Articles on this page are available in 2 other languages: Chinese (Simplified) (1), Spanish (20) (learn more)

Overview

Brief Summary

Species Abstract

The Northern minke whale (Balaenoptera acutorostrata), is a very large cetacean, in the family of Rorquals (Balaenoptera). The Minke is a baleen whale, meaning that instead of teeth, it has long plates which hang in a row (like the teeth of a comb) from its upper jaws. Baleen plates are strong and flexible; they are made of a protein similar to human fingernails. Baleen plates are broad at the base (gumline) and taper into a fringe which forms a curtain or mat inside the whale's mouth. Baleen whales strain huge volumes of ocean water through their baleen plates to capture food: tons of krill, other zooplankton, crustaceans, and small fish.

The smallest of the rorqual whales (and the second-smallest baleen whale), the minke whale is also the most abundant. Two species are now recognised, the northern hemisphere minke whale (the subject of this species page) and the southern hemisphere Antarctic minke whale (Balaenoptera bonaerensis). Minke whales are slim in shape, with a pointed dolphin-like head, bearing a double blow-hole. The smooth skin is dark grey above, while the belly and undersides of the flippers are white, and there is often a white band on the flipper. When seen at close quarters, minke whales have variable smoky patterns which have been used to photo-identify individuals.

Minke whales feed on fish and various invertebrates; like all baleen whales they filter their food from the water using their baleen plates like sieves. Although largely a solitary species, when feeding minke whales can often be seen in pairs, and on particularly good feeding grounds up to a hundred individuals may congregate. A number of feeding techniques have been observed, including trapping shoals of fish against the surface of the water. After a ten month gestation period, births occur in mid-winter, at birth the calf measures up to 2.8 metres in length. It will be weaned at four months of age, and will stay with its mother for up to two years, becoming sexually mature at seven years of age. Minke whales have an average life span of around 50 years. Minke whales are rather inquisitive and often swim by the side of boats for up to half an hour.
  • * Encyclopedia of Earth. Lead Author; Encyclopedia of Life. ed. C.Michael Hogan. Northern minke whale. ed.-in-chief Cutler J.Cleveland. National Council for Science and the Environment. Washington DC
  • http://www.eoearth.org/article/Northern_Minke_Whale?topic=49540
  • * Howson, C.M. & Picton, B.E. (ed.), (1997). The species directory of the marine fauna and flora of the British Isles and surrounding seas. Belfast: Ulster Museum. [Ulster Museum publication, no. 276]
  • * Keller, R.W., S. Leatherwood & S.J. Holt (1982). Indian Ocean Cetacean Survey, Seychelle Islands, April to June 1980. Rep. Int. Whal. Commn 32, 503-513.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Encyclopedia of Earth; Encyclopedia of Life

Supplier: C. Michael Hogan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The smallest of the rorqual whales, the minke whale is also the most abundant (2). Two species are now recognised, the northern hemisphere minke whale (the subject of this species page) and the southern hemisphere minke whale (Balaenoptera bonaerensis) (5). Minke whales are slim in shape (2), with a pointed 'dolphin-like' head (2), bearing a double blow-hole (5). The smooth skin is dark grey above, the belly and undersides of the flippers are white, and there is often a white band on the flipper (5) (6). When seen at close quarters, minke whales have variable 'smoky' patterns which have been used to photo-identify individuals (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Minke whales are the second-smallest baleen whales. They are identifiable by a narrow, pointy snout, and most seen in North American waters have a white stripe on the back of each flipper. Minkes are relatively common in coastal waters, where they feed on marine crustaceans and fish. They may also become the prey of killer whales. During spring and summer minkes generally migrate north through coastal waters. In fall and winter they go south, taking an offshore route. They tend to occur in small groups of two or three. Mature females can calve every year, after a gestation of about 10 months. Calves are born at any time of the year, but mostly in January and June. Newborns are less than 3 m long, nurse for 4 or 5 months, and take at least 6-7 years to mature.

Links:
Mammal Species of the World
  • Original description: Lacépède, B-G, 1804. Histoire Naturelle des Cétacées, Paris: Plassan An XII, p. 134.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Minke whales feed on fish and various invertebrates; like all baleen whales they filter their food from the water using their baleen plates like sieves (2). Although largely a solitary species, when feeding minke whales can often be seen in pairs, and on particularly good feeding grounds up to a hundred individuals may congregate (2). A number of feeding techniques have been observed, including trapping shoals of fish against the surface of the water (7). After a ten month gestation period, births occur in mid-winter (2), at birth the calf measures up to 2.8 metres in length (5). It will be weaned at four months of age (3), and will stay with its mother for up to two years, becoming sexually mature at seven years of age (7). Minke whales have an average life span of around 50 years (7). Minke whales are fairly inquisitive and often swim by the side of boats for up to half an hour (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 2.0 of 5

Comprehensive Description

Description

 The Minke is a medium sized whale, sleek in shape, with a very pointed head. It is dark grey to black in colour with a white underside and has white patches behind the head and a bright white band on the outer part of the flippers. Adults reach lengths of 6.75-10 m long and 5 -10 tonnes in weight. The new born calf is ca 2.5 m long and weighs ca 350 kg. There are 30-70 throat grooves that always end before the naval (umbilicus). The dorsal fin is sickle-shaped, and about two-thirds of the way back from the tip of the animal's snout. The tail flukes are a quarter of the animal's length in width, and are not shown when diving. There are 230-360 baleen plates, 12 -20 cm long, in each half of the upper jaw, which are yellowish-white at the front to grey-brown at the rear.The blow is very weak and can been seen at the same time as the dorsal fin appears. Spyhopping and breaching are common for this species, which forms small groups of up to 3 individuals. The Minke can remain submerged for up to 20 minutes (Kinze, 2002).

 This whale could be confused at a distance with the Sei whale and the Bryde's whale as they are relatively the same size, however the weak blow of the Minke whale and dorsal fin appearing at the same time as the blow is characteristic. At close range the white bands on the Minke's flippers are diagnostic (Jefferson et al., 1993; Kinze, 2002).

 Baleen whales are included in group species action plan under the UK Biodiversity Action Plan (Anon, 1999v). All baleen whales are protected under schedule 5 in the Wildlife and Countryside Act 1981, the Wildlife (Northern Ireland) Order 1985. All whales are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES, Appendix I, thus prohibiting their commercial trade (Anon, 1999v). Whales are listed in Appendix I of CITES, Appendix II of the Bern Convention and Annex IV of the EC Habitats Directive (Anon, 1999v).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, Danish Exclusive Economic Zone, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Kenya, Kenyan Exclusive Economic Zone, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Norwegian Exclusive Economic Zone, Portuguese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Southern Bight, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The common minke whale is a cosmopolitan species found in all oceans and in virtually all latitudes, from 65°S to 80°N. In parts of its range it is very abundant, in other parts much less so. Its migration patterns are poorly known. It occurs in the North Atlantic, the North Pacific, and the Southern Hemisphere, but is not known from the northern Indian Ocean.

North Atlantic
In summer, minke whales are common throughout the northern North Atlantic as far north as Baffin Bay, Greenland Sea, Svalbard (Norway), Franz Josef Land and Novaya Zemlya (Russian Federation), and as far south as 40°N (New Jersey) on the US east coast (Anon. 2005a), and as far south as the Hebrides (northwest British Isles) and the central North Sea in the east. In the mid-Atlantic summer concentrations of minke whales occur to at least as far south as 50°N (Sigurjónsson et al. 1991). It is likely that at least a part of the minke whale population over-winters in the summer range, but there has been very little observation effort in winter to confirm this.

Minke whales also occur south of this range in the southeastern North Atlantic, but with no obvious seasonality, and are not common, with the exception of the Canary Islands, where they appear to be frequent year-round (Van Waerebeek et al. 1999). There have been occasional sightings (Aguilar et al. 1983) and strandings (Van Waerebeek et al. 1999) off Spain and Portugal, Western Sahara, Mauritania and Senegal. Minke whales are rare in the Azores and not recorded from Madeira. The minke whale is considered a “visitor species” in the Mediterranean (average <1 record per year) with one vagrant recorded in the Black Sea (Reeves and Notabartolo di Sciara 2006).

There are very few winter records, but a summary by Mitchell (1991) indicates that they do occur in winter near Bermuda, the Bahamas and the Antilles, and the US coast south of 40°N. Ten strandings have been recorded in the Gulf of Mexico (Jefferson and Schiro 1997) but hardly any live sightings. A Norwegian winter expedition sent to the tropical Atlantic in 1989/90 to “find the breeding grounds of the minke whale” encountered just two minke whales, at 20°N and 10°N off West Africa in December (Folklow and Blix 1991).

North Pacific
Minke whales occur in summer right across the North Pacific north of about 30°N in summer, with a tendency for the distribution to shift northward in high summer. They are particularly abundant in the Okhotsk Sea in August (Miyashita et al. 1995), and also occur in the Bering Sea, around the Aleutian Islands and in the Gulf of Alaska (Moore et al. 2002, Zerbini et al. 2006) and the Chukchi Sea (Ivashin and Votrogov 1981). In the eastern North Pacific, there appears to be a year-round population off California and Baja California and in the Gulf of California, and minke whales occur in summer off Oregon, Washington and British Columbia (Anon. 2003). They have been seen off Hawaii but are not common there (Anon. 2005b).

In the western North Pacific, there are at least two distinct subpopulations: the so-called “J stock,” an autumn-breeding population that occurs in the Yellow Sea, East China Sea and Sea of Japan, with some penetration into the Okhotsk Sea in summer; and the O-stock which, like most baleen whales, breeds in winter, and occurs in summer in the northwestern Pacific, including the northeastern coasts of Japan, and in the Okhotsk Sea (Omura and Sakiura 1956, Kato 1992).

The winter distribution is poorly known. Japanese expeditions to look for wintering grounds in the southwestern North Pacific during 1993-95 failed to locate any minke whales (Miyashita et al. 1996). The timing of the arrival of minke whales in Korean and western Japanese waters is suggestive of migration from the south in spring and return in autumn (Ohsumi 1983). The wintering area in the eastern North Pacific has been identified acoustically to be primarily between 15 and 35 degrees N latitude (Rankin and Barlow 2005).

Southern hemisphere
Much of the data on the occurrence of minke whales in the Southern Hemisphere is ambiguous with respect to identification as B. acutorostrata or B. bonaerensis, because the two species are partially sympatric. Japanese scouting vessel data indicated high abundance of minke whales in November between 10°-30°S in the central South Pacific and in much of the eastern and southern Indian Ocean down to 50°S (Miyashita et al. 1995), but their species identity is unclear. The limited information available from surveys in low and middle latitudes from the 1987/88 season onwards, when the two species were reliably distinguished, indicates that most of the minke whales are B. bonaerensis (Nishiwaki et al. 1991), probably on route to the Antarctic from (as yet unknown) low-latitude breeding grounds, but also that B. acutorostrata is present in these latitudes.

Dwarf minke whales occur at higher latitudes but are much less common than B. bonaerensis. Of more than 1,700 minke whales taken by Antarctic pelagic whaling from the 1987/88 to the 1992/93 season (when the two species have been reliably distinguished), only 16 were dwarf minke whales (Nishiwaki et al. 2005). One was taken at 65°S and the remainder at between 55-62°S, the northern limit of whaling operations.

In coastal waters, dwarf minke whales have been recorded off most of the South Atlantic coast of South America (Baldas and Castello 1986, Zerbini et al. 1996), in the Beagle Channel (Chile/Argentina) (Acevedo et al. 2005), off South Africa (Best 1985), Australia (Arnold et al. 1987, Bannister et al. 1996, Arnold 1997), New Zealand (Dawson and Slooten 1990), and New Caledonia (Garrigue and Greaves 2001). The most northerly confirmed Southern Hemisphere record is from 2°S, off the northern coast of Brazil (Magalhães et al. 2007). Three dwarf minke whales were caught in whaling operations off Costinha, Brazil in 1980 (along with 900 Antarctic minke whales) (da Rocha and Braga 1982).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Minke whales have a worldwide distribution, appearing in all oceans and some adjoining seas. Cooler regions seem to be preferred over tropical regions.

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

On a small note in Dubar (1828) was written that this species was stranded in Blankenberge (Belgium) in 1837
 (Dubar, J. (1828). Ostéographie de la baleine échouée à l'est du port d'Ostende, le 4 novembre 1827; précédée d'une notice sur la découverte et la dissection de ce Cétacée. Laurent Frères, Imprimeurs-Libraires: Bruxelles, Belgium. 61, 13 folded plates pp.)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

circum-global
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Pacific; Eastern and Atlantic Ocean; Indo-West Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Throughout the world's oceans in tropical, temperate, and polar waters, including Hudson Bay (Can. Field-Nat. 106:266-267). See IUCN (1991) for further details. IWC stock management units have little or no biological significance (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Occurs in all oceans of the northern hemisphere from polar waters to tropical regions. The northern hemisphere minke whale is the whale most likely to be seen from the coasts of the UK and Ireland, particularly from Scotland, western Ireland and the Northern Isles (7). In the English Channel and southern parts of the Northern Sea it is rare (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Minkes are the smallest of the finback whales, growing to a maximum of 10.2 meters long. Females are larger than males, occasionally growing to a maximum of 10,000 kg. Coloration is dark above with a white underbelly. The head is pointed and bulletlike, with a relatively small rostrum. Baleen plates number around 300, are yellowish in color, and occasionally assymetrical in pattern. There are between 50-70 ventral grooves. A broad white band trims the dorsal side of flippers. The tail extends into two long tips. The dorsal fin is high and curved back.

Range mass: 6000 to 9000 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 9100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Females are larger than males.

Length:
Range: 6.7-9.8 m males; 7.3-10.7 m females

Weight:
Range: 20,000-40,000 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: white flipper patches. Blow not readily visible. Colour is light grey with white belly.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Balaenoptera acutorostrata Lacepede, 1804
Catalog Number: USNM A12177
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull; Photograph
Collector(s): C. Scammon
Year Collected: 1870
Locality: Admiralty Inlet, North Shore Of Admiralty Inlet., Jefferson, Washington, United States, North America, North Pacific Ocean
  • Type: Scammon, C. M. 1872. Proc. Cal. Acad. Sci. 4: 269.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The common minke whale occurs in both coastal and offshore waters and exploits a variety of prey species in different areas according to availability. In the Northern Hemisphere some populations migrate to higher latitudes in summer, but minke whales are also found year-round in some areas. With the exception of the Sea of Japan – Yellow Sea – East China Sea population, conception and birth occur in winter. Most animals occur singly, and few in groups of more than two.

In the North Atlantic, studies in the Barents and Norwegian Seas showed that minke whale diet varied greatly between areas and years, being dominated by krill in the northern areas, but by herring or capelin in other areas according to what was most abundant that year, with gadoids being taken when herring and capelin were scarce (Lindstrøm and Haug 2002). In the North Sea the diet consisted almost exclusively of sandeel (data from one year only). Minke whales taken off Iceland in 2003-04 contained mainly sandeel, with some capelin and gadoids (Víkingsson et al. 2006). Minke whales caught off Newfoundland during 1966-72 contained mainly capelin (Mallotus villosus) (Mitchell 1974).

In the Northwest Pacific, Lindstrøm et al. (1998) found that krill Euphausia pacifica dominated the diet in coastal areas and in the Okhotsk Sea, while in the offshore Pacific, Pacific saury Cololabis saira dominated.

Feeding habits of the dwarf minke whale are poorly known. The stomach contents of an individual collected in Brazil contained exclusively Euphausia similis (Secchi et al. 2003). Whales taken in the Antarctic (n=16) ingested mostly myctophid fishes (Kato and Fujise 2000).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although not considered "coastal", these baleen whales rarely venture farther than 169 km from land. They also commonly enter estuaries, bays, fjords, and lagoons. They are also know to move farther into polar ice fields than other rorqual species.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

inshore to offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2687 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1606 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): -1.678 - 29.313
  Nitrate (umol/L): 0.016 - 30.199
  Salinity (PPS): 30.771 - 37.050
  Oxygen (ml/l): 4.431 - 8.213
  Phosphate (umol/l): 0.044 - 2.073
  Silicate (umol/l): 0.494 - 87.652

Graphical representation

Temperature range (°C): -1.678 - 29.313

Nitrate (umol/L): 0.016 - 30.199

Salinity (PPS): 30.771 - 37.050

Oxygen (ml/l): 4.431 - 8.213

Phosphate (umol/l): 0.044 - 2.073

Silicate (umol/l): 0.494 - 87.652
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal and pelagic waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 An open water species, most often seen in coastal and inshore areas but sometimes enters inlets, bays or estuaries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Inhabits inshore to offshore waters and is usually more concentrated in higher latitudes during the summer and lower latitudes during the winter, but migrations vary from year to year. This whale often enters estuaries, bays and inlets, and during summer may feed around headlands and small islands (2) (8)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Many populations migrate to high latitude waters for summer, to low latitude waters for winter.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

A baleen whale, this species feeds primarily on krill and some small fish. There are regional differences in the diet. Minkes eat krill almost exclusively in the Antarctic, but they are more omnivorous in the northern hemisphere, taking as food squid and small vertebrates such as cod, herring, and sardines.

Animal Foods: fish; mollusks; aquatic crustaceans

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mostly fishes in North Pacific, krill in southern ocean, fishes (mainly) and krill in North Atlantic (IUCN 1991); fishes eaten are small, schooling species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually solitary, sometimes found in groups of 2-3. Annual survival rate in Antarctic exceeds 90% (IUCN 1991). Common prey for orca (killer whale).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
45.0 years.

Average lifespan

Status: wild:
47.0 years.

Average lifespan

Status: wild:
50.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: These animals have been estimated to live up to 50 years in the wild (Bernhard Grzimek 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Only one young is born at a time. Gestation lasts for 10 to 11 months. Weight at birth is 450 kg. The young are weaned at 5 months, but they do not become sexually mature for 6 years. Females are thought to have young every other year. The breeding period is long--from December to May in the Atlantic and year round in the Pacific. Peak months for births are December and June. Growth stops at about 18 years for females and 20 years for males.

Breeding interval: Females are thought to have young every other year.

Breeding season: The breeding period lasts from December to May in the Atlantic and year round in the Pacific

Average number of offspring: 1.

Range gestation period: 10 to 11 months.

Average age at sexual or reproductive maturity (female): 6 years.

Average age at sexual or reproductive maturity (male): 6 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 320000 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2740 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
2740 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts 10-11 months. Single calf is born November-March in North Atlantic, mainly late May and early June in Southern Hemisphere. Young are weaned in 6 months or less. Adult females produce one calf every 1-2 years. Most sources give the age of sexual maturity as 6-7 years or 7-8 years, but 2 years or mean of 6-15 years also has been reported; age of maturity apparently decreases when populations are significantly reduced. Maximum age is about 30-40 years in the North Atlantic, something less than 50 years in the Southern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Balaenoptera acutorostrata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTGTATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACCGGCCTAAGCTTACTAATTCGCGCTGAGCTAGGCCAGCCTGGCACACTAATCGGAGACGACCAAGTCTACAATGTATTGGTAACAGCCCACGCCTTCGTAATAATCTTTTTCATGGTCATGCCTATTATAATTGGCGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCACCCGACATAGCTTTCCCCCGTATAAATAATATAAGCTTCTGACTACTTCCCCCTTCTTTTTTACTTCTAATAGCATCTTCAATAGTCGAGGCTGGTGCGGGTACAGGCTGAACTGTATATCCTCCTTTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTTGACCTTACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTCATCACAACTATCATCAATATAAAACCACCTGCTATAACCCAATATCAAACTCCCCTTTTCGTATGATCCGTCCTAGTCACAGCAGTACTACTCTTACTATCATTACCCGTCTTAGCAGCCGGAATCACTATACTACTTACTGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGTGGAGGAGACCCCATCCTATACCAACACCTATTCTGATTCTTTGGTCACCCCGAAGTATATATCCTAATTCTCCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGTTATATAGGAATAGTCTGAGCTATAGTATCCATTGGGTTTTTAGGCTTTATCGTATGAGCCCATCACATGTTTACAGTAGGTATAGACGTTGACACACGAGCATATTTCACATCAGCTACTATAATCATTGCCATTCCCACAGGAGTAAAAGTCTTCAGCTGATTAGCAACACTACACGGAGGTAACATTAAATGATCTCCTGCTCTAATATGAGCCCTAGGTTTCATCTTCCTCTTCACAGTAGGCGGCCTAACTGGTATTGTCCTAGCCAACTCATCACTAGATATTGTCCTACACGACACCTACTACGTAGTTGCTCATTTCCACTATGTATTATCAATAGGAGCAGTTTTCGCCATCATGGGAGGTTTTGTCCACTGGTTCCCACTATTCTCAGGGTATACACTTAACCCTACATGAACAAAAATTCACTTCATAATCATATTTCTAGGTGTAAACCTAACATTCTTTCCGCAGCACTTCTTAGGCCTATCCGGTATACCTCGACGGTACTCCGACTACCCAGACGCCTATACAACATGAAATACCATTTCATCCATAGGCTCCTTTATTTCACTAACAGCAGTTATACTAATAATCTTCATTATCTGAGAAGCATTCACATCCAAACGAGAAGTACTAGCAGTAGATCTTACCACTACCAACCTCGAATGACTAAACGGATGCCCCCCACCATACCATACATTCGAAGAACCAGCATTCGTCAACCCAAAATATTCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Balaenoptera acutorostrata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Justification
There is no estimate of total global population size, but estimates from parts of the range in the Northern Hemisphere (totaling in excess of 100,000 individuals) show that it is well above the thresholds for a threatened category. While declines have been detected or inferred in some areas, there is no indication that the global population has declined to an extent that would qualify for a threatened category.

History
  • 1996
    Lower Risk/near threatened
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The global population is estimated at over 300,000 individuals, and there seems to be no cause for concern, since this species is not commonly hunted anymore. Many populations are on appendix 1 of CITES. Numbers have also been on the rise since the early 1900's because close competitors (other rorqual species) have been overhunted.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive. All whales are listed on Annex A of EU Council Regulation 338/97 and are therefore classed as if they are listed on Appendix 1 of CITES. Under the Fisheries Act of 1981 whaling is illegal in UK waters. All cetaceans (whales and dolphins) are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985. The UK recognises the authority of the International Whaling Commission in matters concerning whaling regulations (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Near Threatened.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The IWC recognizes four stocks of minke whales in the North Atlantic: Northeast Atlantic, Central North Atlantic, West Greenland, and Canadian East Coast. The last includes the US east coast. Population estimates were last reviewed by the IWC SC in 2003 (IWC 2004a), but a new estimate for West Greenland was accepted in 2006 (IWC 2007a). The best/most recent available estimates are listed in Table 1 in the linked PDF document (which constitutes an integral part of this assessment). These total about 182,000.

No abundance estimate is available for the Newfoundland area where there was a small-scale fishery for minke whales during 1948-72 (Mitchell 1974).

Minke whales have been exploited in the North Atlantic, mainly since the 1940s, and recorded catches total about 140,000 (IWC 2006a). The largest catches have been by Norwegian “small-type” whalers who have taken about 120,000 since 1948, mainly in the Northeast Atlantic. Annual catches peaked at over 4,000 in the late 1950s, declining to about 2,000 annually in the early 1980s. Catches were phased out from 1984 to 1987. Commercial minke whaling resumed in 1993 at a lower level and continues to the present.

About 4,000 minke whales were taken off Iceland during 1941-85, but recent abundance estimates imply that this would have had no discernible effect on the population. About 8,000 common minke whales have been caught by small-type whaling off West Greenland, mainly since 1960. The present catch limits (up to 175 annually for the years 2003-7) were set by the IWC in the absence of advice from its SC. Some concerns have been expressed by the IWC SC over the sustainability of the catch levels given the uncertainty over the size of the population available to the hunters off West Greenland (IWC 2007a) although sex ratio information suggests that the population has not been significantly reduced by the catches (Witting 2006).

North Pacific
The IWC recognizes three management stocks in the North Pacific: Sea of Japan – Yellow Sea – East China Sea; Okhotsk Sea – West Pacific (west of 180°); and “Remainder” (east of 180°). Considerable research has been undertaken since the IWC designation indicating the potential for further stock structure both within the Okhotsk Sea - West Pacific area and in the "Remainder" area.

Okhotsk Sea – West Pacific
The IWC SC conducted an assessment of the Okhotsk Sea – West Pacific stock in 1991. Surveys in the summers of 1989 and 1990 yielded an abundance estimate of 25,049 (CV 0.316) of which the bulk (19,209; CV 0.339) was in the Okhotsk Sea (Buckland et al. 1992). Although the Okhotsk Sea was surveyed again in 1992 and 2003 (Miyashita 2004), an abundance estimate from the last of these surveys has yet to be presented.

About 13,000 minke whales have been recorded caught by Japanese coastal whaling during 1948-87 (IWC 2006a), of which probably all but about 1,000 were from the Okhotsk Sea-West Pacific stock. Annual catches peaked at over 500 in 1973, declining to 300 in 1987 when commercial whaling was suspended. Catches resumed in 1994 under scientific permits issued by the Government of Japan and have increased since then. The catch in 2006 was 195 from a permit for 220 (Miyashita and Kato 2007).

The above catch figures do not include net catches, which are not subject to whaling regulations. Reported net catches of minke whales off Japanese coasts averaged only about 5 per year in the 1980s, but Tobayama et al. (1992) estimated that the true level in 1989 was about 100. Based on genetic analysis of samples of whale products collected in commercial markets during 1993-1999, Baker et al. (2000) also estimated the net catch to be about 100 per year. During the 1990s, reported net catches averaged about 20 per year. After new regulations were introduced in 2001 that provided an incentive to report (only those catches that are reported and genetically sampled can be legally marketed), reported net catches have averaged 127 per year (Japan 2002-2006). About 55% of the reported net catches during 2001-05 have been on the Sea of Japan and East China Sea coasts (IWC 2007b), and would be mainly from the “J stock” (see below), with the remainder from the Okhotsk Sea-West Pacific Stock.

The issue of subpopulation structure within the Okhotsk Sea – West Pacific Stock has been discussed extensively by the IWC SC in the context of preparations for implementing the Revised Management Procedure (RMP) for western North Pacific minke whales, but with inconclusive results (IWC 2004b).

Although population models suggest that, when considered as a single biological unit, the Okhotsk Sea-West Pacific stock has declined little under the influence of past or present catches (IWC 2004c), the situation should be kept under review; in particular, the more recent 2003 survey data should be analyzed to update the 1990 and 1992abundance estimates for the Okhotsk Sea.

Sea of Japan (East Sea) – Yellow Sea – East China Sea stock (“J stock”)
The reproductive cycle of this stock, usually referred to by biologists as the “J stock”, appears to be four months out of phase with other Northern Hemisphere minke whales, with conceptions occurring in October-November instead of February-March for the Okhotsk Sea – West Pacific stock (Omura and Sakiura 1956, Kato 1992). This is the only known case of breeding asynchrony in baleen whale populations from the same hemisphere. A degree of reproductive isolation between the two stocks is also suggested by frequency differences at selected allozyme loci (Wada 1984). A segregation of maternal lineages is indicated by marked differences in the frequencies of mtDNA haplotypes (Goto and Pastene 1997; Baker et al. 2000).

About 16,000 whales are recorded to have been taken from this stock by commercial whaling based in South Korea during 1940-86, in addition to about 1,000 from western Japan (IWC 2006a). Catches peaked at 1,033 in 1977. Catches were phased out with a complete moratorium to take effect from 1986 (IWC 1984).

However, net catches (which are not subject to whaling regulations) began in Korea in the late 1980s (Kim 1999). From 1996 onwards, a regulation has been in effect that requires the reporting of such catches. During 1996-2005, reported catches averaged 90 per year. However, a genetic analysis of samples of whale products on Korean commercial markets yielded an estimate of 827 (SE 164) whales entering the market in the period 1999-2003, as compared with a reported catch of only 458 whales (Baker et al. In press). This suggests that reporting is still far from complete, and that the total J-stock catch from South Korea and Japan (see above) has exceeded 200 per year over the last 10 years. Minke whales are also reported to be a common bycatch in China, but no figures are available (IWC 2006c).

Surveys in the range of the J-stock have been conducted from 1999 in the waters of the Republic of Korea (Sohn et al. 2005) and from 2002 in Japanese waters (Miyashita 2004), but no estimate of total population size is available. The IWC in 2005 (IWC 2006b) endorsed plans for joint research by the range states (Republic of Korea, China, Japan, Russian Federation), and a comprehensive survey in the waters of all four countries is planned for 2007.

Eastern North Pacific (east of 180°E)
Population estimates are available only for parts of the eastern North Pacific, e.g. 1,015 (CV 0.73) for the west coast of the US during 1991-2001 (Anon. 2003) and 810 (CV 0.36) and 1003 (CV=0.26) respectively in the central and southeastern Bering Sea (Moore et al. 2002), and 1,232 (CV=0.34) for coastal waters of the northern Gulf of Alaska and the eastern and central Aleutian Islands (Zerbini et al., 2006). Minke whales are apparently quite abundant in the offshore Gulf of Alaska (Miyashita et al. 1995) but no abundance estimate is available for that region.

Differences in vocalizations during the breeding season strongly suggest further population structure within this area. Different calls are found on either side of about 135 degrees W longitude (Rankin and Barlow 2005).

Southern Hemisphere
It is not possible at this time to estimate the abundance of B. acutorostrata in the Southern Hemisphere, because most of the available quantitative sighting data do not distinguish it from the much more numerous B. bonaerensis with which it is partially sympatric. B. acutorostrata has not been subject to significant exploitation in the Southern Hemisphere.

Generation time
No satisfactory method of age determination has been developed for this species to date. Therefore the value of 22 years from Taylor et al. (2007) was used. Unlike Antarctic minke whales, common minke whales tend not to develop ear plugs with readable layering (Lockyer 1984). A method based on layer counts in tympanic bullae (Christensen 1981) could not be reproduced by later workers. Other age-estimation methods are being investigated, but none is yet at the stage where it can be applied reliably to this species (Olsen and Øien 2002).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Whaling on this species has been intensive in the Northeast Atlantic, and it reduced the population over the period 1952-83. Catches were phased out by 1987, but whaling resumed, at a lower level, in 1993. Norway sets national catch limits based on the IWC’s Revised Management Procedure, a formula for setting safe catch limits (IWC 1999). In presenting the RMP to the IWC for approval, the IWC SC offered three variants that it believed were acceptable and the IWC chose the most conservative option. Up until 2000, Norway used this option to set its national catch limits. It is now using the least conservative option presented by the SC. The national catch limit for 2006 was 1,052 whales, but only 521 were taken.

Coastal catches averaged about 200 per year off Iceland until 1985 when the IWC moratorium on commercial whaling came into effect. Small (a total of 100 expected for the period 2003-2006) “experimental” catches resumed in 2003. Catches off West Greenland continue, under an IWC catch limit of 175 whales annually, valid through 2007. As discussed above the IWC SC has expressed concern at its inability to provide scientific advice on an appropriate catch limit (IWC 2007a).

Catches resumed in the North Pacific in 1994 under scientific permit issued by the Government of Japan, and have increased since. The catch in 2006 was 195 from a permit for 220 (Miyashita and Kato 2007).

Minke whales are subject to some level of incidental catch in fishing gear throughout much of their range, but in most areas the numbers involved are probably not significant. The exceptions are the coasts of Japan and Korea, and possibly China. In particular, the high level of net catches of the Sea of Japan-Yellow Sea-East China Sea population, likely over 200 per year, is a source of concern, which has prompted the IWC SC to conduct an in-depth assessment of this stock. A multinational survey involving the four range states is planned for 2007.

During this century, a profound reduction in the extent of sea ice in the Arctic is expected, and possibly a complete disappearance in summer, as mean Arctic temperatures rise faster than the global average (Anonymous 2005c). The implications of this for minke whales are unclear but warrant monitoring.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Some stocks (e.g., Sea of Japan/Yellow Sea/East China Sea stock and northeastern North Atlantic stock) have been depleted by commercial whaling (IUCN 1991). There is concern about the status of the West Greenland stock, where catches by local people for their own use continue (IUCN 1991). In the early 1990s, there was strong pressure from some countries to reopen commercial whaling for this species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The common name of this species indicates the main threat that has faced it for many years; Minke was an 18th Century Norwegian whaler who hunted small whales, flouting the whaling rules of the day (7). Despite the world moratorium on commercial whaling set up by the International Whaling Commission (IWC) in 1982, minke whales are still hunted by Norway and Japan (2). Norway officially objected to the moratorium, and Japan kills whales for 'scientific research', but the carcasses are commercially processed after the research has been carried out (2). Other potential threats facing minke whales, and indeed all cetacea, include pollution and reduction in prey abundance, perhaps as a result of over-fishing (7). Entanglement in fishing nets and the effects of long-term climate change are also likely to pose problems, but as yet the importance of these threats is unknown (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Catch limits for all commercial whaling have been set at zero by the IWC since 1986. However, this moratorium does not apply to Iceland, Norway or the Russian Federation which have objected to this provision. IWC members are allowed to issue permits for whaling for scientific research, and Japan makes substantial use of this provision. Limited aboriginal subsistence whaling is permitted by the IWC for common minke whales off Greenland. Takes of dwarf minke whales have been excluded from the Japanese scientific whaling programme in the Antarctic (JARPA) since summer 1992/93 (Nishiwaki et al. 2005). Minke whales, including B. acutorostrata, are included in Appendix I of CITES, with the exception of the population from Greenland which is included in Appendix II. This implies prohibition of commercial international trade in products, but such prohibition does not apply to Iceland, Norway or Japan, who hold reservations on the species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

This whale is a UK Biodiversity Action Plan priority species. Under Schedule 8 of the Wildlife and Countryside Act of 1981, this species is fully protected in UK waters. CITES (the Convention on International Trade in Endangered Species) controls exports of whale meat and products (7). In 1996, six tonnes of Norwegian whale meat was confiscated by customs officials in Japan. The shipment was disguised as mackerel (2). The current population figures for northern hemisphere minke whales are unknown and highly disputed. The future status of this inquisitive whale is unclear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Minke whales have been hunted by people for products such as meat, oil, and baleen since the Middle Ages. Regardless, it has never been of large commercial importance until other whale species were overhunted. Annual kill peaked in 1976 with 12,398 individuals, but now is down to < 1,000. These are taken primarily by indigenous peoples for food, or by scientists for research.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long hunted for human food and oil. Became a major target for modern whalers following depletion of larger species (around the 1930s in the Northern Hemisphere, 1970s in the Southern Ocean). Mainstay of Japanese factory ship whaling in southern ocean in early 1980s. Norway and Japan continued hunting for "scientific research" during recent whaling ban; these and possibly other nations have been pressing to resume commercial hunting of minke. See IUCN (1991) for review of exploitation history.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Minke whale

Minke whale (pron.: /ˈmɪnki/), or lesser rorqual, is a name given to two species of marine mammal belonging to a clade[1] within the suborder of baleen whales. The minke whale was given its official designation[2] by Lacepède in 1804,[3] who described a juvenile specimen of Balænoptera acuto-rostrata.[4] The name is a partial translation of Norwegian minkehval, possibly after a Norwegian whaler named Meincke, who mistook a northern minke whale for a blue whale.[5]

Contents

Taxonomy

Most modern classifications split the minke whale into two species;

Taxonomists further categorize the common minke whale into two or three subspecies; the North Atlantic minke whale, the North Pacific minke whale and dwarf minke whale. All minke whales are part of the rorquals, a family that includes the humpback whale, the fin whale, the Bryde's whale, the sei whale and the blue whale.

The junior synonyms for B. acutorostrata are B. davidsoni (Cope 1872), B. minimia (Rapp, 1837) and B. rostrata (Fabricius, 1780). There is one synonym for B. bonaerensis - B. huttoni (Gray 1874).

Writing in his 1998 classification, Rice recognized two of the subspecies of the common minke whale - B. a. scammoni (Scammon's minke whale) and a further (taxonomically) unnamed subspecies found in the Southern Hemisphere to which he gave the common name the dwarf minke whale (first described by Best, 1986).

On at least one occasion, an Antarctic minke whale has been confirmed migrating to the Arctic.[7][8] In addition, at least one wild hybrid between a common minke whale and an Antarctic minke whale has been confirmed.[7][8]

Description

Minke whale skeleton, Museum Koenig, University of Bonn.

The minke whales are the second smallest baleen whale; only the pygmy right whale is smaller. Upon reaching sexual maturity (6–8 years of age), males measure an average of 6.9 m (23 ft) and females 7.4 m (24 ft) in length, respectively. Reported maximum lengths vary from 9.1 to 10.7 m (30 to 35 ft) for females and 8.8 to 9.8 m (29 to 32 ft) for males. Both sexes typically weigh 4–5 t (3.9–4.9 long tons; 4.4–5.5 short tons) at sexual maturity, and the maximum weight may be as much as 10 t (9.8 long tons; 11 short tons).

The minke whale is a black/gray/purple color. Common minke whales (Northern Hemisphere variety) are distinguished from other whales by a white band on each flipper. The body is usually black or dark-gray above and white underneath. Minke whales have between 240 and 360 baleen plates on each side of their mouths. Most of the length of the back, including dorsal fin and blowholes, appears at once when the whale surfaces to breathe.

Minke whales typically live for 30–50 years; in some cases they may live for up to 60 years.

The brains of minke whales have around 12.8 billion neocortical neurons and 98.2 billion neocortical glia.[9]

Behavior

Multimedia relating to the minke whale
Note that whale calls have been sped up to 10x their original speed.

The whale breathes three to five times at short intervals before 'deep-diving' for two to 20 minutes. Deep dives are preceded by a pronounced arching of the back. The maximum swimming speed of minkes has been estimated at 38 km/h (24 mph).

Reproduction

The gestation period for minke whales is 10 months, and calves measure 2.4 to 2.8 m (7.9 to 9.2 ft) at birth. The newborns nurse for five to possible 10 months. Breeding peaks during the summer months. Calving is thought to occur every two years.[10]

Population and conservation status

The IUCN Red List labels the common minke whale as Least Concern.[11] The Antarctic minke whale is listed as Data Deficient.[12]

COSEWIC puts both species in the Not At Risk category [1]. NatureServe lists them as G5 which means the species is secure on global range [2].

In 2012, the Scientific Committee of the International Whaling Commission agreed upon a population estimate of 515,000 for the Antarctic minke stock. [13] The Scientific Committee acknowledged that this estimate is subject to a negative bias because some minke whales would have been outside the surveyable ice edge boundaries.

Whaling

Line chart that shows catches peak at >4,000 in the 1950s, decline to 0 in the late eighties and increase to >1,000 by 2006
Norwegian minke whale quotas (blue line, 1994-2006) and catches (red line, 1946-2005) in numbers (From Norwegian official statistics)

Whaling was mentioned in Norwegian written sources as early as the year 800, and hunting minke whales with harpoons was common in the 11th century[citation needed]. In the 19th century, they were considered too small to chase, and received their name from a young Norwegian whale-spotter in the crew of Svend Foyn, who harpoooned one, mistaking it for a blue whale and was derided for it.[14]

By the end of the 1930s, they were the target of coastal whaling by Brazil, Canada, China, Greenland, Japan, Korea, Norway, and South Africa. Minke whales were not then regularly hunted by the large-scale whaling operations in the Southern Ocean because of their relatively small size. However, by the early 1970s, following the overhunting of larger whales such as the sei, fin, and blue whales, minkes became a more attractive target of whalers. By 1979, the minke was the only whale caught by Southern Ocean fleets. Hunting continued apace until the general moratorium on whaling began in 1986.

Following the moratorium, most hunting of minke whales ceased. Japan continued catching whales under the special research permit clause in the IWC convention, though in significantly smaller numbers. The stated purpose of the research is to establish data to support a case for the resumption of sustainable commercial whaling. Environmental organizations and several governments contend that research whaling is simply a cover for commercial whaling. The 2006 catch by Japanese whalers included 505 Antarctic minke whales.

Although Norway initially followed the moratorium, they had placed an objection to it with the IWC and resumed a commercial hunt in 1993. The quota for 2006 was set at 1,052 animals, but only 546 were taken.[15] The quota for 2011 is set at 1286.[16] In August 2003, Iceland announced it would start research catches to estimate whether the stocks around the island could sustain hunting. Three years later, in 2006, Iceland resumed commercial whaling.

A 2007 analysis of DNA fingerprinting of whale meat estimated South Korean fishermen caught 827 minke between 1999 and 2003.[17]

Whale Watching

Photo of whale poking its nose through hole in icepack
Minke whale in the Ross Sea

Due to their relative abundance, minke whales are often the focus of whale-watching cruises setting sail from, for instance, the Isle of Mull in Scotland, County Cork in Ireland and Húsavík in Iceland, and tours taken on the east coast of Canada. In contrast to humpback whales, minkes do not raise their flukes out of the water when diving and are less likely to breach (jump clear of the sea surface). This, combined with the fact that minkes can stay submerged for as long as 20 minutes, has led some whale-watchers to label them 'stinky minkes'.[18]

In the northern Great Barrier Reef (Australia), a swim-with-whales tourism industry has developed based on the June/July migration of dwarf minke whales. A limited number of reef tourism operators (based in Port Douglas and Cairns) have been granted permits by the Great Barrier Reef Marine Park Authority to conduct these swims, given strict adherence to a code of practice, and that operators report details of all sightings as part of a monitoring program. Scientists from James Cook University and the Museum of Tropical Queensland have worked closely with participating operators and the Authority, researching tourism impacts and implementing management protocols to ensure these interactions are ecologically sustainable.

Minke whales are also occasionally sighted in Pacific waters, in and around the San Juan Islands of Washington State.

References

  1. ^ Arnason, U., Gullberg A. & Widegren, B. (1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960–970. PMID 8412655. Retrieved 2007-07-13. 
  2. ^ It had been inaccurately described by the Danish zoologist Johann Christian Fabricius in 1780, who assumed it must be an already described species, assigned his specimen to Balaena rostrata, a name, however, that was already in use.
  3. ^ Lacepède, Histoire naturelle des cétacées. (Paris, 1804).
  4. ^ Modern orthography makes it Balaenoptera acutitostrata.
  5. ^ "Dictionary.com". Retrieved 2007-08-30. 
  6. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  7. ^ a b "Antarctic minke whales migrate to the Arctic" 5 (15). Whales On Line. February 3, 2011. Retrieved 2011-06-15. 
  8. ^ a b Glover, K., et al (2010). Migration of Antarctic Minke Whales to the Arctic 5 (12). PLoS ONE. doi:10.1371/journal.pone.0015197. Retrieved 2011-06-15. 
  9. ^ N. Eriksen, Bente Pakkenberg (January 2007). "Total neocortical cell number in the mysticete brain". Anat. Rec. 290 (1): 83–95. doi:10.1002/ar.20404. PMID 17441201. 
  10. ^ http://www.acsonline.org/factpack/MinkeWhale.htm American Cetacean Society: Minke Whale
  11. ^ http://www.iucnredlist.org/details/2474/0
  12. ^ http://www.iucnredlist.org/details/2480/0
  13. ^ http://iwc.int/cache/downloads/6r8jq8llm4cgso0sc0k000w8c/2012%20SC%20REP.pdf
  14. ^ Joseph Horwood, Biology and exploitation of the minke whale (CRC Press) 1989:3.
  15. ^ Tok bare halve hvalkvoten - lofotposten.no
  16. ^ Samme hvalkvote som i år - www.p4.no
  17. ^ Aldhous, Peter (10 May 2007). "High value of whale meat costs minkes in Korea". New Scientist 194 (2603): 10. doi:10.1016/S0262-4079(07)61160-9. 
  18. ^ Look out, it's Stinky Minke - there she blows!, independent.co.uk, July 31, 2005
General references

Further reading

OhUallachain, D. ad Debvaney, D. 2010. Minke whale (Balaenoptera acutorostrata Lacepede) at Ballyhealy, Co. Wexford. Ir Nat. J. 31: 55.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Common minke whale

The common minke whale or northern minke whale (Balaenoptera acutorostrata) is a species of minke whale within the suborder of baleen whales.

Contents

Taxonomy

Otto Fabricius, in his Fauna Groenlandica (1780), was the first to describe the minke, noting its small size and white baleen. He unfortunately described it under the name Balaena rostrata, which was already preoccupied by a beaked whale. In 1804, Baron de Lacepede named it Balaenoptera acuto-rostrata, basing his description partly on the stranding of a juvenile near Cherbourg, France in 1791.[3] There are several forms of common minke whale, including Scammon's minke whale (B. a. scammoni) from the North Pacific and the dwarf minke whale, from the Southern Hemisphere.[3]

Until recently, all minke whales were considered a single species. However, the common minke whale was recognized as a separate species from the Antarctic minke whale based on mitochondrial DNA testing.[4] This testing also confirmed that the Antarctic minke whale is the closest relative of the common minke whale, thus confirming the validity of the minke whale clade.[4]

Description

Skeleton of the Common minke whale.
A minke whale in the Gulf of St. Lawrence, showing the blowholes and dorsal fin at the same time

The common minke whale is the smallest of the rorquals, and one of the smallest baleen whales (second smallest only to the Pygmy Right Whale). At sexual maturity, Northern Hemisphere males average about 6.9 m (22.5 ft) and females 7.3 m (24 ft). In the North Atlantic, the average size at physical maturity is 8 m (26 ft) for males and 8.5 m (28 ft) for females, while maximum lengths are 8.8 m (29 ft) and 9.1 m (30 ft), respectively. At birth they are 2.6-2.8 m (8.5–9 ft) in length. For the dwarf form, the longest reported lengths are 7.62 m (25 ft) for males and 7.77 (25.5 ft) for females.

The back is dark grey and the belly white. All forms have a pale chevron above the flippers or behind the head. All forms also have a white or light marking on each flipper. On the dwarf form the white marking covers most of the flipper. On the northern forms, there is a distinct white band running horizontally through the middle of each flipper.[5]

The common minke whale differs from the Antarctic variety in several aspects. The common species is slightly smaller than the Antarctic, which has much less white marking on the flippers. There are also less distinctive differences in body coloration and shape.[5]

Distribution

View of a common minke whale underwater, showing the diagnostic white flipper band

Common minke whales have a disjointed distribution. In the North Atlantic, they occur as far north as Baffin Bay, Svalbard, Franz Josef Land, and Novaya Zemlya and as far south as 40° N (New Jersey) and the Hebrides and central North Sea during summer. They occur year-round off the Canary Islands. There are occasional sightings and strandings off Spain and Portugal, western Sahara, Mauritania, and Senegal. It is rare off the Azores and a vagrant in the Mediterranean Sea, with a single record in the Black Sea. During the winter it has been recorded off Bermuda, the Bahamas, the Antilles, and the east coast of the United States south of 40° N. In the western North Pacific, they range from the East China Sea, Yellow Sea and Sea of Japan in the south to the Sea of Okhotsk and Bering and Chukchi Seas in the north. In the eastern North Pacific, they occur in the Gulf of Alaska south along the entire west coast of North America down to Baja California and into the Gulf of California. During winter, they've been acoustically recorded mainly between 15° and 35° N in the eastern and central North Pacific. The dwarf form occurs as far south as 65° S during summer, but was mainly caught between 55 and 62° S.[5] It has also been recorded off most of the South Atlantic coast of South America, in the Beagle Channel, off South Africa, Australia, New Zealand, New Caledonia, and as far north as 2° S (northern Brazil).

Feeding

Common minke whales have a diverse diet, feeding on various species of fish and crustaceans. In the North Atlantic, they prey on sand lance, sand eel, salmon, capelin, mackerel, cod, whiting, sprat, wolffish, dogfish, pollack, haddock, herring, euphausiids, and copepods. In the North Pacific, they mainly eat euphausiids, Japanese anchovy, Pacific saury, and walleye pollack. In the Southern Ocean, dwarf minkes feed mainly on myctophid fishes.[6]

Whaling

Norwegian minke whale quotas (blue line, 1994-2006) and catches (red line, 1946.2005) in numbers (from Norwegian official statistics)

Whaling was mentioned in Norwegian written sources as early as the year 800 and hunting common minke whales with harpoons was common in the 11th century[citation needed].

By the end of the 1930s they were the target of coastal whaling from countries including Brazil, Canada, China, Greenland, Japan, Korea and Norway. Hunting continued apace until the general moratorium on whaling was introduced in 1986.

Following the moratorium, most hunting of common minke whales ceased. Japan and more recently Iceland (in August 2003) have continued hunting for minkes on scientific grounds, which have been criticised by many environmental organisations[7] as being a cover for commercial whaling. Both countries have the long-term goal of resuming open commercial whaling.[citation needed] Although Norway initially followed the moratorium, they placed an objection to it with the IWC and resumed commercial hunting in 1993. Norwegian whalers caught 639 in 2005. The quota for 2006 was set at 1052 animals, from which a catch of 546 was taken.[8]

Common minke whale-watching

Common minke whale breaching in the St. Lawrence River near Tadoussac, Quebec

Due to their relative abundance common minke whales are often the focus of whale-watching cruises setting sail from, for instance, the Isle of Mull in Scotland, County Cork in Ireland and Húsavík in Iceland. Common minke whales are frequently inquisitive and will indulge in "human-watching". In contrast to the spectacularly acrobatic humpback whale, minkes do not raise their fluke out of the water when diving and are less likely to breach. Minkes can stay submerged for as long as twenty minutes.[citation needed]

Conservation status

The common minke whale is considered "Least Concern" on the IUCN red list.[2] In addition, the species is covered by the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU) and the Agreement on the Conservation of Cetaceans in the Black Sea Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS)

See also

References

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. (2008). Balaenoptera acutorostrata. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.
  3. ^ a b "Mammal Species of the World". http://www.bucknell.edu/msw3/browse.asp?id=14300012. Retrieved 2007-07-13.
  4. ^ a b "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". http://mbe.oxfordjournals.org/cgi/content/abstract/10/5/960. Retrieved 2007-07-13.
  5. ^ a b c Jarrett, Brett and Shirihai, Hadoram (2006). Whales Dolphins and other Marine Mammals of the World. pp. 62–68. ISBN 0-691-12757-3. 
  6. ^ Perrin, W. F., Bernd G. Würsig, and J. G. M. Thewissen. 2009. Encyclopedia of Marine Mammals. Amsterdam: Elsevier/Academic Press.
  7. ^ Help Us Stop Iceland's Whale Hunt!
  8. ^ Tok bare halve hvalkvoten - lofotposten.no
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: For many years, it was thought that there was one species of minke whale. Recent studies indicate the existence of multiple species (Wada and Numachi 1991). DNA data indicate that the Northern and Southern hemisphere populations are clearly distinct; the North Pacific and North Atlantic populations appear distinct from each other; a Southern Hemisphere dwarf form also is genetically distinct; whether these differences are indicative of species, subspecies, or "stock" rank is unclear (see Dizon et al., 1992, Conservation Biology 6:24-36; IUCN 1991). The Antarctic minke whale (B. bonaerensis) appears to be genetically closer to sei and Bryde's whales than it is to Northern Hemisphere minke whales (B. acutorostrata). Without explanation, the North American mammal checklist by Baker et al. (2003) referred to Balaenoptera acutorostrata as the "northern minke whale," implying that they recognized one or more additional species in the Southern Hemisphere. Mead and Brownell (in Wilson and Reeder 2005) recognized two species of minke whales, Balaenoptera acutorostrata (common minke whale, with a worldwide distribution) and B. bonaerensis (Antarctic minke whale, in the Southern Hemisphere). Balaenoptera acutorostrata includes the unnamed dwarf minke whale of the Southern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!