Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Brief Summary

Description

The largest recorded fin whale was a female about 27 m long, weighing more than 100 tons. Fin whales are sleek, fast swimmers. Some make long distance migrations, spending summers in cold, high latitude northern or southern oceans and returning to warmer waters in winter. Some individuals have been returning to the Gulf of Maine for up to 20 years, but their wintering grounds have not all been located, and they are not usually seen in groups near islands or coasts, making them hard to study. Like other rorquals, fin whales have accordion-like pleats that let them expand the throat and mouth while filling it with water and prey, which is likely to be krill and small schooling fish. But unlike the others, they lunge-feed instead of skimming, by accelerating quickly and turning or rolling into a vast school of prey. Then they contract the throat folds, forcing the water out through the fringed baleen plates and leaving food in the mouth. One of the unexplained oddities of the fin whale is color asymmetry: the lower jaw is white on the right side, black on the left. Some believe this is somehow a feeding adaptation.

Links:
Mammal Species of the World
Visit ARKive for more images of the fin whale  More images, video and sound
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:75, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Fin whales tend to occur in pairs or in groups known as pods that usually contain around six or seven individuals; although larger groups have been observed (5) (7). This species spends spring and early summer in cold feeding grounds at high latitudes, migrating to more southerly areas for winter and the breeding season (5). Northern and southern populations never meet because the seasonal patterns are reversed in the two hemispheres, and so they migrate to the equator at different times of year (5). Mating takes place in winter, and as gestation takes about 11 months, births occur in the winter breeding grounds where conception took place (5). A single calf is produced, which is suckled for six to seven months; when weaned, calves travel with their mother to the feeding grounds (5). Females produce calves every couple of years after reaching sexual maturity at three to twelve years of age. Full maturity is usually attained at 25 to 30 years of age (5). Fin whales feed by filtering planktonic crustaceans, fish and squid through their baleen plates. Individuals can dive to depths of 230 metres and can stay submerged for about 15 minutes (7) (8). The blow of a fin whale reaches six metres in height and is a slim cone shape (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The Fin Whale is the second-largest whale species, after the Blue Whale. Fin Whales are dark grey to brownish black dorsally, grading to pale or white ventrally. The undersides of the flippers and flukes are also white. The head is asymmetrical in color and is mostly dark but the right lower jaw is white. Baleen plates are black on the left jaw and white on the right jaw. The body is free of mottling or extensive scarring. The Fin Whale is very streamlined in appearance, with a distinct ridge along the back behind the dorsal fin. The dorsal fin is set two-thirds of the way along the back, and is up to 60 cm tall, falcate (curved) and often slopes backwards.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Balaenoptera physalus is a baleen whale and can be recognised as such by the plates of baleen (rather than teeth) suspended from the upper jaw and the two blowholes on the upper body. The fin whale is slender bodied and can reach up to 24 m in length. It is a member of the rorqual family with the characteristic ventral pleats of skin under the eye and the relatively flat and broad jaw. The ventral pleats extend beyond the navel. The small flippers are less than one-fifth of the body length. It has only one prominent ridge on the snout. The head is pointed and V-shaped, the dorsal fin is a moderate size and set less far back on the body, and the head colouration is asymmetrical. The fin whale has a dark dorsal and lateral colouration with light streaks and the belly is white. The left side of the head is grey, while much of the right side is white in colour.The fin whale can be confused with the blue whale Balaenoptera musculus but can be recognised by the pointed and V-shaped head with an asymmetrical colouration and the moderate sized dorsal fin that is set less far back on the body. Fin whales are often slightly more social than other rorquals and tend to gather in pods of up to 7 or more individuals. It does occassionally breech but when diving, rarely show the tail flukes. Dives may last up to 10 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Fin whales are the fastest of all cetaceans, reaching speeds of 37 kilometres per hour and known to completely clear the water. This whale is grey in colour on the upper surface and white on the underside (4). The patterns on the jaw are asymmetrical, being white on the right side and dark on the left, and a large number of grooves extend along the throat to the naval (4). The prominent dorsal fin is 60 centimetres in length and curves strongly (4). Males and females tend to be very similar in their general appearance, but females are slightly longer than males (4). The baleen plates are bluish to grey in colour and have white fringes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Fin whales occur worldwide, mainly, but not exclusively, in offshore waters. They are rare in the tropics, except in certain cool-water areas, such as off Peru.

North Atlantic
In the North Atlantic, the fin whale’s range extends as far as Svalbard (Norway) in the northeast (but rarely far into the Barents Sea), to the Davis Strait and Baffin Bay (Canada and Denmark (Greenland)) in the northwest (but rarely into the inner Canadian Arctic), to the Canary Islands (Spain) in the southeast, and to the Antilles in the southwest (Rice 1998, Perry et al. 1999), but it is rare in the Caribbean and Gulf of Mexico (Ward et al. 2001). Their main summer range in the Northwest Atlantic extends from Cape Hatteras (39°N) (US) northward (Anon. 2005a). In former times, fin whales were caught year-round near the Straits of Gibraltar. While there may be some north-south migration between summer and winter, it does not necessarily involve the entire population, and North Atlantic fin whales may occur to some extent throughout the year in all of their range, as suggested by acoustic data (Clark 1995).

Mediterranean
There is a resident subpopulation in the central and western Mediterranean which is genetically distinct from that of the North Atlantic (Bérubé et al. 1998). The species also occurs rarely in the eastern Mediterranean (Notarbartolo di Sciara et al. 2003).

North Pacific
In the eastern North Pacific, fin whales occur year-round off the central and southern California coast (Anon. 2003). They occur in summer off the entire coast of western North America from California into the Gulf of Alaska. Fin whales marked off California in winter were recaptured in summer by whaling operations along the entire coast, suggesting migration. Offshore, fin whales occur across the North Pacific north of 40°N, at least from May to September in summer, with some tendency for a northward shift in distribution in high summer, when they also enter the Okhotsk Sea (Miyashita et al. 1995). They occur in the Bering Sea and some have been seen in the Chuckchi Sea, but rarely in the Beaufort Sea (Angliss and Outlaw 2004).

Fin whales occur, albeit in small numbers, in Hawaiian waters in both summer and winter (Anon 2005b). They are rare or absent throughout the tropical North Pacific.

While there appears to be some migration, acoustic data suggests that overall there is no marked seasonality in distribution in the North Pacific (Watkins et al. 2000), in contrast to the traditional view of the fin whale as a migratory species.

Gulf of California
The fin whales inhabiting the Gulf of California constitute a resident, genetically isolated subpopulation (Bérubé et al. 2002). Telemetry information has shown year-round residency in this area, with seasonal latitudinal movements (Urbán et al. 2005).

East China Sea
Fin whales in the East China Sea are generally recognized as being a distinct subpopulation from those of the North Pacific (Fujino 1960). Fin whales appear to be rare today off the Korean peninsula and southern and central Japan, but large numbers were caught there in the 20th century (IWC 2006); it is not clear whether these animals were part of the East China Sea population or a separate grouping.

Southern Hemisphere
While some fin whales do penetrate into the high Antarctic, along with blue, minke and humpback whales, the bulk of the fin whale summer distribution is in middle latitudes, mainly 40°S-60°S in the southern Indian and South Atlantic oceans, but 50°-65°S in the South Pacific, as evidenced by both sightings data and past catches (Miyashita et al. 1995, IWC 2006a).

The winter distribution is poorly known, but based on catch results fin whales were formerly common off southern Africa in winter and became scarce there following depletion of the species in the Southern Ocean, consistent with this being a wintering area of a migratory population (Best 2003). Catches were mainly off South Africa, but in the early 20th century there were also catches off Angola, Congo and Mozambique (Best 1994).

Recent sighting were made in the mid-latitude region (between 55oS and 61oS) by the IWC/SOWER (Southern Ocean Whale and Ecosystem Research Program). A high density area of fin whales was observed between 0oE and 5oE in the south of Bouvet Island (Ensor et al, 2007).

Large numbers of fin whales were caught off South Georgia in the past, but the species is not common there now (Moore et al. 1999). It is assumed that animals caught at South Georgia were migratory (Mackintosh 1965), but the location of their wintering grounds is unknown. Fin whales are now rare in Brazilian waters, but there is virtually no information from the period before the depletion of the whales around South Georgia (Zerbini et al. 1997). A few were taken in a brief period of whaling in southern Brazil in the early 1960s.

Winter catches of fin whales off Chile, which also declined from the 1950s onwards in line with declining Southern Ocean stocks, are also suggestive of a wintering ground. Fin whales were caught off Peru for only a few years from 1965 (prior to that the industry had focused on sperm whales), and catches petered out in the early 1970s.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Fin whales, or fin-backed whales, are found in all major oceans and open seas. Some populations are migratory, moving into colder waters during the spring and summer months to feed. In autumn, they return to temperate or tropical oceans. Because of the difference in seasons in the northern and southern hemisphere, northern and southern populations of fin whales do not meet at the equator at the same time during the year. Other populations are sedentary, staying in the same area throughout the year. Non-migratory populations are found in the Mediterranean Sea and the Gulf of California.

In summer in the North Pacific Ocean, fin whales migrate to the Chukchi Sea, the Gulf of Alaska, and coastal California. In the winter, they are found from California to the Sea of Japan, East China and Yellow Seas, and into the Philippine Sea.

During the summer in the North Atlantic Ocean, fin whales are found from the North American coast to Arctic waters around Greenland, Iceland, north Norway, and into the Barents Sea. In the winter these fin whale populations are found from the ice edge toward the Caribbean and the Gulf of Mexico and from southern Norway to Spain.

In the southern hemisphere, fin whales enter and leave the Antarctic throughout the year. Larger and older whales tend to travel further south than younger ones.

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

  • Gambell, R. 1985. Fin Whale, Balaenoptera physalus. Pp. 171-192 in S Ridgway, R Harrison, eds. Handbook of Marine Mammals, Vol. 3, first Edition. San Diego, CA: Academic Press Inc..
  • Nowak, R. 1991. Balaenopteridae: Roquals. Pp. 969-1044 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, Fifth Edition. Baltimore and London: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, Den Helder, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North Sea, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, Vlissingen, Wimereux, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Mediterranean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (worldwide).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide in temperate and polar waters, in several distinct breeding stocks. In the western North Atlantic, summers north to arctic Canada and Greenland, winters south to Gulf of Mexico and Caribbean region. In the eastern North Pacific, summers north to the Chukchi Sea, winters north to California (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

All oceans of the world. The northern and southern hemisphere populations appear to be separated by different timing in seasonal movement patterns.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species has a global distribution but is quite rare in tropical or iced polar seas. It occurs in the Atlantic, Pacific, Indian and Arctic Oceans (5); the species is split into two subspecies which do not appear to come into contact, one in the south (B. p. quoyi) and one in the north (B. p. physalus) (5). The fin whale is the only rorqual commonly found in the Mediterranean (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Fin whales are the second largest mammals, after blue whales. They grow to 20 meters in length and weigh approximately 70,000 kilograms. Size varies geographically: southern hemisphere whales are roughly 20 meters long, while northern and Arctic fin whales reach up to 25 meters in length. Sexual dimorphism in fin whales is limited, with males and females reaching roughly the same size and weight as adults. It is generally easy to distinguish fin whales by their long, lean bodies, their brown-grey dorsal surface, and deep white undersides. Fin whales can be distinguished from other whales by the medium-sized white patch on their lower, right jaw. The base of the tail is raised, causing their back to have a distinctive ridge. The white underside wraps around to their midsection laterally. The dorsal fin is 50 cm in height, curved, and found relatively far back on the body. The head is quite flat and represents about 1/5 of total body length. These whales have two blowholes and a single, longitudinal ridge extends from the tip of the snout to the beginning of the blowholes. Fin whales are able to expand their mouths and throats during feeding because of the roughly 100 pleats that run from the bottom of their bodies to their mouths. These pleats allow the mouth cavity to engulf water during feeding. Fin whales are filter feeders, with between 350 and 400 baleen plates that are used to catch very small to medium-sized aquatic life suspended in the water.

Average mass: 70,000 kg.

Range length: 19 to 27 m.

Average length: 24 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 7e+07 g.

  • 2008. "Balaenoptera physalus" (On-line). ICUN 2008 Red List. Accessed April 02, 2009 at http://www.iucnredlist.org/details/2478.
  • Croll, D., C. Clark, A. Acevedo, B. Tershy, S. Flores, J. Gedamke, J. Urban. 2002. Only Male Fin Whales Sing Loud Songs. Nature, 117: 809. Accessed April 09, 209 at http://polymer.bu.edu/hes/articles/aabmsss02.pdf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length: 20-27 m. Weight: 70,000 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 2500 cm

Weight: 8.7E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: Males 22 m., females 24 m. maximum lengths. Individuals are slightly larger in the Southern Hemisphere.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 17.7-22 m males; 18.3-24 m females

Weight:
Range: 45,000-70,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: white lower jaw on right, gray on left. Blow readily visible-10 m(33') tall, straight column. Curved dorsal fin closer to tail. light grey with white belly, occasional blotches of orange/yellow, blaze or chevron extending from eye across back. Fin and blue whales have the deepest, loudest voices in the ocean, letting them communicate over great distances. Second largest living animal after the blue whale.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Differs from the blue whale in dorsal coloration (mottled blue-gray and without chevrons in blue whale), a V-shaped rather than a broad U-shaped rostrum, and a larger dorsal fin. Differs from the Bryde's whale in having a single median ridge on the rostrum rather than 3 ridges. Differs from the sei whale in asymmetrical lower lip coloration, mixed color baleen, and more throat grooves (56-100 vs. 32-60); dorsal fin of the fin whale is angled upward less strongly than in the sei whale (front edge more than 40 degrees in the latter); dorsal fin of fin whale tends to surface after the head does, rather than simultaneously with the head as in the sei whale; fin whale lacks the slightly downward-turned snout tip of the sei whale. (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Balaenoptera physalus (Linnaeus, 1758)
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull; Photograph
Collector(s): J. Carey
Year Collected: 1868
Locality: Sinepuxent Bay, Coast Near, Worcester, Maryland, United States, North America, North Atlantic Ocean
  • Type: Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 1869: 17.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Fin whales are often portrayed in the secondary literature as eating fish including juvenile herring (e.g. NAMMCO undated). However, the available quantitative evidence suggests that the fin whale’s reputation as a fish-eater is largely overstated. In Icelandic catches, 96% contained krill only, 2.5% a mixture of krill and fish, and 1.6% fish only (Sigurjónsson and Víkingsson 1997), while only one of 267 fin whales caught in the northeast Pacific off British Columbia, Canada, contained fish (Flinn et al. 2002), and over 99% of stomachs with food in the Antarctic contained krill (Kawamura 1994). On the other hand, Overholtz and Nicolas (1979) reported apparent feeding by fin whales on American sand lance (sand eel) Ammodytes americanus in the northwest Atlantic, and Mitchell (1975) found that capelin comprised 80-90% of prey in fin whales caught off Newfoundland. Capelin abundance is extremely variable over time, and fin whales may feed opportunistically on capelin in high-capelin years.

In summary, although the fin whale is more flexible in its diet than the blue whale (B. musculus), its consumption of fish does not necessarily make it a significant competitor with fisheries.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Fin whales inhabit the temperate and polar zones of all major oceans and open seas and, less commonly, in tropical oceans and seas. They tend to live in coastal and shelf waters but never in water less than 200 meters deep.

Range depth: 200 to 250 m.

Habitat Regions: temperate ; tropical ; polar ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

mostly offshore but also near the coast
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6736 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3378 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.706 - 27.858
  Nitrate (umol/L): 0.031 - 29.325
  Salinity (PPS): 30.118 - 37.995
  Oxygen (ml/l): 4.591 - 8.209
  Phosphate (umol/l): 0.039 - 1.932
  Silicate (umol/l): 0.565 - 72.359

Graphical representation

Temperature range (°C): -1.706 - 27.858

Nitrate (umol/L): 0.031 - 29.325

Salinity (PPS): 30.118 - 37.995

Oxygen (ml/l): 4.591 - 8.209

Phosphate (umol/l): 0.039 - 1.932

Silicate (umol/l): 0.565 - 72.359
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Fin whales are found in deep, offshore waters of all major oceans, primarily in temperate to polar latitudes, and less commonly in the tropics. They occur year-round in a wide range of latitudes and longitudes, but the density of individuals in any one area changes seasonally.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Pelagic; usually found in largest numbers 25 miles or more from shore. In the western Atlantic, occurs mainly over continental shelf in summer, in water 50-100 fathoms deep (Katona et al. 1983). Young are born in the warmer waters of the lower latitudes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The fin whale is an open ocean whale, not often seen near the coast in north-west Europe. It can be found at the surface or diving down to over 230 metres in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Temperate to polar marine waters. Mating and calving take place in temperate waters while the whales feed in polar waters.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

A pelagic and coastal species, sometimes occurring in water as shallow as 30 meters (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates seasonally to colder high-latitude waters for feeding (summer), to warmer lower-latitude waters for winter breeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Fin whales primarily feed on plankton-sized animals including crustaceans, fish, and squid. As filter feeders they passively consume food by filtering prey out of the water that they swim through. Fin whales occasionally swim around schools of fish to condense the school so that they increase their catch per dive.

Animal Foods: fish; aquatic crustaceans; other marine invertebrates; zooplankton

Plant Foods: phytoplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Eats other marine invertebrates); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: North Pacific: eats fishes, krill, calanoid copepods, squid. North Atlantic: primary foods are fishes (e.g., capelin, herring, sand launce), krill, and calanoid copepods. Southern ocean: main diet is krill. Gulf of California: eats euphausiids in winter and spring (Tershy 1992). Newly weaned young eat crustaceans; fine fringing on baleen of young facilitates capture of copepods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feed on euphasiids, fish, squid, and copepods. Diet varies with location.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Fin whales have little pressure exerted on them by predatory animals and thus their main contribution to the general ecosystem is to consume large amounts of plankton. Their carcasses also support communities of benthic animals as they fall to the ocean floor and are consumed. As do other large whales, fin whales also host large communities of parasites, such as barnacles, lice, and worms.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult fin whales have no natural predators. Populations have been heavily exploited by humans who nearly hunted them to extinction in the early part of the 20th century. Hunting exceeded nearly 10,000 whales per year in the 1950’s. Young fin whales may be targeted by large predators, such as killer whales, although fin whales groups are likely to be successful in defending their young.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population was estimated at 200,000 by Folkens (1984); at 102,000-122,000 (of which 85,000 in southern ocean) by NMFS (1987). Southern Hemisphere pre-exploitation population probably was 300,000-650,000 (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Travels singly, in pairs, or in pods of 6-7. May concentrate in areas of abundant food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Fin whales, like blue whales, communicate through vocalizations. Fin whales produce low frequency sounds that range from 16 to 40 Hz, outside of the hearing range of humans. They also produce 20 Hz pulses (both single and patterned pulses), ragged low-frequency pluses and rumbles, and non-vocal sharp impulse sounds. Single frequencies (non-patterned pulses) last between 1 and 2 minutes while patterned calling can last for up to 15 minutes. The patterned pulses may be repeated for many days.

Higher frequency sounds have been recorded and are believed to be used for communications between nearby fin whales and other pods. These high frequencies may communicate information about local food availability. The 20 Hz single pulses help whales communicate with both local and long distances members and patterned 20 Hz pulses are associated with courtship displays.

A study done about the sound frequencies of fin whales suggest that whales use counter-calling in order to get information about their surroundings. Counter-calling is when one whale of a pod calls and another answers. The information conveyed by the time it takes to answer as well as the echo of the answer is believed to hold a lot of important information about the whale’s surroundings.

Communication Channels: acoustic

Other Communication Modes: choruses

Perception Channels: visual ; acoustic ; ultrasound

  • McDonlad, M., J. Hildebrand, S. Webb. 1995. Blue and Fin Whales Observed on Seafloor Array in the Northeast Pacific. Journal of the Acoustical Society of America, 98/2: 712-721.
  • 2006. "Finback Whales, Bioacoustics Research Program" (On-line). Cornell Lab of Ornithology. Accessed April 09, 209 at http://www.birds.cornell.edu/brp/listen-to-project-sounds/fin-whales.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Fin Whales are more gregarious than other baleen whales, and often occur in groups of 6–10, though single animals and pairs are more common. Aggregations of over 100 whales may be observed on feeding grounds. Fin Whales feed intensively in high latitudes and may also feed to some extent, depending upon prey availability and locality, in lower latitudes. Fin Whales feed on planktonic crustacea, some fish and cephalopods (crustaceans). Fin Whales frequently lunge or skim feed at or near the surface. Fin Whales are known to dive to 230 m to feed. Surface feeding could make the whales vulnerable to entanglement in craypot lines and various nets. Fin Whales are killed by ship strike more than any other whale. Surface feeding could make Fin Whales particularly vulnerable to ship strike.

The reproductive habits of these whales remain largely unknown; however, females are thought to give birth only at 3-year intervals. Mating and calving occur from November to March in temperate waters. The gestation period is approximately 11 months and newborn fin whales are about 6.4 m in length and weigh 1.8 metric tons. The period of lactation lasts 6-7 months and after weaning the young whales are approximately 12.2 m long. Sexual maturity is reached at 6-12 years of age.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day and night. Makes long dives during the day and spends more time at the surface at night. In the Gulf of California, fed throughout the day (Tershy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The typical lifespan of a fin whale is roughly 75 years but some there are reports of fin whales that have lived in excess of 100 years.

Range lifespan

Status: wild:
95 (high) years.

Average lifespan

Status: wild:
75 years.

Average lifespan

Status: wild:
75 years.

Average lifespan

Status: wild:
114.0 years.

Average lifespan

Status: wild:
116.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 114 years (wild) Observations: As in other whales, these animals attain sexual maturity before they are fully grown. It is estimated that they attain physical maturity in about 25-30 years. Although there are no detailed studies, some estimates suggest these animals may live over 100 years in the wild with one study estimating that some individuals may live up to 114 years (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Fin whales are seen in pairs during the breeding season and are believed to be monogamous. There have been sightings of courtship behavior during the breeding season. A male will chase a female while emitting a series of repetitive, low-frequency vocalizations, similar to humpback whale songs. However, these songs are not as complex as those observed in humpback whales or gray whales. One study has shown that only males produce these low-frequency sounds. Low frequencies are used because they travel well in water, attracting females from far away. This is important because fin whales do not have specific mating grounds and must communicate to find each other.

Mating System: monogamous

Both mating and calving occur in the late fall or winter when fin whales inhabit warmer waters. Each female gives birth every 2 to 3 years, birthing one calf per pregnancy. Although there have been reports of fin whales giving birth to multiple offspring, it is rare and those offspring rarely survive. The gestation period is 11 to 11.5 months. The mother then undergoes a resting period of 5 or 6 months before mating again. This resting period may extend to a year if the female fails to conceive during the mating period.

Fin whale calves are born at an average length of 6 meters and weighing 3,500 to 3,600 kilograms. Calves are precocial at birth, able to swim immediately after. The age of sexual maturity ranges in from 4 to 8 years. Male fin whales become sexually mature at a body length of about 18.6 meters while females mature at a body length of 19.9 meters. Physical maturity does not occur until the whales have reached their full length, after 22 to 25 years of age. The average length for a physically mature male is 18.9 m and 20.1 m for females.

Breeding interval: Fin whales breed every 2 to 3 years.

Breeding season: Breeding occurs from November to January in the northern hemisphere and June to September in the southern hemisphere.

Range number of offspring: 1 to 1.

Range gestation period: 11 to 12 months.

Range birth mass: 3,500 to 3,600 kg.

Range weaning age: 6 to 7 months.

Range time to independence: 6 to 8 months.

Range age at sexual or reproductive maturity (female): 4 to 8 years.

Average age at sexual or reproductive maturity (female): 7.7 years.

Range age at sexual or reproductive maturity (male): 4 to 8 years.

Average age at sexual or reproductive maturity (male): 6.7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

The mother nurses the infant for 6 to 7 months after it is born. Since the calf does not have the ability to suckle, like land mammals, the mother must spray the milk into the mouth of the baby by contracting the circular muscles at the base of the nipple sinus. Feeding takes place at 8 to 10 minute intervals throughout the day. At weaning the calf is usually 14 meters long, it then travels with its mother to a polar feeding area where it learns to feed itself independent of its mother.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Croll, D., C. Clark, A. Acevedo, B. Tershy, S. Flores, J. Gedamke, J. Urban. 2002. Only Male Fin Whales Sing Loud Songs. Nature, 117: 809. Accessed April 09, 209 at http://polymer.bu.edu/hes/articles/aabmsss02.pdf.
  • Gambell, R. 1985. Fin Whale, Balaenoptera physalus. Pp. 171-192 in S Ridgway, R Harrison, eds. Handbook of Marine Mammals, Vol. 3, first Edition. San Diego, CA: Academic Press Inc..
  • Nowak, R. 1991. Balaenopteridae: Roquals. Pp. 969-1044 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, Fifth Edition. Baltimore and London: The John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mates in winter. Gestation lasts 11-12 months. Adult females bear 1 young every 2-3 years. Young are weaned at 6-8 months. Sexually mature at a minimum age of about 5-6 years in the western Atlantic. Life span may be 40-100 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These whales are probably sexually mature around 6-7 years old. Most mating takes place in fall and winter. The gestation period is approximately 11.25 months, and the calf nurses for 6-7 months.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Lungs efficiently expel air: fin whale
 

Lungs of whales efficiently expel air via powerful exhalations.

     
  "The mammals' dependency on air for breathing must be considered a real handicap in water, but the whale has minimised the problem by breathing even more efficiently than most mammals. Man only clears about 15% of the air in his lungs with a normal breath. The whale, in one of its roaring, spouting exhalations, gets rid of about 90% of its spent air. As a result it only has to take a breath at very long intervals. It also has in its muscles a particularly high concentration of a substance called myoglobin, that enables it to store oxygen. It is this constituent that gives whale meat its characteristic dark colour. With the help of these techniques, the fin-back whale, for example, can dive to depth of 500 metres and swim for forty minutes without drawing breath." (Attenborough 1979: 242)
  Learn more about this functional adaptation.
  • Attenborough, David. 1979. Life on Earth. Boston, MA: Little, Brown and Company. 319 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera physalus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0519-06|NC_001321|Balaenoptera physalus| AACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATACTTATTATTCGGTGCTTGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATCCGCGCTGAGCTAGGTCAACCTGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTATTAGTAACAGCCCATGCCTTCGTGATAATTTTCTTCATGGTTATACCTATCATAATTGGCGGATTCGGAAACTGACTAGTCCCACTAATA---ATTGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCTCCTTCTTTCTTACTGTTAATAGCATCCTCAATAATCGAAGCCGGTGCAGGCACAGGCTGAACTGTATATCCCCCCTTAGCCGGAAATTTAGCACATGCAGGAGCCTCAGTTGACCTT---ACCATCTTCTCCCTACACTTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTTATCACAACCATTATCAACATAAAACCACCCGCCATAACCCAGTATCAAACTCCCCTTTTCGTATGATCAGTCCTAGTCACAGCAGTACTACTCCTATTATCACTACCTGTTTTAGCAGCC---GGAATTACAATGCTACTTACTGACCGAAACCTAAATACAACTTTCTTCGACCCTGCAGGTGGAGGAGACCCAATCCTGTACCAACACCTATTCTGATTCTTTGGCCACCCTGAGGTATATATCCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCCTTTGGCTACATAGGAATAGTTTGAGCTATGGTGTCCATTGGGTTTTTAGGCTTTATCGTATGAGCCCATCATATGTTTACAGTAGGTATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera physalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1d

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
The cause of the population reduction in this species (commercial whaling) is reversible, understood, and is not currently in operation. For this reason, the species is assessed under criterion A1, not under A2, A3 or A4. The analysis in this assessment estimates that the global population has declined by more than 70% over the last three generations (1929-2007), although in the absence of current substantial catches it is probably increasing. Most of the global decline over the last three generations is attributable to the major decline in the Southern Hemisphere. The North Atlantic subpopulation may have increased, while the trend in the North Pacific subpopulation is uncertain.

History
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Overhunting is responsible for low population numbers of fin whales currently. With the invention and use of modern whaling technology, fin whale populations were depleted due to hunting. In addition, fin whales are injured or killed in vessel collisions. This is especially true in the Mediterranean Sea where collisions are a significant source of fin whale mortality. Between 2000 and 2004, 5 fatal collisions with vessels were recorded off the east coast of the United States. Fishing gear also kills fin whales; entanglement results in at least one death per year. Fishing accidents have killed 4 fin whales in the years 2000 to 2004. Finally, a study done on whale calls shows that human sound can prevent mating. Since the whales use low frequency sounds to call to females, human interruption through sound waves, such as military sonar and seismic surveys can disrupt the signal sent to the females. This potentially can result in mates not meeting and a reduction in birth rates in populations.

In order to help populations of fin whales recover worldwide, the International Whaling Commission has set a zero limit for fin whale catches in the North Pacific and southern hemisphere. The catch limit was passed in 1976 and continues be law today. Hunting stopped in the North Atlantic in 1990. There are some exceptions to the commission’s limitation, a limited number of whales are allowed to be caught and killed by aboriginal natives in Greenland.  Commercial catches resumed in Iceland in 2006 and a Japanese fleet began catching fin whales for "scientific" purposes in 2005.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: TNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: TNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widespread in Atlantic, Pacific, Indian, and Southern oceans; populations were greatly reduced by historical commercial whaling; approximately 102,000-122,000 remain from pre-exploitation levels of over 450,000; threatened by general deterioration of the marine ecosystem.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Balaenoptera physalus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The fin whale is considered an endangered species under the ESA. It was hunted commercially in the North Pacific until 1975, and until 1985 in the North Atlantic. It is now protected by the IWC moratorium on commercial whaling, and is listed under CITES Appendix I.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
North Atlantic
North Atlantic fin whales were comprehensively assessed by the International Whaling Commission (IWC) Scientific Committee (SC) in 1991 (IWC 1992), and an update for the northern part of the region was undertaken in 2006 in a joint workshop with the North Atlantic Marine Mammal Commission (NAMMCO) (IWC 2007a). North Atlantic fin whale stocks had previously been assessed by the IWC Scientific Committee in 1976 (IWC 1977).

Based mainly on past whaling operations, the IWC recognizes seven management areas in the North Atlantic: Nova Scotia; Newfoundland-Labrador; West Greenland; East Greenland-Iceland; North Norway; West Norway-Faeroe Islands; British Isles-Spain-Portugal. Based on genetic evidence, it is now considered more likely that there are from two to four breeding stocks, which use these seven management areas in different proportions (IWC 2007a).

The best available estimates of recent abundance accepted by the IWC Scientific Committee (IWC 2007c) are: 25,800 (CV 0.125) in 2001 for the central North Atlantic (East Greenland-Iceland, Jan Mayen (Norway) and the Faeroes (Denmark)); 4,100 (CV 0.21) in 1996-2001 for the northeastern North Atlantic (North and West Norway); 17,355 (CV 0.27) in 1989 for the Spain-Portugal-British Isles area (Buckland et al. 1992); and 1,722 (CV 0.37) for West Greenland in 2005 (IWC 2007b) There are no complete estimates for the western North Atlantic , but partial estimates are 1,013 (95% CI 459-2,654) for Newfoundland in 2002-3 (IWC 2007a), and 2,814 (CV 0.21) for the east coast of North America from the Gulf of St Lawrence southward (Anon. 2005a).

Subject to a caveat concerning the different dates of the surveys, these figures can be summed to provide a rough total estimate of about 53,000 around the year 2000.
No significant trends were found in the total abundance for any of the above areas, but when the area west and southwest of Iceland was singled out, a significant increasing trend was found (IWC 2007a).

Fin whales were heavily exploited in the late 19th and early 20th centuries, starting in 1876, particularly off Norway, Iceland, the Faeroes and British Isles. Whaling then spread to Spain, Greenland and eastern Canada, and exploitation continued at a lower level until the 1980s.

Catch statistics for the early years are probably incomplete, and a large number of whales were killed but lost, due to lines breaking, etc., perhaps up to one-half in the first 20-25 years and one-third in the next 15-20 years (Tønnessen 1967). The IWC Scientific Committee added 50% to recorded catches up to 1915 to allow for this (IWC 2007a): recorded catches up to 1915 total 15,315 fin whales plus 29,024 unspecified whales of which about half may have been fin whales, thus the total kill may have been about 45,000 up to 1915. The total recorded catch post-1915 has been about 55,000 fin whales. The approximate figures by area are: Canada 12,000; Norway 10,000; Iceland 10,000; Faeroes 5,000; Greenland 1,000; British Isles 3,000; Spain and Portugal 11,000; and pelagic operations 3,000.

The behaviour evident for the various North Atlantic fin whale populations following earlier reductions by whaling differs. It ranges from clear evidence of recovery to no firm indications of any increase. An estimated 14,000 fin whales were killed off northern Norway during 1876-1904, and a further 1,500 during 1948-71, but fin whales are rare there now (although quite abundant off western Spitsbergen, where about 1,500 whales had been killed during 1904-11) (Øien 2003, 2004). An estimated 12,000 fin whales were killed off Iceland during 1890-1915, until whaling was suspended partly due to concerns about the reductions in the stocks, but the modern abundance data suggest that the there has been a recovery in the population that may still be continuing, particularly west of Iceland, despite catches during 1948-89 averaging about 220 per year (Branch and Butterworth 2006). An estimated 10,000 fin whales were taken from the Faeroes, but about 25% of these were actually caught off eastern Iceland (IWC 2007a). Whaling from the Faeroes and West Norway petered out during the 1960s as whales became scarce (IWC 1977), but catches had apparently been mainly of migrating whales rather than whales belonging to local populations. The impact of catches on the fin whale stocks in the Northwest Atlantic is unclear (Mitchell 1972).

Mediterranean
Catches of about 7,000 fin whales taken near the Straits of Gibraltar in the 1920s apparently reduced the local abundance, and fin whales are still rare there today, but this did not seem to affect the abundance of fin whales off northern Spain, where catches continued until 1985. Within the Mediterranean, the population was estimated in 1991 from surveys covering much of the western basin at 3,583 (CV 0.27) (Forcada et al. 1996). It is likely, but not certain, that the historical catches near the Strait of Gibraltar were from the North Atlantic rather than from this population (Sanpera and Aguilar 1992). Palsbøll et al. (2004) found that Mediterranean fin whales probably have a small but non-zero genetic exchange with fin whales elsewhere in the North Atlantic. The Mediterranean subpopulation contains fewer than 10,000 mature individuals and is subject to ongoing threats that may be causing a decline, but data on trend in abundance are insufficient to determine this (Reeves and Notarbartolo di Sciara 2006).

North Pacific
North Pacific fin whale stocks have not been assessed in depth by the IWC Scientific Committee since 1973, when the assessment by Ohsumi and Wada (1974) was accepted, and that was updated by Allen (1977). The stock in the western North Pacific was estimated to have declined from an “initial level” of 44,000, to 17,000 in 1975. The figures refer to the “exploitable” population, above the minimum allowed size at capture. However, these assessments were based on indices of catch-per-unit-effort (CPUE) and sightings-per-unit-effort (SPUE) that did not meet modern requirements for the analysis of such data (e.g. IWC 1989), although there is no doubt that the populations had declined to some unknown extent.

The current abundance of fin whales in the North Pacific is not well known, because survey coverage has been patchy, and not all available data have been analyzed. Current estimates indicate a population of 5,700 whales in the Bering Sea, coastal Aleutian Islands and Gulf of Alaska (Moore et al.2002, Zerbini et al. 2006). Zerbini et al. (2006) estimated a trend in abundance of 4.8%/year with a nominal CV of 0.15 for fin whales in the northern Gulf of Alaska from 1987 to 2003, but recalculation of the variance from the data indicates low precision (95% confidence limits -1.6-11.1%).

Based on surveys conducted in 1996 and 2001, an estimated 3,300 (CV 0.31) fin whales occur in summer/autumn off the west coast of the US (Barlow 2003a). Apart from a small population in Hawaiian waters (estimated 174 animals, CV 0.72; Barlow 2003b), there are no recent estimates of fin whale abundance in the remainder of the North Pacific. Some relevant data exist, including data collected under the Japanese Research Programme in the North Pacific (JARPN) (Tamura et al. 2005), but these do not appear to have been analysed with respect to fin whale abundance. Fin whales seem to be abundant in the central offshore part of the Okhotsk Sea, based on Japanese surveys conducted in 1989, 1990, 1992, 1999, 2000 and 2003, but no abundance estimate has been calculated (Miyashita 2004).

Given the lack of a comprehensive recent estimate, the estimate of 17,000 in 1975 from the earlier assessment is used for this assessment, but the global assessment is not particularly sensitive to the figure used for the North Pacific.

Over 74,000 fin whales are recorded caught by modern whaling in the North Pacific during 1910-75, plus about 20,000 unspecified whales during 1900-30, of which a substantial proportion may have been fin whales. Fin whales were protected by the IWC from whaling in the North Pacific from 1976 onwards, but small Korean catches continued until the early 1980s.

As to whether fin whales recovered from exploitation in the North Pacific, the evidence is, as for the North Atlantic, mixed. Over 24,000 fin whales are recorded caught off coastal Japan and the Korean peninsula from 1910 onwards; annual catches peaked at over 1,000 whales in 1915 and declined steadily thereafter. Fin whales appear to be rare there now (Miyashita et al. 1995, Kim et al. 2004). Similar patterns of apparent exhaustion of stocks occurred elsewhere. For example, about 4,000 fin whales were taken by stations in British Columbia, western Canada, until catches ceased in 1967, with signs of rapid decline in the last 10 years of operation (Gregr et al. 2000).

Gulf of California
This genetically isolated subpopulation was estimated in 2004 from a mark-recapture analysis of photo-identification data at 613 (CI 426-970) (Díaz-Guzman 2006). There are no data on population trend for this subpopulation. Telemetry information shows an all-year residency in the Gulf of California with seasonal latitudinal movements by these whales (Urbán et al. 2005).

East China Sea
There do not appear to be any current or historical estimates of abundance for fin whales in the East China Sea.

Southern Hemisphere
Along with other baleen whales, the IWC has traditionally managed Southern Hemisphere fin whales on the basis of six management areas, Areas I through VI, which are longitudinal pie slices 50°-70° wide. The areas were originally chosen as putative management stocks for humpback whales, and later used for all baleen whales, with little or no biological support (Donovan 1991).

Over 725,000 fin whales have been recorded caught in the Southern Hemisphere during 1905-76 (IWC 2006b). There was a series of assessments in the 1970s, including a synthesis by Chapman (1976) which was reassessed by Breiwick (1977), and updated (for Areas II-VI) by Allen (1977). A reassessment of Area VI fin whales was inconclusive (IWC, 1980).

These assessments were based on a combination of evidence, including trends in CPUE by whaling fleets, sighting rates by Japanese scouting vessels, and inferences on recruitment and mortality rates from age and length data. Their reliability is questionable on various grounds. For example, the IWC Scientific Committee subsequently determined that CPUE data should only be used for stock assessments when the nature of the whaling operations is fully described (IWC 1989). A reanalysis of the historical data using modern methods and insights is warranted.

Less indirect estimates are available from sightings data for more recent times. IWC (1995) gives estimates of 18,000 (CV 0.47) using data from 1966-79 and 15,000 (CV 0.61) using data from 1979-88 for the total population of fin whales south of 30°S in summer. These are obtained by extrapolating abundance estimates for the area south of 60°S from the International Decade of Cetacean Research (IDCR) international surveys, to the area south of 30°S using Japanese scouting vessel data. A slightly finer stratification of the same data yielded estimates of 8,387 for 1966-79 and 15,178 for 1979-88 (IWC 1996; no variances given). Despite their low precision, these estimates suggest that the previous assessments of the populations were seriously over-optimistic. Best (2003) suggested a similar conclusion, based on declines of fin whale catch and sighting rates of 89-97% on the former South African winter whaling grounds during 1954-75.

The most recent estimate of 15,178 for 1979-88 is used for the purpose of this assessment and referred to the year 1983, the middle of the period to which it refers. Use of updated results from subsequent IDCR surveys (Branch and Butterworth 2001) would lead to an estimate of 38,185 referenced to the year 1997 (Mori and Butterworth 2006), but use of this for the population trajectory computation would hardly affect the results because the predicted trajectory passes close to this value anyway. (The trajectory shown in Fig.1. is for the mature population, and hence not directly comparable).

Biological parameters and assessment
The generation time for a non-depleted fin whale population is estimated to be 25.9 years (Taylor et al. 2007). The time period of three generations is 1929-2007.

Estimates of age at sexual maturity for female fin whales, based on observed proportions mature by age, are 6-7 years in the Southern Hemisphere from British catches in the 1960s (Lockyer 1972) and Japanese catches in the 1960s and early 1970s (Mizroch 1981), but these values are likely negatively biased due to selection against smaller animals. For the North Atlantic, Gunnlaugsson and Víkingsson (2006) estimated an average of 8.9 years from catches off Iceland during 1967-89, but with some indication of an increase over time from 7.5 years during 1967-78 to 9.25 years during 1979-89. Aguilar et al. (1988) estimated 7.9 years using the same method from catches off Spain during 1979-84. Slightly different values are obtained using alternative methods. There do not seem to be any precise values for the North Pacific, but Kimura et al. (1958) estimated 8-12 years. For the purpose of this assessment, an age at maturity of 8 years is assumed, corresponding to an age at first reproduction of 9 years. The values of other biological parameters (age at first capture, net recruitment rate, and natural mortality rate) were taken from the previous Scientific Committee assessments (Allen 1977).

Because the available published assessments for this species are not up to date, an updated population assessment is conducted here to enable assessment of the population reduction over the period 1929-2007 relative to the A criterion. While the available data do not permit a scientifically rigorous estimation of the extent of population reduction, it is reasonable to use conventional population assessment methods to provide a crude indication of the extent of possible reduction relative to the criteria. A conventional deterministic age-structured model with an age at first capture (“recruitment”) (ar) and an age at first reproduction (am), and linear density-dependence was applied to the North Pacific, North Atlantic and Southern Hemisphere regions separately. The parameter values are listed in Table 1 in the attached PDF document (which forms an integral part of this assessment). The starting year was 1874 in the North Atlantic and 1900 in the North Pacific and Southern Hemisphere. The sex ratio of the population and catches is assumed to be 50:50. The results of this population assessments can be found in the linked PDF document, which forms an integral part of this assessment.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Prior to the advent of modern whaling in the late 19th century, fin whales were largely immune from human predation because they were too hard to catch. Fin whales were depleted worldwide by commercial whaling in the 20th century. Fin whales have been protected in the Southern Hemisphere and North Pacific since 1975, and catches ceased in the North Atlantic by 1990, except for small “aboriginal subsistence” catches off Greenland. Commercial catches resumed off Iceland in 2006, with nine fin whales being taken that year. A Japanese fleet resumed experimental catches of fin whales in the Antarctic in 2005, taking 10 whales each during 2005/06 and 2006/07, with plans to take 50 per year from the 2007/08 season (IWC 2006a). It seems unlikely that catching of fin whales will return to the high levels of previous years, not least due to the limited market demand for whale products.

Fin whales are one of the more commonly recorded species of large whale reported in vessel collisions (Laist et al. 2001). Five fatal collisions were recorded off the US east coast during 2000-04 (Cole et al. 2006). Collisions with vessels appear to be a significant, but not necessarily unsustainable, source of mortality for the Mediterranean population (Panigada et al. 2006, Reeves and Notarbartolo di Sciara 2006).

Fin whales are occasionally caught in fishing gear as a by-catch. Four deaths and serious injuries from this source were reported from the eastern US coast during 2000-04 (Cole et al. 2006); recent Japanese Progress Reports to the IWC (www.iwcoffice.org/sci_com/scprogress.htm) reported about 1 fin whale by-caught per year on average.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Populations in all oceans were greatly reduced by historical commercial whaling. Threatened by heavy metal pollution from dumped waste in the Mediterranean. Human exploitation of euphausiids in the southern ocean is a potential threat.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The major threat to the survival of this species has been hunting; their blubber, oil and baleen were all highly prized (4). Between 1935 and 1965, over 30,000 individuals were killed every year (7). At present, there is evidence of man-made injuries to fin whales, many of which have resulted from collisions with boats (9). Like other large whales, they are also threatened by environmental change, including noise and chemical pollution (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The IWC set catch limits at zero for fin whales in the North Pacific and Southern Hemisphere from 1976. The IWC adopted a provision (popularly known as the commercial whaling moratorium) in 1982 to set all catch limits for commercial whaling to zero from1986. This provision does not apply to Norway or the Russian Federation which have objected to this provision. Iceland also considers itself not bound by the provision, based on a reservation attached to its adherence to the treaty governing the IWC. Limited “aboriginal subsistence” whaling is permitted by the IWC for fin whales in Greenland.


Fin whales are listed on Appendix I of the Convention on Trade in Endangered Species (CITES), but this does not apply to Iceland, Norway and Japan, who hold reservations. Fin whales are also listed on Appendices I and II of the Convention on Migratory Species (CMS). Under the Agreement for Conservation of Cetaceans in the Black and Mediterranean Seas (ACCOBAMS), fin whales in the Mediterranean, along with other cetaceans, are protected from deliberate killing by signatories to the agreement.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: A draft recovery plan for the North Pacific and North Atlantic stocks was available in August 1998 (www.nmfs.gov/tmcintyr/prot_res.html/).

Biological Research Needs: Research on how successful/unsuccessful protection has been (i.e., have numbers increased dramatically, etc...).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Enforce national and international conservation measures. See IUCN (1991) for a discussion of international protection measures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1985, the International Whaling Commission (IWC) banned the hunting of all whales by signatory states. The IWC regulates the International Convention for the Regulation of Whaling (1946), and also provides scientific advice to signatory states (11). Conservationists are worried however, that these protection measures are a case of 'too little too late', the southern hemisphere is thought to support only 5,000 fin whales, and the northern seas hold just 2 to 3,000 individuals (4). It seems likely that the species may never recover from past over-exploitation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Fin whales have no negative economic effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Historically, fin whales were hunted extensively for their oil and blubber, as well as their baleen. Aboriginal peoples have hunted fin whales for centuries and all parts of the whale were integral in their lives as a source of food, fuel, and building materials. Large-scale hunting efforts peaked in the 1950’s, as nearly 10,000 whales were killed every year.

Positive Impacts: food ; body parts are source of valuable material; source of medicine or drug ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long exploited by commercial whaling; harvest increased greatly in the 1920s and 1930s as factory ships moved into the Southern Ocean and blue whale became scarce; commercial whaling declined to essentially zero in the 1970s and 1980s, though harvesting for subsistence use in Greenland and for "scientific research" in Iceland have continued. In the early 1990s, resumption of commercial whaling in the North Atlantic was a possibility. See IUCN (1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Endangered (EN)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Fin whale

The fin whale (Balaenoptera physalus), also called the finback whale, razorback, or common rorqual, is a marine mammal belonging to the suborder of baleen whales. It is the second longest animal in the world and second largest rorqual after the blue whale,[3] growing to over 27 metres (89 ft) long[4] and weighing nearly 74 tonnes (73 long tons; 82 short tons).[5] The American naturalist Roy Chapman Andrews called the fin whale "the greyhound of the sea... for its beautiful, slender body is built like a racing yacht and the animal can surpass the speed of the fastest ocean steamship."[6]

Long and slender, the fin whale's body is brownish-grey with a paler underside. There are at least two recognized subspecies: the fin whale of the North Atlantic, and the fin whale of the Southern Hemisphere. It is found in all the world's major oceans, from polar to tropical waters. It is absent only from waters close to the ice pack at both the north and south poles and relatively small areas of water away from the open ocean. The highest population density occurs in temperate and cool waters.[7] Its food consists of small schooling fish, squid, and crustaceans including copepods and krill.

Like all other large whales, the fin whale was heavily hunted during the twentieth century and is an endangered species. Over 725,000 fin whales were reported taken from the Southern Hemisphere alone between 1905 and 1976 and there are now thought to be only 38,000 in that region (ref. to 1997).[2] The International Whaling Commission (IWC) has issued a moratorium on commercial hunting of this whale,[8] although Iceland and Japan have resumed hunting: in 2009 and 2010, Iceland took 125 and 148 fin whales, while Japan has taken five fin whales in four seasons (2008-12) of whaling in the Antarctic.[9][10][11] The species is also hunted by Greenlanders under the Aboriginal Subsistence Whaling provisions of the IWC. Estimates suggest that the population of the remaining fin whales in the world's seas range from less than 100,000 to roughly 119,000.[2][12] Collisions with ships and noise from human activity also significantly threaten recovery.

Contents

Taxonomy

Taxonomy diagram
A cladogram of animals related to the fin whale

The fin whale has long been known to taxonomists. It was first described by Friderich Martens in 1675 and then again by Paul Dudley in 1725. The former description was used as the primary basis of the species Balaena physalus by Carl Linnaeus in 1758.[13] In 1804, Bernard Germain de Lacépède reclassified the species as Balaenoptera rorqual, based on a specimen that had stranded on Île Sainte-Marguerite (Cannes, France) in 1798. In 1830, Louis Companyo described a specimen that had stranded near Saint-Cyprien, southern France, in 1828 as Balaena musculus. Most later authors followed him in using the specific name musculus, until Frederick W. True (1898) showed that it referred to the blue whale. In 1846, the British taxonomist John Edward Gray described a 16.7 m (55 ft) specimen from the Falkland Islands as Balaenoptera australis, while the German naturalist Hermann Burmeister in 1865 described a c. 15 m (50 ft) specimen found near Buenos Aires about thirty years earlier as Balaenoptera patachonicus. In 1903, the Romanian scientist Emil Racoviță placed all these designations into Balaenoptera physalus.[14][15] The word "physalus" comes from the Greek word physa, meaning "blows", referring to the prominent blow of the species (as described by Martens [1675, p. 132]: "They know the finn-fish by the... vehement blowing and spouting up of the water...").

Fin whales are rorquals, members of the family Balaenopteridae, which also includes the humpback whale, the blue whale, the Bryde's whale, the sei whale and the minke whale. The family diverged from the other baleen whales in the suborder Mysticeti as long ago as the middle Miocene,[16] although it is not known when the members of these families further evolved into their own species. Hybridization between the blue whale and the fin whale is known to occur at least occasionally in the North Atlantic[17] and in the North Pacific.[18] Recent DNA evidence indicates that the fin whale may be more closely related to the humpback whale (Megaptera novaeangliae), and in at least one study the gray whale (Eschrichtius robustus), two whales in different genera, than it is to members of its own genus, such as the minke whales.[19][20] If further research confirms this theory, this taxonomy would need revision.

As of 2006, there are two named subspecies, each with distinct physical features and vocalizations. The Northern fin whale, B. p. physalus (Linnaeus 1758), inhabits the North Atlantic, and the Antarctic fin whale, B. p. quoyi (Fischer 1829), occupies the Southern Ocean.[21] Most experts consider the fin whales of the North Pacific to be a third, as yet unnamed subspecies.[7] The three groups mix at most rarely.[citation needed]

Description and behavior

Fin whale skeleton
Fin whales often travel in pairs

The fin whale is usually distinguished by its tall spout, long back, prominent dorsal fin, and asymmetrical coloration. In the Northern Hemisphere, the average size of adult males and females is about 18.5 m (60 ft) and 20 m (65 ft), while in the Southern Hemisphere it is 20.5 m (67 ft) and 22 m (72 ft).[22] In the North Atlantic, the longest reported was 24.5 m (80' 6" ft) (what whalers' called a "bastard", a possible blue/fin hybrid), while the longest measured by True (1904) was 21.5 m (70' 8" ft), both females. In the North Pacific, the longest reported were 22.9 m (75 ft) for males and 24.7 m (81 ft) for females, while the longest reliably measured were 20.8 m (68 ft) and 22.9 m (75 ft), respectively.[23] In the Southern Hemisphere, the longest reported for each sex were 25 m (82 ft) and 27.3 m (89' 6" ft), while the longest measured by Mackintosh and Wheeler (1929) were 22.4 m (73' 7" ft) and 24.5 m (80' 5" ft);[4] although Major F. A. Spencer, while whaling inspector of the factory ship Southern Princess (1936-38), confirmed the length of a 25.9 m (85 ft) female caught in the Antarctic south of the southern Indian Ocean.[24] The largest fin whale ever weighed (piecemeal) was a 22.7 m (74.5 ft) pregnant female caught by Japanese whalers in the Antarctic in 1948 which weighed 69.5 tonnes (68.4 long tons; 76.6 short tons), minus 6% for loss of fluids during the flensing process.[5] Full physical maturity is attained between 25 and 30 years. Fin whales live to 94 years of age,[25] although specimens have been found aged at an estimated 135–140 years.[26] A newborn fin whale measures about 6.5 metres (21 ft) in length and weighs approximately 1,800 kilograms (4,000 lb).[27] The animal's large size aids in identification, and it is usually only confused with the blue whale, the sei whale, or, in warmer waters, Bryde's whale.

The fin whale is brownish to dark or light gray dorsally and white ventrally. It has paired blowholes on a prominent splashguard, and a broad, flat V-shaped rostrum. Two lighter-colored chevrons radiate from the eyes and curve forward, joining to form a V-shape oriented towards the head.[12] Its lower jaw (and occasionally upper jaw) is white, while the left side of the jaw is gray or black.[12] This type of asymmetry is seen in Omura's whale and occasionally in minke whales. It was hypothesized to have evolved because the whale swims on its right side when surface lunging and it often circles to the right while at the surface above a prey patch. However, the whales just as often circle to the left. There is no accepted hypothesis to explain the asymmetry.[28]

Fin whale arching for a deep dive, showing characteristic backswept dorsal fin

The whale has a series of 56–100 pleats or grooves along the bottom of the body that run from the tip of the chin to the navel that allow the throat area to expand greatly during feeding. It has a curved, prominent 60 centimetres (24 in) dorsal fin about three-quarters of the way along the back. Its flippers are small and tapered, and its tail is wide, pointed at the tip, and notched in the centre.[12]

When the whale surfaces, the dorsal fin is visible soon after the spout. The spout is vertical and narrow and can reach heights of 6 metres (20 ft) or more.[12] When feeding, they will blow 5-7 times in quick succession, but while traveling or resting will blow a single time every minute or two. On their terminal (last) dive they arch their back high out of the water, but rarely raise their flukes out of the water. It then dives to depths of up to 470 metres (1,540 ft) when feeding or only a few hundred feet when resting or traveling. The average feeding dive off California and Baja lasts 6 minutes, with a maximum of 17 minutes; when traveling or resting they usually dive for only a few minutes at a time.[29] Fin whales rarely breach.[12]

Life history

Mating occurs in temperate, low-latitude seas during the winter, followed by an eleven months to one year gestation period. A newborn weans from its mother at 6 or 7 months of age when it is 11 metres (36 ft) to 12 metres (39 ft) in length, and the calf accompanies the mother to the summer feeding ground. Females reproduce every 2 to 3 years, with as many as 6 fetuses being reported, but single births are far more common. Females reach sexual maturity at between 6 and 12 years of age at lengths of 17.7-19 m (58-62.5 ft) in the Northern Hemisphere and 20 m (65 ft) in the Southern Hemisphere.[22]

Predation

The only known predator of the fin whale is the killer whale, with at least twenty eyewitness and second-hand accounts of attack or harassment. They usually flee and offer little resistance to attack. Only a single confirmed fatality has occurred: in October 2005, sixteen killer whales attacked and killed a fin whale in the Canal de Ballenas, Gulf of California, after chasing it for about an hour. They fed on its sinking carcass for about 15 minutes before leaving the area. In July 1908, a whaler reportedly saw two killer whales attack and kill a fin whale off western Greenland. In January 1984 seven were seen from the air circling, holding the flippers, and ramming a fin whale in the Gulf of California, but the observation ended when darkness set in.[30][31]

Feeding

Photo of whale at surface
Overhead view of a fin whale feeding

The fin whale is a filter-feeder, feeding on small schooling fish, squid, and crustaceans including copepods and krill. In the North Pacific, they feed on the krill species Euphausia pacifica, Thysanoessa inermis, T. longipes, T. spinifera, and Nyctiphanes simplex; large copepods (mainly Neocalanus cristatus); squid (Ommastrephes sloani pacificus); and schooling fish such as herring, Japanese sardine (Sardinella melanosticta), walleye pollock (Theragra chalcogramma), capelin, and anchovies (Engraulis mordax). In the North Atlantic, they prey on krill (Meganyctiphanes norvegica and T. inermis) and small schooling fish (e.g. capelin, Mallotus villosus; herring, Clupea harengus; and sand lance, Ammodytes spp.). In the Southern Ocean they mainly consume E. superba.[7][32][33]

It feeds by opening its jaws while swimming at a relatively high speed, 11 kilometres per hour (6.8 mph) in one study,[34] which causes it to engulf up to 70 cubic metres (18,000 US gal; 15,000 imp gal) of water in one gulp. It then closes its jaws and pushes the water back out of its mouth through its baleen, which allows the water to leave while trapping the prey. An adult has between 262 and 473 baleen plates on each side of the mouth. Each plate is made of keratin that frays out into fine hairs on the ends inside the mouth near the tongue. Each plate can measure up to 76 centimetres (30 in) in length and 30 centimetres (12 in) in width.[3] The whale routinely dives to depths of more than 200 metres (660 ft) where it executes an average of four "lunges", where it feeds on aggregations of krill. Each gulp provides the whale with approximately 10 kilograms (22 lb) of krill.[34] One whale can consume up to 1,800 kilograms (4,000 lb) of food a day,[3] leading scientists to conclude that the whale spends about three hours a day feeding to meet its energy requirements, roughly the same as humans. If prey patches are not sufficiently dense, or are located too deep in the water, the whale has to spend a larger portion of its day searching for food.[34] One hunting technique is to circle schools of fish at high speed, frightening the fish into a tight ball, then turning on its side before engulfing the massed prey.[3]

Behavior

The fin whale is one of the fastest cetaceans and can sustain speeds of 37 kilometres per hour (23 mph)[27] and bursts in excess of 40 kilometres per hour (25 mph) have been recorded, earning the fin whale the nickname "the greyhound of the sea".[35] Fin whales are more gregarious than other rorquals, and often live in groups of 6–10, although feeding groups may reach up to 100 animals.[25]

Vocalizations

Multimedia relating to the fin whale
Note that the whale calls have been sped up 10x from their original speed.

Like other whales, the male fin whale makes long, loud, low-frequency sounds.[27] The vocalizations of blue and fin whales are the lowest-frequency sounds made by any animal.[36] Most sounds are frequency-modulated (FM) down-swept infrasonic pulses from 16 to 40 hertz frequency (the range of sounds that most humans can hear falls between 20 hertz and 20 kilohertz). Each sound lasts one to two seconds, and various sound combinations occur in patterned sequences lasting 7 to 15 minutes each. The whale then repeats the sequences in bouts lasting up to many days.[37] The vocal sequences have source levels of up to 184–186 decibels relative to 1 micropascal at a reference distance of one metre, and can be detected hundreds of miles from their source.[38]

When fin whale sounds were first recorded by US biologists, they did not realize that these unusually loud, long, pure and regular sounds were being made by whales. They first investigated the possibilities that the sounds were due to equipment malfunction, geophysical phenomena, or even part of a Soviet Union scheme for detecting enemy submarines. Eventually, biologists demonstrated that the sounds were the vocalizations of fin whales.[36]

Direct association of these vocalizations with the reproductive season for the species and that only males make the sounds point to these vocalizations as possible reproductive displays.[39][40] Over the past 100 years, the dramatic increase in ocean noise from shipping and naval activity may have slowed the recovery of the fin whale population, by impeding communications between males and sexually receptive females.[41]

Range and habitat

Aerial view of a fin whale, showing V-shaped chevron

Like many large rorquals, the fin whale is a cosmopolitan species. It is found in all the world's major oceans, and in waters ranging from the polar to the tropical. It is absent only from waters close to the ice pack at both the north and south extremities and relatively small areas of water away from the large oceans, such as the Red Sea and the Baltic Sea. The highest population density occurs in temperate and cool waters. It is less densely populated in the warmest, equatorial regions. It prefers deep waters beyond the continental shelf to shallow waters.[citation needed]

The North Atlantic fin whale has an extensive distribution, occurring from the Gulf of Mexico and Mediterranean Sea, northward to the edges of the Arctic ice pack. In general, fin whales are more common north of approximately 30°N latitude, but considerable confusion arises about their occurrence south of 30°N latitude because of the difficulty in distinguishing fin whales from Bryde's whales.[42] Extensive ship surveys have led researchers to conclude that the summer feeding range of fin whales in the western North Atlantic was mainly between 41°20'N and 51°00'N, from shore seaward to the 1,000 fathoms (1,800 m) contour.[43]

Summer distribution of fin whales in the North Pacific is the immediate offshore waters from central Baja California to Japan, and as far north as the Chukchi Sea bordering the Arctic Ocean.[44] They occur in high densities in the northern Gulf of Alaska and southeastern Bering Sea between May and October, with some movement through the Aleutian passes into and out of the Bering Sea.[45] Several whales tagged between November and January off southern California were killed in the summer off central California, Oregon, British Columbia, and in the Gulf of Alaska.[44] Fin whales have been observed feeding 250 miles south of Hawaii in mid-May, and several winter sightings have been made there.[46] Some researchers have suggested that the whales migrate into Hawaiian waters primarily in the autumn and winter.[47]

Although fin whales are certainly migratory, moving seasonally in and out of high-latitude feeding areas, the overall migration pattern is not well understood. Acoustic readings from passive-listening hydrophone arrays indicate a southward migration of the North Atlantic fin whale occurs in the autumn from the Labrador-Newfoundland region, south past Bermuda, and into the West Indies.[48] One or more populations of fin whales are thought to remain year-round in high latitudes, moving offshore, but not southward in late autumn.[48] In the Pacific, migration patterns are poorly characterized. Although some fin whales are apparently present year-round in the Gulf of California, there is a significant increase in their numbers in the winter and spring.[49] Antarctic fin whales migrate seasonally from relatively high-latitude Antarctic feeding grounds in the summer to low-latitude breeding and calving areas in the winter. The location of winter breeding areas is still unknown, since these whales tend to migrate in the open ocean.[7]

Population and trends

A frontal view of a fin whale, showing asymmetrical coloration

Poor understanding of migration patterns combined with contradictory population surveys makes estimating the historical and current population levels of the whale difficult and contentious. Due to a long history of hunting this whale, pre-exploitation population levels are difficult to determine.[citation needed]

North Atlantic

Photo of stamp displaying diving whale with bent tail with Faroyar printed across the top and Nebbafiskur and Baelaenoptera physalus in successively smaller print at bottom
Drawing of a fin whale on a Faroese stamp, issued 17 September 2001

North Atlantic fin whales are defined by the International Whaling Commission to exist in one of seven discrete population zones: Nova Scotia-New England, Newfoundland-Labrador, western Greenland, eastern Greenland-Iceland, North Norway, West Norway-Faroe Islands, and Ireland-Spain-United Kingdom-Portugal. Results of mark-and-recapture surveys have indicated that some movement occurs across the boundaries of these population zones, suggesting that each zone is not entirely discrete and that some immigration and emigration does occur.[43] J. Sigurjónsson estimated in 1995 that total pre-exploitation population size in the entire North Atlantic ranged between 50,000 and 100,000 animals,[50] but his research is criticized for not providing supporting data and an explanation of his reasoning.[7] In 1977, D.E. Sergeant suggested a "primeval" aggregate total of 30,000 to 50,000 throughout the North Atlantic.[51] Of that number, about 8,000 to 9,000 would have resided in the Newfoundland and Nova Scotia areas, with whales summering in U.S. waters south of Nova Scotia presumably omitted.[7][52] J.M. Breiwick estimated that the "exploitable" (above the legal size limit of ft50) component of the Nova Scotia population was 1,500 to 1,600 animals in 1964, reduced to only about 325 in 1973.[53] Two aerial surveys in Canadian waters since the early 1970s gave numbers of 79 to 926 whales on the eastern Newfoundland-Labrador shelf in August 1980,[54] and a few hundred in the northern and central Gulf of Saint Lawrence in August 1995–1996.[55] Summer estimates in the waters off western Greenland range between 500 and 2,000,[56] and in 1974, Jonsgard considered the fin whales off Western Norway and the Faroe Islands to "have been considerably depleted in postwar years, probably by overexploitation".[57] The population around Iceland appears to have fared much better, and in 1981, the population appeared to have undergone only a minor decline since the early 1960s.[58] Surveys during the summers of 1987 and 1989 estimated of 10,000 to 11,000 between eastern Greenland and Norway.[59] This shows a substantial recovery when compared to a survey in 1976 showing an estimate of 6,900, which was considered to be a "slight" decline since 1948.[60] A Spanish NASS survey in 1989 of the France-Portugal-Spain sub-area estimated a summer population range at 17,355.[61] The aggregate population level is estimated to be between 40,000[62] and 56,000[17] individuals.

North Pacific

Photo of skeleton from read displaying individual bones extending much of body length
Fin whale skeleton

The total historical North Pacific population was estimated at 42,000 to 45,000 before the start of whaling. Of this, the population in the eastern portion of the North Pacific was estimated to be 25,000 to 27,000.[63] By 1975, the estimate had declined to between 8,000 and 16,000.[64][65] Surveys conducted in 1991, 1993, 1996, and 2001 produced estimates of between 1,600 and 3,200 off California and 280 to 380 off Oregon and Washington.[66] The miniumum estimate for the California-Oregon-Washington population, as defined in the U.S. Pacific Marine Mammal Stock Assessments: 2005, is about 2,500.[67] Surveys in coastal waters of British Columbia in summers 2004 and 2005 produced abundance estimates of approximately 500 animals (95% confidence intervals: 201-1,220).[68] Surveys near the Pribilof Islands in the Bering Sea indicated a substantial increase in the local abundance of Fin Whales between 1975–1978 and 1987–1989.[69] In 1984, the entire population was estimated to be at less than 38% of its historic carrying capacity.[70]

Antarctica

Relatively little is known about the historical and current population levels of the Antarctic fin whale. The IWC officially estimates that the Southern Hemisphere pre-whaling population was 400,000 whales, and that the population in 1979 (at the cessation of Antarctic large scale whaling) was 85,200.[71] Both the current and historical estimates should be considered as poor estimates because the methodology and data used in the study are known to be flawed.[7] Other estimates cite current size to be between 15,000 (1983) and 38,000 (1997).[2] As of 2006, there is no scientifically accepted estimate of current population or trends in abundance.[7]

Human interaction

Photo of whale on flensing platform with man standing in its opened mouth
A 65 long tons (66 t), 72 feet (22 m) fin whale caught at Grays Harbor circa 1912
"The Finback" (Balaenoptera velifera, Cope) from Charles Melville Scammon's Marine Mammals of the North-western coast of North America (1874)

In the 19th century, the fin whale was occasionally hunted by open-boat whalers, but it was relatively safe because of its speed and the fact that it often sank when killed. However, the later introduction of steam-powered boats and harpoons that exploded on impact made it possible to kill and secure them along with blue whales and sei whales on an industrial scale. As other whale species became over-hunted, the whaling industry turned to the still-abundant fin whale as a substitute.[72] It was primarily hunted for its blubber, oil, and baleen. Approximately 704,000 fin whales were caught in Antarctic whaling operations alone between 1904 and 1975.[73]

The introduction of factory ships with stern slipways in 1925 substantially increased the number of whales taken per year. In 1937-38 alone, over 29,000 fin whales were taken. From 1953-54 to 1961-62, the catch averaged over 30,000 per year. By 1962-63, sei whale catches began to increase as fin whales became scarce. By 1975-76, fewer than 1,000 fin whales were being caught each year. In the North Pacific, over 74,000 fin whales were caught between 1910 and 1975.[74] Between 1910 and 1989, over 55,000 were caught in the North Atlantic.[75]

The IWC prohibited hunting in the Southern Hemisphere in 1976.[73] The Soviet Union engaged in the illegal killing of protected whale species in the North Pacific and Southern Hemisphere, over-reporting fin whale catches to cover up illegal takes of other species. In the North Pacific, they reported taking over 10,000 fin whales between 1961-79, while the true catch was less than 9,000. In the Southern Hemisphere, they reported taking nearly 53,000 between 1948-73, when the true total was a little over 41,000.[76][77][78] The fin whale was given full protection from commercial whaling by the IWC in the North Pacific in 1976, and in the North Atlantic in 1987, with small exceptions for aboriginal catches and catches for research purposes.[27] All populations worldwide remain listed as endangered species by the US National Marine Fisheries Service and the International Conservation Union Red List, and the fin whale is on Appendix 1 of CITES.[2][79][80]

The IWC has set a quota of 19 fin whales per year for Greenland. Meat and other products from whales killed in these hunts are widely marketed within Greenland, but export is illegal. Iceland and Norway are not bound by the IWC's moratorium on commercial whaling because both countries filed objections to the moratorium.[7] In October 2006, Iceland's fisheries ministry authorized the hunting of nine fin whales through August 2007.[81] In 2009 and 2010, Iceland caught 125 and 148 fin whales, respectively.[82]

In the southern hemisphere, Japan permits annual takes of 10 fin whales under its Antarctic Special Permit whaling program for the 2005–2006 and 2006–2007 seasons.[83] The proposal for 2007–2008 and the subsequent 12 seasons allows taking 50 per year,[7] but no fin whales had been caught in the 2007-2008 season. A single fin whale was caught in both the 2008-09 and 2009-10 seasons, two were taken in the 2010-11 season, and one was taken in the 2011-12 season.[84]

Collisions with ships are a major cause of mortality. In some areas, they cause a substantial portion of large whale strandings. Most serious injuries are caused by large, fast-moving ships over or near the continental shelf.[85]

Museums

Several fin whale skeletons are exhibited in North America. The Natural History Museum of Los Angeles County in Los Angeles, California has an exhibit entitled the "Fin Whale Passage", which displays a 19.2 m (63 ft) fin whale skeleton collected by former museum osteologist Eugene Fischer and field collector Howard Hill in 1926 from the Trinidad whaling station (1920-1926) in Humboldt County, northern California. A steel armature supports the skeleton, which is accompanied by sculpted flukes.[86] Science North, a science museum in Greater Sudbury, Ontario, Canada, has a 20 m (65.6 ft) fin whale skeleton collected from Anticosti Island hanging from the fourth floor of their main building.[87]

Several fin whale skeletons are also exhibited in Europe. The Natural History Museum of Slovenia in Ljubljana, Slovenia, houses a 13 m (42.5 ft) female fin whale skeleton – the specimen had been found floating in the Gulf of Piran in the spring of 2003.[88] The Hungarian Natural History Museum in Budapest, Hungary, displays a fin whale skeleton hanging near its main entrance which had been caught in the Atlantic Ocean in 1896 and purchased from Vienna in 1900.[89] The Cambridge University Museum of Zoology, in Cambridge, United Kingdom, exhibits a nearly 70 ft (21 m) male fin whale skeleton, which had stranded at Pevensey, East Sussex, in November 1865.[90]

The Otago Museum, in Dunedin, New Zealand, displays a 16.76 m (55 ft) fin whale skeleton, which had stranded on the beach at Nelson at the entrance of the Waimea River in 1882.[91]

Whale watching

Fin whales are regularly encountered on whale watching excursions worldwide. In the Southern California Bight, fin whales are encountered year-round, with a peak in the summer and fall. They can even be seen from land (for example, from Point Vicente, Palos Verdes, where they can be seen lunge feeding at the surface only a half mile to a few miles offshore). They are regularly sighted in the summer and fall in the Gulf of St. Lawrence,[92] the Gulf of Maine, the Bay of Fundy, the Bay of Biscay, and the western Mediterranean. In southern Ireland, they are seen from June to February, with peak sightings in November and December.[93] Cruise ships en route to and from the Antarctic Peninsula sometimes encounter fin whales in the Drake Passage.

Conservation

The Fin whale is listed on both Appendix I[94] and Appendix II[94] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix I[94] as this species has been categorized as being in danger of extinction throughout all or a significant proportion of their range and CMS Parties strive towards strictly protecting these animals, conserving or restoring the places where they live, mitigating obstacles to migration and controlling other factors that might endanger them and also on Appendix II[94] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements. In addition, Fin whale is covered by the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS) and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU).

See also

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 725. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300023. 
  2. ^ a b c d e Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera physalus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b c d "Balaenoptera physalus Fin Whale". MarineBio.org. http://marinebio.org/species.asp?id=40. Retrieved 2006-10-23. 
  4. ^ a b Mackintosh, N. A. and J. F. G. Wheeler. (1929). Southern blue and fin whales. Discovery Reports, Vol. I, pp. 259-540.
  5. ^ a b Lockyer, C. (1976). Body weights of some species of large whales. J. Cons. int. Explor. Mer, 36 (3); 259-273.
  6. ^ Andrews, Roy Chapman. 1916. Whale hunting with gun and camera; a naturalist's account of the modern shore-whaling industry, of whales and their habits, and of hunting experiences in various parts of the world. New York: D. Appleton and Co., p. 158.
  7. ^ a b c d e f g h i j National Marine Fisheries Service (2006) (pdf). Draft recovery plan for the fin whale (Balaenoptera physalus). Silver Spring, Maryland: National Marine Fisheries Service. http://www.nmfs.noaa.gov/pr/pdfs/recovery/draft_finwhale.pdf. 
  8. ^ "Revised Management Scheme". International Whaling Commission. http://www.iwcoffice.org/conservation/rms.htm. Retrieved 2006-11-07. 
  9. ^ Revkin, Andrew C. (2009-09-08). "Iceland Defends Its Hunt of 94 (Now 125) Fin Whales". The New York Times. http://dotearth.blogs.nytimes.com/2009/09/08/us-rebukes-iceland-for-killing-94-fin-whales. 
  10. ^ http://www.iwcoffice.org/conservation/table_permit.htm
  11. ^ http://www.icrwhale.org/120331ReleasebougaiENG.html
  12. ^ a b c d e f Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton Field Guides. pp. 43–45. ISBN 0-61-12757-2. 
  13. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii).. pp. 824. http://dz1.gdz-cms.de/index.php?id=img&no_cache=1&IDDOC=265100. 
  14. ^ Allen, G. M. (1915). The Whalebone whales of New England, pp. 176-78.
  15. ^ Cousteau, J. (1988). Whales, p. 77.
  16. ^ Gingerich, P. (2004). "Whale Evolution". McGraw-Hill Yearbook of Science & Technology. The McGraw Hill Companies. ISBN 0-07-142784-8. 
  17. ^ a b Bérubé, M.; A. Aguilar (1998). "A new hybrid between a blue whale, Balaenoptera musculus, and a fin whale, B. physalus: frequency and implications of hybridization". Mar. Mamm. Sci. 14: 82–98. doi:10.1111/j.1748-7692.1998.tb00692.x. http://www.blackwell-synergy.com/doi/abs/10.1111/j.1748-7692.1998.tb00692.x?cookieSet=1&journalCode=mms. 
  18. ^ Doroshenko, V.N. (1970). "A whale with features of the fin and blue whale (in Russian)". Izvestia TINRO 70: 225–257. 
  19. ^ Arnason, U., Gullberg A. & Widegren, B. (1 September 1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960–970. PMID 8412655. http://mbe.oxfordjournals.org/cgi/content/abstract/10/5/960. Retrieved 2009-01-25. 
  20. ^ Sasaki, T. et al. (February 23, 2005). "Mitochondrial Phylogenetics and Evolution of Mysticete Whales". Systematic Biology 54 (1): 77–90. doi:10.1080/10635150590905939. PMID 15805012. http://sysbio.oxfordjournals.org/content/54/1/77.full. Retrieved 2009-01-25. 
  21. ^ "Balaenoptera physalus". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180527. Retrieved 23 October 2006. 
  22. ^ a b Evans, Peter G. H. (1987). The Natural History of Whales and Dolphins. Facts on File.
  23. ^ Clapham et al (1997). Catches of Humpback and Other Whales from Shore Stations at Moss Landing and Trinidad, California, 1919-1926. Mar. Mam. Sci. 13 (3): 368-94.
  24. ^ Mackintosh, N. A. (1943). The southern stocks of whalebone whales. Discovery Reports, Vol. XXII, pp. 199-300.
  25. ^ a b Martin, Anthony R. (1991). Whales and dolphins. London: Salamander Books. ISBN 0-8160-3922-4. 
  26. ^ Danmarks Radio, 2010-10-28.
  27. ^ a b c d Fox, David (2001). "Balaenoptera physalus (fin whale)". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Balaenoptera_physalus.html. Retrieved 2006-10-22. 
  28. ^ Tershy, B. R.; D. Wiley (1992). "Asymmetrical pigmentation in the fin whale: a test of two feeding related hypotheses". Marine Mammal Science 8 (3): 315–318. doi:10.1111/j.1748-7692.1992.tb00416.x. 
  29. ^ Croll D. A., Acevedo-Gutiérrez A., Tershy B. R., Urbán-Ramírez J. (2001). The diving behavior of blue and fin whales: is dive duration shorter than expected based on oxygen stores? Comp Biochem Physiol A 129:797–809
  30. ^ Jefferson, T. A.,; Stacey, P. J.; Baird, R. W. (1991). "A review of killer whale interactions with other marine mammals: predation to co-existence" (PDF). Mammal Reviews 21 (4): 151–180. doi:10.1111/j.1365-2907.1991.tb00291.x. http://swfsc.noaa.gov/uploadedFiles/Divisions/PRD/Publications/Jeffersonetal.1991(8).pdf. 
  31. ^ Ford and Reeves (2008),Fight or flight: antipredator strategies of baleen whales, Mammal Review, Vol. 38, 50-86.
  32. ^ Reynolds, John Elliott, and Sentiel A. Rommel. 1999. Biology of Marine Mammals. Washington: Smithsonian Institution Press.
  33. ^ S.L. Perry; D.P. DeMaster, and G.K. Silber (1999). "Special Issue: The Great Whales: History and Status of Six Species Listed as Endangered Under the U.S. Endangered Species Act of 1973". Marine Fisheries Review 61 (1): 52–58. http://spo.nwr.noaa.gov/mfr611/mfr611.htm. 
  34. ^ a b c Lin, Brian (2007-06-07). "Whale Has Super-sized Big Gulp". University of British Columbia. http://www.publicaffairs.ubc.ca/ubcreports/2007/07jun07/whale.html. Retrieved 2007-06-08. 
  35. ^ "Fin Whale". nature.ca: Canadian Museum of Nature. http://www.nature.ca/notebooks/english/finwale.htm. Retrieved 2006-10-22. 
  36. ^ a b Payne, Roger (1995). Among Whales. New York: Scribner. pp. 176. ISBN 0-684-80210-4. 
  37. ^ "Finback Whales". Bioacoustics Research Program, Cornell Lab of Ornithology. http://www.birds.cornell.edu/brp/listen-to-project-sounds/fin-whales. Retrieved 2006-10-26. 
  38. ^ W. J. Richardson, C. R. Greene, C. I. Malme and D. H. Thomson, Marine Mammals and Noise (Academic Press, San Diego, 1995).
  39. ^ Croll, D.A.; Clark, C.W., Acevedo, A., Flores, S., Gedamke, J., and Urban, J. (2002). "Only male fin whales sing loud songs" (pdf). Nature 417 (6891): 809. doi:10.1038/417809a. http://polymer.bu.edu/hes/articles/aabmsss02.pdf. 
  40. ^ Watkins, W.; Tyack, P., Moore, K., Bird, J. (1987). "The 20 Hz signals of finback whales (Balaenoptera physalus)". The Journal of the Acoustical Society of America 82 (6): 1901–1902. doi:10.1121/1.395685. http://scitation.aip.org/getabs/servlet/GetabsServlet?prog=normal&id=JASMAN000082000006001901000001&idtype=cvips&gifs=yes. 
  41. ^ Segelken, R. (2002-06-19). "Humanity's din in the oceans could be blocking whales' courtship songs and population recovery". Cornell University. http://www.news.cornell.edu/releases/June02/ocean_noise.hrs.html. Retrieved 2006-11-11. 
  42. ^ Mead, J.G. (1977). "Records of Sei and Bryde's whales from the Atlantic Coast of the United States, the Gulf of Mexico, and the Caribbean". Rep. Int. Whal. Commn Spec. Iss. 1: 113–116. ISBN 0-906975-03-4. 
  43. ^ a b Mitchell, E. (1974). "Present status of Northwest Atlantic fin and other whale stocks". In W.E. Schevill (ed.). The Whale Problem: A Status Report. Cambridge, MA: Harvard University Press. pp. 108–169. ISBN 0-674-95075-5. 
  44. ^ a b Rice, D.W. (1974). "Whales and whale research in the eastern North Pacific". In W.E. Schevill (ed.). The Whale Problem: A Status Report. Cambridge, MA: Harvard University Press. pp. 170–195. ISBN 0-674-95075-5. 
  45. ^ Reeves, R.R.; M.W. Brown (1985). "Whaling in the Bay of Fundy". Whalewatcher 19 (4): 14–18. 
  46. ^ Mobley, J.R., Jr.; M. Smultea, T. Norris and D. Weller (1996). "Fin whale sighting north of Kaua'i, Hawai'i". Pacific Science 50 (2): 230–233. 
  47. ^ Thompson, P.O.; W.A. Friedl (1982). "A long term study of low frequency sound from several species of whales off Oahu, Hawaii". Cetology 45: 1–19. 
  48. ^ a b Clark, C.W. (1995). "Application of US Navy underwater hydrophone arrays for scientific research on whales". Rep. Int. Whal. Commn 45: 210–212. 
  49. ^ Tershy, B.R.; D. Breese and C.S. Strong (1990). "Abundance, seasonal distribution and population composition of balaenopterid whales in the Canal de Ballenas, Gulf of California, Mexico". Rep. Int. Whal. Commn Spec. Iss. 12: 369–375. ISBN 0-906975-23-9. 
  50. ^ Sigurjónsson, J. (1995). "On the life history and autecology of North Atlantic rorquals". In A.S. Blix, L. Walløe, and Ø. Ulltang (ed.). Whales, Seals, Fish and Man. Elsevier Science. pp. 425–441. ISBN 0-444-82070-1. 
  51. ^ D.E. Sergeant (1977). "Stocks of fin whales Balaenoptera physalus L. in the North Atlantic Ocean". Rep. Int. Whal. Commn 27: 460–473. 
  52. ^ Allen, K.R. (1970). "A note on baleen whale stocks of the north west Atlantic". Rep. Int. Whal. Commn 20: 112–113. 
  53. ^ Breiwick, J.M. (1993). Population dymanics and analyses of the fisheries for fin whales (Balaenoptera physalus) in the northwest Atlantic Ocean. (Ph.D. thesis) University of Washington, Seattle. 310 pp.. 
  54. ^ Hay, K. (1982). "Aerial line-transect estimates of abundance of humpback, fin, and long-finned pilot whales in the Newfoundland-Labrador area". Rep. Int. Whal. Commn 31: 373–387. 
  55. ^ Kingsley, M.C.S.; R.R. Reeves (1998). "Aerial surveys of cetaceans in the Gulf of St. Lawrence in 1995 and 1996". Marine Mammal Science 17 (1): 35–75. doi:10.1139/cjz-76-8-1529. http://rparticle.web-p.cisti.nrc.ca/rparticle/AbstractTemplateServlet?journal=cjz&volume=76&year=&issue=&msno=z98-054&calyLang=eng. 
  56. ^ Larsen, F. (1995). "Abundance of minke and fin whales off West Greenland". Rep. Int. Whal. Commn 45: 365–370. 
  57. ^ Jonsgard, A. (1974). "On whale exploitation in the eastern part of the North Atlantic Ocean". In W.E. Schevill (ed.). The Whale Problem: A Status Report. Cambridge, MA: Harvard University Press. pp. 97–107. ISBN 0-674-95075-5. 
  58. ^ Rørvik, C.J.; J. Sigurjónsson (1981). "A note on the catch per unit effort in the Icelandic fin whale fishery". Rep. Int. Whal. Commn 31: 379–383. 
  59. ^ Buckland, S.T.; K.L. Cattanach and Th. Gunnlaugsson (1992). "Fin whale abundance in the North Atlantic, estimated from Icelandic and Faroese NASS-87 and NASS-89 data". Rep. Int. Whal. Commn 42: 645–651. 
  60. ^ Rørvik, C.J.; J. Jónsson, O.A. Mathisen, and Å. Jonsgård (1976). "Fin Whales, Balaenoptera physalus (L.), Off the West Coast of Iceland. Distribution, Segregation by Length and Exploitation". Rit Fiskideildar 5: 1–30. ISSN 0484-9019. 
  61. ^ Buckland, S.T.; K.L. Cattanach and S. Lens (1992). "Fin whale abundance in the eastern North Atlantic, estimated from Spanish NASS-89 data". Rep. Int. Whal. Commn 42: 457–460. 
  62. ^ Bérubé, M.; Aguilar, A., Dendanto, D., Larsen, F., Notarbartolo di Sciara, G., Sears, R., Sigurjónsson, J., Urbán-R, J. and Palsbøll, P.J. (1998). "Population genetic structure of North Atlantic, Mediterranean Sea and Sea of Cortez Fin Whales, Balaenoptera physalus (Linnaeus 1758): analysis of mitochondrial and nuclear foci". Molecular Ecology 7 (5): 585–599. doi:10.1046/j.1365-294x.1998.00359.x. ISSN 1471-8278. PMID 9633102. http://www.ingentaconnect.com/content/bsc/mecol/1998/00000007/00000005/art00004. 
  63. ^ Ohsumi, S.; S. Wada (1974). "Status of whale stocks in the North Pacific, 1972". Rep. Int. Whal. Commn 24: 114–126. 
  64. ^ Rice, D.W. (1974). "Whales and whale research in the eastern North Pacific". In W.E. Schevill (ed.). The Whale Problem: A Status Report. Cambridge, MA: Harvard University Press. pp. 170–195. ISBN 0-674-95075-5. 
  65. ^ Chapman, D.G. (1976). "Estimates of stocks (original, current, MSY level and MSY)(in thousands) as revised at Scientific Committee meeting 1975". Rep. Int. Whal. Commn 26: 44–47. 
  66. ^ Barlow, J. (2003). Preliminary estimates of the Abundance of Cetaceans along the U.S. West Coast: 1991–2001. Administrative report LJ-03-03, available from Southwest Fisheries Science Center, 8604 La Jolla Shores Dr., La Jolla CA 92037. 
  67. ^ Caretta, J.V., K.A. Forney, M.M. Muto, J. Barlow, J. Baker, B. Hanson, and M.S. Lowry (2006) (PDF). U.S. Pacific Marine Mammal Stock Assessments: 2005. U.S. Department of Commerce Technical Memorandum, NOAA-TM-NMFS-SWFSC-388. http://www.nmfs.noaa.gov/pr/pdfs/sars/po2005.pdf. 
  68. ^ Williams, R. and Thomas, L. (2007). "Distribution and abundance of marine mammals in the coastal waters of BC, Canada" (PDF). Journal of Cetacean Research and Management 9: 15–28. http://www.marinemammal.org/MMRU/williams/williams%20thomas%20jcrm%202007%20015-028.pdf. 
  69. ^ Baretta, L.; G.L. Hunt, Jr. (1994). "Changes in the numbers of cetaceans near the Pribilof Islands, Bering Sea, between 1975–78 and 1987–89" (PDF). Arctic 47: 321–326. http://pubs.aina.ucalgary.ca/arctic/Arctic47-4-321.pdf. 
  70. ^ Mizroch, S.A.; D.W. Rice, and J.M. Breiwick (1984). "The fin whale, Balaenoptera physalus". Mar. Fish. Review 46: 20–24. 
  71. ^ IWC (1979). "Report of the sub-committee on protected species. Annex G, Appendix I". Rep. Int. Whal. Commn 29: 84–86. 
  72. ^ "American Cetacean Society Fact Sheet: Fin Whale, Balaenoptera physalus". American Cetacean Society. http://acsonline.org/fact-sheets/fin-whale/. Retrieved 2012-3-12. 
  73. ^ a b IWC (1995). "Report of the scientific committee". Rep. Int. Whal. Commn 45: 53–221. 
  74. ^ Barlow, J., K. A. Forney, P.S. Hill, R.L. Brownell, Jr., J.V. Caretta, D.P. DeMaster, F. Julian, M.S. Lowry, T. Ragen, and R.R. Reeves (1997) (PDF). U.S. Pacific Marine Mammal Stock Assessments: 1996. NOAA Technical Memo NMFD-SWFSC-248. http://swfsc.noaa.gov/publications/TM/SWFSC/NOAA-TM-NMFS-SWFSC-248.PDF. 
  75. ^ International Whaling Statistics.
  76. ^ Clapham, P. J. and C. Scott Baker. "Reported vs. Actual Catches by the U.S.S.R. in the Southern Hemisphere, 1948-73". Appendix II in Berzin, A. A.; trans. by Y. V. Ivashchenko (2008). "The Truth About Soviet Whaling". Marine Fisheries Review. 70 (2), pp. 4-59.
  77. ^ Clapham, P.J. and R. L. Brownell, Jr. "Soviet catches of large whales in the North Pacific", 1961-79. Appendix III in Berzin, A. A.; trans. by Y. V. Ivashchenko (2008). "The Truth About Soviet Whaling". Marine Fisheries Review. 70 (2), pp. 4-59.
  78. ^ Yablokov, A.V. (1994). "Validity of whaling data". Nature 367 (6459): 108. doi:10.1038/367108a0. 
  79. ^ "UNEP-WCMC Species Database: CITES-Listed Species". UNEP-WCMC. 2006-10-23. http://www.unep-wcmc.org/isdb/CITES/Taxonomy/tax-species-result.cfm?displaylanguage=eng&Genus=Balaenoptera&Species=physalus&source=animals&Country=&tabname=status. Retrieved 2006-10-23. 
  80. ^ "Species Profile for Finback whale". U.S. Fish & Wildlife Service. http://ecos.fws.gov/speciesProfile/SpeciesReport.do?spcode=A02O. Retrieved 2006-10-23. 
  81. ^ "Iceland to Resume Whale Hunting, Defying Global Ban". Bloomberg.com. 2006-10-18. http://www.bloomberg.com/apps/news?pid=20601085&sid=a4fs59pxIqXI&refer=europe. Retrieved 2006-10-23. 
  82. ^ "Catches under Objection". International Whaling Commission. http://www.iwcoffice.org/conservation/table_objection.htm. Retrieved 2012-2-6. 
  83. ^ "U.S. Protests Japan's Announced Return to Whaling in Antarctic". Bureau of International Information Programs, U.S. Department of State. 20 November 2006. http://www.america.gov/st/washfile-english/2006/November/20061120171913lcnirellep0.9033319.html. Retrieved 2006-11-27. 
  84. ^ "Catches under Permit". International Whaling Commission. http://www.iwcoffice.org/conservation/table_permit.htm. Retrieved 2012-2-6. 
  85. ^ Laist, D.W.; Knowlton, A.R., Mead, J.G., Collet A.S., and Podesta, M. (2001). "Collisions between ships and whales" (PDF). Marine Mammal Science 17: 35–75. doi:10.1111/j.1748-7692.2001.tb00980.x. http://www.nero.noaa.gov/shipstrike/whatsnew/Laist%20et%20al_2001.pdf. 
  86. ^ The Fin Whale Passage, Natural History Museum of Los Angeles County
  87. ^ Science North – Fourth Floor exhibits
  88. ^ Slovenian Museum of Natural History, Exhibitions – The mysterious death of young Leonora
  89. ^ Hungarian Natural History Museum – Permanent Exhibitions – Fin whale skeleton
  90. ^ Cambridge University Museum of Zoology – The Finback Whale
  91. ^ Otago Museum, Exhibitions – Fin whale skeleton
  92. ^ Whales Online -- Fin whale
  93. ^ Irish Whale and Dolphin Group -- Fin Whale Species Profile
  94. ^ a b c d "Appendix I and Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.

General references

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Population as defined by COSEWIC.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Population as defined by COSEWIC.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!