You are viewing this Taxon as classified by:

Articles on this page are available in 2 other languages: Spanish (20), Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Species Abstract

The Northern minke whale (Balaenoptera acutorostrata), is a very large cetacean, in the family of Rorquals (Balaenoptera). The Minke is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans, and small fish.

The smallest of the rorqual whales (and the second-smallest baleen whale), the minke whale is also the most abundant. Two species are now recognised, the northern hemisphere minke whale (the subject of this species page) and the southern hemisphere Antarctic minke whale (Balaenoptera bonaerensis). Minke whales are slim in shape, with a pointed dolphin-like head, bearing a double blow-hole. The smooth skin is dark grey above, while the belly and undersides of the flippers are white, and there is often a white band on the flipper. When seen at close quarters, minke whales have variable smoky patterns which have been used to photo-identify individuals.

Minke whales feed on fish and various invertebrates; like all baleen whales they filter their food from the water using their baleen plates like sieves. Although largely a solitary species, when feeding minke whales can often be seen in pairs, and on particularly good feeding grounds up to a hundred individuals may congregate. A number of feeding techniques have been observed, including trapping shoals of fish against the surface of the water. After a ten month gestation period, births occur in mid-winter, at birth the calf measures up to 2.8 metres in length. It will be weaned at four months of age, and will stay with its mother for up to two years, becoming sexually mature at seven years of age. Minke whales have an average life span of around 50 years. Minke whales are rather inquisitive and often swim by the side of boats for up to half an hour.
  • * Encyclopedia of Earth. Lead Author; Encyclopedia of Life. ed. C.Michael Hogan. Northern minke whale. ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC
  • http://www.eoearth.org/article/Northern_Minke_Whale?topic=49540
  • * Howson, C.M. & Picton, B.E. (ed.), (1997). The species directory of the marine fauna and flora of the British Isles and surrounding seas. Belfast: Ulster Museum. [Ulster Museum publication, no. 276]
  • * Keller, R.W., S. Leatherwood & S.J. Holt (1982). Indian Ocean Cetacean Survey, Seychelle Islands, April to June 1980. Rep. Int. Whal. Commn 32, 503-513.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The smallest of the rorqual whales, the minke whale is also the most abundant (2). Two species are now recognised, the northern hemisphere minke whale (the subject of this species page) and the southern hemisphere minke whale (Balaenoptera bonaerensis) (5). Minke whales are slim in shape (2), with a pointed 'dolphin-like' head (2), bearing a double blow-hole (5). The smooth skin is dark grey above, the belly and undersides of the flippers are white, and there is often a white band on the flipper (5) (6). When seen at close quarters, minke whales have variable 'smoky' patterns which have been used to photo-identify individuals (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Minke whales are the second-smallest baleen whales. They are identifiable by a narrow, pointy snout, and most seen in North American waters have a white stripe on the back of each flipper. Minkes are relatively common in coastal waters, where they feed on marine crustaceans and fish. They may also become the prey of killer whales. During spring and summer minkes generally migrate north through coastal waters. In fall and winter they go south, taking an offshore route. They tend to occur in small groups of two or three. Mature females can calve every year, after a gestation of about 10 months. Calves are born at any time of the year, but mostly in January and June. Newborns are less than 3 m long, nurse for 4 or 5 months, and take at least 6-7 years to mature.

Links:
Mammal Species of the World
  • Original description: Lacépède, B-G, 1804. Histoire Naturelle des Cétacées, Paris: Plassan An XII, p. 134.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Minke whales feed on fish and various invertebrates; like all baleen whales they filter their food from the water using their baleen plates like sieves (2). Although largely a solitary species, when feeding minke whales can often be seen in pairs, and on particularly good feeding grounds up to a hundred individuals may congregate (2). A number of feeding techniques have been observed, including trapping shoals of fish against the surface of the water (7). After a ten month gestation period, births occur in mid-winter (2), at birth the calf measures up to 2.8 metres in length (5). It will be weaned at four months of age (3), and will stay with its mother for up to two years, becoming sexually mature at seven years of age (7). Minke whales have an average life span of around 50 years (7). Minke whales are fairly inquisitive and often swim by the side of boats for up to half an hour (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

Description

 The Minke is a medium sized whale, sleek in shape, with a very pointed head. It is dark grey to black in colour with a white underside and has white patches behind the head and a bright white band on the outer part of the flippers. Adults reach lengths of 6.75-10 m long and 5 -10 tonnes in weight. The new born calf is ca 2.5 m long and weighs ca 350 kg. There are 30-70 throat grooves that always end before the naval (umbilicus). The dorsal fin is sickle-shaped, and about two-thirds of the way back from the tip of the animal's snout. The tail flukes are a quarter of the animal's length in width, and are not shown when diving. There are 230-360 baleen plates, 12 -20 cm long, in each half of the upper jaw, which are yellowish-white at the front to grey-brown at the rear.The blow is very weak and can been seen at the same time as the dorsal fin appears. Spyhopping and breaching are common for this species, which forms small groups of up to 3 individuals. The Minke can remain submerged for up to 20 minutes (Kinze, 2002).

 This whale could be confused at a distance with the Sei whale and the Bryde's whale as they are relatively the same size, however the weak blow of the Minke whale and dorsal fin appearing at the same time as the blow is characteristic. At close range the white bands on the Minke's flippers are diagnostic (Jefferson et al., 1993; Kinze, 2002).

 Baleen whales are included in group species action plan under the UK Biodiversity Action Plan (Anon, 1999v). All baleen whales are protected under schedule 5 in the Wildlife and Countryside Act 1981, the Wildlife (Northern Ireland) Order 1985. All whales are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES, Appendix I, thus prohibiting their commercial trade (Anon, 1999v). Whales are listed in Appendix I of CITES, Appendix II of the Bern Convention and Annex IV of the EC Habitats Directive (Anon, 1999v).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

On a small note in Dubar (1828) was written that this species was stranded in Blankenberge (Belgium) in 1837
(Dubar, J. (1828). Ostéographie de la baleine échouée à l'est du port d'Ostende, le 4 novembre 1827; précédée d'une notice sur la découverte et la dissection de ce Cétacée. Laurent Frères, Imprimeurs-Libraires: Bruxelles, Belgium. 61, 13 folded plates pp.)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Pacific; Eastern and Atlantic Ocean; Indo-West Pacific
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-global
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Common Minke Whale is a cosmopolitan species found in all oceans and in virtually all latitudes, from 65°S to 80°N. In parts of its range it is very abundant, in other parts much less so. Its migration patterns are poorly known. It occurs in the North Atlantic, the North Pacific, and the Southern Hemisphere, but is not known from the northern Indian Ocean.

North Atlantic
In summer, Minke Whales are common throughout the northern North Atlantic as far north as Baffin Bay, Greenland Sea, Svalbard (Norway), Franz Josef Land and Novaya Zemlya (Russian Federation), and as far south as 40°N (New Jersey) on the US east coast (Anon. 2005a), and as far south as the Hebrides (northwest British Isles) and the central North Sea in the east. In the mid-Atlantic summer concentrations of minke whales occur to at least as far south as 50°N (Sigurjónsson et al. 1991). It is likely that at least a part of the Minke Whale population over-winters in the summer range, but there has been very little observation effort in winter to confirm this.

Minke Whales also occur south of this range in the southeastern North Atlantic, but with no obvious seasonality, and are not common, with the exception of the Canary Islands, where they appear to be frequent year-round (Van Waerebeek et al. 1999). There have been occasional sightings (Aguilar et al. 1983) and strandings (Van Waerebeek et al. 1999) off Spain and Portugal, Western Sahara, Mauritania and Senegal. Minke whales are rare in the Azores and not recorded from Madeira. The minke whale is considered a “visitor species” in the Mediterranean (average <1 record per year) with one vagrant recorded in the Black Sea (Reeves and Notabartolo di Sciara 2006).

There are very few winter records, but a summary by Mitchell (1991) indicates that they do occur in winter near Bermuda, the Bahamas and the Antilles, and the US coast south of 40°N. Ten strandings have been recorded in the Gulf of Mexico (Jefferson and Schiro 1997) but hardly any live sightings. A Norwegian winter expedition sent to the tropical Atlantic in 1989/90 to “find the breeding grounds of the minke whale” encountered just two minke whales, at 20°N and 10°N off West Africa in December (Folklow and Blix 1991).

North Pacific
Minke whales occur in summer right across the North Pacific north of about 30°N in summer, with a tendency for the distribution to shift northward in high summer. They are particularly abundant in the Okhotsk Sea in August (Miyashita et al. 1995), and also occur in the Bering Sea, around the Aleutian Islands and in the Gulf of Alaska (Moore et al. 2002, Zerbini et al. 2006) and the Chukchi Sea (Ivashin and Votrogov 1981). In the eastern North Pacific, there appears to be a year-round population off California and Baja California and in the Gulf of California, and minke whales occur in summer off Oregon, Washington and British Columbia (Anon. 2003). They have been seen off Hawaii but are not common there (Anon. 2005b).

In the western North Pacific, there are at least two distinct subpopulations: the so-called “J stock,” an autumn-breeding population that occurs in the Yellow Sea, East China Sea and Sea of Japan, with some penetration into the Okhotsk Sea in summer; and the O-stock which, like most baleen whales, breeds in winter, and occurs in summer in the northwestern Pacific, including the northeastern coasts of Japan, and in the Okhotsk Sea (Omura and Sakiura 1956, Kato 1992).

The winter distribution is poorly known. Japanese expeditions to look for wintering grounds in the southwestern North Pacific during 1993-95 failed to locate any minke whales (Miyashita et al. 1996). The timing of the arrival of minke whales in Korean and western Japanese waters is suggestive of migration from the south in spring and return in autumn (Ohsumi 1983). The wintering area in the eastern North Pacific has been identified acoustically to be primarily between 15 and 35 degrees N latitude (Rankin and Barlow 2005).

Southern hemisphere
Much of the data on the occurrence of minke whales in the Southern Hemisphere is ambiguous with respect to identification as B. acutorostrata or B. bonaerensis, because the two species are partially sympatric. Japanese scouting vessel data indicated high abundance of minke whales in November between 10°-30°S in the central South Pacific and in much of the eastern and southern Indian Ocean down to 50°S (Miyashita et al. 1995), but their species identity is unclear. The limited information available from surveys in low and middle latitudes from the 1987/88 season onwards, when the two species were reliably distinguished, indicates that most of the minke whales are B. bonaerensis (Nishiwaki et al. 1991), probably on route to the Antarctic from (as yet unknown) low-latitude breeding grounds, but also that B. acutorostrata is present in these latitudes.

Dwarf minke whales occur at higher latitudes but are much less common than B. bonaerensis. Of more than 1,700 minke whales taken by Antarctic pelagic whaling from the 1987/88 to the 1992/93 season (when the two species have been reliably distinguished), only 16 were dwarf minke whales (Nishiwaki et al. 2005). One was taken at 65°S and the remainder at between 55-62°S, the northern limit of whaling operations.

In coastal waters, dwarf minke whales have been recorded off most of the South Atlantic coast of South America (Baldas and Castello 1986, Zerbini et al. 1996), in the Beagle Channel (Chile/Argentina) (Acevedo et al. 2005), off South Africa (Best 1985), Australia (Arnold et al. 1987, Bannister et al. 1996, Arnold 1997), New Zealand (Dawson and Slooten 1990), and New Caledonia (Garrigue and Greaves 2001). The most northerly confirmed Southern Hemisphere record is from 2°S, off the northern coast of Brazil (Magalhães et al. 2007). Three dwarf minke whales were caught in whaling operations off Costinha, Brazil in 1980 (along with 900 Antarctic minke whales) (da Rocha and Braga 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Minke whales have a worldwide distribution, appearing in all oceans and some adjoining seas. Cooler regions seem to be preferred over tropical regions.

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Throughout the world's oceans in tropical, temperate, and polar waters, including Hudson Bay (Can. Field-Nat. 106:266-267). See IUCN (1991) for further details. IWC stock management units have little or no biological significance (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in all oceans of the northern hemisphere from polar waters to tropical regions. The northern hemisphere minke whale is the whale most likely to be seen from the coasts of the UK and Ireland, particularly from Scotland, western Ireland and the Northern Isles (7). In the English Channel and southern parts of the Northern Sea it is rare (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Minkes are the smallest of the finback whales, growing to a maximum of 10.2 meters long. Females are larger than males, occasionally growing to a maximum of 10,000 kg. Coloration is dark above with a white underbelly. The head is pointed and bulletlike, with a relatively small rostrum. Baleen plates number around 300, are yellowish in color, and occasionally assymetrical in pattern. There are between 50-70 ventral grooves. A broad white band trims the dorsal side of flippers. The tail extends into two long tips. The dorsal fin is high and curved back.

Range mass: 6000 to 9000 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 9100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Females are larger than males.

Length:
Range: 6.7-9.8 m males; 7.3-10.7 m females

Weight:
Range: 20,000-40,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: white flipper patches. Blow not readily visible. Colour is light grey with white belly.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Balaenoptera acutorostrata Lacepede, 1804
Catalog Number: USNM A12177
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull; Photograph
Collector(s): C. Scammon
Year Collected: 1870
Locality: Admiralty Inlet, North Shore Of Admiralty Inlet., Jefferson, Washington, United States, North America, North Pacific Ocean
  • Type: Scammon, C. M. 1872. Proc. Cal. Acad. Sci. 4: 269.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

inshore to offshore
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Common Minke Whale occurs in both coastal and offshore waters and exploits a variety of prey species in different areas according to availability. In the Northern Hemisphere some populations migrate to higher latitudes in summer, but minke whales are also found year-round in some areas. With the exception of the Sea of Japan – Yellow Sea – East China Sea population, conception and birth occur in winter. Most animals occur singly, and few in groups of more than two.

In the North Atlantic, studies in the Barents and Norwegian Seas showed that minke whale diet varied greatly between areas and years, being dominated by krill in the northern areas, but by herring or capelin in other areas according to what was most abundant that year, with gadoids being taken when herring and capelin were scarce (Lindstrøm and Haug 2002). In the North Sea the diet consisted almost exclusively of sandeel (data from one year only). Minke whales taken off Iceland in 2003-04 contained mainly sandeel, with some capelin and gadoids (Víkingsson et al. 2006). Minke whales caught off Newfoundland during 1966-72 contained mainly capelin (Mallotus villosus) (Mitchell 1974).

In the Northwest Pacific, Lindstrøm et al. (1998) found that krill Euphausia pacifica dominated the diet in coastal areas and in the Okhotsk Sea, while in the offshore Pacific, Pacific saury Cololabis saira dominated.

Feeding habits of the Dwarf Minke Whale are poorly known. The stomach contents of an individual collected in Brazil contained exclusively Euphausia similis (Secchi et al. 2003). Whales taken in the Antarctic (n=16) ingested mostly myctophid fishes (Kato and Fujise 2000).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although not considered "coastal", these baleen whales rarely venture farther than 169 km from land. They also commonly enter estuaries, bays, fjords, and lagoons. They are also know to move farther into polar ice fields than other rorqual species.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2687 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1606 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.678 - 29.313
  Nitrate (umol/L): 0.016 - 30.199
  Salinity (PPS): 30.771 - 37.050
  Oxygen (ml/l): 4.431 - 8.213
  Phosphate (umol/l): 0.044 - 2.073
  Silicate (umol/l): 0.494 - 87.652

Graphical representation

Temperature range (°C): -1.678 - 29.313

Nitrate (umol/L): 0.016 - 30.199

Salinity (PPS): 30.771 - 37.050

Oxygen (ml/l): 4.431 - 8.213

Phosphate (umol/l): 0.044 - 2.073

Silicate (umol/l): 0.494 - 87.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal and pelagic waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 An open water species, most often seen in coastal and inshore areas but sometimes enters inlets, bays or estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits inshore to offshore waters and is usually more concentrated in higher latitudes during the summer and lower latitudes during the winter, but migrations vary from year to year. This whale often enters estuaries, bays and inlets, and during summer may feed around headlands and small islands (2) (8)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Many populations migrate to high latitude waters for summer, to low latitude waters for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

A baleen whale, this species feeds primarily on krill and some small fish. There are regional differences in the diet. Minkes eat krill almost exclusively in the Antarctic, but they are more omnivorous in the northern hemisphere, taking as food squid and small vertebrates such as cod, herring, and sardines.

Animal Foods: fish; mollusks; aquatic crustaceans

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mostly fishes in North Pacific, krill in southern ocean, fishes (mainly) and krill in North Atlantic (IUCN 1991); fishes eaten are small, schooling species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually solitary, sometimes found in groups of 2-3. Annual survival rate in Antarctic exceeds 90% (IUCN 1991). Common prey for orca (killer whale).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

schooling fish and various invertebrates
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
45.0 years.

Average lifespan

Status: wild:
47.0 years.

Average lifespan

Status: wild:
50.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: These animals have been estimated to live up to 50 years in the wild (Bernhard Grzimek 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Only one young is born at a time. Gestation lasts for 10 to 11 months. Weight at birth is 450 kg. The young are weaned at 5 months, but they do not become sexually mature for 6 years. Females are thought to have young every other year. The breeding period is long--from December to May in the Atlantic and year round in the Pacific. Peak months for births are December and June. Growth stops at about 18 years for females and 20 years for males.

Breeding interval: Females are thought to have young every other year.

Breeding season: The breeding period lasts from December to May in the Atlantic and year round in the Pacific

Average number of offspring: 1.

Range gestation period: 10 to 11 months.

Average age at sexual or reproductive maturity (female): 6 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 320000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2740 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2740 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts 10-11 months. Single calf is born November-March in North Atlantic, mainly late May and early June in Southern Hemisphere. Young are weaned in 6 months or less. Adult females produce one calf every 1-2 years. Most sources give the age of sexual maturity as 6-7 years or 7-8 years, but 2 years or mean of 6-15 years also has been reported; age of maturity apparently decreases when populations are significantly reduced. Maximum age is about 30-40 years in the North Atlantic, something less than 50 years in the Southern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera acutorostrata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTGTATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACCGGCCTAAGCTTACTAATTCGCGCTGAGCTAGGCCAGCCTGGCACACTAATCGGAGACGACCAAGTCTACAATGTATTGGTAACAGCCCACGCCTTCGTAATAATCTTTTTCATGGTCATGCCTATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCCGACATAGCTTTCCCCCGTATAAATAATATAAGCTTCTGACTACTTCCCCCTTCTTTTTTACTTCTAATAGCATCTTCAATAGTCGAGGCTGGTGCGGGTACAGGCTGAACTGTATATCCTCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTTGACCTTACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTCATCACAACTATCATCAATATAAAACCACCTGCTATAACCCAATATCAAACTCCCCTTTTCGTATGATCCGTCCTAGTCACAGCAGTACTACTCTTACTATCATTACCCGTCTTAGCAGCCGGAATCACTATACTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCCATCCTATACCAACACCTATTCTGATTCTTTGGTCACCCCGAAGTATATATCCTAATTCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGTTATATAGGAATAGTCTGAGCTATAGTATCCATTGGGTTTTTAGGCTTTATCGTATGAGCCCATCACATGTTTACAGTAGGTATAGACGTTGACACACGAGCATATTTCACATCAGCTACTATAATCATTGCCATTCCCACAGGAGTAAAAGTCTTCAGCTGATTAGCAACACTACACGGAGGTAACATTAAATGATCTCCTGCTCTAATATGAGCCCTAGGTTTCATCTTCCTCTTCACAGTAGGCGGCCTAACTGGTATTGTCCTAGCCAACTCATCACTAGATATTGTCCTACACGACACCTACTACGTAGTTGCTCATTTCCACTATGTATTATCAATAGGAGCAGTTTTCGCCATCATGGGAGGTTTTGTCCACTGGTTCCCACTATTCTCAGGGTATACACTTAACCCTACATGAACAAAAATTCACTTCATAATCATATTTCTAGGTGTAAACCTAACATTCTTTCCGCAGCACTTCTTAGGCCTATCCGGTATACCTCGACGGTACTCCGACTACCCAGACGCCTATACAACATGAAATACCATTTCATCCATAGGCTCCTTTATTTCACTAACAGCAGTTATACTAATAATCTTCATTATCTGAGAAGCATTCACATCCAAACGAGAAGTACTAGCAGTAGATCTTACCACTACCAACCTCGAATGACTAAACGGATGCCCCCCACCATACCATACATTCGAAGAACCAGCATTCGTCAACCCAAAATATTCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera acutorostrata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
There is no estimate of total global population size, but estimates from parts of the range in the Northern Hemisphere (totalling in excess of 100,000 individuals) show that it is well above the thresholds for a threatened category. While declines have been detected or inferred in some areas, there is no indication that the global population has declined to an extent that would qualify for a threatened category.

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The global population is estimated at over 300,000 individuals, and there seems to be no cause for concern, since this species is not commonly hunted anymore. Many populations are on appendix 1 of CITES. Numbers have also been on the rise since the early 1900's because close competitors (other rorqual species) have been overhunted.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive. All whales are listed on Annex A of EU Council Regulation 338/97 and are therefore classed as if they are listed on Appendix 1 of CITES. Under the Fisheries Act of 1981 whaling is illegal in UK waters. All cetaceans (whales and dolphins) are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985. The UK recognises the authority of the International Whaling Commission in matters concerning whaling regulations (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The IWC recognizes four stocks of Minke Whales in the North Atlantic: Northeast Atlantic, Central North Atlantic, West Greenland, and Canadian East Coast. The last includes the US east coast. Population estimates were last reviewed by the IWC SC in 2003 (IWC 2004a), but a new estimate for West Greenland was accepted in 2006 (IWC 2007a). The best/most recent available estimates are listed in Table 1 in the linked PDF document (which constitutes an integral part of this assessment). These total about 182,000.

No abundance estimate is available for the Newfoundland area where there was a small-scale fishery for Minke Whales during 1948-72 (Mitchell 1974).

Minke Whales have been exploited in the North Atlantic, mainly since the 1940s, and recorded catches total about 140,000 (IWC 2006a). The largest catches have been by Norwegian “small-type” whalers who have taken about 120,000 since 1948, mainly in the Northeast Atlantic. Annual catches peaked at over 4,000 in the late 1950s, declining to about 2,000 annually in the early 1980s. Catches were phased out from 1984 to 1987. Commercial minke whaling resumed in 1993 at a lower level and continues to the present.

About 4,000 Minke Whales were taken off Iceland during 1941-85, but recent abundance estimates imply that this would have had no discernible effect on the population. About 8,000 Common Minke Whales have been caught by small-type whaling off West Greenland, mainly since 1960. The present catch limits (up to 175 annually for the years 2003-7) were set by the IWC in the absence of advice from its SC. Some concerns have been expressed by the IWC SC over the sustainability of the catch levels given the uncertainty over the size of the population available to the hunters off West Greenland (IWC 2007a) although sex ratio information suggests that the population has not been significantly reduced by the catches (Witting 2006).

North Pacific
The IWC recognizes three management stocks in the North Pacific: Sea of Japan – Yellow Sea – East China Sea; Okhotsk Sea – West Pacific (west of 180°); and “Remainder” (east of 180°). Considerable research has been undertaken since the IWC designation indicating the potential for further stock structure both within the Okhotsk Sea - West Pacific area and in the "Remainder" area.

Okhotsk Sea – West Pacific
The IWC SC conducted an assessment of the Okhotsk Sea – West Pacific stock in 1991. Surveys in the summers of 1989 and 1990 yielded an abundance estimate of 25,049 (CV 0.316) of which the bulk (19,209; CV 0.339) was in the Okhotsk Sea (Buckland et al. 1992). Although the Okhotsk Sea was surveyed again in 1992 and 2003 (Miyashita 2004), an abundance estimate from the last of these surveys has yet to be presented.

About 13,000 Minke Whales have been recorded caught by Japanese coastal whaling during 1948-87 (IWC 2006a), of which probably all but about 1,000 were from the Okhotsk Sea-West Pacific stock. Annual catches peaked at over 500 in 1973, declining to 300 in 1987 when commercial whaling was suspended. Catches resumed in 1994 under scientific permits issued by the Government of Japan and have increased since then. The catch in 2006 was 195 from a permit for 220 (Miyashita and Kato 2007).

The above catch figures do not include net catches, which are not subject to whaling regulations. Reported net catches of minke whales off Japanese coasts averaged only about five per year in the 1980s, but Tobayama et al. (1992) estimated that the true level in 1989 was about 100. Based on genetic analysis of samples of whale products collected in commercial markets during 1993-1999, Baker et al. (2000) also estimated the net catch to be about 100 per year. During the 1990s, reported net catches averaged about 20 per year. After new regulations were introduced in 2001 that provided an incentive to report (only those catches that are reported and genetically sampled can be legally marketed), reported net catches have averaged 127 per year (Japan 2002-2006). About 55% of the reported net catches during 2001-05 have been on the Sea of Japan and East China Sea coasts (IWC 2007b), and would be mainly from the “J stock” (see below), with the remainder from the Okhotsk Sea-West Pacific Stock.

The issue of subpopulation structure within the Okhotsk Sea – West Pacific Stock has been discussed extensively by the IWC SC in the context of preparations for implementing the Revised Management Procedure (RMP) for western North Pacific Minke Whales, but with inconclusive results (IWC 2004b).

Although population models suggest that, when considered as a single biological unit, the Okhotsk Sea-West Pacific stock has declined little under the influence of past or present catches (IWC 2004c), the situation should be kept under review; in particular, the more recent 2003 survey data should be analyzed to update the 1990 and 1992 abundance estimates for the Okhotsk Sea.

Sea of Japan (East Sea) – Yellow Sea – East China Sea stock (“J stock”)
The reproductive cycle of this stock, usually referred to by biologists as the “J stock”, appears to be four months out of phase with other Northern Hemisphere minke whales, with conceptions occurring in October-November instead of February-March for the Okhotsk Sea – West Pacific stock (Omura and Sakiura 1956, Kato 1992). This is the only known case of breeding asynchrony in Baleen Whale populations from the same hemisphere. A degree of reproductive isolation between the two stocks is also suggested by frequency differences at selected allozyme loci (Wada 1984). A segregation of maternal lineages is indicated by marked differences in the frequencies of mtDNA haplotypes (Goto and Pastene 1997; Baker et al. 2000).

About 16,000 whales are recorded to have been taken from this stock by commercial whaling based in South Korea during 1940-86, in addition to about 1,000 from western Japan (IWC 2006a). Catches peaked at 1,033 in 1977. Catches were phased out with a complete moratorium to take effect from 1986 (IWC 1984).

However, net catches (which are not subject to whaling regulations) began in Korea in the late 1980s (Kim 1999). From 1996 onwards, a regulation has been in effect that requires the reporting of such catches. During 1996-2005, reported catches averaged 90 per year. However, a genetic analysis of samples of whale products on Korean commercial markets yielded an estimate of 827 (SE 164) whales entering the market in the period 1999-2003, as compared with a reported catch of only 458 whales (Baker et al. In press). This suggests that reporting is still far from complete, and that the total J-stock catch from South Korea and Japan (see above) has exceeded 200 per year over the last 10 years. Minke Whales are also reported to be a common bycatch in China, but no figures are available (IWC 2006c).

Surveys in the range of the J-stock have been conducted from 1999 in the waters of the Republic of Korea (Sohn et al. 2005) and from 2002 in Japanese waters (Miyashita 2004), but no estimate of total population size is available. The IWC in 2005 (IWC 2006b) endorsed plans for joint research by the range states (Republic of Korea, China, Japan, Russian Federation), and a comprehensive survey in the waters of all four countries is planned for 2007.

Eastern North Pacific (east of 180°E)
Population estimates are available only for parts of the eastern North Pacific, e.g. 1,015 (CV 0.73) for the west coast of the US during 1991-2001 (Anon. 2003) and 810 (CV 0.36) and 1003 (CV=0.26) respectively in the central and southeastern Bering Sea (Moore et al. 2002), and 1,232 (CV=0.34) for coastal waters of the northern Gulf of Alaska and the eastern and central Aleutian Islands (Zerbini et al., 2006). Minke Whales are apparently quite abundant in the offshore Gulf of Alaska (Miyashita et al. 1995) but no abundance estimate is available for that region.

Differences in vocalizations during the breeding season strongly suggest further population structure within this area. Different calls are found on either side of about 135 degrees W longitude (Rankin and Barlow 2005).

Southern Hemisphere
It is not possible at this time to estimate the abundance of B. acutorostrata in the Southern Hemisphere, because most of the available quantitative sighting data do not distinguish it from the much more numerous B. bonaerensis with which it is partially sympatric. B. acutorostrata has not been subject to significant exploitation in the Southern Hemisphere.

Generation time
No satisfactory method of age determination has been developed for this species to date. Therefore the value of 22 years from Taylor et al. (2007) was used. Unlike Antarctic Minke Whales, common minke whales tend not to develop ear plugs with readable layering (Lockyer 1984). A method based on layer counts in tympanic bullae (Christensen 1981) could not be reproduced by later workers. Other age-estimation methods are being investigated, but none is yet at the stage where it can be applied reliably to this species (Olsen and Øien 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Whaling on this species has been intensive in the Northeast Atlantic, and it reduced the population over the period 1952-83. Catches were phased out by 1987, but whaling resumed, at a lower level, in 1993. Norway sets national catch limits based on the IWC’s Revised Management Procedure, a formula for setting safe catch limits (IWC 1999). In presenting the RMP to the IWC for approval, the IWC SC offered three variants that it believed were acceptable and the IWC chose the most conservative option. Up until 2000, Norway used this option to set its national catch limits. It is now using the least conservative option presented by the SC. The national catch limit for 2006 was 1,052 whales, but only 521 were taken.

Coastal catches averaged about 200 per year off Iceland until 1985 when the IWC moratorium on commercial whaling came into effect. Small (a total of 100 expected for the period 2003-2006) “experimental” catches resumed in 2003. Catches off West Greenland continue, under an IWC catch limit of 175 whales annually, valid through 2007. As discussed above the IWC SC has expressed concern at its inability to provide scientific advice on an appropriate catch limit (IWC 2007a).

Catches resumed in the North Pacific in 1994 under scientific permit issued by the Government of Japan, and have increased since. The catch in 2006 was 195 from a permit for 220 (Miyashita and Kato 2007).

Minke whales are subject to some level of incidental catch in fishing gear throughout much of their range, but in most areas the numbers involved are probably not significant. The exceptions are the coasts of Japan and Korea, and possibly China. In particular, the high level of net catches of the Sea of Japan-Yellow Sea-East China Sea population, likely over 200 per year, is a source of concern, which has prompted the IWC SC to conduct an in-depth assessment of this stock. A multinational survey involving the four range states is planned for 2007.

During this century, a profound reduction in the extent of sea ice in the Arctic is expected, and possibly a complete disappearance in summer, as mean Arctic temperatures rise faster than the global average (Anonymous 2005c). The implications of this for minke whales are unclear but warrant monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Some stocks (e.g., Sea of Japan/Yellow Sea/East China Sea stock and northeastern North Atlantic stock) have been depleted by commercial whaling (IUCN 1991). There is concern about the status of the West Greenland stock, where catches by local people for their own use continue (IUCN 1991). In the early 1990s, there was strong pressure from some countries to reopen commercial whaling for this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The common name of this species indicates the main threat that has faced it for many years; Minke was an 18th Century Norwegian whaler who hunted small whales, flouting the whaling rules of the day (7). Despite the world moratorium on commercial whaling set up by the International Whaling Commission (IWC) in 1982, minke whales are still hunted by Norway and Japan (2). Norway officially objected to the moratorium, and Japan kills whales for 'scientific research', but the carcasses are commercially processed after the research has been carried out (2). Other potential threats facing minke whales, and indeed all cetacea, include pollution and reduction in prey abundance, perhaps as a result of over-fishing (7). Entanglement in fishing nets and the effects of long-term climate change are also likely to pose problems, but as yet the importance of these threats is unknown (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Catch limits for all commercial whaling have been set at zero by the IWC since 1986. However, this moratorium does not apply to Iceland, Norway or the Russian Federation which have objected to this provision. IWC members are allowed to issue permits for whaling for scientific research, and Japan makes substantial use of this provision. Limited aboriginal subsistence whaling is permitted by the IWC for common minke whales off Greenland. Takes of dwarf minke whales have been excluded from the Japanese scientific whaling programme in the Antarctic (JARPA) since summer 1992/93 (Nishiwaki et al. 2005). Minke whales, including B. acutorostrata, are included in Appendix I of CITES, with the exception of the population from Greenland which is included in Appendix II. This implies prohibition of commercial international trade in products, but such prohibition does not apply to Iceland, Norway or Japan, who hold reservations on the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

This whale is a UK Biodiversity Action Plan priority species. Under Schedule 8 of the Wildlife and Countryside Act of 1981, this species is fully protected in UK waters. CITES (the Convention on International Trade in Endangered Species) controls exports of whale meat and products (7). In 1996, six tonnes of Norwegian whale meat was confiscated by customs officials in Japan. The shipment was disguised as mackerel (2). The current population figures for northern hemisphere minke whales are unknown and highly disputed. The future status of this inquisitive whale is unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Minke whales have been hunted by people for products such as meat, oil, and baleen since the Middle Ages. Regardless, it has never been of large commercial importance until other whale species were overhunted. Annual kill peaked in 1976 with 12,398 individuals, but now is down to < 1,000. These are taken primarily by indigenous peoples for food, or by scientists for research.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long hunted for human food and oil. Became a major target for modern whalers following depletion of larger species (around the 1930s in the Northern Hemisphere, 1970s in the Southern Ocean). Mainstay of Japanese factory ship whaling in southern ocean in early 1980s. Norway and Japan continued hunting for "scientific research" during recent whaling ban; these and possibly other nations have been pressing to resume commercial hunting of minke. See IUCN (1991) for review of exploitation history.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common minke whale

The common minke whale or northern minke whale (Balaenoptera acutorostrata) is a species of minke whale within the suborder of baleen whales. It is the smallest member of the rorquals and the second smallest species of baleen whale. Although first ignored by whalers due to its small size and low oil yield, it began to be exploited by various countries beginning in early 20th century. As other species declined larger numbers of common minke whales were caught, largely for their meat. It is now one of the primary targets of the whaling industry.

Taxonomy[edit]

Otto Fabricius, in his Fauna Groenlandica (1780), was the first to describe the minke, noting its small size and white baleen. He unfortunately described it under the name Balaena rostrata, which was already preoccupied by a beaked whale. In 1804, Baron de Lacepede named it Balaenoptera acuto-rostrata, basing his description partly on the stranding of a 4.26 m (14 ft) juvenile female near Cherbourg, France in 1791.[3] There are several forms of common minke whale, including Scammon's minke whale (B. a. scammoni) from the North Pacific and the dwarf minke whale, from the Southern Hemisphere.[3]

Until recently, all minke whales were considered a single species. However, the common minke whale was recognized as a separate species from the Antarctic minke whale based on mitochondrial DNA testing.[4] This testing also confirmed that the Antarctic minke whale is the closest relative of the common minke whale, thus confirming the validity of the minke whale clade.[4]

Description[edit]

Skeleton of the Common minke whale.
A minke whale in the Saguenay–St. Lawrence Marine Park, showing the blowholes and dorsal fin at the same time
A minke whale in the Gulf of St. Lawrence showing scars perhaps caused by killer whales

The common minke whale is the smallest of the rorquals, and one of the smallest baleen whales (second smallest only to the Pygmy right whale). In the North Atlantic, Norwegian whaling vessels in 1940 allegedly caught individuals of up to 10.7 m (35 ft) in length, but they were likely only measured visually in comparison to objects of known dimensions aboard the ships themselves – the longest caught in subsequent years were typically only up to 9.4-10.05 m (31–33 ft) in length.[5] In the North Pacific, Soviet vessels operating out of the Kuril Islands claimed to have caught two males of 12.2 (40 ft) and 12 m (39.4 ft) and a female of 10.7 m (35.1 ft) – the first two were landed in 1951, the third in 1960.[6] These likely represent undersized sei whales, part of the massive misreporting of whaling data by the Soviet Union in the North Pacific and elsewhere.

The longest measured by Icelandic scientists were an 8.7 m (28.5 ft) male and a 9 m (29.5 ft) female, while the longest caught by the Japanese in the western North Pacific were 8.5 m (27.9 ft) males and a 9.1 m (29.8 ft) female – the latter caught off eastern Hokkaido in 1977.[7][8] For the dwarf form, the longest reported lengths are 7.62 m (25 ft) for males and 7.77 (25.5 ft) for females.[9]

At sexual maturity, males and females in the North Atlantic average between 6.16-6.75 m (20.2-22.1 ft) and 6.03-7.15 m (19.8-23.4 ft), while in the North Pacific they average between 6.3-6.8 m (20.7-22.3 ft) and 7.1-7.3 m (23.3-23.9 ft). At physical maturity, males and females in the North Atlantic average between 7.9-8.17 m (25.9-26.8 ft) and 8.42-8.5 m (27.6-27.9 ft), while in the North Pacific they are slightly smaller, averaging only 7.5 and 8 m (24.6 and 26.2 ft), respectively. At birth, they are estimated to be 2.5-2.8 m (8.5-9.2 ft) in length and weigh 150–300 kg (330-660 lbs). They are thought to be weaned at about 4.57 m (15 ft) in length.[7][8][10]

A minke whale's size relative to a zodiac off Tadoussac

Common minke whales are among the most robust members of their genus, the greatest height of their body to total length being one to five. They have a narrow, pointed, triangular rostrum, and a prominent, falcate dorsal fin, which averages about 30 cm (12 in) in height (range: 7–77 cm [2.8-30.8 in]), set two-thirds the way along the back. They are dark gray dorsally and clean white ventrally, with two broad light gray swaths (the thorax and flank patches, which join ventrally) on the flank and a light-colored shoulder streak or chevron oriented towards the anterior. Most have a prominent, transverse, white flipper band – though it can be obscure in a small percentage of individuals in the western North Pacific. The majority of common minke whales have creamy white baleen plates, with a small percentage in the western North Pacific (mostly larger individuals) having baleen plates with a thin black band along the outer margin. They possess 50 to 70 thin ventral pleats, which only extend about 47 percent of the body length – among the shortest relative to body length among the rorquals, second only to the sei whale.[11][12][13]

The common minke whale differs from the Antarctic variety in several aspects. The common species is slightly smaller than the Antarctic, which has much less white marking on the flippers. There are also less distinctive differences in body coloration and shape.[14]

Distribution[edit]

Range[edit]

View of a common minke whale underwater, showing the diagnostic white flipper band

Common minke whales have a disjointed distribution. In the North Atlantic, they occur as far north as Baffin Bay, Svalbard, Franz Josef Land, and Novaya Zemlya and as far south as 40° N (New Jersey) and the Hebrides and central North Sea during summer. They occur year-round off the Canary Islands. There are occasional sightings and strandings off Spain and Portugal, western Sahara, Mauritania, and Senegal. It is rare off the Azores and a vagrant in the Mediterranean Sea, with a single record in the Black Sea.[15] During the winter it has been recorded off Bermuda, the Bahamas, the Antilles, and the east coast of the United States south of 40° N.[16] In the western North Pacific, they range from the East China Sea, Yellow Sea and Sea of Japan in the south to the Sea of Okhotsk and Bering and Chukchi Seas in the north.[17] In the eastern North Pacific, they occur in the Gulf of Alaska south along the entire west coast of North America down to Baja California and into the Gulf of California. During winter, they've been acoustically recorded mainly between 15° and 35° N in the eastern and central North Pacific.[18] The dwarf form occurs as far south as 65° S during summer, but was mainly caught between 55 and 62° S.[14] It has also been recorded off most of the South Atlantic coast of South America, in the Beagle Channel, off South Africa, Australia, New Zealand, New Caledonia, and as far north as 2° S (northern Brazil).

Occurrence[edit]

Site fidelity[edit]

Minke whales individually identified in three separate study sites on the western coast of North America showed strong site fidelity. A total of 55 individuals were identified, 30 in the San Juan Islands of Washington State from 1980 to 1984, 17 in the Monterey Bay area of central California from 1984 to 1987, and eight in the Johnstone Strait area of British Columbia from 1981 to 1987 – although in the last region most were only photographed incidentally to the study of killer whales. The number of sightings per individual ranged from only one in one year to 37 over nine years, with 31 whales (56.4%) being sighted in at least two years and 12 (21.8%) being seen in at least five years. Most were seen exclusively or almost exclusively in one of three sub-regions in the San Juan Islands and one of two sub-regions in the Monterey Bay area.[13]

In the San Juan Islands, 14 out of 18 whales were within their primary range on at least 94 per cent of sightings. Of the three sub-regions, Range A, northwest of Orcas Island, had the most stable constituency, with five individuals seen repeatedly over the study period, accounting for all but one of 88 sightings. Range B, east of San Juan Island, had the least stable constituency as well as the lowest number of sightings per year, while Range C, south and west of San Juan Island, had the greatest number of sightings and the greatest number of identified individuals every year. One whale, S4, was repeatedly and consistently found in Range B for three years, but was never seen there again after 1982; few sightings were made since then and all of these occurred in 1984, most of them involving three whales that were usually found in Range A (S8, S10, and S13). In Range C, five whales were seen there every year, while seven were only seen in a single year – most of the latter individuals were never encountered in any other part of the study site. There were also whales that showed no site fidelity at all, moving freely between the sub-regions. For example, whale S9, although only being sighted five times over four years, had sightings evenly divided between ranges B and C; whale S5, on the other hand, encountered 27 times over the course of eight years, was seen in more than one range in most years and moved around the three sub-regions more than any other whale.[13]

In the Monterey Bay area, Range A was north of the deep-water canyon that runs into Carmel Bay, while Range B was south of that canyon. Individuals were sighted within one of the two ranges on at least 88 per cent of the sightings, with whales even being observed to turn around as they approached the border of their primary range and head back toward the middle of their range – this happened five times at the northern border and twice at the southern border of Range A, and six times at the northern border of Range B. Whales were sighted within 3 km (1.8 miles) of the coast, occasionally just outside the kelp, most of the time moving in a more or less straight line.[13]

In a photo-identification study of minke whales off Iceland conducted between 2001 and 2010, a total of 353 whales were individually identified: 292 in Faxaflói Bay, on the southwest coast, and 61 in Skjálfandi Bay, on the northeast coast. In Faxaflói Bay, 68 (23.3%) were resighted at least once, with 53 (18.2%) being resighted in two years, nine (3.1%) in three years, and six (2.1%) in four years. The majority in Skjálfandi was only sighted in one year, while ten (16.4%) were resighted at least once, four (6.6%) in two years, and six (9.8%) in three years or more. One whale, first photographed in Skjálfandi Bay in July 2002, moved repeatedly between the two study sites over a period of nearly ten years, sometimes being sighted in both areas in the same season.[19]

Migration[edit]

Three minke whales tagged off Iceland showed large-scale movements. One tagged off the north coast on 20 August 2002 first moved northeast of Iceland on 31 October before heading south, reaching 56° N, 27° W on 8 November. Another, tagged in Faxaflói Bay on 14 September 2004, turned south along the Reykjanes Ridge about two weeks later; its last signal was received on 8 October at about 50° N, 34° W. The third traveled the greatest distance. After being tagged in Faxaflói Bay on 27 August 2004 its first signal wasn’t received until 17 November, when it was over the Mid-Atlantic Ridge, 900 km (559 mi) west of northern Spain. Its next position was transmitted six days later, some 700 km (435 mi) to the south, around the Azores, while its last signal was received on 5 December along the Canary Current, 1,000 km (621 mi) northwest of the Cape Verde Islands. In all, it traveled 3700 km (2299 mi) from its tagging location in a little over 100 days.[20]

Biology[edit]

Reproduction[edit]

Common minke whales are sexually mature at about six to eight years of age for females and about six to seven years for males.[10][21] After a gestation period of 10 months, a single 2.6 m (8.5 ft) calf is born – only one out of 79 mature females during a study of minke whales off Iceland had twin fetuses, an 8.7 m (28.5 ft) female caught in July 2006 which had a 34 cm (13.4 in) male and a 32 cm (12.6 in) female.[7] The calf is weaned after a period of six months. Peak conception is February in the North Atlantic, late February to mid-March for the "O stock" (which migrates along the eastern coast of Japan to the Okhotsk Sea), and between October and November for the "J stock" (which occurs in the Yellow Sea, East China Sea, and Sea of Japan, and migrates to the southern Okhotsk Sea in the spring, where it mixes with the O stock).[2][8] Peak calving is December in the North Atlantic, December to January in the North Pacific, and May to July for the J stock.[22] The calving interval is only a year, so females are often simultaneously pregnant and lactating. Females reach physical maturity perhaps as early as 13 years of age; another study suggested that growth ceases for both sexes when they have 15 to 20 growth layers in their tympanic bullae, which may correspond to about 15 to 20 years of age.[10][21] Both sexes can live to about 50 years of age – the oldest in a study of Icelandic minke whales were 42 years for females and 47 years for males, respectively.[7]

Prey[edit]

Common minke whales have been described as ichthyophagous, but their diet also includes pelagic crustaceans and cephalopods and varies by region, season, and year. In the North Atlantic, they primarily eat small schooling fish, demersal fish, and krill. A 2007 study showed that off Spitsbergen they fed almost exclusively on members of the euphausiid genus Thysanoessa (mainly T. inermis), but nearly a fifth also fed on small amounts of capelin. A small percentage of individuals, by decreasing frequency, also fed on polar cod, Atlantic cod, haddock, and copepods. Capelin dominated off Bear Island and in the southern Barents Sea, accounting for about three-quarters of their diet in both regions. Nearly half (nearly 46 per cent) also consumed euphausiids (Thysanoessa spp.) in the former area – haddock (12.5%), blue whiting (8.3%), polar cod, Atlantic cod, Atlantic herring, and copepods constituted the rest. Herring and haddock were also taken in the southern Barents Sea (accounting for 41.5 and 28.7 per cent by frequency of occurrence, respectively), while sandeel (Ammodytes spp.), Atlantic cod, copepods, euphausiids, pollock, and blue whiting made up the rest of the diet. In the Norwegian Sea, herring was found in all individuals sampled (n= 10), with some (20 per cent each) also feeding on a small amount of capelin and blue whiting – an earlier study, based on data primarily obtained between 1943-1945, showed that they fed exclusively on herring off Vesterålen, while the diet off Lofoten was more varied, including herring (34 per cent by occurrence), pelagic crustaceans (23%), Atlantic cod (22%), haddock (6%), and a mixture of coalfish and flatfish for one individual (1.5%).[23][24] In the North Sea, they primarily fed on sandeel (62%) and Atlantic mackerel (nearly 30%), with some feeding on herring (16.2%), small amounts of Mueller's pearlside (10.8%), copepods, haddock, capelin, and whiting. They were found to feed almost exclusively on Atlantic mackerel in the northern North Sea, while the same was true for sandeel in the eastern North Sea.[23] Off Iceland, they mainly fed on sandeel (nearly 58 per cent of sampled individuals), haddock (22.6%), herring (20%), capelin (19.4%), and Atlantic cod (14.7%), with the rest of the diet consisting of euphausiids, various larger species of gadiods, and Norway pout. Sandeel was more important in southern Iceland (constituting 78 per cent of sampled individuals), while capelin (35.1%), haddock (28.7%), and cod (22.3%) were more important in the north. Euphausiids were only consumed in the north. Although haddock was only a minor part of the diet the first couple years of the study (0 and 4% in 2003 and 2004, respectively), it subsequently constituted a major component of it (31-35% in 2005-2007), while sandeel's importance in the south declined considerably (95.2 to 77.7% from 2003-2006, but only 18.1% in 2007).[25] Off southeastern Greenland, they only fed on capelin, while sandeel dominated off southwestern Greenland.[24]

In the North Pacific, small schooling fish and krill are major food items. They feed exclusively on Pacific herring in the northern Okhotsk Sea and only on Alaska pollock east of Sakhalin Island. Japanese mackerel (found in 61 per cent of sampled stomachs) and Pacific saury (18%) are consumed east of the southern Kuril Islands, with only the former species being found in whales sampled in September and the latter species likewise only being found in whales taken in October. Euphausiids make up nearly two-thirds of the diet (62%) around the western Aleutian Islands, with unidentified fish (19%) constituting most of the rest. On the Okhotsk Sea side of Hokkaido they mainly feed on euphausiids (55%), but also take sardine (24%) and sand lance (13%); on the Pacific side of Hokkaido, they feed almost exclusively on sardine (99%). In Sanriku, sardine makes up the bulk of the diet (54%), but euphausiids also play an important part (32%) – only a small percentage (9%) fed on sand lance. Euphausiids were a major food item on the Okhotsk Sea side of Hokkaido and off Sanriku in the spring (71, 72 and 62% from April–June in the former area, and 83% in April in the latter area), while sardine dominated the diet in the summer in both areas (71% in September for the former region, and 70, 92, and 93% from May–July in the latter region).[26] More recent data from Japanese scientific catches in the western North Pacific shows Japanese anchovy to be a major component of the diet in two of the three sub-areas (60 per cent by weight in sub-area 7 and 37.4% in sub-area 8), while Pacific saury was the major food item in sub-area 9 (64.6%) and played an important part of the diet in sub-area 8 (36.4%). Euphausiids (9.2% in all areas combined), Alaska pollock (7.8% in sub-area 7), minimal armhook squid (4.9% in sub-area 9), and mackerel were also consumed.[27] They are thought to feed on juvenile herring and probably sand lance (Ammodytes hexapterus) around the San Juan Islands, while in the Monterey Bay region they have been observed feeding on baitfish – probably northern anchovy, which is abundant there.[13]

In the Southern Ocean, dwarf minkes feed mainly on myctophid fishes.[28]

Predation[edit]

There have been numerous recorded instances of killer whales attacking common minke whales in places such as the Kamchatka Peninsula, Alaska, British Columbia, Washington State, the Gulf of St. Lawrence, and Greenland.[29][30] They are normally able to outpace pursuing killer whales in open water or are trapped in a bay, where they are rammed and drowned or strand and die – in one instance a minke whale was able to refloat itself on the rising tide and swim away. Chases usually last about 30 minutes to an hour and can reach speeds of up 30 km/hr (18.6 mph), often with both species porpoising out of the water in low-angle leaps. Typically two to four killer whales and a lone minke are involved. If the pursuing killer whales do catch up to the minke it does not defend itself, which is typical of the fast-moving members of its genus. On two occasions fleeing minkes sought shelter under a boat, once off Yakutat, Alaska, in 1977 and again in Glacier Bay, Alaska, in 1996 – in both instances they were attacked and killed. Killer whales typically only eat the tongue, skin, and some of the blubber of the minkes they kill.[31]

Parasites and epibiotics[edit]

Common minke whales are a host to a number of internal and external parasites, as well as commensals, and other epibiotic fauna. Off Iceland, 45.2 per cent (85 of 188) of sampled minke whales bore old scars from attacks by the sea lamprey Petromyzon marinus, while a further 10.6 per cent had fresh scars on the posterior part of their flanks; five were found with live lampreys still clinging to their flesh. The copepod Caligus elongatus was found on 11.9 per cent of individuals, with a mean intensity (M. I.) of 95.5 per whale – the monogenean hyperparasite Udonella caligorum was also found attached to 22 (6.6%) of a sub-sample of 332 C. elongatus. Another copepod, Pennella balaenopterae, was found anchored into the flesh of 10.3 per cent of the whales (M. I. 1.6, with a maximum of five). The whale louse Cyamus balaenopterae was found on the skin of 6.5 per cent of the whales (M.I. 37), while the pseudo-stalked barnacle Xenobalanus globicipitis was found on the flukes of three whales (M.I. 5.3). A single individual of the goose barnacle Conchoderma auritum was found attached to a baleen plate that belonged to a 7.9 m (25.9 ft) male caught off the northwest coast in 2005, while four C. virgatum were found attached to a specimen of P. balaenopterae on a 5.3 m (17.4 ft) female caught off the north coast in 2003.[32]

Among a sample of 100 minke whales caught in the western North Pacific in 1995, 78% had the copepod P. balaenopterae anchored into their skin and blubber – the goose barnacle C. virgatum was found attached to P. balaenopterae on three of the whales. The whale louse C. balaenopterae was found on the skin of four whales, while a single whale had the pseudo-stalked barnacle X. globicipitis attached to its skin. All individuals sampled were infected with the nematode Anisakis simplex in their stomachs (sometimes their small intestine) and the acanthocephalan Bolbosoma nipponicum in their small intestine. Other internal parasites included the cestodes Diphyllobothrium macroovatum, Diplogonoporus balaenopterae, and Tetrabothius sp., which infected the small intestine and were found in 17 per cent of the sample (all three species combined).[33]

Behavior[edit]

A common minke whale breaching off the Azores

Common minke whales are normally seen singly. In the San Juan Islands, although up to six whales could be seen in a feeding area at once they usually acted independently, with no indications of cooperative feeding like that observed in their larger relatives the humpback and fin whale. On occasion, two whales could be seen surfacing at the same time, within one or two body lengths of each other – such associations could last for only one surfacing to as long as about 90 minutes. Only once were three individuals seen together for a couple surfacings. In the Monterey Bay area, usually only one whale was visible at a time; on only four occasions were two whales seen swimming together. On several occasions in the Johnstone Strait area pairs and trios were briefly seen surfacing together.[13]

Minke whales occasionally breach, sometimes completely clearing the water – one individual in the Johnstone Strait area reacted to the approach of foraging killer whales by breaching eight times in rapid succession.[13]

Surfacing sequence[edit]

When a minke whale first comes to the surface to breathe its pointed rostrum is the first to break the surface. It either exhales beforehand or a narrow, diffuse blow or a low, bushy, diffuse blow is visible. It then arches its back in a quick motion, exaggerating this arch during its terminal deep dive. Often the blowholes and dorsal fin are visible at the same time. Depending on its behavior, it may exhale anywhere from one to seven times in rapid succession before going on a longer dive of several minutes duration. In the Gulf of St. Lawrence, this depended on whether a whale was traveling, searching, or feeding. During traveling, when the whale was slower moving (generally in a straight line), it would exhale the greatest number of times (6.44 on average) and dive for a longer period of time (3.67 minutes on average) than when it was feeding, which was characterized by constant change in direction and vigorous swimming – this normally involved one or two respirations interspersed with three to seven (2.27 on average) followed by a relatively short dive (1.36 minutes on average). When a whale was searching, on the other hand (which involved the whale moving at a faster speed than traveling in a sort of zigzag motion), it would exhale 3.22 times on average and dive the longest of the three modes (3.76 minutes on average).[34]

In the Monterey Bay area, focal follows of minke whales showed that they respired an average of 3.74 times during a surfacing sequence. These short duration dives averaged 37.8 seconds and were followed by a long duration dive of an average of 4.43 minutes.[35] In the San Juan Islands, the number of exhalations and the duration of dives depended on whether the whale was lunge feeding or feeding with birds. In the former method of feeding, whales made short dives – about 22 seconds long – up to seven times in rapid succession before making a long dive of about 3.8 minutes, while during the latter method they made longer short dives of about 65 seconds followed by shorter long dives of about 1.5 minutes.[13]

Feeding techniques[edit]

In the Gulf of St. Lawrence, minke whales exhibit three types of behaviors: entrapment maneuvers, engulfment maneuvers, and entrapment/engulfment maneuvers. Entrapment maneuvers include circles, gyres, ellipses, figure-of-eights, and hyperbolas. Circles involve a whale, lying on its side with its ventral surface facing its intended prey, swimming in a circle 1.5 to 2.5 times its diameter and lunging mouth agape across the diameter of this circle. As the whale mounts the water column the movement of its flukes create a print or trace. Gyres are larger versions of circles that steadily decrease in diameter as the whale performs each circuit. Ellipses cover a greater area than the former two maneuvers as the whale swims a long and short axis – the former can be greater than 100 m (328 ft) at times. Ellipses can be maintained for long periods of time and may include feeding circles within them as well as a number of engulfing maneuvers. Unlike circles, surface traces are rarely apparent. Figure-of-eights are smaller versions of ellipses, with a long axis of less than six body lengths. The whale turns in opposite directions at each end of the long axis. Hyperbolas involve the whale turning at least once at the end of a short straight line run – this maneuver is sometimes performed alongside a rock face, followed by an inward facing feeding lunge.[34]

Engulfment maneuvers include plunges, oblique, lateral, vertical and ventral lunges. During plunges the whale approaches the water at an angle of less than 30° with its ventral surface facing downwards. Usually only the rostrum and part of the lower lip are visible above the surface of the water as it breaks the surface and often the tops of the extended ventral pleats. Oblique lunges are executed at a greater angle (about 45°) and entirely expose the extended ventral pleats; at times the entire body exits the water in a low, porpoising-like breach. During a lateral lunge the whale breaks the surface on its side, while during vertical and ventral lunges the whale exits the water at a 90° angle and while on its back, respectively.[34]

Entrapment/engulfment maneuvers include horizontal, lateral and ventral arcs. During a horizontal arc a whale turns sharply – on either side – with only a pectoral fin or occasionally a tip of the flukes breaking the surface of the water. Lateral and ventral arcs are similar to lateral and ventral lunges, but without any part of the whale breaking the surface of the water. All three of these maneuvers have been observed with both expanded and unexpanded ventral pleats.[34]

Plunges were used the most often (22% of the time), followed by ventral (19%), lateral (17%), and oblique lunges (15%). Vertical lunges were infrequently utilized (only 5% of the time), as were horizontal (7%), ventral (6%), and lateral arcs (3%).[34]

Novel feeding techniques were observed during a study of five individually identified minke whales (named M1 to M5) in the Saguenay Fjord National Park, on the north side of the St. Lawrence estuary, from June to October 2003. These maneuvers included head slaps, chip-up blows, and exhales on the dive. During a head slap, the whale would raise its head high out of the water at angle of about 30 to 45°, take a quick breath, and then slam its head onto the water, creating a loud splash. It would do this without expanding its ventral pleats or forcing water out of its mouth. After doing several head slaps the whale would perform a feeding lunge. Head slaps were used almost exclusively by M4 and M5. A chin-up blow is similar to a normal surfacing but more energetic and executed at a greater angle as the whale comes high out of the water to breathe and dive again in one continuous motion without slapping the surface of the water. Chin-up blows were utilized often and performed by all five whales; it was the principal technique used by M1, M2, and M3 prior to a feeding lunge. An exhale on the dive is exactly what its name implies: a whale exhaling as its blowholes submerge. This resulted in a large volume of water being displaced and typically followed a normal blow or a chin-up blow and on occasion a head slap. This technique was only executed by M1 and M5. These new techniques are thought to have been developed by these whales to help them herd small schooling fish (likely capelin) in the well-mixed waters of the Saguenay Fjord; these tactics were not observed in the nearby Laurentian Channel Head, where "strong tidal currents, a stratified water column and bottom topography combine to create large areas of upwelling in which prey are forced to the surface".[36]

In July 2007, a minke whale with what appeared to be a rope injury was observed surface feeding on capelin in the Gulf of St. Lawrence. The long, linear laceration extended around the ventral pleats, restricting their distention. This individual performed a number of oblique lunges on its right side and then rotated in mid-air to the left, landing upright on its rostrum. This was not observed in any of the other feeding whales. This may have been done to avoid landing on the injured portion of its ventral pleats.[37]

Whaling[edit]

North Atlantic[edit]

Norwegian minke whale quotas (blue line, 1994-2006) and catches (red line, 1946.2005) in numbers (from Norwegian official statistics)

Whaling was mentioned in Norwegian written sources as early as the year 800 and hunting common minke whales with harpoons was common in the 11th century[citation needed].

Norwegian catching of minke whales from small fishing vessels started off Møre, western Norway, in the 1920s. It had spread north to Salten by 1932 and all along the Norwegian coast by the late 1930s. Licenses were introduced in 1938. Just after World War II the trade had reached Spitsbergen and by about 1950 had spread to the Barents Sea, where 1,676 whales were caught in 1952 alone (nearly half the total catch that season). Catches in the latter area begin to decline by about 1960. A westward expansion to the waters north and east of Iceland occurred; by 1966 they had reached the Denmark Strait and western Greenland just two years later. At its peak over 300 vessels participated in the hunt each season, but this declined to about 50 in the 1980s. By the end of the Second World War the catch was at nearly 2,000 per annum, peaked at 4,338 in 1958, and declined to 2,307 by 1970.[38][39] About 120,000 have been caught since 1948. None were taken from 1984 to 1987, in accordance with a moratorium against commercial whaling voted on by the International Whaling Commission in 1982 and to take effect in 1986.[2] From 1988 to 1990 and again from 1992 to 1994 Norway caught minke whales under scientific permit and resumed commercial whaling of the species in 1993. They typically catch 450 to 600 individuals a year, with 464 being taken in 2012.

Minke whales were first caught off Iceland in 1914 by the powered 4-ton fishing vessel Margrét IS 314, which was mounted with a 1.5 inch bore harpoon gun – this was replaced in 1923 with a 2-inch bore harpoon gun manufactured in Norway. Later other vessels joined the trade. Operations were limited to coastal waters, normally within 30 nautical miles of shore. The season extended from the beginning of March to late November, even to early December at times; though most were caught between April and October. They were mainly caught for their meat, with a minimum of 3,362 being taken between 1914 and 1980. Catch limits were introduced in 1977. The average annual catch rose from 105 from 1966 to 1970, to 137 from 1971-1975, and finally to 200 from 1976 to 1980.[40] The last were caught in 1985 before whaling resumed in 2003 under scientific permit, with 200 being taken from 2003 to 2007. Commercial whaling for minkes was renewed in 2006, with a total catch of 296 between 2006 and 2012.

North Pacific[edit]

There is no evidence minke whales were caught in Japan during the harpoon and net whaling eras.[41] The small-type catcher boat Yuko-maru 7 GRT caught the first minkes out of Akukawa in 1930. In the first half of the 1930s, about 20-30 was taken per year out of this port. Minke whaling soon spread to the port of Kamaishi (1938), on the northeast coast of Honshu; Ogawajima (about 1951), on the west coast of Kyushu; and to Wakasa Bay and Aomori (both by 1957), the former on the west coast and the latter on the north coast of Honshu. Several hundred were caught each year, with the peak being reached in 1956, when 532 were taken. About 13,000 were taken by Japanese coastal whaling between 1948 and 1987. Most were caught off Sanriku and on the Okhotsk Sea side of Hokkaido, with the Pacific side of Hokkaido gaining some importance by the early 1970s. They were seldom caught off the west coast of Honshu (off Tottori, in Tsuruga Bay, and Toyama Bay), which was abandoned by the mid-1970s. Few were taken on the Sea of Japan side of Hokkaido as well. They were formerly captured off western Kyushu and the south coasts of Honshu and Shikoku, but catching in those regions ceased by 1965 due to the scarcity of whales. The first minkes of the season were caught off western Kyushu and the Sea of Japan side of Honshu, where peak catches occurred from March to May and March to April, respectively; from there effort shifted to the Okhotsk Sea side of Hokkaido and Sanriku, where catches peaked in May for the former area and from April to May in the latter area. Effort was finally diverted to the Pacific side of Hokkaido, where peak catches were made from July to September. The season as a whole extended from February to October.[42][43][44][45]

In 1973 a duel factory-catcher boat was built, the Miwa Maru, which caught 279 minke whales from 1973 to 1975, mainly in the Okhotsk Sea. Japanese pelagic fleets also caught six in the Gulf of Alaska, four in 1964 and two in 1971; an additional 22 were taken by pelagic fleets in the western North Pacific and western Bering Sea in 1969, 1970, and 1976.[26][42]

Commercial catches ended in 1987. In 1994, Japan began catching minke whales in the western North Pacific under scientific permit. Under the title of JARPN (Japanese Research Program in the North), up to 100 whales were caught each year by a pelagic fleet until 1999. After a two-year feasibility study, JARPN II began in 2002, also taking up to 100 whales per year with a pelagic fleet but expanding its operations to include a coastal component, with a total of up to 120 individuals being caught off Sanriku in the spring and off Kushiro, on the Pacific side of Hokkaido, in the fall. This research program continues to the present.

Whaling for minke whales off Korea began in the early 1930s, when they were opportunistically caught by vessels targeting larger species. By the early 1960s a few hundred were being caught each year. The catch increased from 715 in 1970, to 882 in 1973, to a peak of 1,033 and 1,018 in 1977 and 1978. Minkes were caught almost year-round (February to December), with the most important whaling ground being the central Yellow Sea from March to April. From there, catches extended to the Korean Strait in May and the southwestern Sea of Japan from June to October. Most were caught from April to June, with a peak in the Yellow Sea in April and in the Sea of Japan in June. They were also caught in the northern Yellow Sea and off the east coast of North Korea (before 1936), where peak catches were reached from May to June and from April to June, respectively. About 16,000 were caught between 1940 and 1986, when hunting of minke whales ceased.[2][46][47]

A small number of minke whales were caught by the Soviets in the western North Pacific, with 21 being taken by pelagic fleets between 1933 and 1979 and an additional 94 being caught by catchers operating out of the Kuril Island land stations – the annual catch in the latter region never exceeded nine or ten whales (1951, 1954, and 1956).[17]

Common minke whale-watching[edit]

Common minke whale breaching in the St. Lawrence River near Tadoussac, Quebec

Due to their relative abundance common minke whales are often the focus of whale-watching cruises setting sail from, for instance, the Isle of Mull in Scotland, County Cork in Ireland and Húsavík in Iceland. Common minke whales are frequently inquisitive and will indulge in "human-watching". In contrast to the spectacularly acrobatic humpback whale, minkes do not raise their fluke out of the water when diving and are less likely to breach. Minkes can stay submerged for as long as twenty minutes.[citation needed]

Conservation status[edit]

The common minke whale is considered "Least Concern" on the IUCN red list.[2] In addition, the species is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU) and the Agreement on the Conservation of Cetaceans in the Black Sea Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS)

See also[edit]

References[edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d e Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera acutorostrata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ a b "Mammal Species of the World". Retrieved 2007-07-13. 
  4. ^ a b "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Retrieved 2007-07-13. 
  5. ^ Øien, N. (1988). "Length distribution in catches from the northeastern Atlantic stock of minke whales". Report of the International Whaling Commission 39: 289-296.
  6. ^ Ivashin, M. (1992). "USSR catch and sightings data". Report of the Scientific Committee on North Pacific minke whales (Appendix 7), p. 168.
  7. ^ a b c d Hauksson, E., G. A. Víkingsson, S. D. Halldorsson, D. Olafsdottir, and J. Sigurjónsson. (2011). "Preliminary report on biological parameters for NA minke whales in Icelandic waters". Report of the International Whaling Commission 63: 1-45.
  8. ^ a b c Kato, H. (1992). "Body length, reproduction and stock separation of minke whales off Northern Japan". Report of the International Whaling Commission 43: 443-456.
  9. ^ Best, P. (1985). "External characters of southern minke whales and the existence of a diminutive form". Scientific Reports of the Whales Research Institute 36: 1-33.
  10. ^ a b c Christensen, I. (1981). "Age determination of minke whales, Balaenoptera acutorostrata, from laminated structures in the tympanic bulla". Report of the International Whaling Commission 31: 245-253.
  11. ^ Kato, H., T. Kishiro, T. Fujise, and S. Wada. (1992). "Morphology of minke whales in the Okhotsk Sea, Sea of Japan and off the East Coast of Japan, with respect to stock identification". Report of the International Whaling Commission 43: 437-442.
  12. ^ Hauksson, E., I. Christensen, G. A. Víkingsson, and S. D. Halldorsson. 2013. "Morphometric comparison of common minke whales Balaenoptera acutorostrata from different areas of the North Atlantic, including animals from Icelandic waters". Reports of the International Whaling Commission 65: 1-21.
  13. ^ a b c d e f g h Dorsey, E. M., Stern, S. J., Hoelzel, A. R., and Jacobsen, J. (1990). "Minke whales (Balaenoptera acutorostrata) from the west coast of North America: individual recognition and small-scale site fidelity". Reports of the International Whaling Commission (Special Issue 12): 357-368.
  14. ^ a b Jarrett, Brett and Shirihai, Hadoram (2006). Whales Dolphins and other Marine Mammals of the World. pp. 62–68. ISBN 0-691-12757-3. 
  15. ^ Van Waerebeek, K., Andre, M., Sequeira, M., Martin, V., Robineau, D., Collet, A., Papastavrou, V. and Ndiyaye, E. 1999. "Spatial and temporal distribution of the minke whale, Balaenoptera acutorostrata (Lacepede, 1804), in the southern northeast Atlantic Ocean and the Mediterranean Sea, with reference to stock identity". Journal of Cetacean Research and Management 1 (3): 223-238.
  16. ^ Mitchell, E. D. 1991. "Winter records of the minke whale (Balaenoptera acutorostrata Lacepede 1804) in the southern North Atlantic". Reports of the International Whaling Commission 41: 455-457.
  17. ^ a b Ivashin, M. V. and Votrogov, L. M. 1981. "Minke whales, Balaenoptera acutorostrata davidsoni, inhabiting inshore waters of the Chukotka coast". Reports of the International Whaling Commission 31: 231.
  18. ^ Rankin, S. and Barlow, J. 2005. "Source of the North Pacific "boing" sound attributed to minke whales". Journal of the Acoustical Society of America 118: 3346-3351.
  19. ^ Bertulli, C. G., M. H. Rasmussen and M. J. Tetley. (2013). "Photo-identification rate and wide-scale movement of common minke whales (Balaenoptera acutorostrata) in the coastal waters of Faxaflói and Skjálfandi Bays, Iceland". Journal of Cetacean Research and Management 13 (1): 39-46
  20. ^ Víkingsson, G. A. and M. P. Heide-Jørgensen. (2013). "Migration and local movements of common minke whales tracked by satellite in the North Atlantic during 2001-2010". Reports of the International Whaling Commission's Icelandic Special Meeting, pp. 1-12.
  21. ^ a b Olsen, E., and J. Sunde. (2002). "Age determination of minke whales (Balaenoptera acutorostrata) using the aspartic acid racemization technique". Sarsia: North Atlantic Marine Science 87 (1), 1-8.
  22. ^ Evans, Peter G. H. (1987). The Natural History of Whales and Dolphins. Facts on File.
  23. ^ a b Windsland, K., Lindstrom, U., Nilssen, K. T., and T. Haug. (2007). "Relative abundance and size composition of prey in the common minke whale diet in selected areas of the northeastern Atlantic during 2000–04". Journal of Cetacean Research and Management 9: 167-178.
  24. ^ a b Jonsgård, A. (1982). "The food of minke whales (Balaenoptera acutorostrata) in northern North Atlantic waters". Report of the International Whaling Commission 32: 259-262.
  25. ^ Víkingsson, G., B. Elvarsson, V. Chosson, and D. Olafsdottir. (2013). "Recent changes in the diet composition of common minke whales (Balaenoptera acutorostrata) in Icelandic waters – Consequence of climate change?" Reports of the International Whaling Commission 65: 1-31.
  26. ^ a b Kasamatsu, F. and T. Hata. (1985). "Notes on minke whales in the Okhotsk Sea-West Pacific area". Reports of the International Whaling Commission 36: 299-304.
  27. ^ Tamura, T., Konishi, K., Isoda, T., and P. Okamoto. (2009). "Prey consumption and feeding habits of common minke, sei and Bryde's whales in the western North Pacific". NAMMCO/SC/16/MMFI/07.
  28. ^ Perrin, W. F., Bernd G. Würsig, and J. G. M. Thewissen. 2009. Encyclopedia of Marine Mammals. Amsterdam: Elsevier/Academic Press.
  29. ^ Jefferson, T. A.; Stacey, P.J.; Baird, R.W. (1991). "A review of killer whale interactions with other marine mammals: predation to co-existence" (PDF). Mammal Review 21 (4): 151–180. doi:10.1111/j.1365-2907.1991.tb00291.x. 
  30. ^ Ford, J. K., and R. R. Reeves. (2008). "Fight or flight: antipredator strategies of baleen whales". Mammal Review 38 (1), 50-86.
  31. ^ Ford, J. K., Ellis, G. M., Matkin, D. R., Balcomb, K. C., Briggs, D., and Morton, A. B. (2005). "Killer whale attacks on minke whales: prey capture and antipredator tactics". Marine Mammal Science 21 (4), 603-618.
  32. ^ Ólafsdóttir, D., and A. P. Shinn. (2013). "Epibiotic macrofauna on common minke whales, Balaenoptera acutorostrata Lacépède, 1804, in Icelandic waters". Parasites & vectors 6 (1), 105.
  33. ^ Araki, J., Kuramochi, T., Machida, M., Nagazawa, K., and Uchida, A. (1997). "A note on the parasite fauna of the western North Pacific minke whale (Balaenoptera acutorostrata)". Report of the International Whaling Commission 47: 565-568.
  34. ^ a b c d e Lynas, E. M., & Sylvestre, J. P. (1988). "Feeding techniques and foraging strategies of minke whales (Balaenoptera acutorostrata) in the St. Lawrence River estuary". Aquatic Mammals 14 (1), 21-32.
  35. ^ Stern, J. S. (1992). "Surfacing rates and surfacing patterns of minke whales (Balaenoptera acutorostrata) off central California, and the probability of a whale surfacing within visual range. Reports of the International Whaling Commission 42: 379-385.
  36. ^ Kuker, K. J., Thomson, J. A., and Tscherter, U. (2005). "Novel surface feeding tactics of minke whales, Balaenoptera acutorostrata, in the Saguenay-St. Lawrence National Marine Park". The Canadian Field-Naturalist 119 (2): 214-218.
  37. ^ Kot, B. W., Ramp, C., & Sears, R. (2009). "Decreased feeding ability of a minke whale (Balaenoptera acutorostrata) with entanglement-like injuries". Marine Mammal Science 25 (3): 706-713.
  38. ^ Christensen, I. And N. Øien. (1990). "Operational patterns of the Norwegian minke whale fishery". Reports of the International Whaling Commission 40: 343-347.
  39. ^ Jonsgard, A. (1974). "On whale exploitation in the eastern part of the North Atlantic Ocean". In W.E. Schevill (ed.). The Whale Problem: A Status Report. Cambridge, MA: Harvard University Press. pp. 97–107. ISBN 0-674-95075-5. 
  40. ^ Sigurjónsson, J. (1982). "Icelandic minke whaling 1914-1980". Reports of the International Whaling Commission 32: 287-295.
  41. ^ Nasu, K. (1992). "Catches of Minke Whales during the Ancient Whaling Era in Japan with a Note on pre-World War II Catches by Modern Whaling". Reports of the International Whaling Commission 42: 429.
  42. ^ a b Ohsumi, S. (1977). "Catch of minke whales in the coastal waters of Japan". Reports of the International Whaling Commission 27: 164-166.
  43. ^ Oshumi, S. (1978). "A note on minke whales in the coastal waters of Japan". Reports of the International Whaling Commission 29: 271-272.
  44. ^ Ohsumi, S. (1982). "Minke whales in the coastal waters of Japan, 1980 and a population assessment of the Okhotsk Sea-West Pacific stock". Reports of the International Whaling Commission 32: 283-6.
  45. ^ Ohsumi, S. (1983). "Minke whales in the coastal waters of Japan in 1981, with special reference to their stock boundary". Reports of the International Whaling Commission 33: 365-372.
  46. ^ Gong, Y. (1981). "Minke whales in the waters off Korea". Reports of the International Whaling Commission 31: 241-244.
  47. ^ Brownell Jr, R. L. (1981). "Review of coastal whaling by the Republic of Korea". Reports of the International Whaling Commission 31: 395-402.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: For many years, it was thought that there was one species of minke whale. Recent studies indicate the existence of multiple species (Wada and Numachi 1991). DNA data indicate that the Northern and Southern hemisphere populations are clearly distinct; the North Pacific and North Atlantic populations appear distinct from each other; a Southern Hemisphere dwarf form also is genetically distinct; whether these differences are indicative of species, subspecies, or "stock" rank is unclear (see Dizon et al., 1992, Conservation Biology 6:24-36; IUCN 1991). The Antarctic minke whale (B. bonaerensis) appears to be genetically closer to sei and Bryde's whales than it is to Northern Hemisphere minke whales (B. acutorostrata). Without explanation, the North American mammal checklist by Baker et al. (2003) referred to Balaenoptera acutorostrata as the "northern minke whale," implying that they recognized one or more additional species in the Southern Hemisphere. Mead and Brownell (in Wilson and Reeder 2005) recognized two species of minke whales, Balaenoptera acutorostrata (common minke whale, with a worldwide distribution) and B. bonaerensis (Antarctic minke whale, in the Southern Hemisphere). Balaenoptera acutorostrata includes the unnamed dwarf minke whale of the Southern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!