Articles on this page are available in 1 other language: Spanish (30) (learn more)

Overview

Brief Summary

Description

"As far as we know, the blue whale is the largest animal ever to have existed on the planet. Weights up to 190,000 kg (as much as 30-40 African elephants) have been recorded. They are also among the fastest swimmers, reaching a speed of 48 km per hour when chased. They eat 6-7 tons of krill, a small, shrimp-like crustacean, per day, by gulp-feeding. With each gulp, the whale's throat stretches along a series of grooves, enlarging the mouth’s capacity, then the water is expelled and the krill remain, trapped by baleen plates. The blue whale's voice is the deepest of any animal's, and their vocalizations carry for thousands of miles underwater, at frequencies below the range of human hearing. This may enable them to communicate across oceans, and may be a sonar-like imaging system that helps a whale map its location relative to distant landmasses or deep underwater terrain. They can live for 80-90 years, and for centuries, blues whale were safe from humans because of their sheer size, but whalers on modern ships armed with harpoon guns drove them almost to extinction. They are protected now, but there is no sign yet that they are recovering from over-exploitation."

Links:
Mammal Species of the World
Visit ARKive for more images of the blue whale  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:76, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 2 people

Average rating: 4.0 of 5

Biology

Blue whales usually occur alone or in groups numbering between two and three individuals, but occasionally large groups of up to 60 individuals may form in areas of high food abundance (7). They feed mainly on shrimp-like krill, which are filtered through the baleen plates (7). Whales tend to feed at less than 100 metres deep, and make dives lasting between 5 and 20 minutes (7). Most blue whales are thought to spend the summer feeding in the colder waters of high latitudes, migrating to warm waters in the winter where females give birth (5); although some may be resident in the same area year round (2). No feeding occurs on the breeding grounds. The two main populations (north and south) remain separated as the seasons are reversed in the two hemispheres. A single calf is produced after a gestation period of 10 to 11 months. The inter-birth period is probably two to three years, although this may have decreased recently in response to the low population densities (7). At birth, a calf measures about 7 m in length (2) and may consume up to 50 gallons of milk a day in its first year of life, leading to a weight gain of 90 kilograms a day (6). Communication seems to occur via a variety of low frequency sounds and clicks (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Brief Prehistory of Blue Whales

Whales evolved from land living animals around 45 million years ago. Around 25 million years ago, some whales evolved into shapes a little like modern whales. Blue Whales might have been hunted by giant sharks, like Megalodon. The prehistory of Blue Whales is not yet fully know'n, and future discoveries will prove the actual story.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: floluk floluk

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 The blue whale Balaenoptera musculus is a baleen whale and can be recognised as such by the plates of baleen (rather than teeth) suspended from the upper jaw and the two blowholes on the upper body. The blue whale is slender bodied and, being the largest whale species, can reach up to 33 m in length. It is a member of the rorqual family with the characteristic ventral pleats of skin under the eye and the relatively flat and broad jaw. The ventral pleats extend beyond the navel. The small flippers are less than one-fifth of the body length. It has only one prominent ridge on the snout. The head is broad and U-shaped, and the head colouration is symmetrical. The dorsal fin is very small and set far back on the body. The blue whale has a mottled dorsal and lateral colouration with white under the flippers.The blue whale can be confused with the fin whale Balaenoptera physalus but is recognised by its broad and U-shaped head, a very small dorsal fin that is set far back on the body, and symmetrical head colouration. Blue whales are usually found alone or in pairs, although in feeding areas up to a dozen have been seen together. It rarely breeches, and when diving, it will often show the tail flukes. Dives may last up to 30 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The blue whale is the largest animal to have ever lived, almost as big as a Boeing 737 (4), and even larger than the biggest dinosaurs (3). The skin is greyish blue in colour (5) with a mottled effect visible in some lights that can allow individuals to be identified (6). The underside, especially of whales living in polar waters, often has a yellowish tinge caused by microscopic algae (diatoms), and between 55 and 88 throat grooves run from under the chin to the navel (2). The blow (or spout) of this species is the biggest amongst all whales; the slender upright column of air can rise to nine meters (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The blue whale is a cosmopolitan species, found in all oceans except the Arctic, but absent from some regional seas such as the Mediterranean, Okhotsk and Bering seas.

The Antarctic form B. m. intermedia, which used to be by far the most abundant form of blue whale, occurs in the Antarctic in summer, from the Antarctic Polar Front up to and into the ice (Branch et al. 2006), including (in the past) the South Georgia area. Its winter distribution is poorly known, but the presumption has been that animals migrate in winter to lower latitudes, largely because blue whales were caught off Namibia, South Africa and Chile in winter (Best 1998, Mackintosh 1965).

Pygmy blue whales (B. m. brevicauda) are confined mainly to the area north of 55°S even in summer, but with one record at 56°15?S (Ichihara 1966). They are most abundant in the southern Indian Ocean on the Madagascar plateau, and off South Australia and Western Australia, where they form part of a more or less continuous distribution from Tasmania to Indonesia. Blue whales are found year round in the northern and equatorial Indian Ocean, especially around Sri Lanka, and the Maldives, and at least seasonally near the Seychelles and in the Gulf of Aden.

Blue whales occur in the eastern Pacific from around 44°S in southern Chile (Hucke-Gaete et al. 2005) as far as the Costa Rica Dome where they are present year-round (Reilly and Thayer 1990). There may be a gap from there to Baja California where they are quite common as also off the Californian coast (Calambokidis and Barlow 2004) but tracking of a tagged whale suggests that some of the Californian whales may migrate to the Costa Rica Dome in winter (Mate et al. 1999). North of 40°N, blue whales occur across the North Pacific from the coast of Oregon to the Kurile Islands (Russian Federation), and north to the Aleutian Islands (US -Alaska) but not far into the Bering Sea. In the past blue whales were caught off southern Japan and the Korean peninsula, but none have been seen there in recent years.

In the North Atlantic the summer distribution of blue whales extends in the west from the Scotian Shelf to the Davis Strait (Canada) (NMFS 1998). Blue whales occur in the Denmark Strait, around Iceland and north to the ice edge, and in the northeast to Svalbard (Norway). Historically, blue whales were commonly caught along the coasts of North and West Norway, the Faeroes and the NW British Isles. They also occur in low numbers off NW Spain (Bérubé and Aguilar 1998) and in the past near the Strait of Gibraltar, but not in the Mediterranean (Reeves and Notarbartolo di Sciara 2006). The winter distribution is poorly known but it appears that in the past blue whales were widely distributed in the southern half of the North Atlantic in winter (Reeves et al. 2004).

McDonald et al. (2006) use song to suggest nine different groupings of blue whales. They argue that because song is used in mating, that these different song types, five of which have data spanning over 30 years and showing stability, should form the basis for population structure hypotheses. Although some of the geographic locations correspond to IWC stocks, for example the northern Indian Ocean, others do not. Thus, the population structure in this account likely underestimates the true number of discreet groups of blue whales.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Blue whales are found in all oceans of the world, from the tropics to the drift ice of polar waters.

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore, Maryland, USA: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Found in all oceans of the world. Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Belgian Exclusive Economic Zone, Comores, European waters (ERMS scope), Gulf of St. Lawrence, Icelandic Exclusive Economic Zone, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Occurs throughout the world's oceans. Three major breeding groups: North Pacific, North Atlantic, and Antarctic; perhaps a separate breeding population in the Indian Ocean. Seen with some regularity in deep coastal canyons off central and southern California, far inside the Gulf of St. Lawrence, and in the Denmark Strait. See IUCN (1991) for further details. For all practical purposes the Northern Hemisphere and Southern Hemisphere stocks do not mix (IUCN 1991). Subspecies BREVICAUDA (pygmy blue whale) is known mainly from subantarctic waters of the Indian Ocean and southeast Atlantic; reported also from other areas such as the northern Indian Ocean and off western South America.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the Atlantic, Pacific, Arctic and Indian Oceans, with a range that extends from the periphery of drift-ice in polar seas to the tropics (5). Three main populations persist: one in the southern hemisphere, one in the North Pacific and one in the North Atlantic (4). It is thought that less than 5,000 individuals remain (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Blue whales are slate to grayish blue and mottled with lighter spots, particularly on the back and shoulders. The undersides often become covered with microorganisms, giving the belly a yellowish tinge. Because of this blue whales are sometimes called "sulphurbottoms". The dorsal fin is short, only about 35 cm. The upper jaw is the widest in the genus, and the rostrum is the bluntest. There are 50-90 throat grooves that extend from the chin to just beyond the navel.

Blue whales are the largest animals ever to exist on earth. Average head-body length in adult males is 25 m; in females it is 27 m. The longest confirmed specimen was 33.5 m in length and the heaviest was 190,000 kg.

Range mass: 190000 (high) kg.

Average mass: 190000 kg.

Range length: 33.5 (high) m.

Average length: 25-27 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Females are larger than males.

Length:
Range: "22-28 m "

Weight:
Range: 64,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 3050 cm

Weight: 1.36E8 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: colour slate blue to grayish blue and mottled with lighter spots, particularly on the back and shoulders. Underside often covered with microorganisms, giving the belly a yellowish tinge. dorsal fin short, only about 35 cm, and placed far back on the body. Upper jaw is the widest in the genus, and the rostrum is the bluntest. There are 50-90 throat grooves that extend from the chin to just beyond the navel. Average length is adult males is 25 m and females is 27m. Largest animal in the world.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Differs from the fin whale in the mottled blue-gray body coloration, symmetrical lower lip coloration, broader U-shaped rather than V-shaped snout, baleen that is black rather than gray to white, and the smaller dorsal fin that is located farther toward the posterior. Differs from the sei whale in the much shorter dorsal fin that is located much farther toward the posterior (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Blue whales feed almost exclusively on euphausiids (krill), with a variety of species being taken by different blue whale populations, such as Euphausia superba in the Antarctic, Nyctiphanes australis off southern Australia (Gill 2002), Euphausia recurva off Western Australia (J. Bannister pers. comm. 2007) and Nyctiphanes simplex off the Galápagos (Palacios 1999). They feed both at the surface and also at depth, following the diurnal vertical migrations of their prey to at least 100 m (Sears 2002).

The migration patterns of blue whales are not well understood, but appear to be highly diverse. Some populations appear to be resident year-round in habitats of year-round high productivity, while others undertake long migrations to high-latitude feeding grounds (see above), but the extent of migrations and the components of the populations that undertake them are poorly known.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Blue whales live in the open ocean.

Habitat Regions: temperate ; tropical ; polar ; saltwater or marine

Aquatic Biomes: pelagic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

mostly offshore but also near the coast
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9212 specimens in 2 taxa.
Water temperature and chemistry ranges based on 2555 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.706 - 29.103
  Nitrate (umol/L): 0.026 - 30.079
  Salinity (PPS): 30.381 - 36.829
  Oxygen (ml/l): 4.556 - 8.213
  Phosphate (umol/l): 0.133 - 2.073
  Silicate (umol/l): 0.856 - 72.178

Graphical representation

Temperature range (°C): -1.706 - 29.103

Nitrate (umol/L): 0.026 - 30.079

Salinity (PPS): 30.381 - 36.829

Oxygen (ml/l): 4.556 - 8.213

Phosphate (umol/l): 0.133 - 2.073

Silicate (umol/l): 0.856 - 72.178
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Mainly pelagic; generally prefers cold waters and open seas, but young are born in warmer waters of lower latitudes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The blue whale is an open ocean whale, not often seen near the coast in north-west Europe. It can be found at the surface or diving down to 150 metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The blue whale inhabits the open ocean, where it is found most frequently along the continental shelf edge and near polar ice (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Most migrate to high latitude feeding areas for summer, return to lower latitude breeding areas for winter. For example, those that summer off Alaska winter off southern California and Baja California (IUCN 1991). There may be a basically resident or short distance migratory population off California and Baja California. Of individuals tagged off southern California, where apparently they were feeding or foraging, one moved to waters off northern California and four moved southward to Baja California, two passing Cabo San Lucas and one of these moving an additional 3000 km to near the Costa Rican Dome (an upwelling feature), which may be a calving/breeding area (Mate et al. 1999). Data on vocalizations support the idea that blue whales off North America and in the eastern tropical Pacific represent a single stock (Stafford et al. 1999). Hydrophone recordings suggest possible winter and late summer migrations off Oahu (Hawaii) (Thompson and Friedl 1982).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of blue whales is principally krill. In southern waters the main species eaten is Euphausia superba, a small (less than 7 cm) planktonic crustacean that is tremendously abundant. In northern waters the main species are Thysanoessa inermis and Meganyctiphanes norvegica, though other planktonic species and small fish are also eaten. Adult whales can ingest 3 to 4 tons of krill per day.

Animal Foods: aquatic crustaceans; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats primarily krill. Feeding occurs primarily in high latitude waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Blue whales, and other large baleen whales, are important predators of krill.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Blue whales, by virtue of their extreme size, have virtually no natural predators. They were hunted by humans extensively in the 20th century, almost to extinction. Blue whale calves may be vulnerable to predation by orcas and large sharks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Balaenoptera musculus preys on:
non-insect arthropods
zooplankton
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: Unknown

Comments: Unknown; difficult to define element occurrences.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Rough estimate of the world-wide population is 15,000 individuals (10,000 in the southern hemisphere, including 5,000 pygmy blue whales; 3,500 in the North Pacific; and 800-1,400 in the North Atlantic (see Mate et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually solitary or in pairs or threes; may congregate in good feeding areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Blue whales have the lowest voices of any whale, vocalizing as low as 14 Hz at volumes up to 200 decibels. Sounds at this frequency and intensity can travel for thousands of miles in the deep ocean. These sounds may be used to communicate with other whales. Low frequency pulses may be used to navigate by creating a sonic image of distant oceanic features.

Little is known about intraspecific communication in these whales. Vision and smell are limited, but hearing is sensitive.

Communication Channels: acoustic

Perception Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day and night

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Longevity in blue whales, and other large cetaceans, is estimated by counting the number of ovarian scars in sexually mature females, changes in the coloration of eye lenses, and counting the number of ridges on baleen plates. Age estimates of blue whales suggest a lifespan of 80 to 90 years.

Average lifespan

Status: wild:
80-90 years.

Typical lifespan

Status: wild:
80 to 90 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 110 years (wild) Observations: The blue whale is the largest animal on earth. Its gestation period is short when considering its size. One possible explanation is that longer gestation periods would mean that the young would be born in the season spent in the season spent in cold waters (Ronald Nowak 1999). It is estimated that these animals live over 100 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Very little is known about mating in the large whale species.

The gestation period is eleven or twelve months long, unusually short for an animal its size. Young are born in warm, low latitude waters in the winter months after the adults return from their high latitude feeding grounds. At birth the young are 7-8 m long. While nursing, blue whales can gain up to 90 kg in body weight a day. Young are weaned after seven or eight months, usually after attaining a length of 16 m. Sexual maturity occurs at about 5 years old in females, or at about 21 to 23 m in length and young are produced every 2 or 3 years after that. Twins are rare but do occur occassionally. Males mature at 20 to 21 m, just under 5 years old. Longevity has been estimated to be as high as 110 years.

Breeding interval: Females give birth to young every 2 to 3 years.

Breeding season: Breeding occurs during the winter months.

Average number of offspring: 1.

Range gestation period: 11 to 12 months.

Range weaning age: 7 to 8 months.

Range time to independence: 2 to 3 years.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 2e+06 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1827 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1827 days.

Blue whale young are cared for extensively by their mother. Male blue whales do not contribute parental care.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

  • Nowak, R. 1991. Walker's Mammals of the World. Baltimore, Maryland, USA: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mates May-September in the Northern Hemisphere. Gestation is reported as 11 or 12 months. Adult females bear one calf every 2-3 years. Young are weaned in about 8 months. Females reach sexual maturity in about 10 years. Maximum lifespan is uncertain; reportedly only about 20 years or up to 80-90 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Baleen plates filter food: blue whale
 

The mouths of whales filter krill for food via sheets of feathered horn, or baleen.

   
  "One group of whales has specialised in feeding on tiny shrimp-like crustaceans, krill, which swarm in vast clouds in the sea. Just as teeth are of no value to mammals feeding on ants, so they are no use to those eating krill. So these whales, like ant-eaters, have lost their teeth. Instead they have baleen, sheets of horn, feathered at the edges, that hang down like stiff, parallel curtains from the roof of the mouth. The whale takes a huge mouthful of water in the middle of the shoal of krill, half-shuts its jaws and then expels the water by pressing its tongue forward so that the krill remains and can be swallowed. Sometimes it gathers the krill by slowly cruising where it is thickest. It also can concentrate a dispersed shoal by diving beneath it and then spiralling up, expelling bubbles as it goes, so that the krill is driven towards the centre of the spiral. Then the whale itself, jaws pointing upwards, rises in the centre and gathers them in one gulp." (Attenborough 1979:242)
  Learn more about this functional adaptation.
  • Attenborough, David. 1979. Life on Earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Branching protects from blockages: blue whales
 

Blue whales efficiently distribute blood and oxygen and create redundancy in case of blockages using a branching circulatory system.

       
  "If you let a drop of ink fall on a piece of paper, the splash pattern that results looks rather like a sea urchin. If you drop water into a bowl of liquid and photograph the moment of impact with high-speed equipment, the coronet shape formed at the surface resembles a sea anemone. Yet another of the basic shapes of life - the explosion, or radiating shape - repeats the forms taken by falling drops of water. Radiating shapes occur wherever numerous lines fan outwards from a single central point - whether in a flat plane, as with a starfish, or in three dimensions, as with a sea urchin. The plant kingdom is full of radiating shapes: the majority of flowers have this form, and many plants grow leaves that radiate directly from a stem base; but there are many examples in the animal kingdom as well. Radiating lines, as a construction design, have two useful attributes: they minimize the distance between the centre and the outlying points, and they provide great scope for increasing the surface area of an organism…The first of these qualities is most convenient in cases where materials must be transported rapidly from the centre to outer points or vice versa. There is a disadvantage, however. If there are a lot of outlying points, the lines tend to become overcrowded around the centre (diagram a). One way to overcome this problem is to develop branching patterns, to reduce the total length of travel and the congestion of lines at the centre (diagram b). If each artery and vein in the body led directly to the heart, for example, the heart would be swamped in a vast tangle of blood vessels. Instead, a few large central vessels divide and redivide into smaller branches. Physically, the resistance to flow or skeletal strength are reduced when the vessels coalesce or the skeletal rays are fused. Biologically, the smaller branching vessels help animals survive damage and aid their development and growth." (Foy and Oxford Scientific Films 1982:24)
  Learn more about this functional adaptation.
  • Foy, Sally; Oxford Scientific Films. 1982. The Grand Design: Form and Colour in Animals. Lingfield, Surrey, U.K.: BLA Publishing Limited for J.M.Dent & Sons Ltd, Aldine House, London. 238 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera musculus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0521-06|NC_001601|Balaenoptera musculus| AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATCCGCGCTGAACTAGGTCAGCCTGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTATTAGTAACAGCCCACGCCTTCGTGATAATCTTCTTCATAGTTATACCTATTATAATCGGCGGATTCGGAAATTGACTGGTCCCTCTAATG---ATTGGAGCACCCGACATAGCCTTCCCTCGTATAAATAACATAAGCTTCTGACTACTCCCTCCTTCCTTCCTACTCTTAATAGCATCCTCAATAATTGAAGCTGGCGCAGGTACAGGCTGAACCGTATATCCCCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTCGACCTT---ACCATTTTCTCCTTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCTATCAATTTTATCACAACTATTATTAATATAAAACCACCTGCCATGACCCAATATCAAACTCCCCTTTTCGTATGATCAGTCCTAGTCACAGCAGTACTACTCTTATTATCATTACCTGTTTTAGCAGCC---GGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGATCCAATTCTGTATCAACACTTATTCTGATTCTTTGGCCACCCTGAAGTATACATTCTAATTCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATGGGAATAATCTGAGCTATGGTGTCCATCGGATTCTTAGGCTTTATCGTATGAGCCCACCATATGTTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera musculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1abd

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
The cause of the population reduction in this species (commercial whaling) is reversible, understood, and is not currently in operation. For this reason, the species is assessed under criterion A1, not under A2, A3 or A4. There is no doubt that the global blue whale population has been depleted greatly. Although there are uncertainties over present abundance, the total population has been depleted by at least 70%, and possibly as much as 90%, over the last three generations, assuming a 31-year average generation time. The species therefore meets the criterion A1(abd) for Endangered, and probably meets the same criterion for Critically Endangered. The dominant contribution to the reduction in the global population is the massive reduction of the formerly very large Antarctic population. For that reason, the Antarctic blue whale (B. m. intermedia) subspecies should be separately as Critically Endangered due to a reduction over the same period of over 97% (that assessment will proceed in future). The pygmy blue whale (B. m. brevicauda) subspecies is less depleted. It is included in this global assessment.

History
  • 1996
    Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Blue whales were not initially among the most heavily hunted species due to their size, speed, and remote habitat. Technological advances from 1860-1920, however, allowed whalers to pursue the species. The estimated total kill of blue whales in the 20th century was 350,000 animals. By the 1960's, blue whales were on the edge of extinction. Despite the opposition of the whaling industry, blue whales gained protection after the 1965/66 whaling season. Estimates of the remaining population range from 2,000 to 6,000 individuals and it is not yet clear that the blue whale will escape extinction. Southern hemisphere populations have been surveyed extensively and are estimated at 400 to 1,400 animals. Northern hemisphere populations are estimated at about 5,000 individuals but the scientific rigor of these surveys has been criticized.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Large range in the Pacific, Atlantic, and southern oceans; low population numbers, far below historical levels, due to whaling; current population more than 10,000, with some populations increasing.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Balaenoptera musculus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List. Listed on Appendix I of CITES and Appendix I of the Convention on Migratory Species (CMS or Bonn Convention). Subspecies: Antarctic blue whale, B. m. intermedia, is classified as Critically Endangered (CR); the pygmy blue whale, B. m. brevicauda, is classified as Data Deficient (DD) and the North Atlantic stock of the North Atlantic blue whale, B. m. musculus, is classified as Vulnerable (VU) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Generation time.
The inferred value of 31 years for generation time given in Taylor et al. (2007) is considered appropriate, given an absence of any indications to the contrary from available biological information for the species. That implies that the three generation time window for applying the A (past reduction) criterion is 1914-2007.

North Atlantic
In the North Atlantic, about 400 whales have been photo-identified in the Gulf of St Lawrence (Ramp et al. 2006) and Pike et al. (2004) estimate 1,000-2,000 in the central North Atlantic (Iceland, Denmark Strait, East Greenland, Jan Mayen, Faeroes and the British Isles). Sightings of blue whales are still very rare in areas where substantial catches were made in the past ? e.g. off Norway and especially in northern Norway (Christensen et al. 1992, Norwegian sighting surveys 1995-2006), Svalbard and the British Isles. Approximately 8,000 blue whales are specifically recorded in whaling statistics since the start of modern whaling in northern Norway in 1868, but an additional 30,000 unspecified large whales were recorded caught in the late 19th and early 20th centuries, of which perhaps as many as 25% could have been blue whales (IWC 2006). However, only about 1,600 blue whales were caught after 1914, hence the main decline occurred primarily before the time window of interest (three generations). The population is estimated to have been recovering at 5.2% p.a. (SE 1.1%) in the Iceland/Denmark Strait area during 1969-88, after catching had ceased (Sigurjónsson and Gunnlaugsson 1990). Taken together this all suggests that the North Atlantic population was very low when whaling ceased in the mid-1960s (apart from a very few pirate whaling catches up to 1978) and may now be at or above the 1911 level but still well below the pre-whaling level.

Antarctic
The Antarctic blue whale B. m. intermedia was extremely abundant in the past: about 341,830 blue whales have been recorded caught in the Antarctic and sub-Antarctic (IWC 2006) in the 20th century, of which 12,618 were identified as pygmy blue whales or are assumed to have been so from their location (Branch et al. 2004). About 40,000 of these were taken around South Georgia. In addition, the majority of the over 17,000 blue whales caught off southern Africa were probably Antarctic blue whales (Branch et al. 2006). Ignoring these and other catches north of 40°S, Branch et al. (2004) estimated the pre-exploitation (1905) abundance to be 239,000 (202,000-311,000). The current population size in 1996, based primarily on data from the IWC-sponsored whale sightings cruises conducted during 1978-2001, was estimated to be 1,700 (860-2,900) and to be increasing at the rate of 7.3% (1.4-11.6%) p.a. Branch et al.'s initial (1905) population estimate can be taken as a conservative proxy for the 1911 population size, because few (
Southern Indian Ocean
No precise estimates are available of the population of pygmy blue whales (B. m. brevicauda) in the southern Indian Ocean. From a survey in December 1996, Best et al. (2003) estimated the abundance of pygmy blue whales in a survey area south of Madagascar to be 424 with wide confidence limits (about 190-930) and suggested, based on the distribution of past catches, that the total population in the southwestern Indian Ocean may be about 3 times that in the survey area. Blue whales appear to be rare in the central southern Indian Ocean (Branch et al. 2006). They occur in the southeastern Indian Ocean off western and southern Australia but are abundant only in quite small areas (Kato et al. 1996, Bannister et al. 2007, Gill 2002), suggesting a population only in the hundreds. The catch of at least 12,618 pygmy blue whales in the southern Indian Ocean in a rather short period during 1960-71 (Branch et al., 2004) suggests that the initial population was at least this size, and hence that the current population is still depleted, but not as severely as the Antarctic blue whale.

Northern Indian Ocean
No population estimates are available but blue whales are regularly observed off Sri Lanka (Alling et al. 1991) and the Maldives (Anderson 2005). Mikhalev (1996) reports 1,294 pygmy blue whales caught illegally by Soviet fleets during 1963-66, mainly off the Seychelles, the Maldives, in the Gulf of Aden, and west of southern India and Sri Lanka.

Western North Pacific
No quantitative abundance estimates for western North Pacific blue whales are available. Japanese scouting surveys recorded 183 blue whales during about 165,000 nmi of search effort in the North Pacific north of 40°N in summer, 1974-2005, spread fairly uniformly throughout the area, although none were observed in coastal waters off Japan where they were hunted historically (Japanese Progress Reports to the IWC, 1975-2006; Clapham et al. 2008).

The IWC data tables list 7,300 blue whales caught in the North Pacific in the 20th Century (western and eastern), but to these should be added about 700 blue whales caught by Soviet fleets in the 1960s that were not reported at the time (Doroshenko 2000). In addition, about 20,000 unspecified large whales were caught during 1900-1930, of which an unknown proportion would have been blue whales (IWC 2006). About 1,500 were taken during the first half of the 20th century off southern Japan to Taiwan and Korea where no blue whales have been seen in recent times (Clapham et al. 2008).

Eastern North Pacific
For blue whales in the eastern North Pacific (sub-specific identity uncertain), available population estimates are ~3,000 for the area off California and Baja California (Calambokidis and Barlow 2004). Some proportion of ~1,400 whales from a study that spans the equator and runs from late July through early December are from the North Pacific (Wade and Gerrodette 1993), although there may have been some double counting of whales censused off California and Baja California (Calamblokidis and Barlow 2004). The locations of the American pelagic catches are not all recorded, but up to 2,000 of the recorded blue whale catches and an unknown proportion of the unspecified catches could have been from the California-Mexican blue whale population.

Eastern South Pacific

Some proportion of ~1,400 whales from a study that spans the equator and runs from late July through early December are from the South Pacific (Wade and Gerrodette 1993). Donovan (1984) does not provide an abundance estimate from a survey of Peruvian and Ecuadorian waters, but on the assumption of a similar effective sighting distance to that calculated by Best et al. (2003) using the same vessel and similar procedures, an abundance of the order of ~1,000 whales is implied. No abundance estimates for Chile are available, but the fact that a blue whale fishery catching several hundred animals per year continued until its closure in 1967 without obvious signs of decline (371 blue whales being taken in 1965 alone) suggests a population in the thousands. No abundance estimate has yet been calculated from the IWC Blue Whale Survey in Chilean waters (Findlay et al.1998) but their sighting rate (~5 blue whales per 1,000 km) is consistent with a population in the low thousands. The survey missed a newly discovered blue whale summer feeding and nursery ground around Chiloé Island (41°-44°S) (Hucke-Gaete et al. 2005), which appears to contain a population at least in the hundreds.

Other areas
Recent records of blue whales are very rare from the South Atlantic. A stranding at 34°S in southern Brazil could not be diagnosed unambiguously as a pygmy or ?true? blue whale (Dalla Rosa and Secchi 1997). There are no records for the offshore central South Pacific outside the Antarctic, although data for this area are sparse (Branch et al. 2006).

Global
The global population of blue whales is uncertain, but based on the above information, the global total for the species is plausibly in the range 10,000-25,000, corresponding to about 3-11% of the 1911 population size.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The main threat in the past was direct exploitation, which only became possible in the modern era using deck-mounted harpoon cannons. Blue whale hunting started in the North Atlantic in 1868 and spread to other regions around 1900 after the northeastern Atlantic populations had been severely reduced. The Antarctic and North Atlantic populations were probably depleted to the low hundreds by the time whaling ceased, but are increasing (see above). Blue whales have been protected worldwide since 1966, although they continued to be caught illegally by former USSR fleets until 1972. The last recorded deliberate catches were off Spain in 1978 (IWC 2006).

Blue whales are subject to some ship strikes and entanglements (NMFS 1998) but reported cases are few. The remote distribution of some blue whale populations probably makes them less vulnerable to human impacts than some other cetacean species, but local populations that inhabit waters with significant levels of human activity may be subject to some threat, such as disturbance from vessel traffic, including ship noise (e.g. Gulf of St Lawrence population, NMFS 1998). Globally, there appear to be no major threats to blue whales at present.

During this century, a profound reduction in the extent of sea ice in the Antarctic is expected, and possibly a complete disappearance in summer, as mean Antarctic temperatures rise faster than the global average (Turner et al. 2006). The implications of this for blue whales are unclear but warrant monitoring.

Small populations such as the surviving Antarctic population can have a number of interacting effects that accelerate overall risk (Gilpin and Soule, 1986). Among those effects are demographic stochasticity, inbreeding depression and density dispensation (Allee effects). Although the expectation is that these threats could be serious because cetaceans are social animals with low reproductive output, the fact that the Antarctic population is increasing is encouraging.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Historically over-harvested. Today the species may be negatively affected by food-chain alterations resulting from commercial fishing/whaling (J. Barlow, pers. comm., 1995). There is concern among some biologists that underwater sound waves, such as those to be transmitted as part of the Acoustic Thermometry of Ocean Climate project (see Schmidt, 1994, Science 264:339-340), may detrimentally impact marine mammals; all agree that more information is needed on the impact of noise on marine mammals.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

As blue whales are so large, fast for their size and difficult to find, they were not targeted by the whaling industry until technological advances between 1860 and 1920 made capture possible (5). By the 1960s such large numbers had been killed that the species was thought to be on the very brink of extinction (5). This whale is still threatened by pollution, and blue whale meat still turns up on markets in Japan (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The IWC had granted protection to blue whales by 1966. Catch limits for all commercial whaling have been set at zero by the IWC since 1986. However, this moratorium does not apply to Iceland, Norway or the Russian Federation, which have objected to this provision. No blue whales have been recorded deliberately caught since 1978. The species is on Appendix I of both CITES and CMS.

Local measures may be required to protect the habitat of specific local populations in order to ensure their long-term viability in the face of increasing human impacts, e.g. see Hucke-Gaete et al. 2005.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Final recovery plans for the U.S. Atlantic and Pacific stocks became available in 1998 (www.nmfs.gov/prot_res/cetacean/blue.html).

Biological Research Needs: Determine health, abundance, and distribution of food resource.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Enforce international and national protection regulations. Establish marine sanctuaries in high use areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Hunting of the blue whale has been banned since 1966 (4), however they have been hunted since by illegal soviet whaling. International trade is forbidden as the species is listed on Appendix I of the Convention on International Trade in Endangered Species (CITES) (8). Populations in the Southern Hemisphere are now gradually increasing (9), but the species still remains in a precarious position.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of blue whales on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue whales were formerly heavily hunted for blubber and oil. Because of the immensity of blue whales, only sperm whales approached them in economic importance. A single blue whale could yield 70 or 80 barrels of oil. Baleen was also an important whale product, valued for its plastic like properties that were applied in a wide variety of products.

Blue whales, and other large whales, have important ecotourism value.

Positive Impacts: body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Hunted initially for oil; meat for human consumption and other by-products also were obtained. The largest harvests (nearly 30,000/year) occurred in the 1930s after factory ships began whaling in the southern ocean. Probably about 280,000 were harvested between the mid-1920s and early 1970s. Harvest dropped to essentially zero by the early 1970s. See IUCN (1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Endangered (EN); Antarctic population Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue whale

The blue whale (Balaenoptera musculus) is a marine mammal belonging to the suborder of baleen whales (called Mysticeti).[3] At 30 metres (98 ft)[4] in length and 180 metric tons (200 short tons)[5] or more in weight, it is the largest known animal to have ever existed.[6]

Long and slender, the blue whale's body can be various shades of bluish-grey dorsally and somewhat lighter underneath.[7] There are at least three distinct subspecies: B. m. musculus of the North Atlantic and North Pacific, B. m. intermedia of the Southern Ocean and B. m. brevicauda (also known as the pygmy blue whale) found in the Indian Ocean and South Pacific Ocean. B. m. indica, found in the Indian Ocean, may be another subspecies. As with other baleen whales, its diet consists almost exclusively of small crustaceans known as krill.[8]

Blue whales were abundant in nearly all the oceans on Earth until the beginning of the twentieth century. For over a century, they were hunted almost to extinction by whalers until protected by the international community in 1966. A 2002 report estimated there were 5,000 to 12,000 blue whales worldwide,[9] located in at least five groups. More recent research into the Pygmy subspecies suggests this may be an underestimate.[10] Before whaling, the largest population was in the Antarctic, numbering approximately 239,000 (range 202,000 to 311,000).[11] There remain only much smaller (around 2,000) concentrations in each of the eastern North Pacific, Antarctic, and Indian Ocean groups. There are two more groups in the North Atlantic, and at least two in the Southern Hemisphere.

Contents

Taxonomy

Blue whales are rorquals (family Balaenopteridae), a family that includes the humpback whale, the fin whale, Bryde's whale, the sei whale and the minke whale.[3] The family Balaenopteridae is believed to have diverged from the other families of the suborder Mysticeti as long ago as the middle Oligocene. It is not known when the members of those families diverged from each other.

The blue whale is usually classified as one of eight species in the genus Balaenoptera; one authority places it in a separate monotypic genus, Sibbaldus,[12] but this is not accepted elsewhere.[1] DNA sequencing analysis indicates that the blue whale is phylogenetically closer to the sei whale (Balaenoptera borealis) and Bryde's whale (Balaenoptera brydei) than to other Balaenoptera species, and closer to the humpback whale (Megaptera) and the gray whale (Eschrichtius) than to the minke whales (Balaenoptera acutorostrata and Balaenoptera bonaerensis).[13][14] If further research confirms these relationships, it will be necessary to reclassify the rorquals.

There have been at least 11 documented cases of blue/fin hybrid adults in the wild. Arnason and Gullberg describe the genetic distance between a blue and a fin as about the same as that between a human and a gorilla.[15] Researchers working off of Fiji believe they photographed a hybrid humpback/blue whale.[16]

The first published description of the blue whale comes from Robert Sibbald's Phalainologia Nova (1694). In September 1692, Sibbald found a blue whale that had stranded in the Firth of Forth—a male 78-feet-long—which had "black, horny plates" and "two large apertures approaching a pyramid in shape".[17]

The specific name musculus is Latin and could mean "muscle", but it can also be interpreted as "little mouse".[18] Carl Linnaeus, who named the species in his seminal Systema Naturae of 1758,[19] would have known this and may have intended the ironic double meaning.[20] Herman Melville called this species sulphur-bottom in his novel Moby-Dick due to an orange-brown or yellow tinge on the underparts from diatom films on the skin. Other common names for the blue whale have included Sibbald's rorqual (after Sibbald, who first described the species), the great blue whale and the great northern rorqual. These names have now fallen into disuse. The first known usage of the term blue whale was in Melville's Moby-Dick, which only mentions it in passing and does not specifically attribute it to the species in question. The name was really derived from the Norwegian blåhval, coined by Svend Foyn shortly after he had perfected the harpoon gun; the Norwegian scientist G. O. Sars adopted it as the Norwegian common name in 1874.[17]

Authorities classify the species into three or four subspecies: B. m. musculus, the northern blue whale consisting of the North Atlantic and North Pacific populations, B. m. intermedia, the southern blue whale of the Southern Ocean, B. m. brevicauda, the pygmy blue whale found in the Indian Ocean and South Pacific,[21] and the more problematic B. m. indica, the great Indian rorqual, which is also found in the Indian Ocean and, although described earlier, may be the same subspecies as B. m. brevicauda.[1]

Description and behaviour

A blue whale lifting its tail flukes.
Adult blue whale

The blue whale has a long tapering body that appears stretched in comparison with the stockier build of other whales.[22] The head is flat, U-shaped and has a prominent ridge running from the blowhole to the top of the upper lip.[22] The front part of the mouth is thick with baleen plates; around 300 plates (each around one metre (3.2 ft) long)[22] hang from the upper jaw, running 0.5 m (1.6 ft) back into the mouth. Between 70 and 118 grooves (called ventral pleats) run along the throat parallel to the body length. These pleats assist with evacuating water from the mouth after lunge feeding (see feeding below).

The dorsal fin is small,[22] visible only briefly during the dive sequence. Located around three-quarters of the way along the length of the body, it varies in shape from one individual to another; some only have a barely perceptible lump, but others may have prominent and falcate (sickle-shaped) dorsals. When surfacing to breathe, the blue whale raises its shoulder and blowhole out of the water to a greater extent than other large whales, such as the fin or sei whales. Observers can use this trait to differentiate between species at sea. Some blue whales in the North Atlantic and North Pacific raise their tail fluke when diving. When breathing, the whale emits a spectacular vertical single-column spout up to 12 metres (39 ft), typically 9 metres (30 ft). Its lung capacity is 5,000 litres (1320 U.S. gallons). Blue whales have twin blowholes shielded by a large splashguard.[22]

The flippers are 3–4 metres (9.8–13 ft) long. The upper sides are grey with a thin white border; the lower sides are white. The head and tail fluke are generally uniformly grey. The whale's upper parts, and sometimes the flippers, are usually mottled. The degree of mottling varies substantially from individual to individual. Some may have a uniform slate-grey color, but others demonstrate a considerable variation of dark blues, greys and blacks, all tightly mottled.[3]

Blue whales can reach speeds of 50 kilometres per hour (31 mph) over short bursts, usually when interacting with other whales, but 20 kilometres per hour (12 mph) is a more typical traveling speed.[3] When feeding, they slow down to 5 kilometres per hour (3.1 mph).

Blue whales most commonly live alone or with one other individual. It is not known how long traveling pairs stay together. In locations where there is a high concentration of food, as many as 50 blue whales have been seen scattered over a small area. They do not form the large, close-knit groups seen in other baleen species.

Aerial view of a blue whale showing both pectoral fins

Size

The blow of a blue whale
The small dorsal fin of this blue whale is just visible on the far left.

The blue whale is the largest animal ever known to have lived.[22] The largest known dinosaur of the Mesozoic Era was Argentinosaurus,[23] which is estimated to have weighed up to 90 metric tons (99 short tons).

Blue whales are difficult to weigh because of their size. As is the case with most large whales targeted by whalers, adult blue whales have never been weighed whole, but cut up into manageable pieces first. This caused an underestimate of the total weight of the whale, due to the loss of blood and other fluids. Nevertheless, measurements between 150–170 metric tons (170–190 short tons) were recorded of animals up to 27 metres (89 ft) in length. The weight of an individual 30 metres (98 ft) long is believed by the American National Marine Mammal Laboratory (NMML) to be in excess of 180 metric tons (200 short tons). The largest blue whale accurately weighed by NMML scientists to date was a female that weighed 177 metric tons (195 short tons).[9] As a whole, blue whales from the Northern Atlantic and Pacific appear to be smaller on average than those from sub-Antarctic waters.

There is some uncertainty about the biggest blue whale ever found, as most data come from blue whales killed in Antarctic waters during the first half of the twentieth century, and was collected by whalers not well-versed in standard zoological measurement techniques. The heaviest whale ever recorded weighed in at 190 metric tons (210 short tons).[24] The longest whales ever recorded were two females measuring 33.6 metres (110 ft) and 33.3 metres (109 ft), although in neither of these cases was the piecemeal weight gathered.[25] The longest whale measured by scientists at the NMML was 29.9 metres (98 ft),[9] a female caught in the Antarctic by Japanese whalers in 1946-47. The longest reported in the North Pacific was a 27.1 metres (89 ft) female taken by Japanese whalers in 1959, and the longest reported in the North Atlantic was a 28.1 metres (92 ft) female caught in the Davis Strait.[17]

Due to its large size, several organs of the blue whale are the largest in the animal kingdom. A blue whale's tongue weighs around 2.7 metric tons (3.0 short tons)[26] and, when fully expanded, its mouth is large enough to hold up to 90 metric tons (99 short tons) of food and water.[8] Despite the size of its mouth, the dimensions of its throat are such that a blue whale cannot swallow an object wider than a beach ball.[27] Its heart weighs 600 kilograms (1,300 lb) and is the largest known in any animal.[26] A blue whale's aorta is about 23 centimetres (9.1 in) in diameter.[28] During the first seven months of its life, a blue whale calf drinks approximately 400 litres (100 U.S. gallons) of milk every day. Blue whale calves gain weight quickly, as much as 90 kilograms (200 lb) every 24 hours. Even at birth, they weigh up to 2,700 kilograms (6,000 lb)—the same as a fully grown hippopotamus.[3]

A 19-foot-long blue whale skull in the collections of the Smithsonian Museum of Natural History

Feeding

Blue whales feed almost exclusively on krill, though they also take small numbers of copepods.[29] The species of this zooplankton eaten by blue whales varies from ocean to ocean. In the North Atlantic, Meganyctiphanes norvegica, Thysanoessa raschii, Thysanoessa inermis and Thysanoessa longicaudata are the usual food;[30][31][32] in the North Pacific, Euphausia pacifica, Thysanoessa inermis, Thysanoessa longipes, Thysanoessa spinifera, Nyctiphanes symplex and Nematoscelis megalops;[33][34][35] and in the Antarctic, Euphausia superba, Euphausia crystallorophias and Euphausia valentin.

An adult blue whale can eat up to 40 million krill in a day.[36] The whales always feed in the areas with the highest concentration of krill, sometimes eating up to 3,600 kilograms (7,900 lb) of krill in a single day.[29] This daily requirement of an adult blue whale is in the region of 1.5 million kilocalories.[37]

Because krill move, blue whales typically feed at depths of more than 100 metres (330 ft) during the day and only surface-feed at night. Dive times are typically 10 minutes when feeding, though dives of up to 20 minutes are common. The longest recorded dive is 36 minutes.[38] The whale feeds by lunging forward at groups of krill, taking the animals and a large quantity of water into its mouth. The water is then squeezed out through the baleen plates by pressure from the ventral pouch and tongue. Once the mouth is clear of water, the remaining krill, unable to pass through the plates, are swallowed. The blue whale also incidentally consumes small fish, crustaceans and squid caught up with krill.[39][40]

Life history

A juvenile blue whale with its mother

Mating starts in late autumn and continues to the end of winter.[41] Little is known about mating behaviour or breeding grounds. Females typically give birth once every two to three years at the start of the winter after a gestation period of 10 to 12 months.[41] The calf weighs about 2.5 metric tons (2.8 short tons) and is around 7 metres (23 ft) in length. Blue whale calves drink 380–570 litres (100–150 U.S. gallons) of milk a day. The calf is weaned after six months, by which time it has doubled in length. Sexual maturity is typically reached at five to ten years of age. In the Northern Hemisphere, whaling records show that males averaged 20–21 m (65.6–69 ft) and females 21–23 m (69–75 ft) at sexual maturity,[42] while in the Southern Hemisphere it was 22.6 m (74 ft) and 24 m (79 ft), respectively.[43] In the Southern Hemisphere, as adults, males averaged 25 m (82 ft) and females 26.5 m (87 ft).[43] In the North Pacific, photogrammetric studies have shown blue whale adults today average 21.6 m (71 ft), with a maximum of over 24.4 m (80 ft)[44] -- although a 26.5 m (87 ft) female stranded near Pescadero, California in 1979.[45]

Scientists estimate that blue whales can live for at least 80 years;[25][41][46] though since individual records do not date back into the whaling era, this will not be known with certainty for many years. The longest recorded study of a single individual is 34 years, in the eastern North Pacific.[38] The whales' only natural predator is the orca.[47] Studies report that as many as 25% of mature blue whales have scars resulting from orca attacks.[25] The mortality rate of such attacks is unknown.

Blue whale strandings are extremely uncommon, and, because of the species' social structure, mass strandings are unheard of.[48] When strandings do occur, they can become the focus of public interest. In 1920, a blue whale washed up near Bragar on the Isle of Lewis in the Outer Hebrides of Scotland. It had been shot by whalers, but the harpoon had failed to explode. As with other mammals, the fundamental instinct of the whale was to try to carry on breathing at all costs, even though this meant beaching to prevent itself from drowning. Two of the whale's bones were erected just off a main road on Lewis and remain a tourist attraction.[49]

Vocalizations

Estimates made by Cummings and Thompson (1971) suggest the source level of sounds made by blue whales are between 155 and 188 decibels when measured relative to a reference pressure of one micropascal at one metre.[50][51] All blue whale groups make calls at a fundamental frequency between 10 and 40 Hz; the lowest frequency sound a human can typically perceive is 20 Hz. Blue whale calls last between ten and thirty seconds. Blue whales off the coast of Sri Lanka have been repeatedly recorded making "songs" of four notes, lasting about two minutes each, reminiscent of the well-known humpback whale songs. As this phenomenon has not been seen in any other populations, researchers believe it may be unique to the B. m. brevicauda (pygmy) subspecies.

The reason for vocalization is unknown. Richardson et al. (1995) discuss six possible reasons:[52]

  1. Maintenance of inter-individual distance
  2. Species and individual recognition
  3. Contextual information transmission (for example feeding, alarm, courtship)
  4. Maintenance of social organization (for example contact calls between females and males)
  5. Location of topographic features
  6. Location of prey resources

Population and whaling

Hunting era

Blue whale populations have declined dramatically due to commercial whaling.
Blue whale skeleton at the Canadian Museum of Nature in Ottawa, Ontario.

Blue whales are not easy to catch or kill. Their speed and power meant that they were rarely pursued by early whalers, who instead targeted sperm and right whales.[53] In 1864, the Norwegian Svend Foyn equipped a steamboat with harpoons specifically designed for catching large whales.[3] Although initially cumbersome and with a low success rate, Foyn perfected the harpoon gun, and soon several whaling stations were established on the coast of Finnmark in northern Norway. Because of disputes with the local fishermen, the last whaling station in Finnmark was closed down in 1904.

Soon, blue whales were being hunted in Iceland (1883), the Faroe Islands (1894), Newfoundland (1898), and Spitsbergen (1903). In 1904-05 the first blue whales were taken off South Georgia. By 1925, with the advent of the stern slipway in factory ships and the use of steam-driven whale catchers, the catch of blue whales, and baleen whales as a whole, in the Antarctic and sub-Antarctic began to increase dramatically. In the 1930–31 season, these ships caught 29,400 blue whales in the Antarctic alone. By the end of World War II, populations had been significantly depleted, and, in 1946, the first quotas restricting international trade in whales were introduced, but they were ineffective because of the lack of differentiation between species. Rare species could be hunted on an equal footing with those found in relative abundance.

Arthur C. Clarke, in his 1962 book Profiles of the Future, was the first prominent intellectual to call attention to the plight of the blue whale. He mentioned its large brain and said, "we do not know the true nature of the entity we are destroying."[54]

Blue whale hunting was banned in 1966 by the International Whaling Commission,[55][56] and illegal whaling by the USSR finally halted in the 1970s,[57] by which time 330,000 blue whales had been caught in the Antarctic, 33,000 in the rest of the Southern Hemisphere, 8,200 in the North Pacific, and 7,000 in the North Atlantic. The largest original population, in the Antarctic, had been reduced to 0.15% of their initial numbers.[11]

Population and distribution today

A blue whale set against the backdrop of the Azores
Image of a blue whale's tail fluke with the Santa Barbara Channel Islands in the background, August 2007

Since the introduction of the whaling ban, studies have failed to ascertain whether the conservation reliant global blue whale population is increasing or remaining stable. In the Antarctic, best estimates show a significant increase at 7.3% per year since the end of illegal Soviet whaling, but numbers remain at under 1% of their original levels.[11] It has also been suggested that Icelandic and Californian populations are increasing but these increases are not statistically significant. The total world population was estimated to be between 5,000 and 12,000 in 2002, although there are high levels of uncertainty in available estimates for many areas.[9]

The IUCN Red List counts the blue whale as "endangered" as it has since the list's inception. In the United States, the National Marine Fisheries Service lists them as endangered under the Endangered Species Act.[58] The largest known concentration, consisting of about 2,800 individuals, is the northeast Pacific population of the northern blue whale (B. m. musculus) subspecies that ranges from Alaska to Costa Rica, but is most commonly seen from California in summer.[59] Infrequently, this population visits the northwest Pacific between Kamchatka and the northern tip of Japan.

In the North Atlantic, two stocks of B. m. musculus are recognised. The first is found off Greenland, Newfoundland, Nova Scotia and the Gulf of Saint Lawrence. This group is estimated to total about 500. The second, more easterly group is spotted from the Azores in spring to Iceland in July and August; it is presumed the whales follow the Mid-Atlantic Ridge between the two volcanic islands. Beyond Iceland, blue whales have been spotted as far north as Spitsbergen and Jan Mayen, though such sightings are rare. Scientists do not know where these whales spend their winters. The total North Atlantic population is estimated to be between 600 and 1,500.

In the Southern Hemisphere, there appear to be two distinct subspecies, B. m. intermedia, the Antarctic blue whale, and the little-studied pygmy blue whale, B. m. brevicauda, found in Indian Ocean waters. The most recent surveys (midpoint 1998) provided an estimate of 2,280 blue whales in the Antarctic[60] (of which fewer than 1% are likely to be pygmy blue whales).[61] Estimates from a 1996 survey show that 424 pygmy blue whales were in a small area south of Madagascar alone,[62] thus it is likely that numbers in the entire Indian Ocean are in the thousands. If this is true, the global numbers would be much higher than estimates predict.[10]

A fourth subspecies, B. m. indica, was identified by Blyth in 1859 in the northern Indian Ocean, but difficulties in identifying distinguishing features for this subspecies led to it being used a synonym for B. m. brevicauda, the pygmy blue whale. Records for Soviet catches seem to indicate that the female adult size is closer to that of the Pygmy Blue than B. m. musculus, although the populations of B. m. indica and B. m. brevicauda appear to be discrete, and the breeding seasons differ by almost six months.[63]

Migratory patterns of these subspecies are not well known. For example, pygmy blue whales have been recorded in the northern Indian Ocean (Oman, Maldives and Sri Lanka), where they may form a distinct resident population.[63] In addition, the population of blue whales occurring off Chile and Peru may also be a distinct population. Some Antarctic blue whales approach the eastern South Atlantic coast in winter, and occasionally, their vocalizations are heard off Peru, Western Australia, and in the northern Indian Ocean.[63] In Chile, the Cetacean Conservation Center, with support from the Chilean Navy, is undertaking extensive research and conservation work on a recently discovered feeding aggregation of the species off the coast of Chiloe Island in the Gulf of Corcovado, where 326 blue whales were spotted in 2007.[64]

Efforts to calculate the blue whale population more accurately are supported by marine mammologists at Duke University, who maintain the Ocean Biogeographic Information System—Spatial Ecological Analysis of Megavertebrate Populations (OBIS-SEAMAP), a collation of marine mammal sighting data from around 130 sources.[65]

Threats other than hunting

A blue whale surfaces off Santa Cruz Island in the Channel Islands, near Santa Barbara, CA
Blue whales stop producing foraging D calls once a mid-frequency sonar is activated, even though the sonar frequency range (1–8 kHz) far exceeds their sound production range (25–100 Hz).[66]

Due to their enormous size, power and speed, adult blue whales have virtually no natural predators. There is one documented case in National Geographic Magazine of a blue whale being attacked by orcas off the Baja California Peninsula; although the orcas were unable to kill the animal outright during their attack, the blue whale sustained serious wounds and probably died as a result of them shortly after the attack.[67] Up to a quarter of the blue whales identified in Baja bear scars from orca attacks.[17]

Blue whales may be wounded, sometimes fatally, after colliding with ocean vessels, as well as becoming trapped or entangled in fishing gear.[68] The ever-increasing amount of ocean noise, including sonar, drowns out the vocalizations produced by whales, which makes it harder for them to communicate.[66][68] Blue whales stop producing foraging D calls once a mid-frequency sonar is activated, even though the sonar frequency range (1–8 kHz) far exceeds their sound production range (25–100 Hz).[66] Human threats to the potential recovery of blue whale populations also include accumulation of polychlorinated biphenyl (PCB) chemicals within the whale's body.[8]

With global warming causing glaciers and permafrost to melt rapidly and allowing a large amount of fresh water to flow into the oceans, there are concerns that if the amount of fresh water in the oceans reaches a critical point, there will be a disruption in the thermohaline circulation.[69] Considering the blue whale's migratory patterns are based on ocean temperature, a disruption in this circulation, which moves warm and cold water around the world, would be likely to have an effect on their migration.[70] The whales summer in the cool, high latitudes, where they feed in krill-abundant waters; they winter in warmer, low latitudes, where they mate and give birth.[71]

The change in ocean temperature would also affect the blue whale's food supply. The warming trend and decreased salinity levels would cause a significant shift in krill location and abundance.[72]

Museums

Blue whale skeleton, outside the Long Marine Laboratory at the University of California, Santa Cruz

The Natural History Museum in London contains a famous mounted skeleton and life-size model of a blue whale, which were both the first of their kind in the world, but have since been replicated at the University of California, Santa Cruz. Similarly, the American Museum of Natural History in New York City has a full-size model in its Milstein Family Hall of Ocean Life. A juvenile blue whale skeleton is installed at the New Bedford Whaling Museum in New Bedford, Massachusetts.

The Aquarium of the Pacific in Long Beach, California features a life-size model of a mother blue whale with her calf suspended from the ceiling of its main hall.[73] The Beaty Biodiversity Museum at the University of British Columbia, Canada, houses a display of a blue whale skeleton (skull is cast replica) directly on the main campus boulevard.[74] A real skeleton of a blue whale at the Canadian Museum of Nature in Ottawa was also unveiled in May 2010.[75]

The Museum of Natural History in Gothenburg, Sweden contains the only stuffed blue whale in the world. There one can also find the skeleton of the whale mounted beside the whale.

The Melbourne Museum features a skeleton of the pygmy blue whale.

Whale-watching

Blue whales may be encountered (but rarely) on whale-watching cruises in the Gulf of Maine[76] and are the main attractions along the north shore of the Gulf of Saint Lawrence and in the Saint Lawrence estuary.[68] Blue whales can also be seen off Southern California, starting as early as March and April, with the peak between July and September.[77]

In Chile, the Alfaguara project combines conservation measures for the population of blue whales feeding off Chiloé Island with whale watching and other ecotourism activities that bring economic benefits to the local people.[78] Whale-watching, principally blue whales, is also carried out south of Sri Lanka.[79]

Footnotes

  1. ^ a b c Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 725. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3. 
  2. ^ Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera musculus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b c d e f "American Cetacean Society Fact Sheet - Blue Whales". Archived from the original on 11 July 2007. http://web.archive.org/web/20070711025158/http://www.acsonline.org/factpack/bluewhl.htm. Retrieved 20 June 2007. 
  4. ^ J. Calambokidis and G. Steiger (1998). Blue Whales. Voyageur Press. ISBN 0-89658-338-4. 
  5. ^ "Animal Records". Smithsonian National Zoological Park. http://nationalzoo.si.edu/Animals/AnimalRecords/. Retrieved 2007-05-29. 
  6. ^ "What is the biggest animal ever to exist on Earth?". How Stuff Works. http://science.howstuffworks.com/question687.htm. Retrieved 2007-05-29. 
  7. ^ FI - Species fact sheets. Fisheries and Aquaculture Department, Food and Agriculture Organization.
  8. ^ a b c Jason de Koning and Geoff Wild (1997). "Contaminant analysis of organochlorines in blubber biopsies from blue whales in the St Lawrence". Trent University. http://whale.wheelock.edu/bwcontaminants/welcome.html. Retrieved 2007-06-29. 
  9. ^ a b c d "Assessment and Update Status Report on the Blue Whale Balaenoptera musculus" (PDF). Committee on the Status of Endangered Wildlife in Canada. 2002. http://www.sararegistry.gc.ca/virtual_sara/files/cosewic/sr_blue_whale_e.pdf. Retrieved 2007-04-19. 
  10. ^ a b Alex Kirby (2003-06-19). "Science seeks clues to pygmy whale". BBC News. http://news.bbc.co.uk/2/hi/science/nature/3003564.stm. Retrieved April 21, 2006. 
  11. ^ a b c T.A. Branch, K. Matsuoka and T. Miyashita (2004). "Evidence for increases in Antarctic blue whales based on Bayesian modelling". Marine Mammal Science 20: 726–754. doi:10.1111/j.1748-7692.2004.tb01190.x. 
  12. ^ Barnes LG, McLeod SA. (1984). "The fossil record and phyletic relationships of gray whales.". In Jones ML et al.. The Gray Whale. Orlando, Florida: Academic Press. pp. 3–32. ISBN 0-12-389180-9. 
  13. ^ Arnason, U., Gullberg A. & Widegren, B. (September 1, 1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960–970. PMID 8412655. http://mbe.oxfordjournals.org/cgi/content/abstract/10/5/960. Retrieved 2009-01-25. 
  14. ^ Sasaki, T. et al. (March 4, 2011). "Mitochondrial phylogenetics and evolution of mysticete whales". Systematic Biology 54 (1): 77–90. doi:10.1080/10635150590905939. PMID 15805012. http://sysbio.oxfordjournals.org/content/54/1/77.full. 
  15. ^ A. Arnason and A. Gullberg (1993). "Comparison between the complete mtDNA sequences of the blue and fin whale, two species that can hybridize in nature". Journal of Molecular Ecology 37 (4): 312–322. PMID 8308901. 
  16. ^ Amazing Whale Facts Archive. Whale Center of New England (WCNE). Retrieved on 2008-02-27.
  17. ^ a b c d Bortolotti, Dan (2008). Wild Blue: A Natural History of the World’s Largest Animal. St. Martin's Press. 
  18. ^ Simpson, D. P. (1979). Cassell's Latin Dictionary (5 ed.). London: Cassell Ltd.. p. 883. ISBN 0-304-52257-0. 
  19. ^ (Latin) Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (Editio decima, reformata ed.). Holmiae: Laurentii Salvii. p. 824. 
  20. ^ "Blue Whale Fact Sheet". New York State Department of Environmental Conservation. http://www.dec.ny.gov/animals/9367.html. Retrieved 2007-06-29. 
  21. ^ Ichihara T. (1966). The pygmy blue whale B. m. brevicauda, a new subspecies from the Antarctic in Whales, dolphins and porpoises Page(s) 79-113.
  22. ^ a b c d e f "Size and Description of the Blue Whale Species". http://www.wdcs.org/dan/publishing.nsf/allweb/F8FE8974A62E12F88025696D004A8EE9. Retrieved 15 June 2007. 
  23. ^ (Spanish) Bonaparte J, Coria R (1993). "Un nuevo y gigantesco sauropodo titanosaurio de la Formacion Rio Limay (Albiano-Cenomaniano) de la Provincia del Neuquen, Argentina". Ameghiniana 30 (3): 271–282. 
  24. ^ Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. p. 256. ISBN 978-0-85112-235-9. 
  25. ^ a b c Sears R, Calambokidis J (2002). Update COSEWIC status report on the blue whale Balaenoptera musculus in Canada.. Committee on the Status of Endangered Wildlife in Canada, Ottawa.. pp. 32. 
  26. ^ a b The Scientific Monthly. American Association for the Advancement of Science. 1915. p. 21. 
  27. ^ Blue Planet: Frozen seas (BBC documentary)
  28. ^ Caspar, Dave (April 2001). "Ms. Blue's Measurements" (PDF). Seymour Center, University of California, Santa Cruz.. Archived from the original on August 27, 2004. http://web.archive.org/web/20040827064742/http://www2.ucsc.edu/seymourcenter/PDF/2.+Ms.+B+measurements.pdf. Retrieved 2006-09-01. 
  29. ^ a b "Detailed Information about Blue Whales". Alaska Fisheries Science Center. 2004. http://www.afsc.noaa.gov/nmml/education/cetaceans/blue.php. Retrieved 2007-06-14. 
  30. ^ Hjort J, Ruud JT (1929). "Whaling and fishing in the North Atlantic". Rapp. Proc. Verb. Conseil int. Explor. Mer 56. 
  31. ^ Christensen I, Haug T, Øien N (1992). "A review of feeding and reproduction in large baleen whales (Mysticeti) and sperm whales Physeter macrocephalus in Norwegian and adjacent waters". Fauna Norvegica Series a 13: 39–48. 
  32. ^ Sears R, Wenzel FW, Williamson JM (1987). "The Blue Whale: A Catalogue of Individuals from the Western North Atlantic (Gulf of St. Lawrence)". Mingan Island Cetacean Study, St. Lambert, Quebec.: 27. 
  33. ^ Sears, R (1990). "The Cortez blues". Whalewatcher 24 (2): 12–15. 
  34. ^ Kawamura, A (1980). "A review of food of balaenopterid whales". Scientific Reports of the Whales Research Institute 32: 155–197. 
  35. ^ Yochem PK, Leatherwood S (1980). "Blue whale Balaenoptera musculus (Linnaeus, 1758)". In Ridgway SH, Harrison R. Handbook of Marine Mammals, Vol. 3:The Sirenians and Baleen Whales.. London: Academic Press. pp. 193–240. 
  36. ^ Afp.google.com Hunted, rammed, poisoned, whales may die from heartbreak too
  37. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  38. ^ a b (Sears 1998)
  39. ^ Nemoto T (1957). "Foods of baleen whales in the northern Pacific". Sci. Rep. Whales Res. Inst. 12: 33–89. 
  40. ^ Nemoto T, Kawamura A (1977). "Characteristics of food habits and distribution of baleen whales with special reference to the abundance of North Pacific sei and Bryde’s whales". Rep. Int. Whal. Commn 1 (Special Issue): 80–87. 
  41. ^ a b c "Blue Whale - ArticleWorld". http://www.articleworld.org/index.php/Blue_Whale. Retrieved 2 July 2007. 
  42. ^ Klinowska, M. (1991). Dolphins, Porpoises and Whales of the World: The IUCN Red Data Book. Cambridge, U.K.: IUCN. 
  43. ^ a b Evans, Peter G. H. (1987). The Natural History of Whales and Dolphins. Facts on File.
  44. ^ Gilpatrick, James W., and Wayne L. Perryman. (2008). Geographic variation in external morphology of North Pacific and Southern Hemisphere blue whales (Balaenoptera musculus). J. Cetacean Res. Manage. 10 (1): 9-21.
  45. ^ Blue whale skeleton at Seymour Center at Long Marine Lab
  46. ^ "www.npca.org". http://www.npca.org/marine_and_coastal/marine_wildlife/bluewhale.html. Retrieved 21 June 21, 2007. 
  47. ^ J. Calambokidis, G. H. Steiger, J. C. Cubbage, K. C. Balcomb, C. Ewald, S. Kruse, R. Wells and R. Sears (1990). "Sightings and movements of blue whales off central California from 1986–88 from photo-identification of individuals". Rep. Whal. Comm. 12: 343–348. 
  48. ^ William Perrin and Joseph Geraci. "Stranding" pp 1192–1197 in Encyclopedia of Marine Mammals (Perrin, Wursig and Thewissen eds)
  49. ^ "The Whale Bone Arch". Places to Visit around the Isle of Lewis. http://www.isle-of-lewis.com/places-to-visit.htm. Retrieved 2005-05-18. 
  50. ^ W.C. Cummings and P.O. Thompson (1971). "Underwater sounds from the blue whale Balaenoptera musculus". Journal of the Acoustics Society of America 50 (4): 1193–1198. doi:10.1121/1.1912752. 
  51. ^ W.J. Richardson, C.R. Greene, C.I. Malme and D.H. Thomson (1995). Marine mammals and noise. Academic Press, Inc., San Diego, CA.. ISBN 0-12-588441-9. 
  52. ^ National Marine Fisheries Service (2002). "Endangered Species Act - Section 7 Consultation Biological Opinion" (PDF). http://www.nmfs.noaa.gov/prot_res/readingrm/ESAsec7/7pr_surtass-2020529.pdf. 
  53. ^ Scammon CM (1874). The marine mammals of the northwestern coast of North America. Together with an account of the American whale-fishery. San Francisco: John H. Carmany and Co.. p. 319. 
  54. ^ Clarke, Arthur C. Profiles of the Future; an Inquiry into the Limits of the Possible. New York: Harper & Row, 1962
  55. ^ Gambell, R (1979). "The blue whale". Biologist 26: 209–215. 
  56. ^ Best, PB (1993). "Increase rates in severely depleted stocks of baleen whales". ICES J. Mar. Sci. 50: 169–186. doi:10.1006/jmsc.1993.1018. 
  57. ^ Yablokov, AV (1994). "Validity of whaling data". Nature 367 (6459): 108. doi:10.1038/367108a0. 
  58. ^ "Endangered Species Act". http://www.nmfs.noaa.gov/pr/laws/esa/. 
  59. ^ Blue Whale (Balaenoptera musculus): Eastern North Pacific Stock (NOAA Stock Reports, 2009), p. 178.
  60. ^ Branch, T.A. (2007). "Abundance of Antarctic blue whales south of 60°S from three complete circumpolar sets of surveys". Journal of Cetacean Research and Management 9 (3): 87–96. 
  61. ^ T.A. Branch; Abubaker, E. M. N.; Mkango, S.; Butterworth, D. S. (2007). "Separating southern blue whale subspecies based on length frequencies of sexually mature females". Marine Mammal Science 23 (4): 803–833. doi:10.1111/j.1748-7692.2007.00137.x. 
  62. ^ P.B. Best (2003). "The abundance of blue whales on the Madagascar Plateau, December 1996". Journal of Cetacean Research and Management 5: 253–260. 
  63. ^ a b c T. A. Branch, K. M. Stafford, D. M. Palacios (2007). "Past and present distribution, densities and movements of blue whales Balaenoptera musculus in the Southern Hemisphere and northern Indian Ocean". Mammal Review 37: 116–175. doi:10.1111/j.1365-2907.2007.00106.x. 
  64. ^ R. Hucke-Gaete, B. Carstens, A. Ruiz-Tagle y M. Bello. "Blue Whales in Chile: The Giants of Marine Conservation" (PDF). Rufford Small Grants Foundation. http://www.ruffordsmallgrants.org/files/2007%20Rufford%201st%20phase%20blue%20whale%20report%20Chile_CBA.pdf. Retrieved 2009-03-22. 
  65. ^ The data for the blue whale, along with a species profile, may be found here [1]
  66. ^ a b c http://dx.doi.org/10.1371/journal.pone.0032681
  67. ^ Tarpy, C. (1979). "Killer whale attack!". National Geographic 155 (4): 542–545. 
  68. ^ a b c Reeves RR, Clapham PJ, Brownell RL, Silber GK (1998) (PDF). Recovery plan for the blue whale (Balaenoptera musculus). Silver Spring, MD: National Marine Fisheries Service. p. 42. http://www.nmfs.noaa.gov/pr/pdfs/recovery/whale_blue.pdf. Retrieved 2007-06-20. 
  69. ^ Schiermeier, Quirin (2007). "Climate change: a sea change". Nature 439 (7074): 256–260. doi:10.1038/439256a. PMID 16421539. http://www.nature.com/nature/journal/v439/n7074/full/439256a.html.  (subscription required); see also "Atlantic circulation change summary". RealClimate.org. 19 Jan 2006. http://www.realclimate.org/index.php?p=187. 
  70. ^ Robert A. Robinson, Jennifer A. Learmonth, Anthony M. Hutson, Colin D. Macleod, Tim H. Sparks, David I. Leech, Graham J. Pierce, Mark M. Rehfisch and Humphrey Q.P. Crick (August 2005). "Climate Change and Migratory Species" (PDF). BTO. http://www.bto.org/research/reports/researchrpt_complete/RR414_Climate%20change_&_migratory_species.pdf. Retrieved 2007-07-09. 
  71. ^ Hucke-Gaete, Rodrigo, Layla P. Osman, Carlos A. Moreno, Ken P. Findlay, and Don K. Ljungblad (2003). "Discovery of a Blue Whale Feeding and Nursing Ground in Southern Chile". The Royal Society: s170-s173. http://www.pubmedcentral.nih.gov.oca.ucsc.edu/picrender.fcgi?artid=1810017&blobtype=pdf. 
  72. ^ Moline, Mark A., Herve Claustre, Thomas K. Frazer, Oscar Schofield, and Maria Vernet (2004). "Alteration of the Food Web Along the Antarctic Peninsula in Response to a Regional Warming Trend". Global Change Biology 10 (12): 1973–1980. doi:10.1111/j.1365-2486.2004.00825.x. http://www.blackwell-synergy.com.oca.ucsc.edu/doi/abs/10.1111/j.1365-2486.2004.00825.x. 
  73. ^ "Aquarium of the Pacific - Online Learning Center - Blue Whale". http://www.aquariumofpacific.org/onlinelearningcenter/species/blue_whale/. Retrieved 2009-08-12. 
  74. ^ "The Blue Whale Project". Beaty Biodiversity Museum. Vancouver, BC: University of British Columbia. 2010. Archived from the original on 4 April 2010. http://web.archive.org/web/20100404042222/http://www.beatymuseum.ubc.ca/projblue01.html. Retrieved 2 May 2010. 
  75. ^ http://nature.ca/en/plan-your-visit/what-see-do/our-exhibitions/water-gallery
  76. ^ Wenzel FW, Mattila DK, Clapham PJ (1988). "Balaenoptera musculus in the Gulf of Maine". Mar. Mammal Sci. 4: 172–175. doi:10.1111/j.1748-7692.1988.tb00198.x. 
  77. ^ "Blue Whales Spotted In Unusually Large Numbers Off Southern California Shore". The Huffington Post. September 21, 2010. http://www.huffingtonpost.com/2010/09/21/blue-whales-spotted-in-un_n_732181.html. Retrieved 2012-04-02. 
  78. ^ "Alfaguara project". Rufford Small Grant s Foundation. January 2008. http://www.ruffordsmallgrants.org/files/RSG_AlfaguaraProjectFinalReport_0.pdf. Retrieved 2012-04-01. 
  79. ^ Gehan de Silva Wijeyeratne. "Is southern Sri Lanka the world's top spot for seeing Blue and Sperm whales?". Wildlife Extra.com. http://www.wildlifeextra.com.au/go/whales/sri-lanka-whales.html#cr. Retrieved 2011-04-15. [dead link]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: A proposal to place the blue whale in the monotypic genus Sibbaldius (Barnes and McLeod 1984) has not been accepted by subsequent authors (e.g., Jones et al. 1986, 1992; Mead and Brownell, in Wilson and Reeder 1993, 2005). Includes brevicauda (pygmy blue whale) as a subspecies (Mead and Brownell). Sometimes the Northern and Southern hemisphere stocks are regarded as separate subspecies (musculus and intermedia, respectively). The Indian Ocean population represents the nominal subspecies indica.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!