Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Brief Summary

Species abstract

The Sei whale (scientific name: Balaenoptera borealis), is a very large marine mammal, in the family of Rorquals (Balaenoptera), part of the order of cetaceans. The Sei is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans, and small fish.

The Sei whale is relatively slender bodied and can reach up to 16 metres in length. It is a member of the rorqual family with the characteristic ventral pleats of skin under the eye and the relatively flat and broad jaw. The ventral pleats do not extend up to the navel but end near the pectoral fin. The flippers are a uniform dark colour and the upper body is a uniform blue-grey colour. The sei whale has a dorsal fin rising at a steep angle on the back. It has a single prominent ridge on the snout.

Unlike other rorquals, Sei whales have a dolphin-like dorsal fin. They are also unusual in using two different methods to fill their mouths with water during feeding: they both gulp and skim-feed. During feeding, these whales can be found in large numbers, typically centred around concentrations of copepods, a crustacean they favor. Otherwise, they occur in smaller groups of six or less.

The Sei whale is an endangered species, and it has been protected by the International Whaling Commission since the mid-1980s.

The common name, pronounced "sigh," comes from the Norwegian word for codfish, which Sei whales are known to eat. "Rorqual" is also a word of Scandinavian origin, meaning tubed, and refers to the grooved, expandable throats of the six species of whales in the family Balaenopteridae.

Superficially, the Sei whale can be easily be confused with the Minke whale, Balaenoptera acutorostrata, but can be distinguished by having dark coloured flippers and a uniform blue-grey upper body. The Sei whale can also be differentiated from Bryde's whale, Balaenoptera edeni, by having only a single prominent ridge on the rostrum.

Sei whales usually congregate in small groups of up to five individuals, although in feeding areas up to 30 have been seen together. It seldom breaches, and when diving, it does not show the tail flukes. It can remain submerged for up to 20 minutes.

Few details of the natural history of this whale are known. They tend to occur in groups of between two and five individuals, but larger groups may form in areas where food is abundant. Capable of travelling at great speed, this species is thought to migrate into warmer waters at lower latitudes during the winter months. Little is known of communication in this species, but individuals are known to make many low frequency vocalisations.
  • Peter Saundry; Encyclopedia of Life. 2011. Sei whale. Topic ed. C.Michael Hogan. Ed-in-chief Cutler J.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment, Washington DC http://www.eoearth.org/article/Sei_Whale
  • Sei whale, Encyclopedia of Life (accessed February 17, 2011)
  • Horwood, J. (2002) Sei whale. In: Perrin, W.F., Würsig, B. and Thewissen, J.G.M. Eds. Encyclopedia of Marine Mammals. Academic Press, London
  • Kinze, C. C., (2002). Photographic Guide to the Marine Mammals of the North Atlantic. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Life; Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Few details of the natural history of this whale are known. They tend to occur in groups of between two and five individuals (5), but larger groups may form in areas where food is very abundant (5). Capable of travelling at great speed, this species is believed to migrate into warmer waters at lower latitudes during the winter months (8). Little is known of communication in this species, but individuals are known to make many low frequency sounds (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

"Unlike other rorquals, Sei whales have a dolphin-like dorsal fin. They are also unusual in using two different methods to fill their mouths with water during feeding - they both gulp and skim-feed. During feeding, these whales can be found in large numbers, probably around concentrations of copepods, a crustacean they favor. Otherwise, they occur in smaller groups of six or less. The sei whale is endangered, and it has been protected by the International Whaling Commission since the mid-1980s. The common name, pronounced ""sigh,""  comes from the Norwegian word for codfish, which sei whales are known to eat. ""Rorqual"" is also a word of Scandinavian origin, meaning ""tubed,"" and refers to the grooved, expandable throats of the six species of whales in the family Balaenopteridae."

Links:
Mammal Species of the World

Visit ARKive for more images of the sei whale  More images, video and sound
  • Original description: "Lesson, René Primevère, 1828. Histoire naturelle générale et particulière des Mammifères et des Oiseaux découverts depuis 1788 jusqu'à nos jours, Baudoin Frères, Paris, 1:342,"
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 1.0 of 5

Comprehensive Description

Description

Sei whales are members of the baleen whale family and are considered one of the "great whales". Females may be slightly longer than males. Sei whales have a long, sleek body that is dark bluish-gray to black in color and pale underneath. The body is often covered in oval-shaped scars  and sometimes has subtle "mottling". This species has an erect "falcate", "dorsal" fin located far down (about two-thirds) the animals back. They often look similar in appearance to Bryde's whales, but can be distinguished by the presence of a single ridge located on the animal's "rostrum". Sei whales have 219-410 baleen plates that are dark in color with gray/white fine inner fringes in their enormous mouths. They also have 30-65 relatively short ventral pleats that extend from below the mouth to the naval area. The number of throat grooves and baleen plates may differ depending on geographic population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Balaenoptera borealis is a baleen whale and can be recognised as such by the plates of baleen (rather than teeth) suspended from the upper jaw and the two blowholes on the upper body. The sei whale is slender bodied and can reach up to 16 m in length. It is a member of the rorqual family with the characteristic ventral pleats of skin under the eye and the relatively flat and broad jaw. The ventral pleats do not extend up to the navel but end near the pectoral fin. The flippers are a uniform dark colour and the upper body is a uniform blue-grey colour. The sei whale has a dorsal fin rising at a steep angle on the back. It has a single prominent ridge on the snout.

At a glance, the sei whale can be easily be confused with the minke whale Balaenoptera acutorostrata but can be distinguished by having dark coloured flippers and a uniform blue-grey upper body. The sei whale can also be differentiated from Bryde's whale Balaenoptera edeni by having only a single prominent ridge on the rostrum.

Sei whales usually congregate in small groups of up to 5 individuals, although in feeding areas up to 30 have been seen together. It seldom breeches, and when diving, it does not show the tail flukes. It can remain submerged for up to 20 minutes (Kinze, 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The sei whale is smaller in size than the fin whale (Balaenoptera physalus), and can be distinguished from this similar species because it has symmetrical colouring on the lower parts of its head (5). It is also similar to Bryde's whale (Balaenoptera edeni), but has only one ridge on the upper surface of the head, whereas Bryde's whale has three (5). The 'blow' or spout of the sei whale is a single thin cloud, which reaches about three metres in height (5). The skin is a mottled dark grey colour, with white grooves along the paler underparts (6) (2). The baleen is grey to black with paler fringes (2) and less than 80 centimetres in length (6). The dorsal fin is obvious, has a slightly hooked shape and is located two-thirds along the length of the body (7). The common name 'sei' arose from the arrival of this whale off the coast of Norway tending to coincide with that of coalfish 'seje' (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The sei whale is a cosmopolitan species, with a mainly offshore distribution, occurring in the North Atlantic, North Pacific and Southern Hemisphere, but probably not in the Northern Indian Ocean (Rice 1998); it is an occasional visitor to the Mediterranean (Reeves and Notarbartolo di Sciara 2006). Sei whales migrate between tropical and subtropical latitudes in winter and temperate and subpolar latitudes in summer, staying mainly in water temperatures of 8-–18°C, and tend not to penetrate to such high latitudes as other rorquals. Their winter distribution seems to be widely dispersed and is not fully mapped (Horwood 1987, 2002).

In the North Pacific, sei whales in summer are distributed mainly north of 40°N, including the Gulf of Alaska and Aleutian Islands (US), and to some extent into the Bering Sea, but not into the Okhotsk Sea. The wintering grounds are poorly known, but sei whales were formerly caught in winter off the Bonin Islands (Japan) (IWC 2006); animals tagged there have been recaptured throughout the summer range (Masaki 1977).

In the North Atlantic the summer distribution seems to be quite variable from year to year; however, sei whales typically occur north of an arc running from south of Nova Scotia in the west, to the northwestern British Isles and Trondheim (Norway) in the east. They occur as far north as the Davis Strait and the northern end of the Denmark Strait. Occasional incursions into other areas have been noted (e.g. the Gulf of Maine, Schilling et al. 1993). Peaks of catch rates in early and late summer suggested a northward and southward migration through the former Nova Scotia whaling ground (Mitchell 1975). Sei whales have been scarce in Norwegian waters in recent years despite significant catches there in the past. Sei whales were caught in limited numbers, mainly in late summer, off northwestern Spain (Aguilar and Sanpera 1982), and have been recorded in winter as far south as the Caribbean Sea and Cap Blanc, Mauritania (Rice 1998).

The summer (Jan–Feb) distribution in the southern hemisphere is mainly in the zone 40–50°S in the South Atlantic and southern Indian oceans, and 45–60°S in the South Pacific (Miyashita et al. 1995). Known wintering grounds include a number of former low–latitude whaling grounds, including northeastern Brazil at 7°S (da Rocha 1983), Peru at 6°S (Valdivia et al. 1982), and in earlier years off Angola and the Congo (IWC 2006). Catches off western South Africa (Donkergat) and eastern South Africa (Durban) showed peaks in spring and autumn, suggestive of populations on migration routes (Horwood 1987).

Chilean whaling records (32–38°S) show catches and sightings of “sei” whales throughout the year including summer until the early 1980s, but some of these may have been Bryde’s whales. However, some sei whales have been observed feeding in summer at around 42°S off Chile in recent years (Galletti et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

These whales are found in all oceans and adjoining seas, except polar and tropical regions. These animals occupy temperate and subpolar regions in the summer, but migrate to sub-tropical waters during the winter.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

semi-cosmopolitan
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, Noordkaap, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Sei whales have a cosmopolitan distribution and occur in subtropical, temperate, and subpolar waters around the world. They prefer temperate waters in the mid-latitudes, and can be found in the Atlantic, Indian, and Pacific Oceans. During the summer, they are commonly found in the Gulf of Maine, and on Georges Bank and Stellwagen Bank in the western North Atlantic. The entire distribution and movement patterns of this species is not well known. This species may unpredictably and randomly occur in a specific area, sometimes in large numbers. These events may occur suddenly and then not occur again for long periods of time. Populations of sei whales, like other rorquals, may seasonally migrate toward the lower latitudes during the winter and higher latitudes during the summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Worldwide, but distribution and movements during much of year are poorly known. Coast of Mexico to Gulf of Alaska in the eastern North Pacific. Bering Sea to Japan and Korea in the western North Pacific. Gulf of Mexico to Davis Strait (especially off eastern Canada) in the western North Atlantic. Norway to Spain and northwestern Africa in the eastern North Atlantic. In Southern Hemisphere, Antarctic Ocean to coasts of Brazil, Chile, South Africa, and Australia. See IUCN (1991) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic and Pacific Oceans in both hemispheres.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in almost every ocean of the world, but occurs less frequently in polar waters than the other members of this family (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The largest known Sei whale measured 20 meters in length, although most whales are between 12.2 and 15.2 meters long. Of this length, the head and body make up about 13 meters. Males are slightly smaller than females. Sei whales have a relatively slender body with a compressed tail stock that abruptly joins the flukes. The snout is pointed, and the pectoral fins are short. The dorsal fin is sickle shaped and ranges in height from 25 to 61 centimeters.

The body is typically a dark steel gray with irregular white markings ventrally. The ventrum has 38-56 deeps grooves, which may have some feeding function. Each side of the upper part of the mouth contains 300 - 380 ashy-black baleen plates. The fine inner bristles of these plates are whitish.

Average mass: 2e+07 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length: 21-18 m. Weight: 45,000 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 1860 cm

Weight: 2.0E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: Males 17.1 m, females 18.6 m. Slightly larger in the Southern Hemisphere.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 14-18.6 m

Weight:
Range: 8,500-11,300 kg males; 8,600-15,000 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: Blow readily visible-6m (20'0 straight column, less dense than fin whale. Curved dorsal fin mid-back. Colour is slate grey, occasional round scars.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size is less than that of fin and blue whales. Dorsal fin is decidedly taller, more falcate, and located farther forward (a little more than one-third the body length forward from the fluke notch) than in other large baleen whales. Differs from the Bryde's whale in having a taller, less sharply pointed dorsal fin and a single dorsal rostral ridge rather than three ridges. Differs from the fin whale in the more upward-angled dorsal fin (located farther forward on the body), the lack of asymmetrical lower lip coloration, lack of whitish dorsal chevrons, lack of mixed color baleen, and fewer throat grooves (32-60 vs. 56-100); dorsal fin of sei whale tends to surface simultaneously with the head, rather than later as in the fin whale. Differs from the blue whale in the less U-shaped snout and much larger and more anterior dorsal fin. (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Sei whales exhibit a greater variety in diet than, say, blue whales, but tend to feed on only one type of prey at a time. Of 21,713 stomachs examined in the North Pacific, 82.7% contained copepods only, and 12.6% contained euphausiids only; of 31,494 stomachs examined in the southern hemisphere, 54.3% contained euphausiids only, 30.5% contained copepods only, and 14.4% contained amphipods only (Nemoto and Kawamura 1977). Sei whale stomachs examined in the Northeast Atlantic contained copepods and euphausiids (Jonsgård and Darling 1977). Sei whale stomachs analysed in the North Pacific off California contained euphausiids and anchovies (Rice 1977). Sei whales are noted for their erratic appearance in specific feeding grounds, being plentiful in some years and absent (sometimes for years or even decades) in others (Horwood 1987).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These pelagic whales are found far from shore.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

mostly in open ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 189 specimens in 1 taxon.
Water temperature and chemistry ranges based on 166 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.353 - 26.222
  Nitrate (umol/L): 0.154 - 28.455
  Salinity (PPS): 31.523 - 36.516
  Oxygen (ml/l): 4.657 - 8.106
  Phosphate (umol/l): 0.054 - 1.949
  Silicate (umol/l): 0.775 - 70.561

Graphical representation

Temperature range (°C): -1.353 - 26.222

Nitrate (umol/L): 0.154 - 28.455

Salinity (PPS): 31.523 - 36.516

Oxygen (ml/l): 4.657 - 8.106

Phosphate (umol/l): 0.054 - 1.949

Silicate (umol/l): 0.775 - 70.561
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sei whales prefer subtropical to subpolar waters on the continental shelf edge and slope worldwide. They are usually observed in deeper waters of oceanic areas far from the coastline.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Generally in deep water; along edge of continental shelf and in open ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The sei whale is an open ocean whale, not often seen near the coast. It can be found at the surface or diving down to a few hundred metres.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Temperate marine waters. Prefers deep oceanic waters. Spend winters in temperate waters and move to higher latitudes in the summer.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

An inhabitant of the open ocean, the sei whale tends to avoid coastal waters (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between lower-latitude wintering grounds and higher-latitude feeding grounds. Movements in specific areas may be unpredictable (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Sei whale obtains food by skimming through the water and catching prey in its baleen plates. These whales feed near the surface of the ocean, swimming on their sides through swarms of prey. An average Sei whale eats about 900 kilograms of copepods, amphipods, euphausiids and small fish every day.

Animal Foods: fish; zooplankton

Primary Diet: planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats copepods, euphausiids, squid, and various small schooling fishes. May skim feed on copepods at surface or gulp feed on krill and small fishes (Leatherwood and Reeves 1983, Katona et al. 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Plankton, including krill, copepods, and amphipods.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population is estimated at less than 51,000: about 14,000 in the Northern Hemisphere (mainly in the North Pacific), 37,000 or less in the Southern Hemisphere; a survey of Antarctic waters in the summer of 1989 found only 1500 in an area where perhaps 10,000 were expected (Matthews and Moseley 1990). North Atlantic population numbers a few thousand. See IUCN (1991) for further information on population sizes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually travels in groups of 2-5, may concentrate in larger numbers on feeding grounds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Sei whales are usually observed singly or in small groups of 2-5 animals, but are occasionally found in larger (30-50) loose aggregations. Sei whales are capable of diving 5-20 minutes to opportunistically feed on plankton (e.g., copepods and krill), small schooling fish, and cephalopods (e.g., squid) by both gulping and skimming. They prefer to feed at dawn and may exhibit unpredictable behavior while foraging and feeding on prey. Sometimes seabirds are associated with the feeding frenzies of these and other large whales.

Sei whales become sexually mature at 6-12 years of age when they reach about 45 ft (13 m) in length, and generally mate and give birth during the winter in lower latitudes. Females breed every 2-3 years, with a gestation period of 11-13 months. Females give birth to a single calf that is about 4.6 m long and weighs about 680 kg. Calves are usually nursed for 6-9 months before being weaned on the preferred feeding grounds. Sei whales have an estimated lifespan of 50-70 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
70.0 years.

Average lifespan

Status: wild:
74.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 74 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During mating season, males and females may form a social unit, but strong data on this issue are lacking.

Mating occurs during the winter months. Sei whales in the Northern Hemishpere mate between November and February, whereas mating in the southern hemisphere occurs between May and July. Gestation lasts from 10 1/2 to 12 months. Females typically give birth to a single calf measuring 450 cm in length. There are reports of rare multiple fetuses. The calf nurses for six or seven months. Young reach sexual maturity at 10 years of age, but do not reach full adult size until they are about 25 years old. Sei whales may live as long as 74 years.

Females typically give birth every other year, but a recent increase in pregnancies has been noted. Researchers think this may be a response to the predation rate. Humans kill a great many whales each year, and this might have effects on their reproductive activity.

Breeding interval: Females typically give birth every other year

Breeding season: Mating occurs during the winter months

Average number of offspring: 1.

Range gestation period: 10.5 to 12 months.

Range weaning age: 6 to 7 months.

Average age at sexual or reproductive maturity (female): 10 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 680000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
3652 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
3652 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single calf is born usually in winter after a gestation period of about 11-12 months. Young nurse for about 5-9 months. Calving interval for individual adult females is 2-3 years. Sexually mature at an average age of 6-10 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females are sexually mature at about 5-6 years old. Mating takes place in the late fall and early winter. Exact gestation period is not known, but it is somewhere around 10.5-12.5 months, and the calf nurses for 5-9 months. Calves are 4.5-4.8 m long at birth.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0646-06|NC_006929|Balaenoptera borealis| AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGTACCCTATATTTACTATTTGGTGCATGAGCAGGAATAGTAGGCACTGGCCTA---AGTTTATTAATCCGCGCTGAATTAGGTCAACCCGGTACACTAATCGGAGAT---GACCAAGTCTACAACGTGTTAGTAACAGCTCACGCCTTCGTGATAATCTTCTTCATAGTTATACCTATTATAATTGGTGGATTCGGAAACTGACTAGTCCCCCTAATA---ATTGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCCCCTTCTTTCCTACTATTAATAGCATCCTCAATAGTTGAAGCCGGTGCAGGTACAGGCTGAACTGTATATCCCCCTTTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTT---ACCATCTTCTCCCTACATCTAGCCGGTGTGTCCTCAATCCTCGGAGCCATCAATTTCATCACAACTATTATTAATATAAAACCACCTGCCATGACCCAATACCAAACACCCCTTTTCGTATGATCAGTCCTAGTCACAGCAGTACTACTCTTATTATCACTACCTGTTTTAGCAGCC---GGAATCACCATGCTACTTACCGACCGAAACCTAAATACAACTTTCTTTGACCCTGCAGGCGGAGGAGACCCAATTCTGTACCAACACTTATTCTGATTCTTTGGCCACCCCGAAGTGTACATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTATATGGGGATAGTCTGAGCTATGGTATCCATCGGGTTCTTAGGATTTATCGTATGAGCCCACCATATGTTTACAGTAGGTATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A1ad

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
The cause of the population reduction in this species (commercial whaling) is reversible, understood, and is not currently in operation. For this reason, the species is assessed under criterion A1, not under A2, A3 or A4. The global mature population is estimated to have declined by about 80% over the last three generations (Figure 1 in linked PDF document). This is supported by observed declines in abundance in several regions. Most of this decline is attributable to the southern hemisphere. While a higher intrinsic rate of increase than that given in Table 1 (in linked PDF document) may be possible and could result in a less threatened category, a precautionary approach is to use the value given in Table 1, which, based on the available data, is plausible for sei whales, particularly given the absence of direct evidence of any increase in the population.

History
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Sei whales are listed as CITES appendix 1 from the equator to Antarctica. All other populations are listed as CITES appendix 2. The global population of these whales is estimated at only 57,000. Hunting of these whales by humans has been high since the 1950s. The take of these animals peaked in the 1964-65 season, when 25,454 of these whales were taken. The reported global catch of Sei whales in the 1978-79 season was only 150, showing the dramatic drop in whale populations. Some researchers have concluded that Sei whale populations are rising as a result of decreases in Blue and Fin whale poulations. However, this conclusion must be taken with caution, as actual data are scarce, and the dietary overlap between Sei whales and these other species is not complete.

CITES: appendix i

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Endangered.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Widespread but relatively rare throughout the world's oceans; difficult to protect due to migratory existence.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Balaenoptera borealis , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Listed as an endangered species under the ESA. Commercial whaling of this species was halted by the IWC in 1980 everywhere but the North Atlantic. The Sei Whale is listed in CITES Appendices I and II.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Endangered.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List 2007 (1). Populations from the equator to Antarctica are listed on Appendix I of CITES, all other populations are listed on Appendix II (3). Also listed on Appendices I and II of the Convention on Migratory Species (CMS or the Bonn Convention) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
North Atlantic. The International Whaling Commission (IWC) recognizes three stock divisions for sei whales in the North Atlantic: Nova Scotia; Iceland-Denmark Strait; and Eastern (including the waters of Spain, Portugal, British Isles, Faeroes and Norway), but the divisions were chosen on largely arbitrary grounds (Donovan 1991).

About 14,000 sei whales are recorded caught by modern whaling in the North Atlantic. In addition, an unknown proportion of the approximately 30,000 unspecified large whales caught in the North Atlantic in the late 19th and early 20th centuries were sei whales.

Sei whales appear to have been depleted in the eastern North Atlantic, with over 7,500 recorded taken in Norwegian and British waters prior to World War II (not counting the unspecified whales), but fewer than 200 since then. The species seems to be virtually absent there now: Norwegian surveys of northeast Atlantic waters in 1987, 1989, and annually from 1995–2005 have yielded only one sei whale sighting in the Eastern stock area. Small numbers of sei whales were caught during 1957–80 off northwestern Spain, mainly in late summer/autumn (Aguilar and Sanpera 1982); the stock identity of these animals is unclear.

By contrast, sei whales are still abundant in the central North Atlantic (Iceland-Denmark Strait IWC stock area), especially southwest of Iceland south to 50°N in summer. The only survey with reasonably complete coverage, designed specifically for the purpose of estimating sei whale abundance, was in 1989, and yielded a population estimate of 10,300 whales (CV 0.27) (Cattanach et al. 1993). Areas of sei whale abundance seem to shift markedly between years relative to the northern extent of the distribution, more so than for other baleen whale species (Gunnlaugsson et al. 2004).

No recent abundance estimates are available for the western North Atlantic. The population size during 1966–69 was estimated at 2,078 (Mitchell and Chapman 1977) from sightings surveys, using strip transect methodology. About 1,200 sei whales were taken off Nova Scotia during 1962–72.

North Pacific. The last assessment of North Pacific sei whales by the IWC Scientific Committee was in 1974 (IWC 1977). The exploitable population (animals of legally catchable size) was estimated to have declined from 42,000 in 1963 to 8,600 in 1974 (Tillman 1977). Over 40,000 sei whales were caught during this period (IWC 2006). A 75% reduction in sei whale catch rates of Californian whaling stations during the 1960s is consistent with an ocean-wide decline (Rice 1977). Exploitation ceased in 1975. The extent to which the population has recovered since then is unclear.

Hakamada et al. (2004) gave an estimate of 4,100 animals from one area of the western North Pacific, but attempts to extrapolate this to produce an estimate for the entire western North Pacific have not been accepted. It is likely that there has been some increase in the population since the end of exploitation, but given the tendency for sei whale distribution to change from year to year, it is hard to interpret the limited survey data that currently exist.

Sei whales appear not to have formerly been uncommon in the eastern North Pacific. However, a preliminary estimate for the US west coast based on surveys in 1996 and 2001 is only 56 whales (Barlow 2003). In the Eastern Tropical Pacific, all potential sei/Bryde’s whales that could be specifically identified were found to be Bryde’s, suggesting that sei whales are now rare (Wade and Gerrodette 1993).

Southern Hemisphere. Over 200,000 sei whales are recorded taken by modern whaling in the southern hemisphere during 1905–1979. The IWC arbitrarily divides southern hemisphere sei whales, along with other southern hemisphere baleen whales, into six longitudinally defined management Areas. Sei whales in all of the six Areas have been classified as Protection Stocks by the IWC since 1978. The greatest catches were during 1960–72, when they exceeded 5,000 in every year, topping at nearly 20,000 in 1964 alone. Most catches were taken in summer by pelagic fleets operating south of 40°S, but winter catches were also taken from land stations in Brazil, Peru and South Africa (and smaller numbers in Chile, where there is ambiguity with Bryde’s whales).

The last assessment of southern hemisphere sei whales by the IWC Scientific Committee was conducted in 1979 (IWC 1980). Some extra information on these assessments is given by Horwood (1987). Based on catches/sightings per unit effort from Japanese catch and scouting vessels respectively, the “exploitable” stock size (sei whales of legal size, approximately 2/3 of total population), excluding Area II (South Atlantic sector), was estimated to have declined from about 64,000 in 1960 to about 11,000 by 1979. The population model used failed to produce an estimate for Area II, because nearly all the catch for this area was taken in just the two seasons 1964/65 and 1965/66, with nearly 30,000 sei whales being taken in these two years, yet the abundance indices suggested a more continuous decline during the 1960s and 1970s (IWC 1980). This suggests that the management Areas do not correspond to biological populations.

Other available evidence also suggests a severe and rapid decline in sei whale stocks during the 1960s and 1970s. The catch and sighting rates from winter whaling operations off Brazil and South Africa show even sharper declines. Abundance indices from the Brazilian whaling ground for sei whales during 1966–81 (da Rocha 1983) declined by ca. 90% during 1966–72.

No recovery of sei whales in Brazilian waters has been detected since that time (Zerbini et al. 1997, Andriolo et al. 2001). Catch and sightings indices off Durban, South Africa for 1965–74 (Best 1976) declined by over 95%. Tag-recapture data from pelagic whaling suggested an approximately 6-fold decline between 1962–76 (IWC 1980, Fig. 1).

IWC (1996, Table 2) gives a total population estimate for sei whales south of 30°S of about 10,000 based on a combination of IDCR and Japanese Scout Vessel (JSV) sightings data. It is difficult to know how much reliance to place on this estimate, because no variance is given, but it is consistent with a severe decline. No more recent summer data are available, except for the area south of 60°S, which is outside the main summer range of sei whales. In the absence of dedicated surveys in sei whale habitat, and resulting abundance estimates, it is not possible to assess whether there has been any increase in southern hemisphere sei whales since the cessation of whaling.

Generation time and maximum rate of increase. The generation time is estimated to be 23.3 years (Taylor et al. 2007). The 3-generation time window for applying the decline criterion (A) is 1937–2007.

For assessment purposes, the IWC Scientific Committee has used a natural mortality rate of 0.06, an age at first reproduction declining (with stock depletion) from 12-13 years to 10-11 years, and an annual pregnancy rate increasing (with stock depletion) from 0.27 to 0.37-0.39 (IWC 1980; Horwood 1980). Assuming a maximum annual pregnancy rate of 0.40, a minimum age of first reproduction of 10 years, and no juvenile mortality, the maximum rate of increase is 2.7% p.a. Horwood and Millward (1987) also conclude that the maximum rate of increase for sei whale populations is less than 3% per year.

Population assessment. Because the available published assessments for this species are not up to date, an updated population assessment is conducted here to enable assessment of the population reduction over the period 1937-2007 relative to the A criterion. While the available data do not permit a scientifically rigorous estimation of the extent of population reduction, it is reasonable to use conventional population assessment methods to provide a crude indication of the extent of possible reduction relative to the criteria. A conventional deterministic age-structured model with an age at first capture (“recruitment”) (ar) and an age at first reproduction (am), and linear density-dependence was applied to the North Pacific, North Atlantic and Southern Hemisphere regions separately. The results are provided in the linked PDF document, and constitutes an integral part of this assessment.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Comments: Numbers have rebounded slightly if at all since most whaling was stopped by international treaty (Matthews and Moseley 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Sei whale exploitation by modern whalers was particularly intensive in the southern hemisphere and the North Pacific from the late 1950s to the mid-1970s, following the depletion of blue, fin and humpback whales. Sei whale stocks were seriously depleted during this period. Exploitation in the North Atlantic occurred over a longer period and was less intensive, except in the eastern North Atlantic, where the population appears not to have recovered from early modern whaling. Commercial exploitation ceased in the North Pacific in 1975, in the southern hemisphere in 1979 and in the North Atlantic in 1989. Catches by Japan under scientific permit resumed in the North Pacific in 2002: since 2004, the annual take has been 100 animals.

Reports of other human-caused deaths of sei whales are rare. Two fatal ship strikes (sei whales found dead on the bows of ships) were reported on the US East Coast during 2000–2004 (Cole et al. 2006). It is hard to extrapolate from known cases to an estimated total, but sei whales appear to be at relatively low risk of human impacts, probably because of their largely offshore distribution.

Rice (1961, 1974) reported a pathological condition in several North Pacific sei whales which resulted in deterioration or loss of baleen; however, the current frequency of this condition, and its impact (if any) on the population, are unknown.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Populations in all oceans have been depleted by overexploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Although not a traditional target of the whaling industry, the sei whale began to be exploited after the blue, fin and humpback stocks became depleted and protected (6). This species was then relentlessly hunted in the 1960s and 70s (8), before the International Moratorium on Commercial Whaling came into effect in 1986 (9). At present, the species is vulnerable to chemical and noise pollution (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Sei whales have been specifically protected from commercial whaling by the International Whaling Commission since 1975 in the North Pacific and 1979 in the southern hemisphere. They have also been protected by the general moratorium on commercial whaling since 1986, although this does not cover catches taken under scientific permit. This species is included in CITES Appendix I although Iceland has held a reservation against this listing since 2000. The species is listed in Appendix II of CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: A draft recovery plan for the North Pacific and North Atlantic stocks was available in August 1998 (www.nmfs.gov/tmcintyr/prot_res.html/).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Comments: Whale is protected by the IWC, the US MMPA, and the US ESA.

Needs: Enforce ban on harvest set by the IWC and of the MMPA and ESA.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1976, this whale received protected status (8), and the moratorium on commercial whaling took effect from 1986 (9). There are ongoing problems with the moratorium however, and Iceland announced in 2001 that it might soon resume commercial whaling of sei, minke and fin whales (8). Other countries also oppose the ban and the future of endangered species such as the sei whale is not yet secure (5). There are signs however, that populations of this little known cetacean are starting to recover from past exploitation (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The current economic importance of this whale is questionable. However, in the past, these large whales provided a great deal of income to the whaling industry. It cannot be stressed enough, however, that the positive economic effects of hunting this animal have been acheived only by large scale decimation of Sei whale populations. By overharvesting the whales, the whaling industry experienced a short term economic gain at a long term cost-- the reduction in the number of whales available for harvest.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long exploited by shore-based and pelagic whalers, with large numbers taken beginning in the late 1800s; several thousand (probably low 10,000s) were harvested annually in the 1960s and early 1970s; see IUCN (1991) for review of exploitation history. Initially hunted for oil; now desired mainly for meat for human consumption.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Endangered (EN)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sei whale

The sei whale (play /ˈs/ or /ˈs/), Balaenoptera borealis, is a baleen whale, the third-largest rorqual after the blue whale and the fin whale.[3] It inhabits most oceans and adjoining seas, and prefers deep offshore waters.[4] It avoids polar and tropical waters and semi-enclosed bodies of water. The sei whale migrates annually from cool and subpolar waters in summer to winter in temperate and subtropical waters.[5]

Reaching 20 metres (66 ft) long and weighing as much as 28 tonnes (28 long tons; 31 short tons),[5] the sei whale daily consumes an average of 900 kilograms (2,000 lb) of food, primarily copepods, krill, and other zooplankton.[6] It is among the fastest of all cetaceans, and can reach speeds of up to 50 kilometres per hour (31 mph) (27 knots) over short distances.[6] The whale's name comes from the Norwegian word for pollock, a fish that appears off the coast of Norway at the same time of the year as the sei whale.[7]

Following large-scale commercial whaling during the late-nineteenth and twentieth centuries, when over 255,000 whales were taken,[8][9] the sei whale is now internationally protected,[2] although limited hunting occurs under controversial research programmes conducted by Iceland and Japan.[10][11] As of 2008, its worldwide population was about 80,000, nearly a third of its pre-whaling population.[12][13]

Contents

Etymology

The species was first officially described by French naturalist René Primevère Lesson in 1828, but an earlier description was given by Karl Rudolphi in 1822 (although he assumed it was a minke whale, Balaenoptera acutorostrala), leading to occasional references to sei whales as Rudolphi's rorqual.[14] Additional names include pollack whale, coalfish whale, sardine whale, or Japan finner.[15] Additionally, it has been referred to as the lesser fin whale because it somewhat resembles the fin whale.[14] The American naturalist Roy Chapman Andrews compared the sei whale to the cheetah, because it can swim at great speeds "for a few hundred yards", but it "soon tires if the chase is long" and "does not have the strength and staying power of its larger relatives".[16]

Sei is the Norwegian word for pollock, also referred to as coalfish, a close relative of codfish. Sei whales appeared off the coast of Norway at the same time as the pollock, both coming to feed on the abundant plankton.[7] The specific name is the Latin word borealis, meaning northern. In the Pacific, the whale has been called the Japan finner; "finner" was a common term used to refer to rorquals. In Japanese, the whale was called iwashi kujira, or sardine whale, named for a fish that the whale has been observed to eat in the Pacific.[17]

Taxonomy

The sei was classified as Balaena rostraia, Balaena borealis, Bataenoptera laticeps, and Eulama physalus, among others, before Lesson's alternative Balaenoptera borealis was formalized.[14]

Sei whales are rorquals (family Balaenopteridae), baleens that includes the humpback whale, the blue whale, the Bryde's whale, the fin whale, and the minke whale. Rorquals take their name from the Norwegian word røyrkval, meaning "furrow whale",[18] because family members have a series of longitudinal pleats or grooves below the mouth that continue along the body's underside. Balaenopteridae diverged from the other families of suborder Mysticeti, also called the whalebone whales or great whales, as long ago as the middle Miocene.[19] However, little is known about when members of the various families in the Mysticeti, including the Balaenopteridae, diverged from each other.

Two subspecies have been identified—the northern sei whale (Balaenoptera borealis borealis) and southern sei whale (Balaenoptera borealis schlegelii).[20] Their ranges do not overlap.

Description

The sei whale is the third-largest Balaenopteridae, after the blue whale (up to 180 tonnes, 200 tons) and the fin whale (up to 70 tonnes, 77 tons).[3] Mature adults typically measure between 12–15 meters (39–49 ft)[6] and weigh 20–30 tonnes (20–30 long tons; 22–33 short tons). The southern sei whale is larger than the northern. Females are considerably larger than males.[5] The largest known sei whale measured 20 meters (66 ft),[6] and weighed between 40–45 tonnes (39–44 long tons; 44–50 short tons). The largest specimens taken off Iceland were slightly longer than 16 meters (52 ft).[21] At birth, a calf typically measures 4–5 meters (13–16 ft) in length.[6]

Anatomy

The whale's body is typically a dark steel grey with irregular light grey to white markings on the ventral surface, or towards the front of the lower body. The whale has a series of 32–60 pleats or grooves along the bottom of the body that allow the throat area to expand greatly during feeding. The rostrum is pointed and the pectoral fins are relatively short, only 9%–10% of body length, and pointed at the tips.[7] It has a single ridge extending from the tip of the rostrum to the paired blowholes that are a distinctive characteristic of baleen whales.

The whale's skin is often marked by pits or wounds, which after healing become white scars. These are believed to be caused by ectoparasitic copepods (Penella spp.),[22] lampreys (family Petromyzontidae),[23] or possibly "cookie-cutter" sharks (Isistius brasiliensis).[24] It has a tall, sickle-shaped dorsal fin that ranges in height from 25–61 centimeters (9.8–24 in), about two-thirds of the way back from the tip of the rostrum. Dorsal fin shape, pigmentation pattern, and scarring have been used to a limited extent in photo-identification studies.[25] The tail is thick and the fluke, or lobe, is relatively small in relation to the size of the whale's body.[7]

Photo displaying dozens of baleen plates. The plates face each other, and are evenly spaced at approximately 0.25 inches (1 cm) intervals. The plates are attached to the jaw at the top, and have hairs at the bottom end.
A close-up view of baleen plates. The plates are used to strain food from the water

Adults have 300–380 ashy-black baleen plates on each side of the mouth, each about 48 centimeters (19 in) long. Each plate is made of fingernail-like keratin that frays out into whitish fine hairs on the ends inside the mouth near the tongue.[6] The sei's very fine baleen bristles, about 0.1 millimetres (0.004 in) are the most reliable characteristic that distinguishes it from other baleen whales.[26]

The sei whale looks similar to other large baleen whales. The best way to distinguish between it and Bryde's whale, apart from differences in baleen plates, is by the presence of lateral ridges on the dorsal surface of the Bryde's whale's rostrum. Large individuals can be confused with fin whales, unless the fin whale's asymmetrical head coloration is clearly seen. The fin whale's lower jaw's right side is white, and the left side is grey. When viewed from the side, the upper edge of the sei's head has a small arch between the tip of the rostrum and eye, while the fin whale's profile is relatively flat.[5]

Life history

Sei whales usually travel alone[27] or in groups of up to six individuals.[25] Larger groups may assemble at particularly abundant feeding grounds. Very little is known about their social structure. Males and females may bond, but this is uncertain.[3][28]

The sei whale is among the fastest cetaceans. It can reach speeds of up to 50 kilometres per hour (27 kn) over short distances.[6] However, it is not a remarkable diver, reaching relatively shallow depths for five to fifteen minutes. Between dives, the whale surfaces for a few minutes, remaining visible in clear, calm waters, with blows occurring at intervals of about 40–60 seconds. Unlike the fin whale, the sei whale tends not to rise high out of the water as it dives. The blowholes and dorsal fin are often exposed above the water surface simultaneously. The whale almost never extends its flukes above the surface, and it rarely breaches.[5]

Feeding

Photo of krill in water
Krill, shrimp-like marine invertebrate animals, are one of the sei whale's primary foods.

This rorqual is a filter feeder, using its baleen plates to obtain its food by opening its mouth, engulfing large amounts of the water containing the food, then straining the water out through the baleen, trapping any food items inside its mouth.

The sei whale feeds near the surface of the ocean, swimming on its side through swarms of prey to obtain its average of about 900 kilograms (2,000 lb) of food each day.[6] For an animal of its size, for the most part, its preferred foods lie unusually relatively low in the food chain, including zooplankton and small fish. The whale's diet preferences has been determined from stomach analyses, direct observation of feeding behavior.,[29][30] and analyzing fecal matter collected near them, which appears as a dilute brown cloud. The feces are collected in nets and DNA is separated, individually identified, and matched with known species.[31] The whale competes for food against clupeid fish (herring and its relatives), basking sharks, and right whales.

In the North Atlantic, it feeds primarily on calanoid copepods, specifically Calanus finmarchicus, with a secondary preference for euphausiids, in particular Meganyctiphanes norvegica and Thysanoessa inermis.[32][33] In the North Pacific, it feeds on similar zooplankton, including the copepod species Neocalanus cristatus, Neocalanus plumchrus, and Calanus pacificus, and euphausid species Euphausia pacifica, Thysanoessa inermis, Thysanoessa longipes, and Thysanoessa spinifera. In addition, it eats larger organisms, such as the Japanese flying squid, Todarodes pacificus pacificus,[34] and small fish, including members of the Engraulis (anchovies), Cololabis (sauries), Sardinops (pilchards), and Trachurus (jack mackerels) genera.[32][35] Some of these fish are commercially important. Off central California, the whale may feed on anchovies between June and August, and on krill (Euphausia pacifica) during September and October.[23] In the Southern Hemisphere, prey species include the copepods Neocalanus tonsus, Calanus simillimus, and Drepanopus pectinatus, as well as the euphausids Euphausia superba and Euphausia vallentini.[32] Sei whales also eat sardines.

Reproduction

Mating occurs in temperate, subtropical seas during the winter. Gestation is estimated to vary around 1034 months,[36] 1114 months,[37] or one year,[38] depending which model of foetal growth is used. The different estimates result from scientists' inability to observe an entire pregnancy; most reproductive data for baleen whales were obtained from animals caught by commercial whalers, which offers only a single snapshot of fetal growth. Researchers attempt to extrapolate conception dates by comparing fetus size and characteristics with newborns.

A newborn is weaned from its mother at 6–9 months of age, when it is 11–12 meters (36–39 ft) long,[36] so weaning takes place at the summer or autumn feeding grounds. Females reproduce every 2–3 years,[36] with as many as six fetuses reported, but single births are far more common.[6] The average age of sexual maturity of both sexes is 8–10 years,[36] at a length of around 12 meters (39 ft) for males and 13 meters (43 ft) for females.[7] The whales can reach ages of up to 65 years.[39]

Vocalizations

The sei whale makes long, loud, low-frequency sounds. Relatively little is known about specific calls, but in 2003, observers noted sei whale calls in addition to sounds that could be described as "growls" or "whooshes" off the coast of the Antarctic Peninsula.[40] Many calls consisted of multiple parts at different frequencies. This combination distinguishes the their calls from those of other whales. Most calls lasted about a half second, and occurred in the 240–625 hertz range, well within the range of human hearing. The maximum volume of the vocal sequences is reported as 156 decibels relative to 1 micropascal (μPa) at a reference distance of one meter.[40] An observer situated one meter from a vocalizing whale would perceive a volume roughly equivalent to the volume of a jackhammer operating two meters away.[41]

Range and migration

Drawing of a sei whale on a Faroese stamp, issued 17 September 2001

Sei whales live in all oceans, although rarely in polar or tropical waters.[5] The difficulty of distinguishing them at sea from their close relatives, Bryde's whales and in some cases from fin whales, creates confusion about their range and population, especially in warmer waters where Bryde's whales are most common.

In the North Atlantic, its range extends from southern Europe or northwestern Africa to Norway, and from the southern United States to Greenland.[4] The southernmost confirmed records are strandings along the northern Gulf of Mexico and in the Greater Antilles.[26] Throughout its range, the whale tends to avoid semi-enclosed bodies of water, such as the Gulf of Mexico, the Gulf of Saint Lawrence, Hudson Bay, the North Sea, and the Mediterranean Sea.[5] It occurs predominantly in deep water, occurring most commonly over the continental slope,[42] in basins situated between banks,[43] or submarine canyon areas.[44]

In the North Pacific, it ranges from 20°N23°N latitude in the winter, and from 35°N50°N latitude in the summer.[45] Approximately 75% of the North Pacific population lives east of the International Date Line,[8] but there is little information regarding the North Pacific distribution. Two whales tagged in deep waters off California were later recaptured off Washington and British Columbia, revealing a possible link between these areas,[46] but the lack of other tag recovery data makes these two cases inconclusive. In the Southern Hemisphere, summer distribution based upon historic catch data is between 40 and 50°S latitude, while winter distribution is unknown.[32]

Migration

In general, the sei whale migrates annually from cool and subpolar waters in summer to temperate and subtropical waters for winter, where food is more abundant.[5] In the northwest Atlantic, sightings and catch records suggest the whales move north along the shelf edge to arrive in the areas of Georges Bank, Northeast Channel, and Browns Bank by mid to late June. They are present off the south coast of Newfoundland in August and September, and a southbound migration begins moving west and south along the Nova Scotian shelf from mid-September to mid-November. Whales in the Labrador Sea as early as the first week of June may move farther northward to waters southwest of Greenland later in the summer.[47] In the northeast Atlantic, the sei whale winters as far south as West Africa, and follows the continental slope northward in spring. Large females lead the northward migration and reach the Denmark Strait earlier and more reliably than other sexes and classes, arriving in mid-July and remaining through mid-September. In some years, males and younger females remain at lower latitudes during the summer months.[21]

Despite knowing some general migration patterns, exact routes are not known[21] and scientists cannot readily predict exactly where groups will appear from one year to the next.[48] F.O. Kapel noted a correlation between appearances west of Greenland and the incursion of relatively warm waters from the Irminger Current into that area.[49] Some evidence from tagging data indicates individuals return off the coast of Iceland on an annual basis.[50]

Whaling

Photo of harpoon in anchored harpoon gun

The development of explosive harpoons and steam-powered whaling ships in the late nineteenth century brought previously unobtainable large whales within reach of commercial whalers. Initially their speed and elusiveness,[51] and later the comparatively small yield of oil and meat partially protected them. Once stocks of more profitable right whales, blue whales, fin whales, and humpback whales became depleted, sei whales were hunted in earnest, particularly from 1950 to 1980.[3]

North Atlantic

In the North Atlantic between 1885 and 1984, 14,295 sei whales were taken.[8] They were hunted in large numbers off the coast of Norway and Scotland beginning in the late nineteenth and early twentieth centuries,[48] and in 1885 alone, more than 700 were caught off Finnmark, Norway.[52] Their meat was a popular Norwegian food. The meat's value made the hunting of this difficult-to-catch species profitable in the early twentieth century.[53]

In Iceland, a total of 2,574 whales were taken from the Hvalfjörður whaling station between 1948 and 1985. Since the late 1960s to early 1970s, the sei whale has been second only to the fin whale as the preferred target of Icelandic whalers, with meat in greater demand than whale oil, the prior target.[51]

Small numbers were taken off the Iberian Peninsula, beginning in the 1920s by Spanish whalers,[54] off the Nova Scotian shelf in the late 1960s and early 1970s by Canadian whalers,[47] and off the coast of West Greenland from the 1920s to the 1950s by Norwegian and Danish whalers.[49]

North Pacific

In the North Pacific, the total reported catch by commercial whalers was 72,215 between 1910 and 1975;[8] the majority were taken after 1947.[55] Shore stations in Japan and Korea, processed 300–600 each year between 1911 and 1955. In 1959, the Japanese catch peaked at 1,340. Heavy exploitation in the North Pacific began in the early 1960s, with catches averaging 3,643 per year from 1963 to 1974 (total 43,719; annual range 1,280–6,053).[56] In 1971, after a decade of high catches, it became scarce in Japanese waters, ending commercial whaling in 1975.[32][57]

Off the coast of North America, sei whales were hunted off British Columbia from the late 1950s to the mid 1960s, when the number of whales captured dropped to around 14 per year.[3] More than 2,000 were caught in British Columbia waters between 1962 and 1967.[58] Between 1957 and 1971, California shore stations processed 386 whales.[23] Commercial Sei whaling ended in the eastern North Pacific in 1971.

Southern Hemisphere

A total of 152,233 were taken in the Southern Hemisphere between 1910 and 1979.[8] Whaling in southern oceans originally targeted humpback whales. By 1913, this species became rare, and the catch of fin and blue whales began to increase. As these species likewise became scarce, sei whale catches increased rapidly in the late 1950s and early 1960s.[32] The catch peaked in 1964-65 at over 20,000 sei whales, but by 1976, this number had dropped to below 2,000 and commercial whaling for the species ended in 1977.[3]

Post-protection whaling

Since the moratorium on commercial whaling, some sei whales have been taken by Icelandic and Japanese whalers under the IWC's scientific research programme. Iceland carried out four years of scientific whaling between 1986 and 1989, killing up to 40 sei whales a year.[59] Japanese scientists catch about 50 sei whales each year for this purpose. The research is conducted by the Institute of Cetacean Research (ICR) in Tokyo, a privately-funded, nonprofit institution. The main focus of the research is to examine what they eat and to assess the competition between whales and fisheries. Dr. Seiji Ohsumi, Director General of the ICR, said,

"It is estimated that whales consume 3 to 5 times the amount of marine resources as are caught for human consumption, so our whale research is providing valuable information required for improving the management of all our marine resources."[60]

He later added,

"...Sei whales are the second most abundant species of whale in the western North Pacific, with an estimated population of over 28,000 animals. [It is] clearly not endangered."[61]

Conservation groups, such as the World Wildlife Fund, dispute the value of this research, claiming that sei whales feed primarily on squid and plankton which are not hunted by humans, and only rarely on fish. They say that the program is

"nothing more than a plan designed to keep the whaling fleet in business, and the need to use whales as the scapegoat for overfishing by humans."[10]

At the 2001 meeting of the IWC Scientific Committee, 32 scientists submitted a document expressing their belief that the Japanese program lacked scientific rigour and would not meet minimum standards of academic review.[62]

In 2010, a Los Angeles restaurant confirmed to be serving sei whale meat was closed by its owners after prosecution by authorities for handling a protected species. [63]

Conservation status

World map showing that the U.S., China, India, Japan, Australia, Mexico, Russia, South Africa, and most European and Latin American states are members, among others.
Member states of the International Whaling Commission (in blue)

The sei whale did not have meaningful international protection until 1970, when the International Whaling Commission (IWC) first set catch quotas for the North Pacific for individual species. Before quotas, there were no legal limits.[64] Complete protection from commercial whaling in the North Pacific came in 1976.

Quotas on sei whales in the North Atlantic began in 1977. Southern Hemisphere stocks were protected in 1979. Facing mounting evidence that several whale species were threatened with extinction, the IWC established a complete moratorium on commercial whaling beginning in 1986.[5]

In the late 1970s, some "pirate" whaling took place in the eastern North Atlantic.[65] There is no direct evidence of illegal whaling in the North Pacific, although the acknowledged misreporting of whaling data by the Soviet Union[66] means that catch data are not entirely reliable.

The species remained listed on the IUCN Red List of Threatened Species in 2000, categorized as "endangered".[2] Northern Hemisphere populations are listed as CITES Appendix II, indicating they are not immediately threatened with extinction, but may become so if they are not listed. Populations in the Southern Hemisphere are listed as CITES Appendix I, indicating they are threatened with extinction if trade is not halted.[6]

The Sei whale is listed on both Appendix I[67] and Appendix II[67] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix I[67] as this species has been categorized as being in danger of extinction throughout all or a significant proportion of their range and CMS Parties strive towards strictly protecting these animals, conserving or restoring the places where they live, mitigating obstacles to migration and controlling other factors that might endanger them and also on Appendix II[67] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

Sei whale is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU)and the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas(ACCOBAMS)

The species is listed as endangered by the U.S. government National Marine Fisheries Service under the U.S. Endangered Species Act.

Population estimates

The current population is estimated at 80,000, nearly a third of the pre-whaling population.[7][12] A 1991 study in the North Atlantic estimated only 4,000.[68][69] Sei whales were said to have been scarce in the 1960s and early 1970s off northern Norway.[70] One possible explanation for this disappearance is that the whales were overexploited.[70] The drastic reduction in northeastern Atlantic copepod stocks during the late 1960s may be another culprit.[71] Surveys in the Denmark Strait found 1,290 whales in 1987, and 1,590 whales in 1989.[71] Nova Scotia's population estimates are between 1,393 and 2,248, with a minimum of 870.[47]

A 1977 study estimated Pacific Ocean totals of 9,110, based upon catch and CPUE data.[56] Japanese interests claim this figure is outdated, and in 2002 claimed the western North Pacific population was over 28,000,[61] a figure not accepted by the scientific community.[10] In California waters, there was only one confirmed and five possible sightings by 1991 to 1993 aerial and ship surveys,[72][73][73][74] and there were no confirmed sightings off Oregon and Washington. Prior to commercial whaling, the North Pacific hosted an estimated 42,000.[56] By the end of whaling, the population was down to between 7,260 and 12,620.[56]

In the Southern Hemisphere, population estimates range between 9,800 and 12,000, based upon catch history and CPUE.[68] The IWC estimated 9,718 whales based upon survey data between 1978 and 1988.[75] Prior to commercial whaling, there were an estimated 65,000.[68]

See also

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300014. 
  2. ^ a b c Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera borealis. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b c d e f S.L. Perry; D.P. DeMaster, and G.K. Silber (1999). "Special Issue: The Great Whales: History and Status of Six Species Listed as Endangered Under the U.S. Endangered Species Act of 1973". Marine Fisheries Review 61 (1): 52–58. http://spo.nwr.noaa.gov/mfr611/mfr611.htm. 
  4. ^ a b Gambell, R. (1985). "Sei Whale 'Balaenoptera borealis Lesson, 1828". In S.H. Ridgway and R. Harrison (eds). Handbook of Marine Mammals, Vol. 3. London: Academic Press. pp. 155–170. 
  5. ^ a b c d e f g h i Reeves, R.; G. Silber and M. Payne (July 1998) (PDF). Draft Recovery Plan for the Fin Whale Balaenoptera physalus and Sei Whale Balaenoptera borealis. Silver Spring, Maryland: National Marine Fisheries Service. http://www.cresli.org/cresli/pdf%20documents/finwhale.pdf. 
  6. ^ a b c d e f g h i j Shefferly, N. (1999). "Balaenoptera borealis". Animal Diversity Web. http://animaldiversity.ummz.umich.edu/site/accounts/information/Balaenoptera_borealis.html. Retrieved 2006-11-04. 
  7. ^ a b c d e f "Sei Whale & Bryde's Whale Balaenoptera borealis & Balaenoptera edeni". American Cetacean Society. March 2004. http://www.acsonline.org/factpack/SeiBrydesWhales.htm. Retrieved 2006-11-08. 
  8. ^ a b c d e Horwood, J. (1987). The sei whale: population biology, ecology, and management. Kent, England: Croom Helm Ltd. ISBN 0-7099-4786-0. 
  9. ^ Berzin, A. 2008. The Truth About Soviet Whaling (Marine Fisheries Review), pp. 57–8.
  10. ^ a b c "Japanese Scientific Whaling: Irresponsible Science, Irresponsible Whaling" (Press release). WWF-International. 2005-06-01. http://www.panda.org/about_wwf/what_we_do/species/publications/index.cfm?uNewsID=13793. Retrieved 2006-11-10. 
  11. ^ See Whaling in Japan and Whaling in Iceland
  12. ^ a b Jefferson, Thomas, Marc A. Webber, and Robert L. Pitman (2008). Marine Mammals of the World: A Comprehensive Guide to their Identification. London: Academic. 
  13. ^ NOAA, Office of Protected Resources - Sei whale.
  14. ^ a b c Glover Morrill Allen (1916). Whalebone Whales of New England. 8. pp. 234. http://books.google.com/?id=30YZAAAAYAAJ&pg=PA234&dq=Balaenoptera+borealis. Retrieved 2009-06-24. 
  15. ^ "Sei Whales (Balaenoptera borealis)". Whales on the net. http://www.whales.org.au/discover/sei/seig.html. Retrieved 2006-11-29. 
  16. ^ Andrews, Roy Chapman. 1916. Whale hunting with gun and camera; a naturalist's account of the modern shore-whaling industry, of whales and their habits, and of hunting experiences in various parts of the world. New York: D. Appleton and Co., p. 128.
  17. ^ Andrews, R.C. (May 1911). "Shore Whaling: A World Industry". National Geographic Magazine. http://web.archive.org/web/www.edwardtbabinski.us/whales/shore_whaling_industry.html. 
  18. ^ "Etymology of mammal names". IberiaNature – Natural history facts and trivia. http://www.iberianature.com/trivia/etymology_mammals.htm. Retrieved 2006-12-07. 
  19. ^ Gingerich, P. (2004). "Whale Evolution" (PDF). McGraw-Hill Yearbook of Science & Technology. The McGraw Hill Companies. http://www-personal.umich.edu/~gingeric/PDFfiles/PDG413_Whaleevol.pdf. 
  20. ^ "Balaenoptera borealis". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180526. Retrieved 10 November 2006. 
  21. ^ a b c Martin, A.R. (1983). "The sei whale off western Iceland. I. Size, distribution and abundance". Rep. Int. Whal. Commn 33: 457–463. 
  22. ^ Ivashin, M.V.; Yu.P. Golubovsky (1978). "On the cause of appearance of white scars on the body of whales". Rep. Int. Whal. Commn 28: 199. 
  23. ^ a b c Rice, D.W. (1977). "Synopsis of biological data on the sei whale and Bryde's whale in the eastern North Pacific". Rep. Int. Whal. Commn Spec. Iss. 1: 92–97. 
  24. ^ Shevchenko, V.I. (1977). "Application of white scars to the study of the location and migrations of sei whale populations in Area III of the Antarctic". Rep. Int. Whal. Commn Spec. Iss. 1: 130–134. 
  25. ^ a b Schilling, M.R.; I. Seipt, M.T. Weinrich, S.E. Frohock, A.E. Kuhlberg, and P.J. Clapham (1992). "Behavior of individually identified sei whales Balaenoptera borealis during an episodic influx into the southern Gulf of Maine in 1986". Fish. Bull. 90: 749–755. https://secure2.nni.com/whalecenter/pdfs/Sei_whales_FishBull92.pdf. 
  26. ^ a b Mead, J.G. (1977). "Records of sei and Bryde's whales from the Atlantic coast of the United States, the Gulf of Mexico, and the Caribbean". Rep. Int. Whal. Commn Spec. Iss. 1: 113–116. 
  27. ^ Edds, P.L.; T.J. MacIntyre, and R. Naveen (1984). "Notes on a sei whale (Balaenoptera borealis Lesson) sighted off Maryland". Cetus 5 (2): 4–5. 
  28. ^ "The Sei Whale (Balaenoptera borealis)" (PDF). The Institute for Marine Mammal Studies. http://www.dolphinsrus.com/factsheets/sei.pdf. Retrieved 2006-12-07. 
  29. ^ Watkins, W.A.; W.E. Schevill (1979). "Aerial observations of feeding behavior in four baleen whales: Eubalaena glacialis, Balaenoptera borealis, Megaptera novaeangliae, and Balaenoptera physalus". J. Mamm. 60 (1): 155–163. doi:10.2307/1379766. JSTOR 1379766. 
  30. ^ Weinrich, M.T.; C.R. Belt, M.R. Schilling, and M. Marcy (1986). "Behavior of sei whales in the southern Gulf of Maine, summer 1986". Whalewatcher 20 (4): 4–7. 
  31. ^ Darby, A. (February 6, 2002). "New Research Method May Ease Whale Killing". National Geographic News. http://news.nationalgeographic.com/news/2002/02/0206_020206_wirewhales.html. Retrieved 2006-12-19. 
  32. ^ a b c d e f Mizroch, S.A.; D.W. Rice and J.M. Breiwick (1984). "The Sei Whale, Balaenoptera borealis". Mar. Fish. Rev. 46 (4): 25–29. 
  33. ^ Christensen, I.; T. Haug, and N. Øien (1992). "A review of feeding and reproduction in large baleen whales (Mysticeti) and sperm whales Physeter macrocephalus in Norwegian and adjacent waters". Fauna norvegica Series A 13: 39–48. 
  34. ^ Tamura, T. (October 2001) (PDF). Competition for food in the Ocean: Man and other apical predators. Reykjavik Conference on Responsible Fisheries in the Marine Ecosystem, Reykjavik, Iceland, 1–4 October 2001. http://www.fisherieswatch.org/docs/245.pdf. Retrieved 2006-12-09. [dead link]
  35. ^ Nemoto, T.; and A. Kawamura (1977). "Characteristics of food habits and distribution of baleen whales with special reference to the abundance of North Pacific sei and Bryde's whales". Rep. Int. Whal. Commn Spec. Iss. 1: 80–87. 
  36. ^ a b c d Lockyer, C.; and A.R. Martin (1983). "The sei whale off western Iceland. II. Age, growth and reproduction". Rep. Int. Whal. Commn 33: 465–476. 
  37. ^ Lockyer, C. (1977). "Some estimates of growth in the sei whale, Balaenoptera borealis". Rep. Int. Whal. Commn Spec. Iss. 1: 58–62. 
  38. ^ Risting, S (1928). "Whales and whale foetuses". Rapp. Cons. Explor. Mer 50: 1–122. 
  39. ^ WWF (2007-06-18). "Sei whale - Ecology & Habitat". WWF Global Species Programme. http://www.panda.org/what_we_do/endangered_species/cetaceans/about/sei_whale/seiwhale_ecology_habitat/. Retrieved Jaunary 19, 2010. 
  40. ^ a b McDonald, M.; Hildebrand, J., Wiggins, S., Thiele, D., Glasgow, D., and Moore, S. (December 2005). "Sei whale sounds recorded in the Antarctic". The Journal of the Acoustical Society of America 118 (6): 3941–3945. doi:10.1121/1.2130944. PMID 16419837. http://scitation.aip.org/getabs/servlet/GetabsServlet?prog=normal&id=JASMAN000118000006003941000001&idtype=cvips&gifs=yes. 
  41. ^ Direct comparisons of sounds in water to sounds in air can be complicated, see this description for more information.
  42. ^ CETAP (1982). Final Report of the Cetacean and Turtle Assessment Program, University of Rhode Island, to Bureau of Land Management. U.S. Department of the Interior. Ref. No. AA551-CT8–48. 
  43. ^ Sutcliffe, W.H., Jr.; P.F. Brodie (1977). "Whale distributions in Nova Scotia waters". Fisheries & Marine Service Technical Report No. 722. 
  44. ^ Kenney, R.D.; H.E. Winn (1987). "Cetacean biomass densities near submarine canyons compared to adjacent shelf/slope areas". Cont. Shelf Res. 7: 107–114. doi:10.1016/0278-4343(87)90073-2. 
  45. ^ Masaki, Y. (1976). "Biological studies on the North Pacific sei whale". Bull. Far Seas Fish. Res. Lab. 14: 1–104. 
  46. ^ Rice, D.W. (1974). "Whales and whale research in the North Pacific". In Schervill, W.E. (ed.). The Whale Problem: a status report. Cambridge, MA: Harvard University Press. pp. 170–195. ISBN 0-674-95075-5. 
  47. ^ a b c Mitchell, E.; D.G. Chapman (1977). "Preliminary assessment of stocks of northwest Atlantic sei whales (Balaenoptera borealis)". Rep. Int. Whal. Commn Spec. Iss. 1: 117–120. 
  48. ^ a b Jonsgård, Å.; K. Darling (1977). "On the biology of the eastern North Atlantic sei whale, Balaenoptera borealis Lesson". Rep. Int. Whal. Commn Spec. Iss. 1: 124–129. 
  49. ^ a b Kapel, F.O. (1985). "On the occurrence of sei whales (Balenoptera borealis) in West Greenland waters". Rep. Int. Whal. Commn 35: 349–352. 
  50. ^ Sigurjónsson, J. (1983). "The cruise of the Ljósfari in the Denmark Strait (June–July 1981) and recent marking and sightings off Iceland". Rep. Int. Whal. Commn 33: 667–682. 
  51. ^ a b Sigurjónsson, J. (1988). "Operational factors of the Icelandic large whale fishery". Rep. Int. Whal. Commn 38: 327–333. 
  52. ^ Andrews, R.C. (1916). "The sei whale (Balaenoptera borealis Lesson)". Mem. Am. Mus. Nat. Hist. New Ser. 1 (6): 291–388. 
  53. ^ Ingebrigtsen, A. (1929). "Whales caught in the North Atlantic and other seas". Rapports et Procès-verbaux des réunions, Cons. Perm. Int. L’Explor. Mer, Vol. LVI. Copenhagen: Høst & Fils. 
  54. ^ Aguilar, A.; and S. Lens (1981). "Preliminary report on Spanish whaling operations". Rep. Int. Whal. Commn 31: 639–643. 
  55. ^ Barlow, J., K. A. Forney, P.S. Hill, R.L. Brownell, Jr., J.V. Carretta, D.P. DeMaster, F. Julian, M.S. Lowry, T. Ragen, and R.R. Reeves (1997) (PDF). U.S. Pacific marine mammal stock assessments: 1996. NOAA Tech. Mem. NMFS-SWFSC-248. http://swfsc.noaa.gov/publications/TM/SWFSC/NOAA-TM-NMFS-SWFSC-248.PDF. 
  56. ^ a b c d Tillman, M.F. (1977). "Estimates of population size for the North Pacific sei whale". Rep. Int. Whal. Commn Spec. Iss. 1: 98–106. 
  57. ^ Committee for Whaling Statistics (1942). International whaling statistics. Oslo: Committee for Whaling Statistics. 
  58. ^ Pike, G.C; and I.B. MacAskie (1969). "Marine mammals of British Columbia". Fish. Res. Bd. Canada Bull. 171. 
  59. ^ "WWF condemns Iceland’s announcement to resume whaling" (Press release). WWF-International. 2003-08-07. http://www.panda.org/about_wwf/where_we_work/arctic/news/index.cfm?uNewsID=8221. Retrieved 2006-11-10. 
  60. ^ "Japan not catching endangered whales" (PDF) (Press release). The Institute of Cetacean Research, Tokyo, Japan. 2002-03-01. http://www.icrwhale.org/eng/SEI.pdf. Retrieved 2006-11-10. 
  61. ^ a b "Japan's senior whale scientist responds to New York Times advertisement" (PDF) (Press release). The Institute of Cetacean Research, Tokyo, Japan. 2002-05-20. http://www.icrwhale.org/eng/NYTimes.pdf. Retrieved 2006-11-10. 
  62. ^ Clapham, P. et al. (2002). "Relevance of JARPN II to management, and a note on scientific standards. Report of the IWC Scientific Committee, Annex Q1". Journal of Cetacean Research and Management 4 (supplement): 395–396. 
  63. ^ "L.A. eatery charged with serving whale meat closes". Reuters. 2010-03-20. http://www.reuters.com/article/idUSTRE62J1A420100320. 
  64. ^ Allen, K.R. (1980). Conservation and Management of Whales. Seattle, WA: Univ. of Washington Press. ISBN 0295957069. 
  65. ^ Best, P.B. (1992). "Catches of fin whales in the North Atlantic by the M.V. Sierra (and associated vessels)". Rep. Int. Whal. Commn 42: 697–700. 
  66. ^ Yablokov, A.V. (1994). "Validity of whaling data". Nature 367 (6459): 108. doi:10.1038/367108a0. 
  67. ^ a b c d "Appendix I and Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  68. ^ a b c Braham, H. (1992). Endangered whales: Status update. Alaska Fisheries Science Center, Seattle, WA. 
  69. ^ Blaylock, R.A., J.W. Haim, L.J. Hansen, D.L. Palka, and G.T. Waring (1995). U.S. Atlantic and Gulf of Mexico stock assessments. U.S. Dept. of Commerce, NOAA Tech. Memo NMFS-SEFSC-363. 
  70. ^ a b Jonsgård, Å. (1974). "On whale exploitation in the eastern part of the North Atlantic Ocean". In W.E. Schevill (ed.). The whale problem. Cambridge, MA: Harvard University Press. pp. 97–107. 
  71. ^ a b Cattanach, K.L.; J. Sigurjonsson, S.T. Buckland, and Th. Gunnlaugsson (1993). "Sei whale abundance in the North Atlantic, estimated from NASS-87 and NASS-89 data". Rep. Int. Whal. Commn 43: 315–321. 
  72. ^ Hill, P.S. and J. Barlow (1992) (PDF). Report of a marine mammal survey of the California coast aboard the research vessel "MacArthur" July 28 - November 5, 1991.. U.S. Dept. Commerce, NOAA Technical Memo NMFS-SWFSC-169. http://swfsc.noaa.gov/publications/TM/SWFSC/NOAA-TM-NMFS-SWFSC-169.PDF. 
  73. ^ a b Carretta, J.V. and K.A. Forney (1993) (PDF). Report of two aerial surveys for marine mammals in California coastal waters utilizing a NOAA DeHavilland Twin Otter aircraft: March 9 - April 7, 1991 and February 8 - April 6, 1992. U.S. Dept. Commerce, NOAA Technical Memo NMFS-SWFSC-185. http://swfsc.noaa.gov/publications/TM/SWFSC/NOAA-TM-NMFS-SWFSC-185.PDF. 
  74. ^ Mangels, K.F. and T. Gerrodette (1994) (PDF). Report of cetacean sightings during a marine mammal survey in the eastern Pacific Ocean and the Gulf of California aboard the NOAA ships "MacArthur" and "David Starr Jordan" July 28 - November 6, 1993. U.S. Dept. Commerce, NOAA Technical Memo NMFS-SWFSC-211. http://swfsc.noaa.gov/publications/TM/SWFSC/NOAA-TM-NMFS-SWFSC-211.PDF. 
  75. ^ IWC (1996). "Report of the sub-committee on Southern Hemisphere baleen whales, Annex E". Rep. Int. Whal. Commn 46: 117–131. 

General references

Further reading

Oudejans, M. G. and Visser, F. 2010. First confirmed record of a living sei whale (Balaenoptera borealis (Lesson, 1828)) in Irish coastal waters. Ir Nat. J. 31: 46 - 48.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Names and Taxonomy

Taxonomy

Comments: Rice (1998) recognized northern and southern subspecies (B. borealis borealis and B. borealis schlegelii, respectively).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!