Articles on this page are available in 1 other language: Spanish (28) (learn more)

Overview

Brief Summary

Description

"Found worldwide in warm-temperate and tropical waters, Bryde’s whale avoids cold water, unlike most rorquals. Some individuals tend to live in coastal waters; others are migratory and occur well offshore. Bryde's eats more fish than many other balaenopterids. They have been seen feeding on schools of anchovies, sardines, herrings, and light fish. They also feed on a variety of crustaceans. We know little about their breeding habits or social behavior. Calves are born after about a year's gestation, and nurse until they are about six months old. A female bears one calf every two or three years."

Links:
Mammal Species of the World
  • Original description: Anderson, 1879.  Anatomical and Zoological Researches: comprising an account of the zoological results of the two expeditions to the Western Yunnan in 1868 and 1875. p. 551, pl. 44.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The Bryde's whale can mostly be found alone or in mother-calf pairs, but on occasion loose aggregations may form, probably due to the proximity of a productive feeding ground (2) (4). The feeding behaviour of this species is spectacular, and involves the whale lunging forwards through a shoal of fish or krill, mouth opened wide. A vast quantity of prey and water is taken into its mouth, which is accommodated by the expandable region on the underside of the jaw. This is then squeezed back through the closed jaws of the whale, allowing water to escape through the baleen fibres, but trapping food, which is swept off by the huge, rough tongue and swallowed (2). The Bryde's whale is one of the livelier rorqual species, frequently breaching clear of the water, and commonly making one to two minute long dives between the surface and depths of 300 metres (2). Migration patterns vary, with coastal populations in tropical waters appearing to remain in the same location throughout the year, whereas populations in subtropical waters may make limited migrations in response to movements of prey (1) (5). In tropical waters, the Bryde's whale may breed throughout the year, while in sub-tropical waters breeding mainly occurs in winter (5). After a year-long gestation period, a single young is born, already measuring around 4 metres in length. The Bryde's whale becomes sexually mature at around 8 to 11 years, and has a lifespan of up to 50 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Pronounced “broo-dess”, the Bryde's whale is named after Johan Bryde, who helped construct the first South African whaling factory in the early 1900s (4). This species is often confused with the slightly larger sei whale(Balaenoptera borealis), but can be distinguished by the three distinctive ridges that run from the tip of the broad rostrum to the rear of the head, level with the two blowholes. Like other rorqual whales, the Bryde's whale has numerous grooves running along the underside of the lower jaw to the belly, which allow this area to expand when the whale swallows water during feeding. The jaws are lined with between 250 and 365 plates of baleen, which bear long, coarse bristles on the inner edge, used for trapping food. The skin of the Bryde's whale is black or dark grey, with white patches on the throat and chin, and may sometimes appear mottled due to pock marks caused by parasites and small sharks (2). The taxonomic status of the Bryde's whale is currently unclear. While there appear to be numerous different forms—occupying separate locations and habitats, and showing variations in size—a consensus has yet to be reached regarding whether they should be classed as subspecies or species (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Because the number of species or subspecies is still unresolved, and because the different forms are not readily distinguishable at sea, considerable uncertainty remains with regard to the geographic range of each form.

Ordinary Bryde’s whales
“Ordinary” large-type Bryde’s whales occur in the Pacific, Indian and Atlantic oceans between about 40°N and 40°S or in waters warmer than 16.3°C (Kato 2002). Migration to equatorial waters in winter is documented for the southeast Atlantic population (Best 1996) and for the northwest Pacific population (Kishiro 1996). Migration patterns of other populations are poorly known

They are relatively common in the western North Pacific, mainly north of 20°N in summer and south of 20°N in winter. In the eastern North Pacific, they do not venture north of southern California (US), but there appears to be a resident population in the northern Gulf of California (Urbán and Flores 1996), and they occur throughout the eastern tropical Pacific (Wade and Gerrodette 1993). They occur throughout the tropical Pacific, and across the South Pacific down to about 35°S, but with shifts in distributions between seasons (Miyashita et al. 1995). They occur off the coasts of Peru and Ecuador but not during July to September (Valdivia et al. 1981), and off Chile in an upwelling area between 35°-37°S (Gallardo et al. 1983). In the southwestern Pacific, their distribution extends as far south as the North Island of New Zealand (Thompson et al. 2002).

Bryde’s whales occur throughout the Indian Ocean north of about 35°S. Those in the southern Indian Ocean appear to be large-type animals (Ohsumi 1980b), as are the Bryde’s whales of the northwest Indian Ocean, which were taken illegally by Soviet whaling fleets in the 1960s (Mikhalev 1997), and those around the Maldives (Anderson 2005).

In the South Atlantic, there is a population that summers off the western coast of southern Africa, and migrates to West African equatorial waters in winter (Best 2001). Elsewhere in the Atlantic the distribution of Bryde’s whales is not well known. The Bryde’s whale appears to occur year-round throughout Brazilian waters (Zerbini et al. 1997). Bryde’s whales occur in the Gulf of Mexico (Mullin and Fulling 2004) and throughout the wider Caribbean (Ward et al. 2001). They do not occur in the Mediterranean (Reeves and Notabartolo di Sciara 2006). They have been recorded as far north as Cape Hatteras in the northwest Atlantic (Rice 1998).

East China Sea
Bryde’s whales which occur off southern and southwestern Japan are now considered to belong to an East China Sea population, having earlier been thought to be a local resident population (Kato and Kishiro 1999). Phylogenetic analyses suggest that they are a subspecies of Bryde’s whales (Yoshida and Kato 1999) or belong to the separate species B. edeni (Sasaki et al. 2006).

South African inshore form
There is a resident inshore population of Bryde’s whales off South Africa which shows some morphological differences from ordinary Bryde’s whales (Best 1977, 2001). Its main distribution is between Cape Recife and Saldanha Bay (Best 2001). It may simply be a local form of ordinary Bryde’s whale, but its taxonomic status has yet to be investigated genetically.

Other small forms
Small-type “Bryde’s” whales that appear to be mature at small sizes have been found in various Asian waters and off Australia.

The B. edeni holotype (Anderson 1879) was found in the Gulf of Martaban, Andaman Sea. Further specimens were found on the Bay of Bengal coast of Myanmar (Anderson 1879) and in Bangladesh (Andrews 1918). The Junge (1950) specimen, used in recent studies as the genetic representative of B. edeni, is from Sugi Island, Sumatra (Indonesia) (close to Singapore).

A stranding from Hong Kong (China) and a rescued river-trapped individual in eastern Australian (Priddel and Wheeler 1998) have been found to be closely related phylogenetically to the “B. edeni” clade represented by the Junge (1950) specimen and the southwestern Japan whales (Sasaki et al. 2006, LeDuc and Dizon 2002).

Phylogenetic analyses reveal that at least some of the small “Bryde’s whales” taken in the Philippines artisanal fisheries (Perrin et al. 1996) were in fact B. omurai (Sasaki et al. 2006, LeDuc and Dizon 2002).

The identity of “Bryde’s whales” maturing at a small size (11-12 m) caught off western Australia (Bannister 1964) is unclear. They may be a local form, or related to small forms found elsewhere, or they may even have been B. omurai.

The identity of eight small “Bryde’s whales” stranded in Thai waters (Andersen and Kinze 1993) is also unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Bryde's whale is found throughout the world, primarily in warm temperate and sub-tropical waters.

Biogeographic Regions: ethiopian (Native ); neotropical (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Comores, European waters (ERMS scope), Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bryde's whales are dark gray in color with a yellowish white underside. They are the second smallest rorqual with an average length of 12 meters, although the female is usually about 1 foot longer than the male. Bryde's whales have two blowholes located on the top of the head. Bryde's whale is often confused with the Sei whale; however, the Bryde's whale has three parallel ridges in the area between the blowholes and the tip of the head. The flippers are small compared to body size. The prominent dorsal fin is sickle shaped. Instead of teeth, these whales have two rows of baleen plates. These plates are located on the top jaw and number approximately 300 on each side. Each baleen plate is short and wide, 50cm x 19cm.

Range mass: 12000 to 20000 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Length:
Range: 11.9-14.6 m males; 12.2-15.6 m females

Weight:
Range: 11,300-16,200 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A long- standing prohibition on the operation of factory ships north of 40°S except in the North Pacific north of 20°N meant that Bryde’s whale populations largely escaped the consequences of whaling suffered by baleen whale species that feed in higher latitudes, although this regulation was not respected by Soviet whaling fleets in the 1960s, nor by the pirate whaling ship Sierra in the 1970s (see above). However, some populations such as the East China Sea and South African Inshore stocks may have been reduced by whaling.

Pelagic whaling for Bryde’s whales was suspended in the North Pacific from 1980 following a ban by the IWC on most factory ship whaling, but catches continued from the coast of Japan and the Bonin Islands until 1987. Pelagic whaling resumed in the western North Pacific in 2000 under special permits issued by the Japanese authorities, but to date catches have been limited to 50 per year (IWC 2006a). Like most cetaceans, Bryde’s whales are occasionally by-caught in fishing gear, but they do not appear to be especially susceptible. Records of vessel strikes are also rare.

There are ongoing (or at least recent) artisanal fisheries in the Philippines and Indonesia taking small “Bryde’s whales” (Dolar et al. 1994, Perrin et al. 1996, Reeves 2002), but the catches include at least some specimens of B. omurai (LeDuc and Dizon 2002). It is unclear whether one or more forms of Bryde’s whale are also involved. In the absence of better information on the identity of the catches, it is not possible to judge whether these fisheries constitute a conservation threat.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Populations exist mainly in warmer waters (~20 degrees Celsius). More research needs to be done on this topic.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

mostly in tropical and subtropical zones, offshore as well as near the coast
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 532 specimens in 1 taxon.
Water temperature and chemistry ranges based on 147 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 14.617 - 28.903
  Nitrate (umol/L): 0.037 - 9.965
  Salinity (PPS): 32.701 - 36.232
  Oxygen (ml/l): 4.437 - 5.901
  Phosphate (umol/l): 0.092 - 0.922
  Silicate (umol/l): 0.983 - 7.372

Graphical representation

Temperature range (°C): 14.617 - 28.903

Nitrate (umol/L): 0.037 - 9.965

Salinity (PPS): 32.701 - 36.232

Oxygen (ml/l): 4.437 - 5.901

Phosphate (umol/l): 0.092 - 0.922

Silicate (umol/l): 0.983 - 7.372
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

There appear to be two distinct habitat preferences amongst Bryde's whales, with some populations, usually comprising smaller-bodied individuals, occurring in coastal waters, while other populations can be found in the open ocean (1) (5). Nevertheless, all Bryde's whales have a preference for warmer waters above 16.3 degrees Celsius (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bryde's whales feed almost exclusively on pelagic fish (pilchard, mackerel, herring, and anchovies) and pelagic crustaceans (shrimp,crabs, and lobsters). They also have been observed to eat cephalopods (octopus, squid, and cuttlefish).

Animal Foods: fish; mollusks; aquatic crustaceans

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
72.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 72 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Breeding occurs year round in Bryde's whales. Sexual maturity is reached at 10 years of age for males and 8 years of age for females. The gestation period is approximately 12 months. Most Bryde's whales bear 1 calf. Calves are around 4 meters at birth and weigh 1 ton.

Breeding season: Breeding occurs year round in Bryde's whales

Average number of offspring: 1.

Average gestation period: 12 months.

Average age at sexual or reproductive maturity (female): 8 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 1e+06 g.

Average gestation period: 376 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
3104 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
3104 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera edeni

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0664-06|NC_007938|Balaenoptera edeni| AACCGCTGACTATTCTCAACCAACCACAAAGACATTGGCACCCTATATTTACTATTTGGTGCATGAGCAGGAATAGTAGGCACTGGCCTA---AGCTTATTAATCCGTGCTGAGTTAGGTCAGCCCGGCACACTAATCGGAGAT---GACCAAGTCTACAACGTATTAGTAACAGCCCACGCCTTTGTGATAATCTTCTTCATAGTCATACCTATTATAATTGGTGGATTCGGAAACTGACTAGTCCCCCTAATA---ATCGGAGCACCTGACATAGCTTTCCCTCGTATAAATAATATAAGCTTCTGACTACTCCCCCCTTCTTTCCTACTGCTAATAGCATCCTCAATAGTCGAAGCTGGTGCAGGTACAGGCTGAACTGTATATCCCCCTTTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTT---ACCATCTTCTCCCTACATCTAGCCGGTGTATCCTCAATCCTCGGAGCCATCAATTTCATTACAACTATTATTAATATAAAACCACCCGCCATGACTCAATATCAAACACCCCTTTTCGTATGATCAGTCCTAGTCACAGCAGTGCTACTCCTACTATCGTTACCTGTTTTAGCAGCC---GGAATCACCATGCTACTTACTGACCGAAACCTAAATACAACTTTCTTCGACCCTGCAGGTGGAGGAGACCCAATTCTGTACCAACACCTATTCTGATTCTTTGGCCACCCCGAAGTGTATATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAA---GAACCTTTCGGCTACATGGGGATAGTCTGAGCTATGGTATCCATCGGGTTCTTAGGATTTATCGTATGAGCCCATCATATGTTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera edeni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
The taxonomy (number and identity of species) is not yet resolved. If there is more than one species, the less abundant species may be threatened. If it is all one species, then it should be classified as Least Concern.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Some populations were seriously depleted as a result of whaling practices. Bryde's whales are not on the Endangered species list. As a result of the 1986 Moratorium on Whaling, they are protected worldwide.

CITES: appendix i

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1) and listed on Appendix I of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Catch statistics
Prior to 1972, Bryde’s whales were not distinguished from sei whales in International Whaling Statistics, but in some cases the pre-1972 species breakdown of “sei” whale catches can be determined from original records, or approximated, based on current knowledge of the geographical and seasonal occurrence of sei and Bryde’s whales, or from the compositions of later catches in the same area and season (IWC 1997, 2006b). Bryde’s whales are distinguished from sei whales in Japanese national catch statistics from 1962, but in sighting records only from 1972 (Ohsumi 1978a).

Stock divisions
In the North Pacific region, the International Whaling Commission (IWC) Scientific Committee (SC) recognises the following stocks: Western North Pacific Stock (west of 150°W, down to 2°S), Eastern Tropical (east of 150°W down to 10°S), East China Sea, and Gulf of California (IWC 1996). The region of the South China Sea, and the Philippines and Indonesian and Solomon archipelagos are considered habitat of small-type Bryde’s whales and Omura’s whale, and not included in any putative stocks for ordinary Bryde’s whales, although the latter probably also occurs there (see above).

The IWC SC has not assessed Southern Hemisphere Bryde’s whales in recent times, but the IWC Schedule lists the following stocks, based on recommendations from the IWC Scientific Committee in 1980: western South Pacific (west of 150°W, but excluding Solomon Islands area), eastern South Pacific (south of 10°S), southern Indian Ocean, northern Indian Ocean, South African Inshore, and South Atlantic.

Western North Pacific
The currently accepted abundance estimate for the western North Pacific is 26,000 (CV=24%) based on surveys conducted during 1998-2002. Catches of Bryde’s whales from coastal stations in Japan are thought to have begun in 1906 and continued uninterrupted until 1987 when Japan adhered to the IWC’s commercial whaling moratorium. Pelagic catches were taken by Japanese fleets during 1971-79 and by Soviet fleets during 1966-79. Bryde’s whales were also caught from Taiwan during 1976-80 from the Bonin islands (Japan) during 1946-52 and 1981-87, and offshore whaling from the Philippines during 1983-1985 (IWC 2006a). Japanese pelagic catches resumed in 2000 under scientific permit (50 per year).

An annual catch series totalling over 20,000 whales for the period 1911-87 was estimated by the IWC SC in 1996 (IWC 1997). Since then, some new information has come to light: for example, Kondo and Kasuya (2002) reported that catches of Bryde’s whales by Japanese operations in the Bonin Islands during 1981-87 had been falsely reported as 2,659, in order to keep within catch limits, but that the true total was 4,162. According to a 1995 population assessment by the IWC SC, the population was reduced, in the worst case, by 49% during 1911-96 (IWC 1996). Work on a revised catch series and assessment is in progress (IWC 2007).

Eastern tropical Pacific
Wade and Gerrodette (1993) estimated 13,000 (CV= 20%) Bryde’s whales for the eastern tropical Pacific (in an irregularly-shaped area of 19 million km² between about 15°S and 25°N) from data collected during 1986-90.

An IWC/International Decade of Cetacean Research (IDCR) —later Southern Ocean Whale and Ecosystem Research (SOWER) — survey of the eastern equatorial Pacific (10°S-10°N, 80°-110°W) in December 1982 yielded an estimate of 17,000 (CV=32%) Bryde’s whales (IWC 1984), but the estimate should be recalculated using current methodology.

Bryde’s whales were distinguished from sei whales in Peruvian catch statistics from 1973, and 3,589 are recorded caught during 1973-83 (IWC 2006a). Of the “sei” whales reported caught during 1968-72, an estimated 1,953 were Bryde’s whales, to give a total Bryde’s catch of 5,542 during 1968-83.

Other North Pacific stocks
The most recent accepted estimate for the East China Sea Stock is 137 (variance not calculated), and for the Gulf of California stock 235 (173-327) (IWC 1996). The East China Stock was subject to whaling in southwestern Japan until the early 1970s, and may have been depleted (Omura 1977).

Southern Hemisphere
The Southern Hemisphere stocks of Bryde’s whales have not been re-assessed during the past 25 years, but the abundance estimates accepted at the time were: southern Indian Ocean − 13,854; western South Pacific − 16,585; and eastern South Pacific – 13,194 (IWC 1981). These were not based on what are currently accepted methods of survey design and analysis. Based on a majority recommendation of the Scientific Committee, the IWC subsequently reset the classification of these stocks to “zero catch limit pending a satisfactory estimate of stock size” (IWC 1983).

Of 1,705 “sei” whales reported taken off Chile during 1932-79 (IWC 2006a), an unknown proportion were Bryde’s whales (Gallardo et al. 1983).

The South African Inshore stock was estimated at 582 (±184) in 1983 (Best et al. 1984). Over 2,000 Bryde’s whales are recorded caught by modern whaling during 1911-67 in Cape Province, South Africa, including 1,300 during 1947-67 (IWC 2006a) of which most were from the inshore stock (IWC 1980).

No population estimates are available for the remainder of the South Atlantic. Of 2,536 “sei” whales taken by the pirate whaling ship Sierra in the South Atlantic during 1969-76, the majority are believed to be Bryde’s whales (IWC 1980). Of the over 5,000 “sei” whales recorded caught off Brazil during 1948-77, at least some were Bryde’s whales, but possibly only 8% (Omura 1962, Williamson 1975).

North Atlantic
Apart from a population estimate for the Southern Gulf of Mexico of 40 (13-129) animals (Mullin and Fulling 2004) there are no abundance estimates for the North Atlantic. Some of the “sei” whales recorded around the Straits of Gibraltar in the first half of the 20th century may have been Bryde’s whales (Aguilar 1984).

Small-type Bryde’s whales
No population estimates exist, and are unlikely to become available until methods are developed to identify them at sea and their range is better known.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Bryde’s whale was the incidental beneficiary of IWC area restrictions on factory ship whaling that were originally designed to protect the low-latitude winter breeding grounds of other baleen whale species, at a time when the Bryde’s whale was not yet recognised as a distinct species by the whaling industry (Tønnessen and Johnsen 1982). The Bryde’s whale is included in Appendix I of CITES although Japan has held a reservation against this listing since 1983. The species (as B. edeni) is listed in Appendix II of CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

A long standing prohibition on the operation of factory ships north of 40°S, put in place to prevent hunting of rorqual whale's at their lower latitude breeding grounds, allowed the Bryde's whale to escape most of the historical exploitation of rorquals, as it occupies this region all year round (1). Only populations in the North Pacific may have been affected, as whaling vessels in this region were allowed to operate at lower latitudes, but even this threat was mitigated by the international moratorium on all commercial whaling implemented by the International Whaling Commission (IWC) in 1986 (1) (2). Although pelagic whaling by Japan was subsequently resumed in 2000, it is under scientific permit, and limited to catches of 50 individuals per year (1). The main concern is that, while assessed as a single species, the Bryde's whale appears to be abundant, but if it is in fact a complex of several separate species, some populations may be so small that they warrant threatened status and require conservation action (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Bryde’s whale was the incidental beneficiary of IWC area restrictions on factory ship whaling that were originally designed to protect the low-latitude winter breeding grounds of other baleen whale species, at a time when the Bryde’s whale was not yet recognised as a distinct species by the whaling industry (Tønnessen and Johnsen 1982). The Bryde’s whale is included in Appendix I of CITES although Japan has held a reservation against this listing since 1983. The species (as B. edeni) is listed in Appendix II of CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!