Humpback Whales have been recorded across most of the South Pacific, although densities vary from large numbers in East Australia to very low numbers in Fiji (in E3) and parts of French Polynesia. They are regularly found around island groups but also in open water away from islands. Humpbacks have been recorded throughout the southern ocean, including south to the ice edge and in the RossSea.

Little is known regarding life history parameters for the Oceania subpopulation of Humpback Whales, although it is assumed that these rates are similar to those described from whaling records in Australia and New Zealand (Dawbin 1956, 1964, 1966; Chittleborough 1965). One rate that has been preliminarily investigated in the region is calving interval, which is approximately 2-3 years (consistent with that reported from other oceans). The diet of these Humpback Whales consists mainly of krill, which they consume while in Antarctic waters. They are not known to feed while in tropical breeding grounds.

With few exceptions, such as the Arabian Sea population, humpback whales undertake long migrations between breeding grounds in tropical coastal waters in winter to feeding grounds in middle and high latitudes, mainly in continental shelf waters (Clapham 2002).

In the Southern Hemisphere, humpbacks appear to feed mainly in the Antarctic, where the diet consists almost exclusively of krill (Euphausia superba) (Mackintosh 1970), although some feeding in the Benguela Current ecosystem on the migration route west of South Africa has been observed (Best et al. 1995; suspected prey species are: E. lucens and Themisto gaudichaudii).

Limited data on diet in other areas is available. Humpback whales caught off Newfoundland and Labrador in the 1950s and 1960s were found to be consuming mainly capelin (Mallotus villotus) (Mitchell 1973). Those caught off California in the early 20th century were eating mainly euphausiids and sardines (Clapham et al. 1997). In areas of Alaska and the North Atlantic, humpback whales have also been observed feeding co-operatively on schools of herring (Clupea harengus), sand lance (Ammodytes spp.) and (more rarely) mackerel (Scomber scombrus), by herding the school together with bubble nets, clouds or curtains (Hain et al. 1982).

The timing of acquisition of tooth rake marks attributable to killer whales (Orcinus orca) indicates that humpback whale calves, but usually not subadults and adults, are subject to predation by this species (Mehta et al. 2005).

The southwest monsoon system in the Arabian Sea drives one of the five largest upwelling systems in the world (Burkill 1999). During the peak monsoon months of July and August sea-surface temperatures drop to 16-17˚C (Sheppard et al. 1992, Wilson 2000). High nutrient levels in the upwelling systems result in phytoplankton blooms and high productivity, with highest levels recorded on the Arabian Sea coast of Oman (Savidge et al. 1990). This productivity is believed to supply the food that permits whales to reside year-round in the tropical Arabian Sea (Reeves et al. 1991, Papastavrou and Van Waerebeek 1997).

Sightings of humpback whales off Oman include observations of defecation and feeding (Minton et al. in press). Over 50% of 190 whales examined in the November 1966 Soviet catch had full or half-full stomachs. Euphausiids, of unknown species, were the primary prey item in the northeastern part of the Arabian Sea, while small fish from the Scomber and Sardinella families were more prominent off the coast of Oman (Mikhalev 2000).

Get, store, or distribute resources > Capture, absorb, or filter > Organisms 

Maintain community > Cooperate and compete > Within the same species 

Maintain community > Coordinate > Activities 

Move or stay put > Move > In/on liquids 

Move or stay put > Move > In/on liquids 

GBMA0167-06|AP006467|Megaptera novaeangliae| AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATATTTATTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATTCGCGCTGAGCTAGGTCAGCCTGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTATTAGTAACAGCCCATGCCTTCGTGATAATTTTCTTCATGGTTATACCTATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATA---ATTGGAGCACCTGACATAGCTTTTCCTCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCTTATTATTAATAGCATCCTCAATGGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTATATCCCCCCTTAGCCGGAAACCTAGCACATGCAGGAGCTTCAGTTGACCTT---ACCATCTTCTCCCTACACCTAGCCGGCGTGTCCTCAATCCTCGGGGCTATCAACTTCATCACAACCATTATTAACATAAAACCACCTGCCATGACCCAATATCAGACCCCTCTTTTCGTATGATCAGTCCTAGTCACAGCAGTATTACTCCTACTATCATTACCCGTTTTAGCAGCC---GGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCGGGTGGAGGAGACCCAATTCTGTACCAACACCTATTCTGATTCTTTGGCCACCCTGAAGTATACATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCCTTCGGCTATATAGGAATAGTCTGAGCCATGGTATCCATTGGGTTCTTAGGTTTTATCGTATGGGCCCACCATATATTTACAGTAGGTATAG 
-- end --

Red List Category

Red List Criteria

Version

2008

Childerhouse, S., Jackson, J., Baker, C.S., Gales, N., Clapham, P.J. & Brownell Jr., R.L.

Reeves, R.R., Reilly, S.B., Rosenbaum, H. & Taylor, B.L. (Cetacean Red List Authority)

Justification

Red List Category

Red List Criteria

Year Assessed

Assessor/s

Reviewer/s

Contributor/s

Red List Category

Red List Criteria

Version

2008

Minton, G., Collins, T., Pomilla, C., Findlay, K.P., Rosenbaum, H., Baldwin, R. & Brownell Jr., R.L.

Clapham, P.J., Baker, C.S. & Taylor, B.L. (Cetacean Red List Authority)

Justification

The following population estimates are available:

(i) SPWRC (2006) provided a preliminary mark-recapture estimate from photo-identification of the combined population size for E2 (New Caledonia), E3 (Tonga) and F (French Polynesia) of 3,827 (CV = 0.12) for the period 1999-2004. There are no estimates of rate of increase available for this area but it was noted that there was little indication of trend in abundance over the survey period (SPWRC 2006).

(ii) Noad et al. (2006) estimated from land-based sighting surveys that population size of E1 (Eastern Australia) was 7,090 (95% CI ± 660) for 2004 with an annual rate of increase of 10.6 (95% CI ± 0.5%) for 1987 – 2004.

The IWC is presently engaged in a Comprehensive Assessment of Southern Hemisphere humpback whales, and research on the South Pacific breeding stocks of E1, E2, E3, and F is ongoing. The IWC (2006) Comprehensive Assessment of Southern Hemisphere Humpback workshop in 2006 agreed that, “the situation for Breeding Stocks E and F is complex and currently unresolved, and therefore that it was not possible to construct stock structure hypotheses for assessment modelling, particularly with respect to the assignment to Breeding Stocks of catches taken on the feeding grounds”.

For example, while east Australia and New Caledonia (E1 and E2) are within the longitudinal boundaries of Antarctic Area V, and French Polynesia and the Cook Islands (F) are within the longitudinal boundaries of Area VI, Tonga (E3) falls close to the boundary between the two Areas. Thus, in the current assessment, the approach of pooling demographically independent sub-stocks was necessary for practical reasons to develop catch allocation scenarios. However, this approach is likely to be conservative in ignoring potential differences in variable rates of recovery from the regional impacts of whaling. Soviet whaling on the Antarctic feeding grounds in the early sixties was extremely intense, with over 27,300 whales taken during two summers (1959-1961) alone. Maternal site fidelity together with a hunt concentrated both in time and space may have resulted in more extreme declines in some of the far-flung wintering sub-stocks of the Southwestern Pacific.

Jackson et al. (2006) explored a number of catch allocation scenarios for the combined sub-stocks of Oceania and east Australia. In their combined assessment of sub-stocks E1, E2, E3 and F, median population recovery toward historical levels in 2005 was estimated at between 15.9-24.8% (95% probability intervals (PI) 11.1-30.5%; prior population growth rate mean = 6.7% after Branch et al. (2004)). The most appropriate interpolation between these two recovery estimates depended on the degree of interchange between east Australia and Oceania (15.9% is complete interchange, 24.8% is no interchange). Recent photo-identification surveys (Garrigue et al. 2007) indicate that interchange between these regions is relatively low, suggesting that the ‘no interchange’ scenario may be more appropriate for the region. Under this interchange scenario, estimated abundance in 1942 was 41,356 (95% PI 36,800-53,580). Recovery level of the population three generations later (in 2005) is 26.6% (95% PI 18.2-33.5%) relative to 1942. This is using an estimate of 21.5 years/generation (Taylor et al. 2007).

Unknown

The humpback whale is better studied than other balaenopterid species, and migratory destinations are well known for some subpopulations.

North Atlantic
A comprehensive assessment of North Atlantic humpback whales was completed by the IWC Scientific Committee in 2002, from which most of the information below is drawn (IWC 2002, 2003).

There is a distinct but relatively small winter aggregation in the east around the Cape Verde Islands ? the site of fairly extensive 19th century Yankee whaling (Reeves et al. 2002). The major present-day North Atlantic breeding and calving area in the West Indies extends from Cuba in the west down the island chain as far as Venezuela; the largest breeding aggregations occur on Silver and Navidad Banks near the Dominican Republic, with much lower concentrations in Samana Bay (Dominican Republic), off the northwest coast of Puerto Rico, and around the Virgin Islands and the eastern Antilles. Some humpback whales have also been sighted in high-latitude waters during the winter, indicating that not all individuals migrate to the southern wintering grounds every year.

Six distinct feeding aggregations have been identified: Gulf of Maine, Gulf of St Lawrence, Newfoundland/Labrador, West Greenland, Iceland, North Norway (including Bear Island and Jan Mayen). Genetic and photo-identification data indicate that the six feeding aggregations represent relatively discrete subpopulations, fidelity to which is determined matrilineally. However, because whales from different feeding grounds all mix in a common breeding area in the West Indies, there is male-mediated nuclear gene flow between the subpopulations.

The best available abundance estimate for the West Indies group of breeding aggregations is 10,752 in 1992-93 (CV 0.068) with an estimated annual rate of increase of 3.1% (SE 0.5%) (Stevick et al. 2003). There is no estimate of abundance for the Cape Verde Islands breeding aggregation, but to date a total of 72 individuals have been identified there (J. Allen pers. comm. 2007). As of 2007, only one photographic match has been made from the Cape Verde Islands to a feeding ground (off Iceland), but the matching exercise is only partially complete.

Animals from the West Indies breeding area are found in all six known feeding aggregations. However, genetic evidence suggests that part of the Icelandic and Norwegian feeding aggregations consists of whales that winter outside the West Indies. Though some of these likely migrate to the Cape Verde Islands, the population found there in winter is too small relative to the number of animals thought to be breeding somewhere other than the West Indies, and at present the identity of this additional breeding area (or areas) remains unresolved.

Higher rates of increase have been estimated in some feeding areas (e.g. 6.5% for the Gulf of Maine; Barlow and Clapham 1997).

Humpbacks were heavily exploited in the past by pre-modern whaling in their breeding grounds in both the West Indies and the Cape Verde Islands, and by modern whaling in their feeding grounds, especially off Iceland and Norway in the late 19th and early 20th centuries. Catches by pre-modern whaling are estimated primarily from logbook and trade records. Catches by early modern whaling also need to be estimated because most of the catch records during the first few decades were not divided by species.

Catches in the West Indies (including Bermuda) are documented from 1664 to the present day, but the main period was 1826-1928, during which about 8,600 whales were estimated to have been killed. Whaling in the Cape Verde Islands occurred primarily during 1850-1912 with a total estimated kill of about 3,000 animals. An estimated 3,200 were taken from Iceland and 2,000 from northern Norway during 1880-1916. About 1,500 humpback whales are reported killed in the North Atlantic since 1916, from a variety of areas including the British Isles, Faeroes, Norway, Iceland, Greenland, and eastern Canada, as well as Norwegian pelagic catches.

Population modeling exercises show that the recent abundance and increase rate of humpback whales in the North Atlantic are too large to represent a recovery from depletion by the estimated past kills. This suggests that either:
(i) past kills have been substantially underestimated; or
(ii) there has been some increase in the environmental carrying capacity for humpback whales; or
(iii) whaling had a negative impact on the population, over and above the effects of the actual removals, in ways that are not understood; or
(iv) some combination of the above factors.

Whichever of the above hypotheses pertain, the increase rate of 3% per annum implies that humpbacks are considerably more abundant in the North Atlantic today than they were in 1940. This is consistent with anecdotal evidence of the relatively low numbers observed prior to 1960.

North Pacific
The following subpopulations have been identified (Calambokidis et al. 2001, 2008):
Eastern North Pacific. Winters off the coast of Mexico (Baja California, Gulf of California, mainland) and summers off the coasts of California, Oregon, and Washington.
Central North Pacific. Winters in the central North Pacific and Hawaiian Islands; summers in Alaska (Prince William Sound) and British Columbia.
Western North Pacific. Winters in the western North Pacific, in the Bonin Islands, Ryukyu Islands and the Philippines, and possibly in other island areas in the southwestern North Pacific; summers off Kamchatka, in the Bering Sea and along the Aleutian Islands, west of the Kodiak Archipelago.

There are two additional subpopulations, one that winters off Central America and summers off California, the other that winters around the Revillagigedo Islands and summers in unknown areas but possibly in the Bering Sea or near the Aleutian Islands (Urbán et al. 2000)

Some interchange of individuals between the known North Pacific breeding grounds has been documented (Calambokidis et al. 2001, 2008).

Abundance: Eastern North Pacific. Recent information is summarized in the NOAA stock assessment report (Anon. 2005a). The abundance of humpbacks was estimated from shipboard line transect surveys in the waters of California, Oregon and Washington during 1996-2001 to be 1,314 (CV 0.30) animals. Mark-recapture from photo-identification in the same area yielded an estimate of 1,391 whales in 2002/03, with an increase of about 8% per year over the period 1991-2003. Mark-recapture from photo-identification in the Mexican Pacific yielded an estimate of 1,813 (CI: 918-2505) for the Mainland Mexico and Baja California subpopulation, and 914 (CI: 590-1193) for the Revillagigedo subpopulation (Urbán et al. 1999). The recently completed SPLASH (Structure of Populations, Levels of Abundance and Status of Humpback Whales in the North Pacific) project resulted in estimates by various methods of ~1,400-1,700 for the California-Oregon feeding area and ~6,000-7,000 for the Mexican wintering areas (Calambokidis et al. 2008).

Abundance: Central North Pacific. Based on mark-recapture analysis of photo-identification data in the Hawaiian wintering ground, the abundance was estimated at 4,005 (CV 0.095) whales in 1993 (Calambokidis et al. 1997). Older mark-recapture estimates for this stock exist, but their lack of comparability renders their use for estimating an increase rate questionable. Aerial surveys designed to be comparable across years yielded a trend estimate of 7% per year from 1993-2000 (Angliss and Outlaw 2005). SPLASH yielded wintering estimates for the Hawaii wintering ground by various methods of 7,120-10,425 (Calambokidis et al. 2008).

Summer feeding areas for this stock have been identified in Prince William Sound (Alaska), southeastern Alaska and off British Columbia, but the abundance estimates for the known feeding grounds total only about 2,000 (Angliss and Outlaw 2005a). This suggests that more feeding areas are yet to be found. In view of their current high abundance in the Hawaiian Islands, the sparseness of historical accounts of humpback whales in Hawaii prior to the 20th century is surprising. It may be a relatively new wintering ground (Herman 1979). The SPLASH estimates for the combined Southeast Alaska and British Columbia feeding areas are around 3,000-5,000 (Calambokidis et al. 2008)

Abundance: Western North Pacific. Abundance in 1991-93 was estimated at 394 (CV 0.084) from photo-identification data (Angliss and Outlaw 2005b). Humpback whale sightings from Japanese cetacean surveys in the western North Pacific, including those conducted in conjunction with the Japanese scientific whaling programme (JARPN), have not yet been analyzed to provide abundance estimates. The recent SPLASH survey covered the range more broadly and resulted in estimates by various methods of 938-1,107 (Calambokidis et al. 2008)

Humpback whales were severely depleted by whaling throughout the North Pacific until they were protected by the IWC from 1966 onwards. Illegal Soviet catches continued until 1971 (Doroshenko 2000). Humpbacks were taken by pre-modern whalers in Japan before the 20th century, but so far no series of catch estimates have been compiled for the pre-modern period. About 21,000 humpback whales are recorded caught by modern whaling in the North Pacific in the 20th century, of which about 14,000 were in the eastern North Pacific and 7,000 in the west (IWC 2006a). Included in these figures are about 2,500 humpbacks taken illegally by USSR fleets during 1961-65, that were concealed at the time, mainly in the Gulf of Alaska and the Bering Sea (Doroshenko 2000). In addition, nearly 20,000 unspecified whales were caught in the early 20th century, of which a substantial number probably were humpbacks. The latter were taken primarily in the eastern North Pacific, except that the locations of about 9,000 unspecified whales taken by American pelagic whalers during 1911-1919 have not yet been ascertained.

No comprehensive assessment of North Pacific humpback whales has been conducted by the IWC Scientific Committee. The evidence suggests that North Pacific humpback whales have been increasing, following depletion by whaling, but that this recovery is not yet complete. Given catches of nearly 7,500 during 1961-65, a minimum estimate for the 1960 population would be about 8,000, but the population level in 1940 was probably lower than today. A large-scale international collaboration (the SPLASH project) involving photo-identification and genetic sampling was conducted across the entire North Pacific in 2004-06. The results have been recently analyzed and yielded a best estimate for the entire North Pacific of 18,302 (average of estimates of 17,558 for wintering and 19,056 for summer feeding areas). A 4.9% annual increase is suggested for the period since 1991-93.

The low SPLASH population estimate for the western North Pacific subpopulation of around 1,000 is a cause for concern.

Northern Indian Ocean
A resident stock, which apparently does not migrate, is found in the Arabian Sea. Genetic differences, and the lack of photographic matches with other areas, suggest that this is an isolated subpopulation; in addition, analysis of illegal Soviet catch data from the 1960s indicates that this population has a distinctly boreal reproductive cycle (Mikhalev 1997). A population estimate of 56 animals (95% CI 35-255) from photo-identification data may be negatively biased due to incomplete coverage (IWC 2005). A total of 242 whales was taken illegally by Soviet whalers in 1965-66 (Mikhalev 1997).

Southern Hemisphere
A comprehensive assessment of Southern Hemisphere humpback whales by the IWC Scientific Committee is nearing completion (IWC 2005, 2006b, 2007). Traditionally the IWC managed humpback whale stocks on the basis of the six Antarctic Areas (I through VI) but the Scientific Committee now recognizes seven major breeding stocks, A through G, some of which are tentatively further subdivided into substocks.

The wintering grounds of these are:
A (Southwest Atlantic): coast of Brazil
B (Southeast Atlantic): the coast of West Africa from the Gulf of Guinea down to South Africa
C (southwestern Indian Ocean): coasts of eastern South Africa, Mozambique, Madagascar (southern, western and eastern coasts), Mayotte, the Comoros and other western Indian Ocean island groups;
D (southeastern Indian Ocean): northwestern Australia
E (southwest Pacific) northeastern Australia, New Caledonia, Tonga and Fiji.
F (central South Pacific): Cook Islands and French Polynesia
G (southeast Pacific): Ecuador, Galápagos, Colombia, Panama and Costa Rica.

Apart from stocks A and D, there is evidence of substructure within the stocks, with subunits that are spatially and genetically isolated to varying degrees.

The extent of mixing of the C stock wintering off the coasts of Mozambique (the C1 substock), Madagascar (the C3 substock) and the western Indian Ocean island groups (the C2 substock) remains unclear.

The structure of stocks E and F is particularly unclear: there appear to be at least six separate subpopulations (eastern Australia, New Caledonia, Fiji, Tonga, Cook Islands, and islands further east), and it is unclear how these should be grouped if at all.

The structure of stock B is also unclear: there appears to a northern substock (B1) wintering off the coast off Gabon, the Congos and Cabinda (Angola) and in the Bight of Benin, and a southern substock (B2) with a diffuse or ill-defined wintering area off southern Angola, Namibia, and western South Africa, although animals seen in the southern area may include those on migration to and from wintering grounds to the north. Feeding occurs in the Benguela Current area; this may include animals wintering there but also animals stopping to feed during their migration.

The winter distribution of the G stock extends into the Northern Hemisphere, and may overlap with the distribution of North Pacific stocks; several photo-id matches have been made between the Antarctic Peninsula and Central America, although whether there is temporal overlap between these whales and their northern conspecifics is unclear. Tourist observations of mother-calf pairs around the Galápagos during January to March, if confirmed, suggest that North Pacific animals may also use this area. Phylogenetic analyses (Baker et al. 1994) reveal that maternal lineages in the eastern Pacific cross between the Northern and Southern Hemisphere populations, such that there has been some interchange between the hemispheres, but not necessarily in recent times.

For most of the breeding stocks, recent estimates of abundance on their wintering grounds have been obtained from line-transect surveys and/or capture-recapture analyses using photo-identification data. For some stocks, direct estimates of the rate of increase are available from recent time-series of abundance data. The available estimates of recent abundance and trends for wintering grounds are listed in Table 1 (see attached PDF). The total estimate of 36,600 for the Southern Hemisphere is negatively biased, because no abundance estimate is available for stock F, and the estimate for stock B covers only part of the wintering range for a discrete period. Furthermore, it is possible that the entire population does not migrate to the wintering grounds, as evidenced by, for example, an apparent excess of males in winter censuses. Rate of increase estimates are available for five stocks, ranging from 4.6% p.a. to 10.5% p.a.

The abundance of humpback whales during summer in the Antarctic south of 60°S has also been estimated from data from the International Decade of Cetacean Research (IDCR) (later Southern Ocean Whale and Ecosystem Research, SOWER) programme surveys. A part of the Antarctic has been surveyed each year since 1978/79, yielding 3 sets of circumpolar surveys. The abundance estimates for each circumpolar survey are listed in Table 2 (see attached PDF). All three circumpolar estimates are probably underestimates of the hemispheric population, because not all humpback whales will have been south of 60°S during the surveys, and major summer concentration areas north of 60°S in the South Atlantic (to the east of South Georgia and in the vicinity of the South Sandwich Islands and around Bouvet Island) are not included.

The summer feeding areas of each stock cannot be delineated with much precision, but a combination of photo-identification, genetic, satellite tracking and old Discovery mark data suggest the following relationships: Breeding stock A (Brazil) feeds in the South Georgia/South Sandwich area in Area II (Zerbini et al. 2006); breeding stock D (W. Australia) feeds in Antarctic Area IV ands perhaps eastern Area III; breeding stock G (southeast Pacific) feeds along the Antarctic Peninsula and around the South Shetlands, and in the Magellan Strait; breeding stock E (eastern Australia and at least some island groups of western Oceania) feeds in Antarctic Area V. The feeding areas of the other stocks could not be delineated at this stage.

Humpback whale stocks were heavily depleted throughout most the Southern Hemisphere in the early 20th century by a combination of coastal catches in their wintering grounds and catches from land stations and by pelagic fleets in their Antarctic feeding grounds. Approximately 220,000 humpback whales were taken in total, of which about 100,000 since 1940; almost half of these latter consisted of illegal takes by the USSR (Zemsky et al. 1996, Allison 2006).

During 1908-1963, recorded catches outside the Antarctic (north of 40°S) have been: about 30,000 off the western coasts of southern Africa (primarily Gabon and Angola); nearly 20,000 off the eastern coasts of southern Africa (Natal, Mozambique and Madagascar) and in the western Indian Ocean; 28,000 off western Australia; about 15,000 off eastern Australia, New Zealand and southwest Pacific Islands; and about 2,000 each from the western and eastern coasts of South America. After 1904, a further approximately 27,000 whales were taken from land stations in South Georgia and over 12,000 from the South Shetlands. Pelagic whaling fleets operated during 1925-66, taking over 83,000 humpbacks. This includes more than 48,000 animals taken by the USSR, of which all but 2,710 were taken illegally (primarily from Areas IV and V); of this total, some 25,000 Soviet catches were taken in just two whaling seasons (1959/60 and 1960/61).

Due partly to the difficulties of assigning feeding areas, and hence past catches, to breeding stocks, the IWC Scientific Committee has completed population assessments only for stocks A, D, and G. The assessment of D was considered preliminary due to likely mixing in the feeding grounds with stock E and possibly other stocks.

The A stock (southwest Atlantic) is estimated to have been depleted rapidly from an initial level of 25,000 in 1904 to less than 2,000 in the 1920s, by catches from South Georgia land stations. Continued catches from South Georgia and pelagic fleets further depleted the stock to a few hundred animals by the mid-1960s when whaling ceased. The stock has recovered strongly since then to over 6,500 today.

The B stock (southeast Atlantic) was depleted by large catches in its wintering grounds off Gabon, Congo, Angola, Namibia and western South Africa, with open-boat whaling beginning in the 19th century and modern whaling beginning in 1909. Catches in Gabon and Congo were not continuous, but occurred in bursts as the stock(s) apparently began to recover between periods of intensive whaling. Nearly 30,000 humpbacks are recorded caught off the western coasts of sub-Saharan Africa during 1909-1960. The last large catches were made by Norwegian and French whalers off Gabon and São Tomé who took over 4,000 humpbacks during 1951-54. A final attempt at commercial exploitation in 1959 off Gabon caught just 160 whales.

After an initial burst of heavy catching off Mozambique and South Africa totalling nearly 8,000 whales during 1908-15, the C stock (southwest Indian Ocean) was subject to continuous but relatively low catches from Natal, South Africa between 1920 and 1962 and two discrete episodes (1937-39 and 1949-50) off Madagascar (Angot 1951). While catches off Natal remained relatively low after 1915, catches were far higher during the two episodes off Madagascar. Catches by pelagic expeditions in and outside the Antarctic probably also had an impact on this stock.

The D stock (southeast Indian Ocean) is estimated to have been reduced from a pre-whaling population of about 20,000 in 1910 to about half this level by 1940, mainly by catches from and off western Australia. Following a brief respite during WWII, the stock was further depleted (notably by illegal Soviet catches) to perhaps fewer than 1,000 animals by the mid-1960s, but recovered to about 10,000 by 1999. The current population size is very likely more than the 1940 level, and very likely more than half the pre-whaling level, subject to a caveat over the potential for mixing of stock D and other stocks in the feeding grounds (IWC 2007).

The E stock (eastern Australia/western Oceania) was heavily affected not only by catches totalling nearly 15,000 during 1909-62 from shore-station whaling in eastern Australia and elsewhere, but also by Soviet illegal pelagic catches of over 30,000, taken in Area V during the late 1950s and early 1960s.

The F stock (Oceania) was not subject to whaling in its wintering grounds but was probably affected by illegal Soviet catches in Areas V and VI. However, because the migratory destinations of this stock are unclear, assignment of these catches to the F stock has been difficult.

The G stock (southeast Pacific) is estimated to have been rapidly depleted from a pre-whaling level of about 10,000 animals in 1910 to a few hundred animals by the mid 1920s, mainly by catches from land stations on the South Shetland Islands. Pelagic catches in the putative feeding ground of this stock (Antarctic Area I) were relatively few, because of its distance from ports of approach, and because pelagic whaling was prohibited in Antarctic Areas I and VI (the then-Sanctuary) from 1935-55. The stock is estimated to have increased during 1925-55, but to have been knocked back down to the low hundreds by a new wave of pelagic catching that followed the opening of the Sanctuary in 1955. The stock is estimated to have increased since the end of humpback whaling in the mid-1960s, to its current level of about 4,000, which is well above the 1940s level but well below the pre-whaling level.

Generation time: 22 years (Taylor et al. 2007). The time window for applying the reduction criterion (A1) for a threatened category is 1941-2007.

Global population. All the new assessments of humpback whale stocks conducted by the IWC Scientific Committee to date indicate that the stocks concerned have recovered to levels at or above their 1940 level. Because the IWC Scientific Committee has not yet conducted assessments for the North Pacific and for four of the seven recognized Southern Hemisphere stocks, it is not yet possible to formally gauge the world population level relative to the 1940 level. However, given the increase rates observed in several of the unassessed North Pacific and Southern Hemisphere stocks (Table 1; see attached PDF), there is little reason to suppose that the world population is still below 50% of the 1940 level (the threshold for Vulnerable status under the reduction criterion)

Despite the encouraging global status, concern remains about apparently discrete and small subpopulations of humpback whales for which information about their status is lacking; these include the Arabian Sea (isolated from the southern Indian Ocean), the western North Pacific, and South Pacific subpopulations in portions of Oceania (breeding stocks E and F).

Increasing

Soviet whaling data, observations from merchant vessels and recent research (primarily along the coast of Oman) collectively include records from every month of the year and indicate that there is a resident population in the western Arabian Sea (Brown 1957, Slijper et al. 1964, Mikhalev 1997, Minton et al. in press). Re-sightings of photographically identified individuals off the coast of Oman in early autumn and late spring provide further evidence of year-round residency (Minton et al. in press).

Examination of stomach contents and fetuses from the 238 humpback whales taken during Soviet whaling operations in the Arabian Sea in 1965-66 indicated that both breeding and feeding were taking place off the coasts of Oman and Pakistan, consistent with a northern hemisphere cycle (Mikhalev 1997, Mikhalev 2000). A formal comparison of photo-identification catalogues from Oman, Madagascar, the ComorosIslands and Zanzibar yielded no photographic matches between Oman and any other region of the Indian Ocean. Fluke pigmentation pattern frequencies differed significantly between the Oman animals and those from other areas (Minton 2004, Minton et al. in press) and initial analysis of song indicates significant differences between Oman and other regions (C. Clark pers comm.).

Genetic analysis of tissues sampled from live and beach-cast humpback whales off the coast of Oman also provides evidence for a discrete Arabian Sea subpopulation. Although this subpopulation clearly originated from the larger Southern Hemisphere population, analyses of maternally inherited mitochondrial (mt) DNA and nuclear microsatellites confirm genetic differentiation from Southern Hemisphere populations including Madagascar, the Comoros Islands and Mozambique, and lack of current exchange with these neighbouring areas (Pomilla et al. 2006, Rosenbaum et al. 2006). These conclusions were reached with the congruent support of several analytical approaches including: searches for shared or private haplotypes, measures of population differentiation (F-statistics), Bayesian individual clustering and maximum likelihood estimates of migration rates. These results are even more striking in light of the fact that similar levels of distinctiveness have not been shown elsewhere in the Southern Hemisphere (Pomilla et al. 2006, Rosenbaum et al. 2006, Olavarria et al. 2007).

Of 85 sexually mature females examined in the Soviet catch, 39 (45.9%) were pregnant, and the size range (140-375c m, mean 232 cm) of 36 examined fetuses indicated calving commencing in December, with a peak in February. Mikhalev (2000) suggested a 3-4 month mating season lasting from January to May, coincident with that of other Northern Hemisphere populations. Females with calves have been observed on the Arabian Sea coast of Oman between the months of November and February, with recent observations of likely neonates limited to the HalaniyatIslands in February 2000 (Minton et al. in press).

Mark-recapture studies using three different pairings of tail fluke photographs collected in Oman in two main research areas over a period of four and a half years yielded a population estimate of 82 individuals (95% CI 60-111). However, sample sizes are small, and there are various sources of possible negative bias, including insufficient spatial and temporal coverage of the population’s suspected range (Minton et. al. in press).

Unknown

Although commercial whaling seriously depleted all humpback populations, the species has demonstrated remarkable resilience, and most populations have increased since the end of whaling, although there are several populations that remain small and for which no increase has yet been detected, such as the population in the Arabian Sea, the population breeding near South Pacific islands, and the western North Pacific population. Humpback whales have been protected from commercial whaling worldwide since 1966, and there have been few catches since 1968.

Today, small numbers only are taken by a 'subsistence' whaling operation off St Vincent (1-2 animals per year); it is possible that other small unreported catches occur elsewhere.

The government of Japan announced plans to resume humpback whaling in the Antarctic from the 2007/08 season, starting with an experimental catch of 50 animals per year under scientific permit (Government of Japan 2005). The impact of these catches on small unrecovered stocks of humpbacks in Oceania that feed in the whaling grounds of Area V is not clear.

Also, in humpback habitat off the coasts of Brazil, Gabon, Angola, Mozambique and Madagascar (Breeding Stocks A, B, and C), there is a great deal of ongoing and planned offshore oil and gas development, with potential impacts.

Humpback whales are subject to entanglements, often fatal, in fishing gear. They are also vulnerable to injury by ship strikes, which can also be fatal. The documentation of such incidents is best for US waters. For the Atlantic coasts of the US during 1999-2003, there were 19 reports of death or serious injury caused by entanglements and 7 cases of death or serious injury due to ship strikes (Anon. 2005b). For US Pacific waters (mainly Alaska) during 1999-2001 there were 13 reports of deaths and serious injuries due to entanglement and 3 reports of deaths due to ship strikes (Anon. 2005a).

Japanese Annual Progress Reports submitted to the IWC during 2003-06 listed 3-5 humpback whales caught annually in fishing gear, mainly coastal trap nets (Miyashita and Kato 2006).

In most areas, the observed increases in humpback whale abundance in recent times implies that human-caused mortality is not sufficient to threaten the populations concerned. However, the situation should be kept under review for populations that are still small and for which no increase has been detected, such as the in western North Pacific and parts of Oceania.

Although Humpback Whales have been legally protected from commercial whaling since 1966, they can still be killed for the purposes of scientific research under Article VIII of the International Convention for the Regulation of Whaling. The IWC’s Southern Ocean Whale Sanctuary (e.g. the northern boundary of this Sanctuary follows the 40°S parallel of latitude except in the Indian Ocean sector where it joins the southern boundary of that sanctuary at 55°S, and around South America and into the South Pacific where the boundary is at 60°S) provides an additional layer of protection to Humpback Whales while on their summer feeding grounds in Antarctica, although whales inside the Sanctuary can still be killed under Article VIII.

At present, more than 12 million km² of EEZs of more than a dozen South Pacific countries and territories have been designated as whale sanctuaries. This provides protection from commercial whaling for Humpback Whales in some of their breeding areas. Most recently an MoU under the CMS convention has been designed to protect cetaceans and their habitats in the South Pacific. It has already been signed by several countries and territories.

New Zealand and Australia have active disentanglement programmes to release any Humpback Whales captured in fishing gear.

Humpbacks have been protected from commercial whaling in the North Atlantic by the IWC since 1955, in the Southern Hemisphere since 1963 (although spatial and temporal regulation of catches in the Antarctic occurred prior to this), and in the North Pacific since 1966. The last substantial catches occurred in 1968. Despite having been severely depleted to a world population in the low thousands at that time, humpbacks have since recovered strongly to a world population that is estimated at over 60,000 animals and is increasing.

Humpback whales enjoy additional protective measures, such as sanctuaries, in a number of countries. The species is listed in Appendix I of both CITES and CMS.

Humpback whales have been legally protected from commercial whaling in the southern hemisphere since 1963, and the Arabian Sea region has always been a closed area to commercial whaling under the International Convention for the Regulation of Whaling. However, humpback whales were taken from the region illegally by Soviet pelagic operations in 1965 and 1966. The hunting of any cetacean species is prohibited by law in Oman. At the species level, the humpback whale is listed in Appendix I of both CITES and CMS. The Arabian Sea is also part of the International Whaling Commission’s Indian Ocean Sanctuary.

The potential for successful conservation of humpback whales in the region is considered to be high, provided that range state governments are made aware of this population’s precarious status. The countries of the Arabian region are generally affluent and in a good position to implement marine conservation measures for humpback whales in addition to those already initiated for other taxa, such as sea turtles. A coordinated series of marine protected areas, combined with species-specific protection measures, could greatly enhance the long-term prospects for humpback whales in the region.