960s, to its current level of about 4,000, which is well above the 1940s level but well below the pre-whaling level.

Generation time: 22 years (Taylor et al. 2007). The time window for applying the reduction criterion (A1) for a threatened category is 1941-2007.

Global population. All the new assessments of humpback whale stocks conducted by the IWC Scientific Committee to date indicate that the stocks concerned have recovered to levels at or above their 1940 level. Because the IWC Scientific Committee has not yet conducted assessments for the North Pacific and for four of the seven recognized Southern Hemisphere stocks, it is not yet possible to formally gauge the world population level relative to the 1940 level. However, given the increase rates observed in several of the unassessed North Pacific and Southern Hemisphere stocks (Table 1; see attached PDF), there is little reason to suppose that the world population is still below 50% of the 1940 level (the threshold for Vulnerable status under the reduction criterion)

Despite the encouraging global status, concern remains about apparently discrete and small subpopulations of humpback whales for which information about their status is lacking; these include the Arabian Sea (isolated from the southern Indian Ocean), the western North Pacific, and South Pacific subpopulations in portions of Oceania (breeding stocks E and F).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: Low

Comments: Historically, populations were greatly reduced by commercial whaling. Humpback whales have been protected from commercial whaling worldwide since 1966, and there have been few catches since 1968 (Reilly et al. 2008). The species remains vulnerable to marine pollution, disturbance by boat traffic, mortality from boat collisions, and entanglement in fishing gear (e.g., Volgenau et al. 1995 Todd et al. 1996, Mazzuca et al. 1998), but these factors currently are not significantly interfering with population recovery.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Although commercial whaling seriously depleted all humpback populations, the species has demonstrated remarkable resilience, and most populations have increased since the end of whaling, although there are several populations that remain small and for which no increase has yet been detected, such as the population in the Arabian Sea, the population breeding near South Pacific islands, and the western North Pacific population. Humpback whales have been protected from commercial whaling worldwide since 1966, and there have been few catches since 1968.

Today, small numbers only are taken by a 'subsistence' whaling operation off St Vincent (1-2 animals per year); it is possible that other small unreported catches occur elsewhere.

The government of Japan announced plans to resume humpback whaling in the Antarctic from the 2007/08 season, starting with an experimental catch of 50 animals per year under scientific permit (Government of Japan 2005). The impact of these catches on small unrecovered stocks of humpbacks in Oceania that feed in the whaling grounds of Area V is not clear.

Also, in humpback habitat off the coasts of Brazil, Gabon, Angola, Mozambique and Madagascar (Breeding Stocks A, B, and C), there is a great deal of ongoing and planned offshore oil and gas development, with potential impacts.

Humpback Whales are subject to entanglements, often fatal, in fishing gear. They are also vulnerable to injury by ship strikes, which can also be fatal. The documentation of such incidents is best for US waters. For the Atlantic coasts of the US during 1999-2003, there were 19 reports of death or serious injury caused by entanglements and seven cases of death or serious injury due to ship strikes (Anon. 2005b). For US Pacific waters (mainly Alaska) during 1999-2001 there were 13 reports of deaths and serious injuries due to entanglement and 3 reports of deaths due to ship strikes (Anon. 2005a).

Japanese Annual Progress Reports submitted to the IWC during 2003-06 listed 3-5 Humpback Whales caught annually in fishing gear, mainly coastal trap nets (Miyashita and Kato 2006).

In most areas, the observed increases in Humpback Whale abundance in recent times implies that human-caused mortality is not sufficient to threaten the populations concerned. However, the situation should be kept under review for populations that are still small and for which no increase has been detected, such as the in western North Pacific and parts of Oceania.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Humpback whales became one of the major targets of the whaling industry due to their coastal migration routes; it is estimated that over 100,000 humpbacks were slaughtered in the southern hemisphere alone, between 1900 and 1940 (6). Protected from whaling today, these whales are vulnerable to changes in the marine environment and are threatened by pollution and the possible alteration of fish stocks as a result of climate change (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Few (1-3) occurrences appropriately protected and managed

Needs: In waters off northeastern North America, more effective entanglement reporting and assisting systems are needed, and increased efforts are needed to decrease entanglements in fishing gear (Volgenau et al. 1995). Protection could be enhanced by establishement of additional marine sanctuaries in areas where the species congregates.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Humpbacks have been protected from commercial whaling in the North Atlantic by the IWC since 1955, in the Southern Hemisphere since 1963 (although spatial and temporal regulation of catches in the Antarctic occurred prior to this), and in the North Pacific since 1966. The last substantial catches occurred in 1968. Despite having been severely depleted to a world population in the low thousands at that time, humpbacks have since recovered strongly to a world population that is estimated at over 60,000 animals and is increasing.

Humpback Whales enjoy additional protective measures, such as sanctuaries, in a number of countries. The species is listed in Appendix I of both CITES and CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Humpback whales received full protection in 1966 and have since captured the public's imagination (6). Whale watching tours to see these magnificent animals are popular throughout the world from Alaska to Hawaii and Japan to Australia (2). In the northwest Atlantic particularly, these have worked closely with scientists providing valuable photo identification of individuals that has helped to uncover some of the mysteries surrounding their impressive migration (2). Humpback whales are the most studied of the large whales but little is still known about some aspects of their behaviour and about population dynamics (9), further research and monitoring is therefore needed to safeguard these awe-inspiring acrobats of the sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Humpback whales formerly were subjected to heavy commercial harvest, primarily for oil; a very small harvest for local use still occurs in the Lesser Antilles. Economic value today is primarily as objective of many whale watching cruises.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Humpback whales staying close to the shore on the Eastern Canadian seaboard damage cod and herring traps and can tear loose long lengths of a set net.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Humpbacks have historically had incredible economic importance to humans. They were one of the nine species hunted intensively by whalers. They were at times the most important constituent of the catch of modern whalers. Their oil was in demand as a kind of burning oil for lamps and as a lubricant for machinery. Whale oil was also used as a raw material for margarine and as a component of cooking fat. Whale meat was processed for human consumption and made into animal feed. Meal made from whale bones was used as fertilizer.

However, these animals are no longer hunted extensively. They do continue to have some economic impact, as ecotourism and whale sighting tours are quite popular in appropriate coastal areas.

Positive Impacts: ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Oceania humpback whale : Endangered (EN)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category

subpopulation Arabian Sea humpback whale : Endangered (EN)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category

Least Concern (LC)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Humpback whale

The humpback whale (Megaptera novaeangliae) is a species of baleen whale. One of the larger rorqual species, adults range in length from 12–16 metres (39–52 ft) and weigh approximately 36,000 kilograms (79,000 lb). The humpback has a distinctive body shape, with unusually long pectoral fins and a knobbly head. An acrobatic animal known for breaching and slapping the water with its tail and pectorals, it is popular with whale watchers off the coasts of Australasia and the Americas. Males produce a complex song lasting 10 to 20 minutes, which they repeat for hours at a time. Its purpose is not clear, though it may have a role in mating.

Found in oceans and seas around the world, humpback whales typically migrate up to 25,000 kilometres (16,000 mi) each year. Humpbacks feed only in summer, in polar waters, and migrate to tropical or subtropical waters to breed and give birth in the winter. During the winter, humpbacks fast and live off their fat reserves. Their diet consists mostly of krill and small fish. Humpbacks have a diverse repertoire of feeding methods, including the bubble net feeding technique.

Like other large whales, the humpback was and is a target for the whaling industry. Once hunted to the brink of extinction, its population fell by an estimated 90% before a moratorium was introduced in 1966. While stocks have since partially recovered, entanglement in fishing gear, collisions with ships, and noise pollution continue to impact the 80,000 humpbacks worldwide.

Taxonomy[edit]




B. bonaerensis (southern minke whale)



B. acutorostra (northern minke whale)






B. physalus (fin whale)




B. edeni (pygmy Bryde's whale)




B. borealis (sei whale)



B. brydei (Bryde's whale)







B. musculus (blue whale)



Megaptera novaeangliae (humpback whale)



Eschrichtius robustus (gray whale)





A phylogenetic tree of animals related to the humpback whale
Young whale with blowholes clearly visible

Humpback whales are rorquals (family Balaenopteridae), a family that includes the blue whale, the fin whale, the Bryde's whale, the sei whale and the minke whale. The rorquals are believed to have diverged from the other families of the suborder Mysticeti as long ago as the middle Miocene.[3] However, it is not known when the members of these families diverged from each other.

Though clearly related to the giant whales of the genus Balaenoptera, the humpback has been the sole member of its genus since Gray's work in 1846. More recently, though, DNA sequencing analysis has indicated the humpback is more closely related to certain rorquals, particularly the fin whale (Balaenoptera physalus), and possibly to the gray whale (Eschrichtius robustus), than it is to rorquals such as the minke whales.[4][5] If further research confirms these relationships, it will be necessary to reclassify the rorquals.

The humpback whale was first identified as baleine de la Nouvelle Angleterre by Mathurin Jacques Brisson in his Regnum Animale of 1756. In 1781, Georg Heinrich Borowski described the species, converting Brisson's name to its Latin equivalent, Balaena novaeangliae. In 1804, Lacépède shifted the humpback from the Balaenidae family, renaming it Balaenoptera jubartes. In 1846, John Edward Gray created the genus Megaptera, classifying the humpback as Megaptera longipinna, but in 1932, Remington Kellogg reverted the species names to use Borowski's novaeangliae.[6] The common name is derived from the curving of their backs when diving. The generic name Megaptera from the Greek mega-/μεγα- "giant" and ptera/πτερα "wing",[7] refers to their large front flippers. The specific name means "New Englander" and was probably given by Brisson due the regular sightings of humpbacks off the coast of New England.[6]

Genetic research in mid-2014 by the British Antarctic Survey confirmed that the separate populations in the North Atlantic, North Pacific, and Southern Oceans are far more distinct than previously thought. Some biologists believe that these should regarded as separate subspecies of humpback whales,[8] and that they are all evolving independently.[9]

Description[edit]

A humpback whale can easily be identified by its stocky body with an obvious hump and black dorsal coloring. The head and lower jaw are covered with knobs called tubercles, which are hair follicles, and are characteristic of the species. The fluked tail, which it lifts above the surface in some dive sequences, has wavy trailing edges.[10] The four global populations, all under study, are: North Pacific, Atlantic, and Southern Ocean humpbacks, which have distinct populations which complete a migratory round-trip each year, and the Indian Ocean population, which does not migrate, prevented by that ocean's northern coastline.

The long black and white tail fin, which can be up to a third of body length, and the pectoral fins have unique patterns, which make individual whales identifiable.[11][12] Several hypotheses attempt to explain the humpback's pectoral fins, which are proportionally the longest fins of any cetacean. The two most enduring mention the higher maneuverability afforded by long fins, and the usefulness of the increased surface area for temperature control when migrating between warm and cold climates.

Humpbacks have 270 to 400 darkly coloured baleen plates on each side of their mouths.[13] The plates measure from a mere 18 inches (46 cm) in the front to approximately 3 feet (0.91 m) long in the back, behind the hinge. Ventral grooves run from the lower jaw to the umbilicus about halfway along the underside of the whale. These grooves are less numerous (usually 14–22) than in other rorquals but are fairly wide.[13]

The stubby dorsal fin is visible soon after the blow when the whale surfaces, but disappears by the time the flukes emerge. Humpbacks have a 3 metres (9.8 ft), heart-shaped to bushy blow, or exhalation of water through the blowholes. Because humpback whales breathe voluntarily, the whales possibly shut off only half of their brains when sleeping.[14] Early whalers also noted blows from humpback adults to be 10–20 feet (3.0–6.1 m) high.

Newborn calves are roughly the length of their mother's head. At birth, calves measure 6 metres (20 ft) at 2 short tons (1.8 t) The mother, by comparison, is about 15 metres (49 ft). They nurse for approximately six months, then mix nursing and independent feeding for possibly six months more. Humpback milk is 50% fat and pink in color.

Females reach sexual maturity at the age of five, achieving full adult size a little later. Males reach sexual maturity at approximately seven years of age. Humpback whale lifespans range from 45–100 years.[15] Fully grown, the males average 13–14 m (43–46 ft). Females are slightly larger at 15–16 m (49–52 ft); one large recorded specimen was 19 metres (62 ft) long and had pectoral fins measuring 6 metres (20 ft) each.[16] The largest humpback on record, according to whaling records, was killed in the Caribbean. She was 27 metres (89 ft) long with a weight of 90 metric tons (99 short tons).[17] Body mass typically is in the range of 25–30 metric tons (28–33 short tons), with large specimens weighing over 40 metric tons (44 short tons).[18] The female has a hemispherical lobe about 15 centimetres (5.9 in) in diameter in its genital region. This visually distinguishes males and females.[13] The male's penis usually remains hidden in the genital slit.

Identifying individuals[edit]

The varying patterns on the tail flukes are sufficient to identify individuals. A study using data from 1973 to 1998 on whales in the North Atlantic gave researchers detailed information on gestation times, growth rates, and calving periods, as well as allowing more accurate population predictions by simulating the mark-release-recapture technique (Katona and Beard 1982). A photographic catalogue of all known North Atlantic whales was developed over this period and is currently maintained by College of the Atlantic.[19] Similar photographic identification projects have begun in the North Pacific by Structure of Populations, Levels of Abundance and Status of Humpbacks, and around the world.

Life history[edit]

Social structure[edit]

Photo of humpback in profile with most of its body out of the water, with back forming acute angle to water
Humpbacks frequently breach, throwing two-thirds or more of their bodies out of the water and splashing down on their backs.
A humpback in the waters of the Abrolhos Archipelago

The humpback social structure is loose-knit. Typically, individuals live alone or in small, transient groups that disband after a few hours. These whales are not excessively social in most cases. Groups may stay together a little longer in summer to forage and feed cooperatively. Longer-term relationships between pairs or small groups, lasting months or even years, have rarely been observed. Some females possibly retain bonds created via cooperative feeding for a lifetime. The humpback's range overlaps considerably with other whale and dolphin species—for instance, the minke whale. However, humpbacks rarely interact socially with them, though one individual was observed playing with a bottlenose dolphin in Hawaiian waters.[20]

Courtship and reproduction[edit]

Courtship rituals take place during the winter months, following migration toward the equator from summer feeding grounds closer to the poles. Competition is usually fierce, and unrelated males, dubbed escorts by researcher Louis Herman, frequently trail females, as well as mother-calf dyads. Male gather into "competitive groups" and fight for females.[21] Group size ebbs and flows as unsuccessful males retreat and others arrive to try their luck. Behaviors include breaching, spyhopping, lob-tailing, tail-slapping, fin-slapping, peduncle throws, charging and parrying. Whale songs are assumed to have an important role in mate selection; however, they may also be used between males to establish dominance.[22]

Females typically breed every two or three years. The gestation period is 11.5 months, yet some individuals have been known to breed in two consecutive years. The peak months for birth are January, February, July, and August, with usually a one- to two–year period between humpback births. Recent research on humpback mitochondrial DNA reveals groups living in proximity to each other may represent distinct breeding pools.[23]

Interspecies interactions[edit]

Humpbacks, known to be a friendly species, often interact with other cetacean species such as bottlenose dolphins. Right whales are often seen to interact with humpbacks[24] and these behaviors have been recorded in all oceans. A record of a Humpback and a Southern right demonstrating what was thought to be a mating behaviors was documented off the Mozambique coast.[25] Humpback whales are also known to appear in mixed groups with other species, such as the blue whale, fin whale, minke whale, gray whale, and sperm whale.[26] There is even an observation of a group of killer whales attempting to help an injured humpback whale off New Zealand coast.[27]

Song[edit]

Main article: Whale sound
Spectrogram of humpback whale vocalizations: Detail is shown for the first 24 seconds of the 37-second recording "Singing Humpbacks". The ethereal whale "songs" and echolocation "clicks" are visible as horizontal striations and vertical sweeps, respectively.[citation needed]
Recording of Humpback Whales singing and Clicking.

Problems playing this file? See media help.

Both male and female humpback whales vocalize, but only males produce the long, loud, complex "songs" for which the species is famous. Each song consists of several sounds in a low register, varying in amplitude and frequency, and typically lasting from 10 to 20 minutes.[28] Humpbacks may sing continuously for more than 24 hours. Cetaceans have no vocal cords, so whales generate their songs by forcing air through their massive nasal cavities.

Whales within a large area sing the same song. All North Atlantic humpbacks sing the same song, and those of the North Pacific sing a different song. Each population's song changes slowly over a period of years without repeating.[28]

Scientists are unsure of the purpose of whale songs. Only males sing, suggesting one purpose is to attract females. However, many of the whales observed to approach a singer are other males, often resulting in conflict. Singing may, therefore, be a challenge to other males.[29] Some scientists have hypothesized the song may serve an echolocative function.[30] During the feeding season, humpbacks make altogether different vocalizations for herding fish into their bubble nets.[31]

Humpback whales have also been found to make a range of other social sounds to communicate, such as "grunts", "groans", "thwops", "snorts" and "barks".[32]

Ecology[edit]

Photo of two whales, one lies on its back with fins outstretched above the surface
Humpback swimming on its back in Antarctica

Feeding and predation[edit]

Photo of several whales each with only its head visible above the surface
A group of 15 whales bubble net fishing near Juneau, Alaska
Humpback whale lunging in the center of a bubble net spiral.
A whale off Australia on the spring migration, feeding on krill by turning on its side and propelling through the krill

Humpbacks feed primarily in summer and live off fat reserves during winter.[33] They feed only rarely and opportunistically in their wintering waters. The humpback is an energetic hunter, taking krill and small schooling fish such as Atlantic herring, Atlantic salmon, capelin, and American sand lance, as well as Atlantic mackerel, pollock, and haddock in the North Atlantic.[34][35][36] Krill and copepods have been recorded as prey species in Australian and Antarctic waters.[37] Humpbacks hunt by direct attack or by stunning prey by hitting the water with pectoral fins or flukes.

A humpback straining water through its baleen after lunging.

The humpback has the most diverse feeding repertoire of all baleen whales.[38] Its most inventive technique is known as bubble net feeding; a group of whales swims in a shrinking circle blowing bubbles below a school of prey. The shrinking ring of bubbles encircles the school and confines it in an ever-smaller cylinder. This ring can begin at up to 30 metres (98 ft) in diameter and involve the cooperation of a dozen animals. Using a crittercam attached to a whale's back, researchers found that some whales blow the bubbles, some dive deeper to drive fish toward the surface, and others herd prey into the net by vocalizing.[39] The whales then suddenly swim upward through the "net", mouths agape, swallowing thousands of fish in one gulp. Plated grooves in the whale's mouth allow the creature to easily drain all the water initially taken in.

A study published in the April 26, 2013 issue of Science documents a new form of bubble-net feeding called lobtail feeding among a population of whales in the Northern Atlantic Ocean. This technique involves the whale slapping the surface of the ocean with his tail between one and four times before creating the bubble net.[40] Using network-based diffusion analysis, the authors argue that the whales in this group learned the behavior socially from other whales in the group over a period of 27 years in response to a change in the primary form of prey.[41]

Given scarring records, killer whales are thought to prey upon juvenile humpbacks, though this has never been witnessed. The result of these attacks is generally nothing more serious than some scarring of the skin, but young calves likely are sometimes killed.[42]

Range and habitat[edit]

Humpbacks inhabit all major oceans, in a wide band running from the Antarctic ice edge to 77° N latitude, though not in the eastern Mediterranean or the Baltic Sea. They are migratory, spending summers in cooler, high-latitude waters and mating and calving in tropical and subtropical waters.[28] An exception to this rule is a population in the Arabian Sea, which remains in these tropical waters year-round.[28] Annual migrations of up to 25,000 kilometres (16,000 mi) are typical, making it one of the mammals' best-traveled species.

A large population spreads across the Hawaiian Islands every winter, ranging from the island of Hawaii in the south to Kure Atoll in the north.[43] A 2007 study identified seven individuals wintering off the Pacific coast of Costa Rica as having traveled from the Antarctic—around 8,300 kilometres (5,200 mi). Identified by their unique tail patterns, these animals made the longest documented mammalian migration.[44] In Australia, two main migratory populations have been identified, off the west and east coasts, respectively. These two populations are distinct, with only a few females in each generation crossing between the two groups.[45]

In Panama and Costa Rica, Humpback whales come from both the Southern hemisphere, July-October with over 2,000 whales, and the Northern hemisphere, December-March with about 300 whales to breed and give birth.[46]

South Pacific populations migrating thorough off mainland New Zealand, Kermadec Islands and Tasmania are increasing, but in slower speeds than in Australian waters because of illegal whaling by Soviet Union in the 1970s.

Some re-colonizing wintering habitats are confirmed in Asia; various areas in Philippines such as in Babuyan Islands and Pasaleng Bay, Ryukyu Islands, the Volcano Islands, Northern Mariana Islands, and so on. As the populations recover, concerns of entanglements and ship strikes are increasing such as off Japanese coasts where whales began to migrate off Japanese archipelagos and into Sea of Japan. Connections between these stocks and whales seen in Sea of Okhotsk, on Kamchatka coasts, and around Commander Islands have been studied.[47]

Whales historically migrated to Chinese and Taiwanese waters around Guangdong coasts such as off Daya Bay, Hong Kong and Leizhou Peninsula to Hainan Island were possibly wiped out by Japanese whalers that established various whaling stations in China and on Korean Peninsula among with other species such as Gray Whales and North Pacific Right Whales. Whales in Korean and Chinese waters were wiped out by Japanese whalers similar to many other species such as Blue, Fin, and Gray whales.

Whaling[edit]

Main article: Whaling

Humpback whales were hunted as early as the 18th century, but distinguished by whalers as early as the first decades of the 17th century. By the 19th century, many nations (the United States in particular), were hunting the animal heavily in the Atlantic Ocean, and to a lesser extent in the Indian and Pacific Oceans. The late-19th-century introduction of the explosive harpoon, though, allowed whalers to accelerate their take. This, along with hunting in the Antarctic Ocean beginning in 1904, sharply reduced whale populations. During the 20th century, over 200,000 humpbacks were estimated to have been taken, reducing the global population by over 90%, with North Atlantic populations estimated to have dropped to as low as 700 individuals.[48] In 1946, the International Whaling Commission was founded to oversee the whaling industry. They imposed rules and regulations for hunting whales and set open and closed hunting seasons. To prevent extinction, the International Whaling Commission banned commercial humpback whaling in 1966. By then, the population had been reduced to around 5,000.[49] That ban is still in force.

Prior to commercial whaling, populations could have reached 125,000. North Pacific kills alone are estimated at 28,000.[10] The full toll is much higher. It is now known that the Soviet Union was deliberately under-recording its catches; the Soviet catch was reported at 2,820, whereas the true number is now believed to be over 48,000.[50]

As of 2004, hunting of humpback whales was restricted to a few animals each year off the Caribbean island Bequia in the nation of St. Vincent and the Grenadines.[38] The take is not believed to threaten the local population. Japan had planned to kill 50 humpbacks in the 2007/08 season under its JARPA II research program, starting in November 2007. The announcement sparked global protests.[51] After a visit to Tokyo by the chairman of the IWC, asking the Japanese for their co-operation in sorting out the differences between pro- and antiwhaling nations on the Commission, the Japanese whaling fleet agreed no humpback whales would be caught for the two years it would take for the IWC to reach a formal agreement.[52]

In 2010, the International Whaling Commission authorized Greenland's native population to hunt a few humpback whales for the next three years.[53]

Conservation[edit]

Photo of beached whale with observers in background
A dead humpback washed up near Big Sur, California
Humpback whale species in Uramba Bahía Málaga National Natural Park, in Colombia, considered the favorite place for whales to give birth to their young, making it a tourist destination

The worldwide population is at least 80,000 humpback whales, with 18,000–20,000 in the North Pacific,[54] about 12,000 in the North Atlantic,[55] and over 50,000 in the Southern Hemisphere,[56] down from a prewhaling population of 125,000.[10]

In August 2008, the IUCN changed humpback's status from Vulnerable to Least Concern, although two subpopulations remain endangered.[57] The United States is considering listing separate humpback populations, so smaller groups, such as North Pacific humpbacks, which are estimated to number 18,000–20,000 animals, might be delisted. This is made difficult by humpback's extraordinary migrations, which can extend the 5,157 miles (8,299 km) from Antarctica to Costa Rica.[23] In Costa Rica, the Ballena Marine National Park is specially designed for protections of humpbacks.

This species is considered "least concern" from a conservation standpoint, as of 2008. This is an improvement from vulnerable in 1996 and endangered as recently as 1988. Most monitored stocks of humpback whales have rebounded well since the end of commercial whaling,[2][58] such as the North Atlantic, where stocks are now believed to be approaching levels similar to those before hunting began. However, the species is considered endangered in some countries, including the United States.[59][60]

Although much was learned about humpbacks from whaling, migratory patterns and social interactions were not well understood until two studies by R. Chittleborough and W. H. Dawbin in the 1960s.[61] Roger Payne and Scott McVay made further studies of the species in 1971.[62] Their analysis of whale songs led to worldwide media interest and convinced the public that whales were highly intelligent, aiding the antiwhaling advocates.

The Calambokidis et al. 2001 report provided the "first quantitative assessment of the migratory structure of humpback whales in the entire North Pacific basin."[63]

The United States initiated a status review of the species on August 12, 2009, and is seeking public comment on potential changes to the species listing under the Endangered Species Act.[64] Areas where population data are limited and the species may be at higher risk include the Arabian Sea, the western North Pacific Ocean, the west coast of Africa and parts of Oceania.[2]

The U. S. Department of Commerce's commissioned 2008 report entitled "SPLASH: Structure of Populations, Levels of Abundance and Status of Humpback Whales in the North Pacific," noted that there are many challenges to determining the recovery of the previously over-harvested population of the Humpback Whale (North Pacific) because of the lack of accurate abundance estimates, the unexpected complexity of the structure of whale populations and their migratory movements between feeding and wintering areas. According to the 2008 SPLASH report, which was based on data collected between 2004 to 2006, there were between about 18,302 Humpback Whales in the entire North Pacific (Splash 2008:2-3).[65] The SPLASH estimate is consistent with a moderate rate of recovery for a depleted population (SPLASH 2008:3) although it also considered to be a "dramatic increase in abundance" from other postwhaling period estimates" (post-1960s. In comparison to the estimate of 9,819 in the Calambokidis et al. 1997 report[66] covering the period 1991-1993 this represents a four percent increase in population from 1993 to 2006 (SPLASH 2008:3).[65]

Off the west coast of Canada, the Gwaii Haanas National Marine Conservation Area Reserve which covers 3,400 square kilometres, is "a primary feeding habitat" of the Humpback Whale (North Pacific population) protected by Canada’s Species at Risk Act (SARA).[67] Humpback Whale's critical habitat off the coast of British Columbia overlaps with tankers shipping route between Canada and its eastern trade partners.[67] In 2005 the Humpback Whale (North Pacific population) was listed as threatened under Canada’s Species at Risk Act (SARA). In April 19, 2014 the Department of the Environment recommended an amendment to (SARA) to downgrade the status of the Humpback Whale off the coast of British Columbia from “threatened” to “species of special concern.”[68] According to Committee on the Status of Endangered Wildlife in Canada (COSEWIC), the Humpback Whale (North Pacific population) has been increasing at about four per cent each year from 1992 to 2008. Although socio-economic costs and benefits were considered in their decision to downgrade the status of the whales, according to the University of British Columbia’s North Pacific Universities Marine Mammal Research Consortium's research director, the decision was based on biology not politics.[67]

The United Kingdom, among other countries, designated the humpback as a priority species under the national Biodiversity Action Plan. The sanctuary provided by US National Parks, such as Glacier Bay National Park and Preserve and Cape Hatteras National Seashore, among others, have also become major factors in sustaining populations.[69]

Today, individuals are vulnerable to collisions with ships, entanglement in fishing gear, and noise pollution.[2] Like other cetaceans, humpbacks can be injured by excessive noise. In the 19th century, two humpback whales were found dead near sites of repeated oceanic sub-bottom blasting, with traumatic injuries and fractures in the ears.[70]

Saxitoxin, a paralytic shellfish poisoning from contaminated mackerel has been implicated in humpback whale deaths.[71]

Whale-watching[edit]

Main article: Whale watching
Humpback breaching near coast

Humpback whales are generally curious about objects in their environments. Some individuals, referred to as "friendlies", approach whale-watching boats closely, often staying under or near the boat for many minutes. Because humpbacks are often easily approachable, curious, easily identifiable as individuals, and display many behaviors, they have become the mainstay of whale-watching tourism in many locations around the world. Hawaii has used the concept of "ecotourism" to use the species without killing them. This whale-watching business brings in a revenue of $20 million per year for the state's economy.[72]


North AtlanticNorth PacificSouthern Hemisphere
SummerNew England, Nova Scotia and Newfoundland, the northern St. Lawrence River, the Snaefellsnes peninsula in the west of IcelandCalifornia, Alaska, Oregon, Washington, British ColumbiaAntarctica, Bahía Solano and Nuquí in Colombia, Isla Iguana in Panama.
WinterSamaná Province of the Dominican Republic, the Bay of Biscay France, Mona Passage off the coast of Puerto RicoHawaii, Baja, the Bahía de Banderas off Puerto VallartaSydney, Byron Bay north of Sydney, Hervey Bay north of Brisbane, North and East of Cape Town, New Zealand, the Tongan islands, Victor Harbor and outlying beaches

Famous humpbacks[edit]

The Tay whale[edit]

Professor John Struthers about to dissect the Tay whale, Dundee, photographed by George Washington Wilson in 1884

In December 1883, a male humpback swam up the Firth of Tay in Scotland, past what was then the whaling port of Dundee. The whale was exhibited to the public by a local entrepreneur, John Woods, both locally and then as a touring exhibition which travelled to Edinburgh and London. The whale was dissected by professor John Struthers, who wrote seven papers on its anatomy, and then in 1889, a monograph on the humpback.[73][74][75][76]

Migaloo[edit]

"Migaloo" redirects here. For other uses, see Migaloo (disambiguation).

An albino humpback whale that travels up and down the east coast of Australia became famous in the local media on account of its extremely rare, all-white appearance. Migaloo is the only known all-white humpback whale [77] and is known to be a true albino.[78] First sighted in 1991, and believed to be three to five years old at that time, Migaloo was named for an indigenous Australian word for "white fella". Migaloo was shown to be male in 2004 by analysis of sloughed skin samples. Because of the intense interest, environmentalists feared he was becoming distressed by the number of boats following him each day. In response, the Queensland and New South Wales governments introduce legislation each year to create a 500 m (1600-ft) exclusion zone around the whale.

Humphrey[edit]

Main article: Humphrey the Whale

Humphrey the Whale was twice rescued by The Marine Mammal Center and other concerned groups in California.[79][80] In 1985, Humphrey swam into San Francisco Bay and then up the Sacramento River towards Rio Vista.[81] Five years later, Humphrey returned and became stuck on a mudflat in San Francisco Bay immediately north of Sierra Point below the view of onlookers from the upper floors of the Dakin Building. He was pulled off the mudflat with a large cargo net and the help of the Coast Guard. Both times, he was successfully guided back to the Pacific Ocean using a "sound net" in which people in a flotilla of boats made unpleasant noises behind the whale by banging on steel pipes, a Japanese fishing technique known as oikami. At the same time, the attractive sounds of humpback whales preparing to feed were broadcast from a boat headed towards the open ocean.[82] After leaving San Francisco Bay in 1990, Humphrey was seen only once, at the Farallon Islands in 1991.

Media[edit]

Recorded by the National Park Service, using a hydrophone that is anchored near the mouth of Glacier Bay, Alaska for the purpose of monitoring ambient noise.

Also recorded by the National Park Service, as above.


Problems playing these files? See media help.

In popular media[edit]

The 1986 science fiction film Star Trek IV: The Voyage Home features the humpback whale as a major plot element.

See also[edit]

Footnotes[edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). "Megaptera novaeangliae". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 18 January 2013. 
  3. ^ Gingerich P (2004). "Whale Evolution" (PDF). McGraw-Hill Yearbook of Science & Technology. The McGraw Hill Companies. 
  4. ^ Arnason, U., Gullberg A. & Widegren, B. (September 1, 1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and lution 10 (5): 960–970. PMID 8412655. Retrieved 2009-01-25. 
  5. ^ Sasaki, T. et al. (March 4, 2011). "Mitochondrial Phylogenetics and Evolution of Mysticete Whales". Systematic Biology 54 (1): 77–90. doi:10.1080/10635150590905939. PMID 15805012. Retrieved 2011-06-06. 
  6. ^ a b Martin S (2011). The Whales' Journey. Allen & Unwin Pty., Limited. p. 251. ISBN 1-86508-232-5. 
  7. ^ Liddell & Scott (2011). Greek-English Lexicon, Abridged Edition. Oxford University Press, Oxford, UK. ISBN 0-19-910207-4. 
  8. ^ "Humpback whale subspecies revealed by genetic study". Science Daily. May 20, 2014. Retrieved May 20, 2014. 
  9. ^ Tina Ghose (May 22, 2014). "Oceans Apart: 3 Humpback Whale Subspecies Identified". Discovery News. Retrieved May 22, 2014. 
  10. ^ a b c Recovery Plan for the Humpback Whale (Megapten Novaeangliae) (PDF). National Oceanic and Atmospheric Administration. 1991. Retrieved 2011-06-30. 
  11. ^ Katona S.K. and Whitehead, H.P. (1981). "Identifying humpback whales using their mural markings". Polar Record (20): 439–444. 
  12. ^ Kaufman G., Smultea M.A. and Forestell P. (1987). "Use of lateral body pigmentation patterns for photo ID of east Australian (Area V) humpback whales". Cetus 7 (1): 5–13. 
  13. ^ a b c Chapham, Phillip J.; Mead, James G. (1999). "Megaptera novaeangliae". Mammalian Species 604: 1–9. doi:10.2307/3504352. [dead link]
  14. ^ O. I. Lyamin, L. M. Mukhametov, J. M. Siegel, P. R. Manger, and O. V. Shpak (2001). "Resting behavior in a rehabilitating gray whale calf" (pdf). Aquatic Mammals 27.3: 256–266. 
  15. ^ Dawes 2008, p.291
  16. ^ Clapham 2002, p.589–592
  17. ^ https://www.vallarta-adventures.com/tours/whale-watching-photo-safari/whale-watching-guide
  18. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  19. ^ Williamson JM (2005). "Whalenet Data Search". Wheelock College. Retrieved 2007-04-03. 
  20. ^ Deakos, Mark H. et al. (2010). "Two Unusual Interactions Between a Bottlenose Dolphin (Tursiops truncatus) and a Humpback Whale (Megaptera novaeangliae) in Hawaiian Waters". Aquatic Mammals 36 (2): 121–28. doi:10.1578/AM.36.2.2010.121. 
  21. ^ Clapham, Phillip J. (2008). "Humpback Whale Megaptera novaeangliae". In Perrin, William F.; Würsig, Bernd; Thewissen, J.G.M. Encyclopedia of Marine Mammals (2nd ed.). pp. 582–84. ISBN 012373553X. 
  22. ^ Darling, J. et al (2006). "Humpback whale songs: Do they organize males during the breeding season?". Behavior 143: 1051–1101. doi:10.1163/156853906778607381. 
  23. ^ a b Hotz, Robert Lee (November 6, 2009). "Whale Watch: Endangered Designation In Danger". The Wall Street Journal. Retrieved November 8, 2009. 
  24. ^ http://www.coastalstudies.org/what-we-do/right-whales/fieldnotes.htm. retrieved on 13-05-2014
  25. ^ BANKS A., BEST P., GULLAN A., GUISSAMULO A., COCKCROFT V., FINDLAY K., Recent sightings of southern right whales in Mozambique.. http://dolphincare.org/Research_files/Banks%20S11-RW17.pdf. retrieved on 13-05-2014
  26. ^ Shiretoko Nature Cruise. http://www.e-shiretoko.com/news013.html. retrieved on 13-05-2014
  27. ^ https://www.facebook.com/photo.php?fbid=10151162607338780&set=pb.646703779.-2207520000.1366202223.&type=3&src=http%3A%2F%2Fsphotos-b.xx.fbcdn.net%2Fhphotos-snc6%2F178158_10151162607338780_1568585691_o.jpg&smallsrc=http%3A%2F%2Fsphotos-b.xx.fbcdn.net%2Fhphotos-ash4%2F196101_10151162607338780_1568585691_n.jpg&size=1569%2C887. retrieved on 13-05-2014
  28. ^ a b c d "American Cetacean Society Fact Sheet". American Cetacean Society. Retrieved 2007-04-17. 
  29. ^ "Humpback Whales. Song of the Sea.". Public Broadcasting Station. Retrieved 2007-04-22. 
  30. ^ Mercado E III & Frazer LN (July 2001). "Humpback Whale Song or Humpback Whale Sonar? A Reply to Au et al" (PDF). IEEE Journal of Oceanic Engineering 26 (3): 406–415. doi:10.1109/48.946514. Retrieved 3 April 2007. 
  31. ^ Mercado E III, Herman LM & Pack AA (2003). "Stereotypical sound patterns in humpback whale songs: Usage and function" (PDF). Aquatic Mammals 29 (1): 37–52. doi:10.1578/016754203101024068. Retrieved 3 April 2007. 
  32. ^ Cecilia Burke, ''A whale's varied vocabulary', Australian Geographic, AG Online. Retrieved August 7, 2010.
  33. ^ Encyclopedia of Life & Peter Saundry. 2011. Humpback whale. eds. C.Michael Hogan and C.J.Cleveland, Encyclopedia of Earth, National Council for Science and Environment, Washington, DC
  34. ^ Overholtz W.J. and Nicholas J.R. (1979). "Apparent feeding by the fin whale, Balaenoptera physalus, and humpback whale, Megaptera novaeangliae, on the American sand lance, Ammodytes americanus, in the Northwest Atlantic". Fish. Bull. (77): 285–287. 
  35. ^ Whitehead H. (1987). "Updated status of the humpback whale, Megaptera novaeangliae, in Canada". Canadian Field-Naturalist 101 (2): 284–294. 
  36. ^ Meyer T.L., Cooper R.A. and Langton R.W. (1979). "Relative abundance, behavior and food habits of the American sand lance (Ammodytes americanus) from the Gulf of Maine". Fish. Bull 77 (1): 243–253. 
  37. ^ Nemoto T. (1959). "Food of baleen whales with reference to whale movements". Scientific Reports of the Whales Research Institute (14): 149–290. 
  38. ^ a b Prepared by the Humpback Whale Recovery Team for the National Marine Fisheries Service, Silver Spring, Maryland (1991). Recovery Plan for the Humpback Whale (Megaptera novaeangliae). National Marine Fisheries Service. p. 105. 
  39. ^ Acklin, Deb (2005-08-05). "Crittercam Reveals Secrets of the Marine World". National Geographic News. Retrieved 2007-11-01. 
  40. ^ Allen, Jenny; Weinrich, Mason; Hoppitt, Will; Rendell, Luke (26 April 2013). "Network-Based Diffusion Analysis Reveals Cultural Transmission of Lobtail Feeding in Humpback Whales". Science 340 (6131): 485–188. doi:10.1126/science.1231976. 
  41. ^ Lee, Jane J. (April 25, 2013). "Do Whales Have Culture? Humpbacks Pass on Behavior". National Geographic. Retrieved 30 April 2013. 
  42. ^ Clapham, P.J. (1996). "The social and reproductive biology of humpback whales: an ecological perspective" (PDF). Mammal New studies (Ferrari, Mizroch, et al.) show first year calf mortality is 18-20%. Mortality beyond the first year is still being studied. Review 26 (26): 27–49. doi:10.1111/j.1365-2907.1996.tb00145.x. Retrieved 2007-04-26. 
  43. ^ Lammers, Marc O.; Fisher-Pool, Pollyanna I.; Au, Whitlow W. L.; Meyer, Carl G.; Wong, Kevin B.; Brainard, Russell E. (February 1, 2011). "Humpback whale Megaptera novaeangliae song reveals wintering activity in the Northwestern Hawaiian Islands". Marine Ecology Progress Series 423: 261–268. doi:10.3354/meps08959. 
  44. ^ Rasmussen K, Palacios DM, Calambokidis J, Saborío MT, Dalla Rosa L, Secchi ER, Steiger GH, Allen JM, & Stone GS (2007). "Southern Hemisphere humpback whales wintering off Central America: insights from water temperature into the longest mammalian migration". Biology Letters 3 (10.1098/rsbl.2007.0067): 302. doi:10.1098/rsbl.2007.0067. ISSN 1744-957X. 
  45. ^ "Megaptera novaeangliae in Species Profile and Threats Database". Australian Government: Department of the Environment and Water Resources. 2007. Retrieved 2007-04-17. 
  46. ^ http://www.whalewatchingpanama.com/panama.html
  47. ^ Silberg J., Acebes J., Burdin M.A., Mamaev G.E., Dolan C.K., Layusa A.C., Aca Q.E., 2013. "New insight into migration patterns of western North Pacific humpback whales between Babuyan Islands, Philippines and the Commander Islands, Russia". Journal of Cetacean Research and Management 13(1): 53-57. ResearchGate. Retrieved on 2014-08-19
  48. ^ Breiwick JM, Mitchell E, Reeves RR (1983) Simulated population trajectories for northwest Atlantic humpback whales 1865–1980. Fifth biennial Conference on Biology of Marine Mammals, Boston Abstract. p14
  49. ^ Baker, CS; Perry, A; Bannister, JL; Weinrich, MT; Abernethy, RB; Calambokidis, J; Lien, J; Lambertsen, RH; Ramírez, JU (September 1993). "Abundant mitochondrial DNA variation and world-wide population structure in humpback whales" (PDF). Proceedings of the National Academy of Sciences 90 (17): 8239–8243. doi:10.1073/pnas.90.17.8239. PMC 47324. PMID 8367488. Retrieved 2009-01-12. "Before protection by international agreement in 1966, the world-wide population of humpback whales had been reduced by hunting to <5000, with some regional subpopulations reduced to <200..." 
  50. ^ Prof. Alexey V. Yablokov (1997). "On the Soviet Whaling Falsification, 1947–1972". Whales Alive! (Cetacean Society International) 6 (4). 
  51. ^ scoop.co.nz: Leave Humpback Whales Alone Message To Japan 16 May 2007
  52. ^ Hogg, Chris (2007-12-21). "Japan changes track on whaling". BBC News. Retrieved 2010-01-05. 
  53. ^ "Greenland: Humpback Whales Are Deemed Eligible For Hunting". The New York Times. 26 June 2010. p. 7. 
  54. ^ "Humpbacks Make a Splash in the N. Pacific". Wildwhales.org. 2008-05-23. Retrieved 2011-06-07. 
  55. ^ "NOAA SARS Humpback whales, North Atlantic". Nmfs.noaa.gov. 2008-04-01. Retrieved 2011-06-07. 
  56. ^ "Humpback whale abundance south of 60°S from three complete circumpolar sets of surveys" (PDF). Retrieved 2011-06-07. 
  57. ^ "Humpback whale on road to recovery, reveals IUCN Red List". IUCN. 2008-08-12. Retrieved 2008-08-12. 
  58. ^ "Study: Humpback whale population is rising". 2008-05-23. Retrieved 2008-05-23. 
  59. ^ "US National Marine Fisheries Service humpback whale web page". Nmfs.noaa.gov. Retrieved 2010-12-21. 
  60. ^ "Humpback Whale (Megaptera novaeangliae)". Division of Wildlife Conservation, Alaska Department of Fish and Game. 2006. Retrieved 2008-02-10. 
  61. ^ Chittleborough, RG. (1965). "Dynamics of two populations of the humpback whale". Australian Journal of Marine and Freshwater Research 16: 33–128. doi:10.1071/MF9650033. 
  62. ^ Payne, RS; McVay, S. (1971). "Songs of humpback whales". Science 173 (3997): 585–597. doi:10.1126/science.173.3997.585. PMID 17833100. 
  63. ^ John Calambokidis et al. (October 2001). "Movements and population structure of humpback whales in the North Pacific". Marine Mammal Science 17 (4): 769–794. doi:10.1111/j.1748-7692.2001.tb01298.x. Retrieved April 23, 2014. 
  64. ^ "Initiation of a Status Review for the Humpback Whale". Edocket.access.gpo.gov. Retrieved 2010-12-21. 
  65. ^ a b "SPLASH: Structure of Populations, Levels of Abundance and Status of Humpback Whales in the North Pacific" (PDF), Cascadia Research, Final report for Contract commissioned by U.S. Department of Commerce, May 2008, retrieved 22 April 2014 
  66. ^ John Calambokidis et al. (1997), Abundance and population structure of humpback whales in the North Pacific basin. Final Contract Report 50ABNF500113 to Southwest Fisheries Science Center, La Jolla, CA, p. 72 
  67. ^ a b c Chung, Emily (April 22, 2014), Humpback whale losing 'threatened' status amid Northern Gateway concerns, CBC 
  68. ^ Order Amending Schedule 1 to the Species at Risk Act 148 (16), Canada: The Gazette, April 19, 2014, retrieved April 23, 2014 
  69. ^ "Humpback Whale (Megaptera novaeangliae)". National Parks Conservation Association. Retrieved 2007-04-19. 
  70. ^ Ketten, D. R.; Lien, J.; Todd, J. (1993). "Blast injury in humpback whale ears: Evidence and implications". Journal of the Acoustical Society of America 94 (3): 1849–50. doi:10.1121/1.407688. 
  71. ^ Dierauf L & Gulland F (2001). Marine Mammal Medicine. CRC Press. ISBN 0-8493-0839-9. 
  72. ^ "Whale Watching in Hawai`i". Office of National Marine Sanctuaries. Retrieved 6 August 2012. 
  73. ^ "Professor Struthers and the Tay Whale". Retrieved 2008-06-19. 
  74. ^ Williams, M. J. (1996). "Professor Struthers and the Tay whale". Scottish Medical Journal 41 (3): 92–94. PMID 8807706.  edit
  75. ^ Pennington, C. The modernisation of medical teaching at Aberdeen in the nineteenth century. Aberdeen University Press, 1994.
  76. ^ John Struthers. Memoir on the Anatomy of the Humpback Whale, Megaptera Longimana, 1889.
  77. ^ "Exclusion zone for special whale". BBC News. 2009-06-30. Retrieved 2009-06-30. 
  78. ^ doi:10.1093/jhered/esr108
  79. ^ Tokuda W (1992) Humphrey the lost whale, Heian Intl Publishing Company. ISBN 0-89346-346-9
  80. ^ Callenbach E & Leefeldt C Humphrey the Wayward Whale, ISBN 0-930588-23-1
  81. ^ Jane Kay, San Francisco Examiner Monday, 9 October 1995
  82. ^ Toni Knapp, The Six Bridges of Humphrey the Whale. Illustrated by Craig Brown. Roberts Rinehart, 1993 (1989)

References[edit]

Books[edit]

  • Clapham, Phil. (1996). Humpback Whales. ISBN 0-948661-87-9
  • Clapham, Phil (2002). "Humpback Whale". Encyclopedia of Marine Mammals. San Diego: Academic Press. ISBN 0-12-551340-2. 
  • Dawbin, W. H. The seasonal migratory cycle of humpback whales. In K.S. Norris (ed), Whales, Dolphins and Porpoises. University of California Press.
  • Dawes, John; Campbell, Andrew (2008). Exploring the World of Aquatic Life. Infobase Publishing. ISBN 978-1-60413-255-7. Retrieved 2011-01-08. 
  • Evans, Peter G. H., and Juan Antonio. Raga. Marine Mammals: Biology and Conservation. New York: Kluwer Academic/Plenum, 2001. Print.
  • Reeves, Stewart, Clapham and Powell. (2002) National Audubon Society Guide to Marine Mammals of the World. Knopf. ISBN 0-375-41141-0
  • Struthers, John (1889). Memoir on the Anatomy of the Humpback Whale, Megaptera Longimana. Edinburgh: Maclachlan. 

Journal articles[edit]

  • Best, P. B. (1993). "Increase rates in severely depleted stocks of baleen whales". ICES Journal of Marine Science 50 (2): 169–186. doi:10.1006/jmsc.1993.1018. 
  • Smith, T.D.; Allen, J.; Clapham, P.J.; Hammond, P.S.; Katona, S.; Larsen, F.; Lien, J.; Mattila, D.; Palsboll, P.J. et al.; Sigurjonsson, J.; Stevick, P. T.; Oien, N. (1999). "An ocean-basin-wide mark-recapture study of the North Atlantic humpback whale". Marine Mammal Science 15: 1–32. doi:10.1111/j.1748-7692.1999.tb00779.x. 
  • Franklin, T.; Franklin, W.; Brooks, L.; Harrison, P.; Baverstock, P.; Clapham, P. (2011). "Seasonal changes in pod characteristics of eastern Australian humpback whales (Megaptera novaeangliae), Hervey Bay 1992–2005". Marine Mammal Science 27 (3): E134–E152. doi:10.1111/j.1748-7692.2010.00430.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Clapham et al. (1993) reported that available evidence supports the hypothesis that the western North Atlantic population can be considered a single panmictic population; individuals from different high-latitude feeding areas intermix in the breeding range. However, Allen et al. (1994) found that "regional differences in fluke pigmentation suggest that the western North Atlantic population includes a number of relatively isolated subunits, as suggested previously by photoidentification and DNA studies."

Within Mexico, whales wintering off the Revillagigedo Islands are weakly but significantly differentiated genetically from those along the American Pacific coast (Medrano-Gonzalez et al. 1995).

MtDNA data indicate that several distinctive stocks exist in the Southern Hemisphere, with a low level of gene flow among them; also, shared identical nucleotypes occur in the Northern and Southern hemispheres (Baker et al. 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!