Articles on this page are available in 2 other languages: Chinese (Simplified) (3), Spanish (16) (learn more)

Overview

Brief Summary

Biology

The gray whale makes the longest migration of any mammal known, each autumn and spring they pass between their Arctic summer feeding grounds and the warm lagoons near the equator where females give birth (5). This yearly round-trip may entail individuals travelling up to 20,400 kilometres (2). Sexual activity can occur at any time of the year, but tends to be concentrated on the migration south (5). Little is known about the mating strategies of this species, but various numbers of individuals can be involved (5). The breeding cycle last two years: gestation takes about 13 months and the single calf is then suckled for a further seven months (5). At birth the calf is smooth compared to the encrusted adults and lacks sufficient blubber that would allow it to survive in Arctic waters (2). The mother may have to hold the calf near the surface to help it to breathe during the first few hours after birth (2). This species is the only cetacean to feed by straining the sediment on the sea floor (5). Individuals roll onto their sides after diving to the bottom and take large amounts of sediment into their mouth. As the whale rises to the surface it strains the contents of the mouth through the baleen, leaving a trail of mud and sand behind it. The invertebrate prey consisting of bottom-dwelling crustaceans, worms and molluscs is isolated in this way and swallowed (5). A number of seabirds are attracted to feeding gray whales, and take advantage of invertebrates that escape the filtering process (2). Sufficient fat reserves are stored in the feeding grounds to allow individuals to go without food during the breeding season; on return to the feeding grounds about a third of the body weight may have been lost (5). Killer whales are the only non-human predator of the gray whale. Attacks directed towards calves have been observed; adult gray whales often try to position themselves between the killer whales and the calf in order to protect it, and they may also head for shallow waters and kelp beds to take refuge from the attackers (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Description

"Gray whales are bottom feeders. They roll to one side and lower the lip to scour and siphon the bottom for tiny crustaceans, especially amphipods known as ""sand fleas."" They have small, thick, widely-placed baleen plates for screening food from the water. Now found only in the North Pacific, records and bony remains suggest they once lived in waters off the eastern seaboard of the United States and across the Atlantic near England, Sweden, and the Netherlands. Known as long distance travelers, they migrate north along the West Coast for the summer, and south again for the winter, where they calve in the shallows off Baja California. In 1994 the gray whale was removed from the endangered species list. Estimated population size in 1988 was about 21,000 individuals, and growing. Killer whales are the only animals known to attack them."

Links:
Mammal Species of the World
Visit ARKive for more images of the gray whale  More images, video and sound
  • Original description: Lilljeborg 1861.  Forh. Skand. Naturf. Ottende Mode, Kopenhagen, 1860, 8:602 [1861].
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A giant of the ocean, the gray whale is mottled dark to light grey in colour and is encrusted with patches of barnacles and whale lice (4). The species lacks a dorsal fin and instead has a series of bumps along a dorsal ridge on the final third of the back (2). There are two deep grooves on the throat, which allow the mouth to expand when feeding, and the baleen, which is used to filter food, is cream-white in colour. When surfacing, the 'blow' produced is distinctly bushy, short and forked, or 'heart-shaped', as it comes from two blowholes (2) (5). Females tend to be larger than males but otherwise the two sexes are similar in appearance (5). Whalers referred to gray whales as 'devilfish', due to the ferocity of mothers when separated from their calves (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Grey Whale: A long-range migrant of the North Pacific and Amerasian Arctic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mottled gray; No dorsal fin, but a low hump followed by a series bumps (knuckles) on dorsal ridge of tail stock
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The gray whale was once found in the North Atlantic. Sub-fossil remains, the most recent dated at around 1675, have been found on the eastern seaboard of North America from Florida to New Jersey and on the coasts of the English Channel and the North and Baltic seas. There are historical accounts of living gray whales from Iceland in the early 1600s and possibly off New England (USA) in the early 1700s (Rice 1998).

Gray whales are now only found in the North Pacific and adjacent waters. The larger eastern North Pacific population summers and feeds mainly in the shallow waters of the Chukchi and Beaufort seas, and the northwestern Bering Sea; a few also summer and feed along the Pacific coast from Vancouver Island (Canada) to central California (US). The population migrates in autumn along the coast to winter breeding grounds on the west coast of Baja California (Mexico) and the southeastern Gulf of California. Some calves are born during the southward migration but most are born in shallow bays and lagoons on the west coast of Baja California (Jones and Swartz 2002).

The much smaller western subpopulation summers in the Okhotsk Sea. The major known feeding grounds are off the northeastern coast of Sakhalin Island (Russian Federation), but some animals are occasionally seen off the eastern coast of Kamchatka (Russian Federation) and in other coastal waters of the northern Okhotsk Sea. Its migration routes and winter breeding grounds are poorly known, the only recent information being from occasional records on both the eastern and western coasts of Japan and along the Chinese coast (Weller et al. 2002; see separate listing of this subpopulation for more information).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The western gray whale summers in the OkhotskSea, mainly off the northeastern coast of SakhalinIsland (Russian Federation). There are also occasional sightings off the eastern coast of Kamchatka (Russian Federation) and in other coastal waters of the northern OkhotskSea (Vladimirov 1994, Weller et al. 1999). Its migration routes and wintering grounds are poorly known, the only recent information being from occasional records on both the eastern and western coasts of Japan (Kato et al. 2006) and along the Chinese coast (Zhu and Yue 1998). Until 1966, there was a whaling ground off Ulsan (southeastern KoreaPeninsula), where whales were taken during November to April, with two peaks (in December/January and March/April), suggestive of south- and northbound migrations respectively through the Sea of Japan (Kato and Kasuya 2002). However, no gray whales have been recorded in the Korean whaling grounds since 1968. The great majority of recent Japanese records are on the Pacific side, suggesting that this is now the more important migration route. The few modern records from China are scattered along virtually the entire Chinese coast from the northern Yellow Sea to the HainanStrait in the south (Zhu and Yue 1998). The calving grounds are unknown but may be around HainanIsland, this being the southwestern end of the known range (Brownell and Chun 1977).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Gray whales occur in the eastern and western north Pacific. Eastern north Pacific gray whales use shallow arctic feeding grounds during the summer, which are located in the Bering and Chukchi Seas. During the fall, they migrate south along the west coast of North America to their winter calving grounds, located in the warm waters off coast of Baja California. Four specific locations have been identified as important calving grounds for eastern gray whales: Laguna Ojo de Liebre, Guerrero Negro, Bahia Magdalena, and Laguna San Ignacio. Eastern gray whales are often seen during migration, off the western shores of the United States and British Colombia. During the return migration in the spring, a small population of about 80 individuals remains in more southerly Canadian waters. Relative to their eastern counterparts, western Pacific gray whales are poorly understood and are often referred to as the Korean, Western Pacific, or Okhotsk Sea stock. Their feeding grounds extend from the Okhotsk Sea, south along the east coast of Russia to the southern tip of south Korea. During the fall, they likely migrate to the South China Sea to give birth to young in sheltered lagoons and bays along the southern Chinese coast. However, this has not been well documented, as fewer studies have focused on this population.

A third north Atlantic gray whale population existed as recently as the 1700's and was described by whalers and colonists in North America, Iceland, Great Britain and Scandinavia. They have since been extirpated from the north Atlantic, likely due to over-hunting by whalers along with other anthropogenic influences (e.g., coastal development in their former calving grounds).

Biogeographic Regions: nearctic (Native ); palearctic (Native ); oriental ; arctic ocean (Native ); pacific ocean (Native )

  • Committee on the Status of Endangered Wildlife in Canada. COSEWIC Assessment and Status Report on the Grey Whale Eschrichtius robustus Eastern North Pacific Population in Canada. unknown. Ottawa, Ontario: COSEWIC. 2004.
  • Bryant, P. 1995. Dating Remains of Gray Whales from the Eastern North Atlantic. Journal of Mammology, 76/3: 857-861. Accessed February 22, 2009 at http://www.jstor.org/stable/1382754.
  • Clapham, P., S. Young, R. Brownell Jr.. 1999. Baleen whales: conservation issues and the status of the most endangered populations. Mammal Review, 29/1: 35-60. Accessed March 29, 2009 at http://www3.interscience.wiley.com/cgi-bin/fulltext/119075248/PDFSTART.
  • Jones, M., S. Swartz, S. Leatherwood. 1984. The Gray Whale: Eschrichtius robustus. Orlando, Florida 32887: Academic Press, Inc..
  • Reilly, S., J. Bannister, P. Best, M. Brown, R. Brownell Jr., D. Butterworth,, P. Clapham, J. Cooke, G. Donovan, J. Urban, A. Zerbini. 2008. "IUCN 2008 Red List" (On-line). IUCN 2008 Red List - Eschrichtius robustus. Accessed March 22, 2009 at http://www.iucnredlist.org/details/8097.
  • Rice, D., A. Wolman, H. Braham. 1984. The Gray Whale, Eschrichtius robustus. Marine Fisheries Review, 46/4: 7-14. Accessed March 31, 2009 at spo.nmfs.noaa.gov.
  • Sullivan, R., J. Stack, W. Houck. 1983. Observations of Gray Whales (Eschrichtius robustus) along Northern California. Journal of Mammalogy, 64/4: 689-692. Accessed February 22, 2009 at http://www.jstor.org/stable/1380527.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

East Pacific, Indo-West Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Ocean, European waters (ERMS scope), Gulf of Maine, North Pacific, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Non-breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (20,000-2,500,000 square km (about 8000-1,000,000 square miles)) Range includes coastal waters of the North Pacific. Most gray whales are in the Bering and Chukchi seas in summer (some occur then off northern Alaska, the Siberian coast, and southward along the coast to British Columbia and northern California). In winter, they occur in coastal waters off Baja California, Sonora, and Sinaloa. Primary birthing areas are Laguna Ojo de Liebre (Scammon's Lagoon), Laguna Guerrero Negro, Laguna San Ignacio, and Estero Soledad, Mexico (IUCN 1991). This species has been extirpated in the Atlantic (last seen about 1750; Rice 1998, Nowak 1991). A small population exists in the western Pacific (Okhotsk Sea in summer to South Korean coast in winter) (Weller et al. 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
North Pacific Ocean--coastal and Bering Sea, formerly North Atlantic Ocean

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

There are two main stocks of the gray whale; one occurs along the east Pacific coast from Baja California to the Bering and Chukchi seas, the other occurs in the west Pacific from South Korea to the Okhotsk Sea (2). The gray whale once also occurred in the Atlantic Ocean, but became extinct here in the late 17th to early 18th century (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Gray whales have mottled gray backs, a trait shared among several mysticete species. They are often hosts to dense infestations of skin parasites (e.g., barnacles and orange whale lice) that give their skin a rough and patchy appearance. In gray whales, these parasites often cover the entire body, however, in other baleen whales (right whales, Eubalaena australis and humpback whales, Megaptera novaeangliae), infestations are limited to specific areas of the body. Gray whale calves weigh between 500 kg and 600 kg at birth and are about 4.6 m in length. Adult females are slightly larger than males and are between 11.7 m and 15.2 m. Males are between 11.1 m and 14.3 m in length. Gray whales can weigh as much as 36,000 kg.

Unlike humpback whales (Megaptera novaeangliae), with which they are commonly confused, gray whales do not have dorsal fins. Rather, they have a large hump at the anterior end of the tail stock, followed by 7 to 15 knobs or knuckles of decreasing size. Gray whales have small, paddle-shaped flippers, compared to the large white flippers of humpback whales. The caudal fin has 2 wide, gray flukes separated by a deep notch. Their upper jaw extends past the lower jaw, and they have 2 to 5 throat pleats, which allow the mouth and throat to expand while feeding. Adults have 130 to 180 cream-colored baleen plates that are 5 to 25 cm in length.

Range mass: 36000 (high) kg.

Range length: 11.1 to 15.2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 1410 cm

Weight: 3.3E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 11.1-14.3 m males; 11.7-15 m females

Weight:
Range: 15,700-33,800 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Differs from other large sympatric whales that lack a dorsal fin or have only a low one (right, bowhead, and sperm whales) by having mottled gray coloration and the series of bumps on the tail stock; lacks the knobs on the head, ventral grooves, and the very long flippers of the humpback whale (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Gray whales are primarily bottom feeders and are thus restricted to shallow continental shelf waters for feeding. They are largely coastal although they do feed at greater distances from shore on the shallow shelf of the Bering and Chukchi seas.

Gray whales feed primarily on swarming mysids, tube-dwelling amphipods, and polychaete tube worms in the northern parts of their range, but are also known to take red crabs, baitfish, and other food (crab larvae, mobile amphipods, herring eggs and larvae, cephalopods, and megalops) opportunistically or off the main feeding grounds.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology

The main feeding habitat of this subpopulation is the shallow (5-15 m depth) shelf of northeastern SakhalinIsland, particularly off the southern portion of Piltun Lagoon, where the main prey species appear to be amphipods and isopods (Weller et al., 1999). In some years the whales have also used an offshore feeding ground in 30-35m depth southeast of ChayvoBay where benthic amphipods and cumaceans are the main prey species (Fadeev 2003). Some gray whales have also been seen off western Kamchatka but to date all whales photographed there are also known from the Piltun area (Reeves et al. 2005). Recently whales have also been seen, apparently feeding, in SevernayaBay on the north coast of Sakhalin (IUCN 2006).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gray whales feed in shallow coastal waters with muddy or sandy bottoms. They are migratory and rely on a variety of coastal habitats. During summer, they stay in waters of up to 60 m in depth and within 0.5 km to 166 km of shore. During fall, eastern gray whales migrate along the west coast of North America and spend winter in waters of less than 4 m in depth. These waters tend to be hyper-saline and are between 15 and 20 degrees C. Winter calving grounds usually have muddy or sandy bottoms and may contain eelgrass beds or be adjacent to mangrove swamps.

Range depth: < 4 to 60 m.

Habitat Regions: temperate ; tropical ; polar ; saltwater or marine

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

often found within a kilometre of the coastal shore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

strongly coastal
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1703 specimens in 1 taxon.
Water temperature and chemistry ranges based on 236 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 3.011 - 21.311
  Nitrate (umol/L): 0.081 - 8.579
  Salinity (PPS): 30.381 - 34.228
  Oxygen (ml/l): 5.074 - 7.732
  Phosphate (umol/l): 0.330 - 1.092
  Silicate (umol/l): 1.436 - 22.454

Graphical representation

Temperature range (°C): 3.011 - 21.311

Nitrate (umol/L): 0.081 - 8.579

Salinity (PPS): 30.381 - 34.228

Oxygen (ml/l): 5.074 - 7.732

Phosphate (umol/l): 0.330 - 1.092

Silicate (umol/l): 1.436 - 22.454
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Gray whales are seen mostly in coastal and shallow shelf waters. Young are born in lagoons and bays.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Shelf & coastal, North Pacific to Chukchi & Beaufort Seas; Migratory: most animals winter in Baja California where calves are born
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This whale typically occurs in coastal waters no deeper than 100 metres (2). The eastern Pacific stock migrates annually from Arctic feeding grounds to breed in Mexican waters, whilst the western Pacific stock migrates along the east coast of Russia (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

The eastern North Pacific stock migrates northward to summer range in February-May, led by newly pregnant females. The southward migration (November-January), led by pregnant females, passes through Unimak Pass, Alaska, and for most individuals ends in the Mexican winter range. The southward migration is more concentrated and closer to shore than is the northward migration. Roundtrip migration is up to about 18,000 kilometers. Small numbers spend the summer along the west coast of North America, from California north (Rice, in Wilson and Ruff 1999).

The western Pacific stock migrates south from western and northern Sea of Okhotsk to the southern coast of China (Rice, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Gray whales are mysticetes (i.e., filter feeders) and are the only large cetacean known primarily as bottom feeders. They feed in shallow water with muddy or sandy bottoms or in kelp beds. To feed, they dive to the ocean floor and fill their mouths with a large volume of sediment. They force the sediment through their baleen plates, which trap a wide variety of crustaceans (Crustacea) including amphipods (Amphipoda) and ghost shrimp (Neotrypaea californiensis), as well as polychaete worms (Polychaeta), herring eggs (Clupea pallasii) and various forms of larvae. Food items are scraped off baleen plates with their large tongue and ingested.

Gray whales are considered opportunistic feeders and use group feeding strategies on schools of small fish during their southern migration. During feeding episodes, three to four whales corral a school of fish, as a single whale swims up through the school with its mouth agape. The head of the feeding whale emerges out of the water and remains in this position for up to a few minutes. Each whale in the group repeats this process until the school of fish has been significantly depleted.

Animal Foods: fish; eggs; mollusks; aquatic or marine worms; aquatic crustaceans; cnidarians; other marine invertebrates; zooplankton

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Eats eggs, Eats non-insect arthropods, Molluscivore , Vermivore, Eats other marine invertebrates)

  • Heyning, J., J. Mead. 1997. Thermoregulation in the Mouths of Feeding Gray Whales. Science, 278: 1138-1139. Accessed March 16, 2009 at http://www.jstor.org/stable/2894257.
  • Obst, B., G. Hunt. 1990. Marine Birds Feed at Gray Whale Mud Plumes in the Bering Sea. The Auk, 107/4: 678-688. Accessed February 22, 2009 at http://www.jstor.org/stable/4087998.
  • Oliver, J., P. Slattery. 1985. Destruction and Opportunity on the Sea Floor: Effects of Gray Whale Feeding. Ecology, 66/6: 1965-1975. Accessed March 16, 2009 at http://www.jstor.org/stable/2937392.
  • Weitcamp, L., R. Wissmar, C. Simenstad, K. Fresh, J. Odell. 1992. Gray whale foraging on ghost shrimp (Callianassa californiensis) in littoral sand flats of Puget Sound, U.S.A.. Canadian Journal of Zoology, 70: 2275-2280.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: In the southern Chukchi Sea and northern Bering Sea, gray whales eat mainly tube-dwelling gammaridean amphipods; also various other small bottom invertebrates in small quantity. In the southern Bering Sea along the eastern Alaska Peninsula and adjacent Alaskan mainland, shrimp and mysids are the major prey. In Puget Sound, the whales feed on epibenthic ghost shrimp in littoral sand flats (Weitkamp et al. 1992). Elsewhere feeding is less common and prey may include swarms of amphipods, cumaceans, mysids, and infaunal polychaetes.

Gray whales employ a feeding technique not used by other large whales. While swimming forward and rolling to one side they run the head along the bottom and filter small invertebrates from the mud-water interface. They also may ingest invertebrates associated with masses of algae that are scraped through the mouth.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Only whale capable of benthic feeding; also feeds on epi-benthic and planktonic organisms; Wide range of prey including amphipods, cumaceans and other crustaceans, worms; little feeding occurs in the wintering grounds
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Gray whales are hosts to many endo- and ecto-parasites, including barnacles and whale lice. They are major predators of benthic amphipods (Amphipoda) and other marine invertebrates, including ghost shrimp (Palaemonetes). It is not known if gray whales contribute a significant degree of top down control on these prey species. Gray whales are primarily bottom feeders that disrupt muddy ocean bottoms, leaving feeding pits that are then colonized by other organisms. During feeding events, large mud plumes follow whales to the surface, carrying with them many invertebrates that are then eaten by sea birds and fish. Birds commonly associated with gray whales include northern fulmars (Fulmarus glacialis), red phalaropes (Phalaropus fulicarius), black-legged kitti-wakes (Rissa tridactyla), and thick-billed murres (Uria lomvia). Gray whales also eat herring eggs and spawn (Clupea pallasii) along their coastal migration routes and are considered to be opportunistic feeders that also feed upon schools of small baitfish.

Ecosystem Impact: creates habitat; soil aeration

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The only non-human predator of gray whales is the killer whale, also known as the orca (Orcinus orca). Nearly 18% of all gray whales show evidence of orca attack, with juveniles being the most vulnerable. Orca’s hunt in pods and can separate a calf from its mother. Once separated from its mother, the orca pod drowns the calf by holding on to its flippers and tail flukes with their teeth. Adult gray whales often place themselves between their calf and potential predators. When under attack, adults may also swim toward shallow water or kelp beds, where orcas typically do not enter.

Known Predators:

  • Baldridge, A. 1972. Killer Whales Attack and Eat a Gray Whale. Journal of Mammalogy, 53/4: 898-900. Accessed March 22, 2009 at http://www.jstor.org/stable/1379230.
  • Darling, J., A. Taber. 2001. Gray Whale. Pp. 256-261 in D MacDonald, ed. The Encyclopedia of Mammals. Oxfordshire, United Kingdom: Andromeda Oxford Limited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population in the early 1990s was about 21,000. Population in the western North Pacific may include 100-250 individuals. Weller et al. (1999) individually identified 69 whales on their feeding grounds off northeastern Sakhalin Island, Russia, in 1994-1998.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

In the northern Bering Sea, various seabirds (northern fulmar, red phalarope, black-legged kittiwake, and thick-billed murre) commonly forage on prey in the mud plumes stirred up by feeding gray whales.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Little is known about perception and communication in gray whales. Most whales communicate using a variety of high and low frequency "whale songs", including prolonged deep moans. Evidence suggests that gray whales use a simple array of short pulses and moans. Short pulses may be used for basic echolocation.

Communication Channels: acoustic

Other Communication Modes: choruses

Perception Channels: visual ; acoustic ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Size at birth 4.5m (15 feet) and 689kg (1500 pounds); Sexual maturity at 8 years; Females have calves every 2-3 years; Longevity over 40 years; Behavior; Short dives, usually flukes raised before prolonged dive; When feeding on benthic prey, often surfaces with mud streaming from mouth; Small groups, no lasting associations; Fiercely defend themselves and calf against predators/whalers
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Information on the lifespan of gray whales is limited, however, estimates range from 25 to 80 years old. Mortality rates are highest for young gray whales with an average annual calf mortality of 5.4%. About 75% of first-year mortalities occur during the first 2 weeks after birth. Mortality records indicate that calves represent about 91% of deaths at winter calving grounds, followed by yearlings (0 to 19.5%) and adults (0 to 5%). Annual adult mortality is estimated to be between 0.1 and 5% per year. Due to their large size and consequent feeding requirements, gray whales cannot be held in captivity.

Range lifespan

Status: wild:
25 to 80 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 77 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Although little is known of gray whale mating behavior, group mating events of three or more individual have been documented. Gray whales have a high reproductive rate, relative to other baleen whales.

Mating System: polygynandrous (promiscuous)

Gray whales mate throughout the year, however, most conceptions occur during the fall migration. After 13 to 14 months of gestation, females give birth to a single calf (one occurrence of twin fetuses was reported in 1987), which nurses until it is 6 to 7 months old. Eastern gray whale calves are born in late January in the warm coastal waters of Baja California, Mexico; however, early calving during the fall migration has been documented. Although less information is available for western gray whales, their winter calving grounds are thought to be along the coast of the South China Sea and likely have characteristics that are similar to the calving grounds of their eastern counterparts. Calving grounds are typically in shallow lagoons that are less than 4 m in depth and are hyper-saline. Preference for shallow water during calving may have contributed to the extirpation of the north Atlantic population in the mid 1700's.

Sexual maturation in gray whales occurs around 8 years of age, but has been documented in individuals as young as 5 and as old as 11. Nevertheless, studies suggest that size may be a better indicator of sexual maturity than age. Males average 11.1 m in length at time of sexual maturation and females average 11.7 meters. Sixty percent of the population consists of sexually mature adults. The average generation length (number of years between an individual's birth and the age at which they give birth) for gray whales is 22 years.

Breeding interval: Every other year

Breeding season: Year round mating with most conceptions occuring in late November to early December

Range number of offspring: 1 (high) .

Range gestation period: 13 to 14 months.

Range birth mass: 500 to 600 kg.

Range weaning age: 6 to 7 months.

Average time to independence: unknown years.

Range age at sexual or reproductive maturity (female): 5 to 11 years.

Range age at sexual or reproductive maturity (male): 5 to 11 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Gray whales replenish fat reserves during the summer. Pregnant females are especially dependent on these reserves. From the time they leave the summer feeding grounds in the fall, to when they return in early summer, females rely on fat reserves for energy and milk production. During times of limited food availability, interval between individual calving events may be extended.

Gray whale cows often hold newborn calves to the surface to help them breathe and are fiercely defensive of their young, especially against potential predators such as orcas (Orcinus orca) and human whalers. Gray whales inherit their mother's feeding grounds and are often seen, 1 year after they become independent, in their mother's feeding grounds.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); inherits maternal/paternal territory

  • Committee on the Status of Endangered Wildlife in Canada. COSEWIC Assessment and Status Report on the Grey Whale Eschrichtius robustus Eastern North Pacific Population in Canada. unknown. Ottawa, Ontario: COSEWIC. 2004.
  • 1998. "Eschrichtius robustus, Gray Whale" (On-line). MarineBio.org. Accessed March 20, 2009 at http://marinebio.org/species.asp?id=279..
  • International Whaleing Commission. Observed and Maximum Rates of Increase in Gray Whales, Eschrichtius robustus. 8479 Special Issue Six. California: STEPHEN B. REILLY. 1984. Accessed March 31, 2009 at http://swfsc.noaa.gov/publications/CR/1984/8479.PDF.
  • Jones, M., S. Swartz, S. Leatherwood. 1984. The Gray Whale: Eschrichtius robustus. Orlando, Florida 32887: Academic Press, Inc..
  • Rice, D., A. Wolman, H. Braham. 1984. The Gray Whale, Eschrichtius robustus. Marine Fisheries Review, 46/4: 7-14. Accessed March 31, 2009 at spo.nmfs.noaa.gov.
  • Sullivan, R., J. Stack, W. Houck. 1983. Observations of Gray Whales (Eschrichtius robustus) along Northern California. Journal of Mammalogy, 64/4: 689-692. Accessed February 22, 2009 at http://www.jstor.org/stable/1380527.
  • Sumich, J., J. Harvey. 1986. Juvenile Mortality in Gray Whales (Eschrichtius robustus). Journal of Mammalogy, 67/1: 179-182. Accessed March 16, 2009 at http://www.jstor.org/stable/1381019.
  • Sund, P. 1975. Evidence of Feeding during Migration and of an Early Birth of the California Gray Whale (Eschrichtius robustus). Journal of Mammalogy, 56/1: 265-266. Accessed May 04, 2009 at http://www.jstor.org/stable/1379635.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Females are impregnated during the southward migration or close to calving grounds. Gestation lasts about 13.5 months. A single calf is born late December-early February. Weaning occurs within 9 months. The calving interval is usually 2 years. Individuals become sexually mature in 5-11 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Lingual rete precools blood: gray whale
 

Lingual retes of gray whales precool blood in the tongue to avoid heat loss via counter-current heat exchange.

     
  "Vascular structures for heat conservation in the tongue of the gray whale (Eschrichtius robustus) are reported here. Numerous individual countercurrent heat exchangers are found throughout the massive tongue. These converge at the base of the tongue to form a bilateral pair of retia. Temperature measurements from the oral cavity of a live gray whale indicate that more heat may be lost through the blubber layer over the body than through the tongue, despite the fact that the tongue is far more vascularized and has much less insulation. These heat exchangers substantially reduce heat loss when these whales feed in cold waters." (Heyning and Mead 1997:1138)

  Learn more about this functional adaptation.
  • Heyning, J.E.; Mead, J.G. 1997. Thermoregulation in the mouths of feeding gray whales. Science. 278(5340): 1138-1139.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Eschrichtius robustus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACCAATCACAAAGACATTGGCACCCTATATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATTCGCGCTGAACTAGGTCAGCCTGGCTCGCTAATCGGAGATGATCAAATCTACAACGTGCTAGTAACAGCCCACGCCTTCGTAATAATCTTCTTCATGGTCATACCTATTATGATTGGAGGATTCGGAAACTGACTAGTCCCCCTAATGATCGGAGCACCTGATATAGCTTTCCCTCGTATAAATAACATAAGCTTCTGACTGCTCCCTCCTTCCTTCCTACTATTAATAGCATCTTCAATGGTCGAAGCTGGTGCAGGCACAGGCTGAACTGTGTATCCCCCTCTAGCCGGAAACCTAGCACATGCAGGAGCTTCAGTTGACCTTACCATCTTCTCCCTACACCTAGCCGGCGTATCCTCAATCCTCGGAGCCATCAACTTCATCACAACTATCATCAACATAAAACCACCTGCCATAACCCAATACCAAACTCCACTTTTCGTATGATCAGTTCTAATCACAGCAGTCCTACTCCTACTATCATTACCTGTCTTAGCAGCCGGAATCACCATGCTACTTACTGATCGAAACCTAAATACAACTTTCTTCGACCCCGCAGGTGGAGGAGATCCAATCCTATACCAACACCTATTCTGATTCTTTGGCCACCCCGAAGTATATATTCTAATTCTTCCTGGGTTCGGAATAATTTCACACATTGTGACTTATTACTCAGGAAAAAAAGAACCTTTCGGCTATATGGGAATAGTTTGGGCTATGGTATCCATCGGGTTCTTAGGCTTCATCGTATGGGCCCACCATATGTTTACAGTAGGTATAGACGTTGATACACGAGCATATTTCACATCAGCTACTATAATTATTGCCATCCCCACAGGAGTAAAAGTCTTCAGCTGATTAGCAACACTACACGGAGGTAATATTAAATGATCCCCTGCCCTAATGTGAGCCCTAGGTTTCATCTTCCTCTTCACAGTAGGCGGCCTAACCGGTATCGTCCTAGCCAATTCATCACTAGACATTGTCCTACACGATACCTACTATGTAGTTGCTCACTTCCACTATGTCTTATCAATAGGAGCAGTCTTCGCCATTATAGGAGGCTTTGTCCACTGATTTCCACTATTCTCAGGATATACACTTAACACAACATGAACAAAAATCCACTTTATAATCATGTTCGTAGGTGTAAACCTAACATTCTTCCCACAACACTTCTTAGGCCTATCCGGTATACCTCGACGATACTCCGACTATCCAGACGCCTACACAACATGAAATACTATTTCATCTATAGGCTCATTTATTTCACTAACAGCAGTTATGCTAATAATTTTCATTATCTGAGAAGCATTCACATCCAAACGAGAAGTACTAGCAGTAGACCTTACCTCCACCAATCTTGAATGACTAAACGGATGTCCCCCACCATATCATACGTTCGAAGAACCAGCATTCGTCAACCCAAAATGATCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Eschrichtius robustus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
When the two subpopulations are assessed as a single species-level unit, the estimated population size is above the threshold for a threatened category, and the population has increased over the last three generations. The recent apparent decline in the eastern subpopulation is considered to be a fluctuation and is not inconsistent with a Least Concern listing. The western subpopulation is listed separately as Critically Endangered.

History
  • 1996
    Lower Risk/conservation dependent
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(ii);E

Version
3.1

Year Assessed
2000

Assessor/s
Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N.

Reviewer/s
Taylor, B.L. & Notarbartolo di Sciara, G. (Cetacean Red List Authority)

Contributor/s

Justification
Results of a quantitative population analysis (Cooke et al. 2006) indicate Critically Endangered under the assumption that recent mortality levels continue, based on an extinction probability exceeding 50% within three generations (criterion E), or a projected continuing decline of the subpopulation in combination with a mature population size less than 250 (criterion C2a(ii)). In addition, the small absolute subpopulation size, and the estimate of at most 35 reproductive females means that the subpopulation would easily qualify as Endangered under criterion D (
History
  • 2000
    Critically Endangered
  • 1996
    Endangered

Geographic Range


Range Description

The western gray whale summers in the OkhotskSea, mainly off the northeastern coast of SakhalinIsland (Russian Federation). There are also occasional sightings off the eastern coast of Kamchatka (Russian Federation) and in other coastal waters of the northern OkhotskSea (Vladimirov 1994, Weller et al. 1999). Its migration routes and wintering grounds are poorly known, the only recent information being from occasional records on both the eastern and western coasts of Japan (Kato et al. 2006) and along the Chinese coast (Zhu and Yue 1998). Until 1966, there was a whaling ground off Ulsan (southeastern KoreaPeninsula), where whales were taken during November to April, with two peaks (in December/January and March/April), suggestive of south- and northbound migrations respectively through the Sea of Japan (Kato and Kasuya 2002). However, no gray whales have been recorded in the Korean whaling grounds since 1968. The great majority of recent Japanese records are on the Pacific side, suggesting that this is now the more important migration route. The few modern records from China are scattered along virtually the entire Chinese coast from the northern Yellow Sea to the HainanStrait in the south (Zhu and Yue 1998). The calving grounds are unknown but may be around HainanIsland, this being the southwestern end of the known range (Brownell and Chun 1977).


Countries
  • Native
    • China
    • Japan
    • Korea, Democratic People's Republic of
    • Korea, Republic of
    • Russian Federation

FAO Marine Fishing Areas
  • Native
    • Pacific – northwest

Population


Population

Western gray whales were thought to be extinct as recently as 1972 (Bowen 1974), but a small number are now known to survive (Berzin 1974, Weller et al. 2002); the best estimate for 2006 is 113-131 animals, of which 26-35 are reproductive females, based on an analysis of photo-identification data (Cooke et al. 2006). The figures include adjustments for the photo-identified whales that are likely to have died and for the estimated number of living whales that have yet to be catalogued. In the absence of additional new mortality in excess of the estimated rate over 1994-2004, the population size is projected to increase at 2-4% per annum (Cooke et al. 2006). However, even a very small number of additional annual female deaths will cause the subpopulation to decline.


Population Trend
Increasing

Habitat and Ecology


Habitat and Ecology

The main feeding habitat of this subpopulation is the shallow (5-15 m depth) shelf of northeastern SakhalinIsland, particularly off the southern portion of Piltun Lagoon, where the main prey species appear to be amphipods and isopods (Weller et al., 1999). In some years the whales have also used an offshore feeding ground in 30-35m depth southeast of ChayvoBay where benthic amphipods and cumaceans are the main prey species (Fadeev 2003). Some gray whales have also been seen off western Kamchatka but to date all whales photographed there are also known from the Piltun area (Reeves et al. 2005). Recently whales have also been seen, apparently feeding, in SevernayaBay on the north coast of Sakhalin (IUCN 2006).


Systems
  • Marine

Threats


Major Threats

Western gray whales were hunted by aboriginal people in the northern part of their range since prehistoric times but to an unknown extent (Mitchell, 1979). They were taken by Japanese hand-harpoon whalers in the Sea of Japan since at least the 16th century, and by net whalers on the Pacific coast in the 17th to 19th century (Omura 1984, 1988). Western gray whales were also taken by European and American whalers, mainly in the Okhotsk Sea, from the late 1840s to perhaps the start of the 20th century (Henderson 1984), and by Russian steam whalers on the Russian far eastern coast at the end of the 19th century (Andrews 1914, Weller et al. 2002). Quantitative information is scarce, but it is possible that the subpopulation was already depleted by the start of modern whaling at the end of the 19th century. During 1890-1966 an estimated 1,800 – 2,000 gray whales were taken off the Korea peninsula and Japan (Kato and Kasuya 2002). Apart from the main grounds off southeastern Korea, whales were also taken in the Yellow Sea in the early part of this period. Occasional catches are recorded from China during 1916-58 (Zhu and Yue 1998). It is not known whether any whales have been taken by the Democratic People’s Republic of Korea.

Three western gray whales, all females, were fatally entangled in net-traps on the Pacific coast of Japan in 2005 (Kato et al., 2006). Subpopulation projections show that if this level of mortality continues, the subpopulation would decline towards extinction (Cooke et al. 2006, IWC 2007). Most recently, a female yearling (9.1 m) was killed in YoshihamaBay, Sanriku, Japan on 19 January 2007. The stranding of a dead western gray whale in Japan with a hand harpoon lodged in it of the kind used by porpoise hunters (Brownell and Kasuya 1999) is of concern, as is the finding of gray whale meat on domestic whale meat markets on the Pacific coast of Japan (Baker et al. 2002). Incidental catches of cetaceans in the extensive coastal net fisheries off southern China are also of concern (Zhou and Wang 1994).

The substantial nearshore industrialization and shipping congestion throughout the migratory corridors of this subpopulation represent potential threats by increasing the likelihood of exposure to ship strikes, chemical pollution, and general disturbance (Weller et al. 2002).

Offshore gas and oil development in the OkhotskSea within 20 km of the primary feeding ground off northeast SakhalinIsland in the OkhotskSea is of particular concern. Activities related to oil and gas exploration, including geophysical seismic surveying, pipelaying and drilling operations, increased vessel traffic, and oil spills, all pose potential threats to western gray whales. Disturbance from underwater industrial noise may displace whales from critical feeding habitat. Physical habitat damage from drilling and dredging operations, combined with possible impacts of oil and chemical spills on benthic prey communities also warrants concern (Reeves et al. 2005)

Conservation Actions


Conservation Actions

International Whaling Commission (IWC) regulations protect western gray whales from commercial and aboriginal subsistence whaling; the range states of the Russian Federation, Japan, the Republic of Korea, and China, are members of the IWC (but as noted above, some limited illegal hunting may continue). Oil and gas companies operating off SakhalinIsland have implemented some voluntary measures to reduce their impacts on gray whales, such as speed restrictions on their vessels (Anon. 2006). At present, one oil company is co-operating with the IUCN Western Gray Whale Advisory Panel (WGWAP) although it is not bound by the panel’s recommendations (http://www.iucn.org/themes/marine/sakhalin/).

Citation

Reilly, S.B., Bannister, J.L., Best, P.B., Brown, M., Brownell Jr., R.L., Butterworth, D.S., Clapham, P.J., Cooke, J., Donovan, G.P., Urbán, J. & Zerbini, A.N. 2000. Eschrichtius robustus (western subpopulation). In: IUCN 2010 . IUCN Red List of Threatened Species. Version 2010.4 . <www.iucnredlist.org>. Downloaded on 14 May 2012 .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In 2003, the International Whaling Commission (IWC) established an indigenous hunting limit of 620 gray whales over five years, with no more than 140 individuals to be taken in a single year. In 2005, the IWC estimated that 400 individuals could be sustainably taken in any one year. Additionally, the major breeding lagoons of the eastern Pacific population are protected by their inclusion in the El Vizcaino Biosphere Reserve, limiting disturbances from boating, fishing, and coastal development.

The Committee on the Status of Endangered Wildlife in Canada designated the eastern north Pacific gray whale as a species of "Special Concern". After international protection from commercial whaling, gray whale populations experienced a 2.5% annual growth increase until 1998, when the population peaked at around 27,000 individuals. Over the following four years, however, the population declined by more than a third, possibly due to a lack of food in their summer feeding grounds. Since 2002, the eastern north Pacific gray whale population has steadily increased. The United States Fish and Wildlife Service lists the western north Pacific gray whale population as "endangered" and indicates that the eastern north Pacific stock was delisted in 1994. When the western and eastern Pacific populations are considered a single population, the IUCN considers them as a species of "Least Concern". However, the western Pacific population is separately listed as “critically endangered”.

US Federal List: endangered

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2N - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Has recovered to pre-whaling numbers (20,000+) in the eastern North Pacific; rare in western North Pacific, extirpated in Atlantic. Apparently secure but perhaps vulnerable due to the low number of, and threats to, calving areas in Mexico.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: W Pacific Ocean

Status: Delisted due to Recovery
Date Listed: 06/16/1994
Lead Region:   National Marine Fisheries Service (Region 11)   
Where Listed: except where listed


Population detail:

Population location: Entire, except eastern North Pacific Ocean--coastal and Bering, Beaufort, and Chukchi Seas
Listing status: E

For most current information and documents related to the conservation status and management of Eschrichtius robustus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1), and listed on Appendix I of CITES (3). The northeast Pacific stock is classified as Least Concern (LC), and the northwest Pacific stock is classified as Critically Endangered (CR) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Genetic studies and differential recovery patterns (LeDuc et al. 2002) suggest that the small western North Pacific subpopulation is isolated from the larger eastern subpopulation. The former is listed as Critically Endangered (see separate account).

Both eastern and western gray whales were hunted in prehistoric times, but aboriginal catches declined to relatively low levels by the early 20th century due to depletion of the stocks by commercial whaling and the general decline of the traditional aboriginal economies (Mitchell and Reeves 1990).

Eastern gray whales were rapidly depleted by commercial whalers operating in the breeding lagoons when they were discovered in the mid-19th century, estimated peak catches (averaging over 480 whales per year) occurring between 1855 and 1865. Lagoon whaling ended by about 1875, apparently due to exhaustion of the lagoon populations, but shore-based whaling in California continued at a lower level until the late 19th century (Henderson 1984; IWC 1993). In the 20th century, there were some pelagic catches off California and Mexico by Norwegian and American vessels in the 1920s and 1930s, and in the 1930s and 1940s by a Soviet pelagic fleet in the Bering and Chuckchi Seas (Donahue and Brownell 2001; Brownell and Swartz 2006). A further 320 gray whales were taken under scientific permit in the 1960s (Rice and Wolman 1971), and 138 illegal Soviet catches occurred in the 1960s (Doroshenko 2000). Substantial “aboriginal subsistence” whaling in the Bering and Chukchi seas off Chukotka (Russian Federation) resumed in 1948 and has continued into the present, apart from an interruption in the early 1990s during the collapse of the USSR. Catches during the last 50 years (1956-2005) have averaged around 150 per year. Very small numbers have also been taken by aboriginal whalers in Alaska (US), and, in recent years, by the Makah tribe in Washington State, (US) (Donahue and Brownell 2001; IWC 2005).

Despite the continuing catches, the eastern subpopulation has recovered strongly from past over-exploitation, increasing by 2.5% per annum during 1967-96 (Buckland and Breiwick 2002). The subpopulation seems to have peaked around 1997/98 when a census on the southward migration indicated a population of 24,000-36,000; it may have declined since the most recent estimate is 15,000-22,000 for 2001/02 (Rugh et al. 2005). However, there are a number of unresolved possible explanations for the downturn, inter alia related to an ‘overshoot’ of carrying capacity (Moore et al. 2001) and/or unusual environmental conditions around the turn of the millennium resulting in poor calf production, high stranding rates and relatively high numbers of emaciated animals (e.g. LeBouef et al. 2000, IWC 2003, Rugh et al. 2005). Perryman et al. (2002) showed that calf production was related to the proportion of feeding habitat free of sea ice in the preceding summer. Since 2002, calf production has recovered, and mortality and the occurrence of emaciated whales have declined (IWC 2004). The population has probably reached a size where it exceeds the carrying capacity of the environment in years where food availability is below average and is likely to fluctuate around some environmentally determined average level (IWC 2003).

The western Pacific subpopulation remains at a small fraction of past levels and is estimated to number about 100 individuals, of which 20-30 are mature females (Reeves et al. 2005), based on analysis of photo-identification data (see separate listing for the western Pacific subpopulation for more information).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

Western gray whales were thought to be extinct as recently as 1972 (Bowen 1974), but a small number are now known to survive (Berzin 1974, Weller et al. 2002); the best estimate for 2006 is 113-131 animals, of which 26-35 are reproductive females, based on an analysis of photo-identification data (Cooke et al. 2006). The figures include adjustments for the photo-identified whales that are likely to have died and for the estimated number of living whales that have yet to be catalogued. In the absence of additional new mortality in excess of the estimated rate over 1994-2004, the population size is projected to increase at 2-4% per annum (Cooke et al. 2006). However, even a very small number of additional annual female deaths will cause the subpopulation to decline.


Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Increase of 10 to >25%

Comments: In the eastern Pacific Ocean over the past several decades, numbers have increased to levels close to pre-whaling abundance.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Gray whales have been subject to hunting since prehistoric times, due to their slow swimming speeds and coastal distribution. The North Atlantic population was extinct by the early 1700s, although the causes are unclear. Over-exploitation was thought to have caused the extinction of the western gray whale until Soviet scientists in the 1980s reported a small remnant group summering off Sakhalin Island. The eastern North Pacific subpopulation had reached such low numbers by the end of the 19th century that commercial whaling ceased, but it has now recovered to at or near carrying capacity, its abundance showing some fluctuation in response to environmental conditions.

The eastern North Pacific subpopulation is subject to anthropogenic threats such as entanglements in fishing gear (Baird et al. 2002), disturbance by vessels and other noise, collisions, and possibly petroleum-related and other contaminants (Moore and Clarke 2002). However, these do not appear to be having a significant effect on the demography of the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

Western gray whales were hunted by aboriginal people in the northern part of their range since prehistoric times but to an unknown extent (Mitchell, 1979). They were taken by Japanese hand-harpoon whalers in the Sea of Japan since at least the 16th century, and by net whalers on the Pacific coast in the 17th to 19th century (Omura 1984, 1988). Western gray whales were also taken by European and American whalers, mainly in the Okhotsk Sea, from the late 1840s to perhaps the start of the 20th century (Henderson 1984), and by Russian steam whalers on the Russian far eastern coast at the end of the 19th century (Andrews 1914, Weller et al. 2002). Quantitative information is scarce, but it is possible that the subpopulation was already depleted by the start of modern whaling at the end of the 19th century. During 1890-1966 an estimated 1,800 – 2,000 gray whales were taken off the Korea peninsula and Japan (Kato and Kasuya 2002). Apart from the main grounds off southeastern Korea, whales were also taken in the Yellow Sea in the early part of this period. Occasional catches are recorded from China during 1916-58 (Zhu and Yue 1998). It is not known whether any whales have been taken by the Democratic People’s Republic of Korea.

Three western gray whales, all females, were fatally entangled in net-traps on the Pacific coast of Japan in 2005 (Kato et al., 2006). Subpopulation projections show that if this level of mortality continues, the subpopulation would decline towards extinction (Cooke et al. 2006, IWC 2007). Most recently, a female yearling (9.1 m) was killed in YoshihamaBay, Sanriku, Japan on 19 January 2007. The stranding of a dead western gray whale in Japan with a hand harpoon lodged in it of the kind used by porpoise hunters (Brownell and Kasuya 1999) is of concern, as is the finding of gray whale meat on domestic whale meat markets on the Pacific coast of Japan (Baker et al. 2002). Incidental catches of cetaceans in the extensive coastal net fisheries off southern China are also of concern (Zhou and Wang 1994).

The substantial nearshore industrialization and shipping congestion throughout the migratory corridors of this subpopulation represent potential threats by increasing the likelihood of exposure to ship strikes, chemical pollution, and general disturbance (Weller et al. 2002).

Offshore gas and oil development in the OkhotskSea within 20 km of the primary feeding ground off northeast SakhalinIsland in the OkhotskSea is of particular concern. Activities related to oil and gas exploration, including geophysical seismic surveying, pipelaying and drilling operations, increased vessel traffic, and oil spills, all pose potential threats to western gray whales. Disturbance from underwater industrial noise may displace whales from critical feeding habitat. Physical habitat damage from drilling and dredging operations, combined with possible impacts of oil and chemical spills on benthic prey communities also warrants concern (Reeves et al. 2005)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threat to this whale has been hunting; humans have exploited the species for its oil, hide, baleen and meat (6). The activities of early whalers were, at the very least, a contributing factor to the extinction of the gray whale in the Atlantic Ocean (5), while massive over-exploitation in the 19th and 20th centuries almost destroyed the whole species (6). Whilst hunting is now banned a small quota is permitted to indigenous hunters (6). Shipping and industrial activities in the coastal migratory routes increase the risk of collisions with ships, entanglement in fishing nets and pollution. Furthermore, habitat degradation resulting from drilling and dredging is also a problem (1) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Gray whales have been protected from commercial whaling by the International Whaling Commission (IWC) since its establishment in 1946. Limited aboriginal subsistence whaling is permitted by the IWC for the eastern gray whale and catch limits have been set since the 1970s on the basis of advice from its Scientific Committee (most recently under its new aboriginal subsistence whaling management procedure) and a needs request from the relevant governments (Russian Federation and US). The current (2003-07) catch limit for the eastern stock is 620 for five years, subject to a maximum of 140 in any single year. This meets the needs request and is considerably below the estimated level (over 400) that would be sustainable (IWC 2005).

Three gray whale breeding lagoons in Mexico (Laguna Ojo de Liebre, L. San Ignacio and L. Guerrero Negro) enjoy some protection in the form of limitations on boating, fishing and coastal development, originally as National Gray Whale Refuges, now through their inclusions in the El Vizcaino Biosphere Reserve, which is also listed internationally as a UNESCO World Heritage Site and a Ramsar protected wetland (Hoyt 2005).

The species is listed in Appendix I of CITES and Appendix II of CMS.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions

International Whaling Commission (IWC) regulations protect western gray whales from commercial and aboriginal subsistence whaling; the range states of the Russian Federation, Japan, the Republic of Korea, and China, are members of the IWC (but as noted above, some limited illegal hunting may continue). Oil and gas companies operating off SakhalinIsland have implemented some voluntary measures to reduce their impacts on gray whales, such as speed restrictions on their vessels (Anon. 2006). At present, one oil company is co-operating with the IUCN Western Gray Whale Advisory Panel (WGWAP) although it is not bound by the panel’s recommendations (http://www.iucn.org/themes/marine/sakhalin/).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1946, the International Whaling Commission (IWC) legally protected gray whales from commercial whaling, and the eastern Pacific stock has shown a remarkable recovery, increasing from the brink of extinction to around 21,000 individuals today (6). However, the western Pacific population that migrates along the east coast of Russia remains very small and Critically Endangered (1). Whale watching, particularly in southern California and Mexico, has developed into an extremely popular tourist attraction (4), allowing people to appreciate these awesome creatures in their natural environment and providing additional value to their conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Gray whales have no known negative impact on humans; however, future conservation efforts may limit costal development.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Gray whales have been hunted for thousands of years by indigenous populations along the coasts of North America and Russia. Commercial whaling for baleen, blubber, oil, and meat has occurred sporadically since 1900; however, over the past 400 years over-hunting has significantly decreased gray whale abundance. Although commercial whaling is illegal, indigenous subsistence hunting is allowed in North America and Russia. Finally, ecotourism and whale watching are important components of local economies along gray whale migratory routes.

Positive Impacts: food ; body parts are source of valuable material; ecotourism ; research and education

  • U.S. Department of Commerce National Oceanic and Atmospheric Administration National Marine Fisheries Service. Draft Environmental Assessment on Issuing a Quota to the Makah Indian Tribe for a Subsistance Hunt on Gray Whales for the Years 2001 and 2002. unknown. United States: U.S. Department of Commerce National Oceanic and Atmospheric Administration National Marine Fisheries Service. 2001.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long exploited for food and oil; now harvested in eastern Asia (about 175/year in recent decades); see IUCN (1991) for a review of exploitation history. Now viwed by many commercial whale-watching boats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Northwest Pacific gray whale : Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gray whale

The gray whale (Eschrichtius robustus) is a baleen whale that migrates between feeding and breeding grounds yearly. It reaches a length of 14.9 m (49 ft), a weight of 36 tonnes (35 long tons; 40 short tons), and lives 50–70 years.[3] The common name of the whale comes from the gray patches and white mottling on its dark skin.[4] Gray whales were once called devil fish because of their fighting behavior when hunted.[5] The gray whale is the sole living species in the genus Eschrichtius, which in turn is the sole living genus in the family Eschrichtiidae. This mammal descended from filter-feeding whales that developed at the beginning of the Oligocene, over 30 million years ago.

The gray whale is distributed in an eastern North Pacific (North American) population and a critically endangered western North Pacific (Asian) population. North Atlantic populations were extirpated (perhaps by whaling) on the European coast before 500 AD and on the American coast around the late 17th to early 18th centuries.[6] However, on May 8, 2010, a sighting of a gray whale was confirmed off the coast of Israel in the Mediterranean Sea,[7] leading some scientists to think they might be repopulating old breeding grounds that have not been used for centuries.[7]

Contents

Taxonomy

Skeleton

The gray whale is traditionally placed as the only living species in its genus and family.[8] Recent DNA analysis indicates certain rorquals of the family Balaenopteridae, such as the humpback whale, Megaptera novaeangliae, and fin whale, Balaenoptera physalus, are more closely related to the gray whale than they are to some other rorquals, such as the minke whales.[9][10] John Edward Gray placed it in its own genus in 1865, naming it in honour of zoologist Daniel Eschricht.[11] The common name of the whale comes from its coloration. The subfossil remains of now extinct gray whales from the Atlantic coasts of England and Sweden were used by Gray to make the first scientific description of a species then surviving only in Pacific waters.[12] The living Pacific species was described by Cope as Rhachianectes glaucus in 1869.[13] Skeletal comparisons showed the Pacific species to be identical to the Atlantic remains in the 1930s, and Gray's naming has been generally accepted since.[14][15] Although identity between the Atlantic and Pacific populations cannot be proven by anatomical data, its skeleton is distinctive and easy to distinguish from that of all other living whales.[16]

Many other names have been ascribed to the gray whale, including desert whale,[17] devil fish, gray back, mussel digger and rip sack.[18] The name Eschrichtius gibbosus is sometimes seen; this is dependent on the acceptance of a 1777 description by Erxleben.[19]

Description

The gray whale is a dark slate-gray in color and covered by characteristic gray-white patterns, scars left by parasites which drop off in its cold feeding grounds. Individual whales are typically identified using photographs of their dorsal surface and matching the scars and patches associated with parasites that have fallen off the whale or are still attached.

Gray whales measure from 16 feet (4.9 m) in length for newborns to 13-15 m (43-49 ft) for adults (females tend to be slightly larger than adult males). Newborns are a darker gray to black in color. A mature gray whale can reach 40 tonnes (39 long tons; 44 short tons), with a typical range of 15 to 33 tonnes (15 to 32 long tons; 17 to 36 short tons).[20]

They have two blowholes on top of their head, which can create a distinctive V-shaped blow at the surface in calm wind conditions.

A close-up of a gray whale's double blow hole and some of its encrusted barnacles

Notable features that distinguish the gray whale from other mysticetes include its baleen that is variously described as cream, off-white, or blond in color and is unusually short. Small depressions on the upper jaw each contain a lone stiff hair, but are only visible on close inspection. Its head's ventral surface lacks the numerous prominent furrows of the related rorquals, instead bearing two to five shallow furrows on the throat's underside. The gray whale also lacks a dorsal fin, instead bearing 6 to 12 dorsal crenulations ("knuckles"), which are raised bumps on the midline of its rear quarter, leading to the flukes. The tail itself is 10–12 feet (3.0–3.7 m) across and deeply notched at the center while its edges taper to a point.

Populations

Two Pacific Ocean populations are known to exist: one of not more than 130 individuals (according to the most recent population assessment in 2008[21]) whose migratory route is presumed to be between the Sea of Okhotsk and southern Korea, and a larger one with a population between 20,000 and 22,000 individuals in the eastern Pacific travelling between the waters off Alaska and Baja California Sur. The western population is listed as critically endangered by the IUCN. No new reproductive females were recorded in 2010, resulting in a minimum of 26 reproductive females being observed since 1995.[21] Even a very small number of additional annual female deaths will cause the subpopulation to decline.[22]

In 2007, S. Elizabeth Alter used a genetic approach to estimate prewhaling abundance based on samples from 42 California gray whales, and reported DNA variability at 10 genetic loci consistent with a population size of 76,000–118,000 individuals, three to five times larger than the average census size as measured through 2007.[23] NOAA conducted a new populations study in 2010–2011; those data will be available by 2012.[24] The ocean ecosystem has likely changed since the prewhaling era, making a return to prewhaling numbers infeasible; many marine ecologists argue that existing gray whale numbers in the eastern Pacific Ocean are approximately at the population's carrying capacity.[25]

The gray whale became extinct in the North Atlantic in the 18th century.[26] Radiocarbon dating of subfossil or fossil European (Belgium, the Netherlands, Sweden, the United Kingdom) coastal remains confirms this, with whaling the possible cause.[16] Remains dating from the Roman epoch were found in the Mediterranean during excavation of the antique harbor of Lattara near Montpellier in 1997, raising the question of whether Atlantic gray whales migrated up and down the coast of Europe to calve in the Mediterranean.[27] Similarly, radiocarbon dating of American east coastal subfossil remains confirm gray whales existed at least through the 17th century. This population ranged at least from Southampton, New York, to Jupiter Island, Florida, the latest from 1675.[15] In his 1835 history of Nantucket Island, Obed Macy wrote that in the early pre-1672 colony a whale of the kind called "scragg" entered the harbor and was pursued and killed by the settlers.[28] A. B. Van Deinse points out that the "scrag whale", described by P. Dudley in 1725 as one of the species hunted by the early New England whalers, was almost certainly the gray whale.[29][30]

In mid-1980, there were three gray whale sightings in the eastern Beaufort Sea, placing them 585 kilometers (364 mi) further east than their known range at the time.[31] In May 2010, a gray whale was sighted off the Mediterranean shore of Israel.[32] It has been speculated that this whale crossed from the Pacific to the Atlantic via the Northwest Passage, since alternative routes through the Panama Canal or Cape Horn are not contiguous to the whale's established territory. There has been gradual melting and recession of Arctic sea ice with extreme loss in 2007 rendering the Northwest Passage "fully navigable".[33] The same whale was sighted again on May 30, 2010, off the coast of Barcelona, Spain.[34]

In January 2011, a gray whale that had been tagged in the western population was tracked as far east as the eastern population range off the coast of British Columbia.[35]

Life history

Reproduction

Breeding behavior is complex and often involves three or more animals. Both male and female whales reach puberty at approximately eight years of age.[36] Females show highly synchronized reproduction, undergoing oestrus in late November to early December.[37] During the breeding season, it is common for females to have several mates.[38] This single ovulation event is believed to coincide with the species’ annual migration patterns, when births can occur in warmer waters.[38] Most females show biennial reproduction, although annual births have been reported.[37] Males also show seasonal changes, experiencing an increase in testes mass that correlates with the time females undergo oestrus.[38] Currently there are no accounts of twin births, although an instance of twins in utero has been reported.[37]

The gestation period for gray whales is approximately 13.5 months.[36] In the latter half of the pregnancy, the fetus experiences a rapid growth in length and mass. Similar to the narrow breeding season, most calves are born within a six-week time period in mid January.[36] The calf is born tail first, and measures about 4 m (13 ft) in length. Females lactate for approximately seven months following birth, at which point calves are weaned and maternal care begins to decrease.[36] The shallow lagoon waters in which gray whales reproduce are believed to protect the newborn from sharks and orcas.[citation needed]

Feeding

The whale feeds mainly on benthic crustaceans, which it eats by turning on its side (usually the right, resulting in loss of eyesight in the right eye for many older animals) and scooping up sediments from the sea floor. It is classified as a baleen whale and has baleen, or whalebone, which acts like a sieve, to capture small sea animals, including amphipods taken in along with sand, water and other material. Mostly, the animal feeds in the northern waters during the summer; and opportunistically feeds during its migration, depending primarily on its extensive fat reserves. Calf gray whales drink 50 to 80 US gallons (190 to 300 l) of their mothers' 53% fat milk per day.[39]

The main feeding habitat of the western Pacific subpopulation is the shallow (5–15 m depth) shelf off northeastern Sakhalin Island, particularly off the southern portion of Piltun Lagoon, where the main prey species appear to be amphipods and isopods.[40] In some years, the whales have also used an offshore feeding ground in 30–35 m depth southeast of Chayvo Bay, where benthic amphipods and cumaceans are the main prey species.[41] Some gray whales have also been seen off western Kamchatka, but to date all whales photographed there are also known from the Piltun area.[42][22]

Gray whale breaching off the coast of Santa Barbara, California
A gray whale viewed from above

Migration

Each October, as the northern ice pushes southward, small groups of eastern gray whales in the eastern Pacific start a two- to three-month, 8,000–11,000-kilometer (5,000–6,800 mi) trip south. Beginning in the Bering and Chukchi seas and ending in the warm-water lagoons of Mexico's Baja peninsula and the southern Gulf of California, they travel along the west coast of Canada, the United States and Mexico.

The western gray whale summers in the Okhotsk Sea, mainly off the northeastern coast of Sakhalin Island (Russian Federation). There are also occasional sightings off the eastern coast of Kamchatka (Russian Federation) and in other coastal waters of the northern Okhotsk Sea,.[43][44] Its migration routes and wintering grounds are poorly known, the only recent information being from occasional records on both the eastern and western coasts of Japan [45] and along the Chinese coast.[46] The calving grounds are unknown but may be around Hainan Island, this being the southwestern end of the known range.[22][47]

Traveling night and day, the gray whale averages approximately 120 km (75 mi) per day at an average speed of 8 kilometers per hour (5 mph). This round trip of 16,000–22,000 km (9,900–14,000 mi) is believed to be the longest annual migration of any mammal. By mid-December to early January, the majority are usually found between Monterey and San Diego, often visible from shore. The whale watching industry provides ecotourists and marine mammal enthusiasts the opportunity to see groups of gray whales as they migrate.

By late December to early January, eastern grays begin to arrive in the calving lagoons of Baja. The three most popular lagoons are Laguna Ojo de Liebre (formerly known in English as Scammon's Lagoon after whaleman Charles Melville Scammon, who discovered the lagoons in the 1850s and hunted the grays),[48][49] San Ignacio, and Magdalena.

These first whales to arrive are usually pregnant mothers looking for the protection of the lagoons to bear their calves, along with single females seeking mates. By mid-February to mid-March, the bulk of the population has arrived in the lagoons, filling them with nursing, calving and mating gray whales.

Throughout February and March, the first to leave the lagoons are males and females without new calves. Pregnant females and nursing mothers with their newborns are the last to depart, leaving only when their calves are ready for the journey, which is usually from late March to mid-April. Often, a few mothers linger with their young calves well into May.

By late March or early April, the returning animals can be seen from Everett, Washington, to Puget Sound to Canada.

A population of about 200 gray whales stay along the eastern Pacific coast from Canada to California throughout the summer, not making the farther trip to Alaskan waters. This summer resident group is known as the Pacific Coast feeding group.[50]

Whaling

North Pacific

Charles Melville Scammon's 1874 illustration of a gray whale

Humans and the killer whale (orca) are the adult gray whale's only predators. Aboriginal hunters, including those on Vancouver Island and the Makah in Washington, have hunted gray whales. The Japanese began to catch gray whales beginning in the 1570s. At Kawajiri, Nagato, 169 gray whales were caught between 1698 and 1889. At Tsuro, Shikoku, 201 were taken between 1849 and 1896.[51] Several hundred more were probably caught by American and European whalemen in the Sea of Okhotsk from the 1840s to the early 20th century.[52] Whalemen caught 44 with nets in Japan during the 1890s. The real damage was done between 1911 and 1933, when Japanese whalemen killed 1,449. By 1934, the western gray whale was near extinction. From 1891 to 1966, an estimated 1,800–2,000 gray whales were caught, with peak catches of 100–200 annually occurring in the 1910s.[52]

Commercial whaling by Europeans of the species in the North Pacific began in the winter of 1845–46, when two United States ships, the Hibernia and the United States, under Captains Smith and Stevens, caught 32 in Magdalena Bay. More ships followed in the two following winters, after which gray whaling in the bay was nearly abandoned because "of the inferior quality and low price of the dark-colored gray whale oil, the low quality and quantity of whalebone from the gray, and the dangers of lagoon whaling."[53]

Gray whaling in Magdalena Bay was revived in the winter of 1855–56 by several vessels, mainly from San Francisco, including the ship Leonore, under Captain Charles Melville Scammon. This was the first of 11 winters from 1855 through 1865 known as the "bonanza period", during which gray whaling along the coast of Baja California reached its peak. Not only were the whales taken in Magdalena Bay, but also by ships anchored along the coast from San Diego south to Cabo San Lucas and from whaling stations from Crescent City in northern California south to San Ignacio Lagoon. During the same period, vessels targeting right and bowhead whales in the Gulf of Alaska, Sea of Okhotsk, and the Western Arctic would take the odd gray whale if neither of the more desirable two species were in sight.[53]

In December 1857, Charles Scammon, in the brig Boston, along with his schooner-tender Marin, entered Laguna Ojo de Liebre (Jack-Rabbit Spring Lagoon) or later known as Scammon's Lagoon (by 1860) and found one of the gray's last refuges. He caught 20 whales.[53] He returned the following winter (1858–59) with the bark Ocean Bird and schooner tenders A.M. Simpson and Kate. In three months, he caught 47 cows, yielding 1,700 barrels (270 m3) of oil.[54] In the winter of 1859–60, Scammon, again in the bark Ocean Bird, along with several other vessels, performed a similar feat of daring by entering San Ignacio Lagoon to the south where he discovered the last breeding lagoon. Within only a couple of seasons, the lagoon was nearly devoid of whales.[53]

Between 1846 and 1874, an estimated 8,000 gray whales were killed by American and European whalemen, with over half having been killed in the Magdalena Bay complex (Estero Santo Domingo, Magdalena Bay itself, and Almejas Bay) and by shore whalemen in California and Baja California.[53] This, for the most part, does not take into account the large number of calves injured or left to starve after their mothers had been killed in the breeding lagoons. Since whalemen primarily targeted these new mothers, several thousand deaths should probably be added to the total.[citation needed] Shore whaling in California and Baja California continued after this period, until the early 20th century.

A second, shorter, and less intensive hunt occurred for gray whales in the eastern North Pacific. Only a few were caught from two whaling stations on the coast of California from 1919 to 1926, and a single station in Washington (1911–21) accounted for the capture of another. For the entire west coast of North America for the years 1919 to 1929, some 234 gray whales were caught. Only a dozen or so were taken by British Columbian stations, nearly all of them in 1953 at Coal Harbour.[55] A whaling station in Richmond, California, caught 311 gray whales for "scientific purposes" between 1964 and 1969. From 1961 to 1972, the Soviet Union caught 138 gray whales (they originally reported not having taken any). The only other significant catch was made in two seasons by the steam-schooner California off Malibu, California. In the winters of 1934–35 and 1935–36, the California anchored off Point Dume in Paradise Cove, processing gray whales. In 1936, gray whales became protected in the United States.[56]

As of 2001, the Californian gray whale population had grown to about 26,000. As of 2011, the population of western Pacific (seas near Korea, Japan, and Kamchatka) gray whales was an estimated 130.[57]

North Atlantic

The North Atlantic population may have been hunted to extinction in the 18th century. Circumstantial evidence indicates whaling could have contributed to this population's decline, as the increase in whaling activity in the 17th and 18th centuries coincided with the population's disappearance.[15] A. B. Van Deinse points out the "scrag whale", described by P. Dudley in 1725, as one target of early New England whalers, was almost certainly the gray whale.[29][30] In his 1835 history of Nantucket Island, Obed Macy wrote that in the early pre-1672 colony, a whale of the kind called "scragg" entered the harbor and was pursued and killed by the settlers.[28] Gray whales (Icelandic sandlægja) were described in Iceland in the early 17th century.[58]

Conservation

Gray whales have been granted protection from commercial hunting by the International Whaling Commission (IWC) since 1949, and are no longer hunted on a large scale.

Limited hunting of gray whales has continued since that time, however, primarily in the Chukotka region of northeastern Russia, where large numbers of gray whales spend the summer months. This hunt has been allowed under an "aboriginal/subsistence whaling" exception to the commercial-hunting ban. Antiwhaling groups have protested the hunt, saying the meat from the whales is not for traditional native consumption, but is used instead to feed animals in government-run fur farms; they cite annual catch numbers that rose dramatically during the 1940s, at the time when state-run fur farms were being established in the region. Although the Soviet government denied these charges as recently as 1987, in recent years the Russian government has acknowledged the practice. The Russian IWC delegation has said that the hunt is justified under the aboriginal/subsistence exemption, since the fur farms provide a necessary economic base for the region's native population.

Currently, the annual quota for the gray whale catch in the region is 140 per year. Pursuant to an agreement between the United States and Russia, the Makah tribe of Washington claimed four whales from the IWC quota established at the 1997 meeting. With the exception of a single gray whale killed in 1999, the Makah people have been prevented from hunting by a series of legal challenges, culminating in a United States federal appeals court decision in December 2002 that required the National Marine Fisheries Service to prepare an Environmental Impact Statement. On September 8, 2007, five members of the Makah tribe shot a gray whale using high powered rifles in spite of the decision. The whale died within 12 hours, sinking while heading out to sea.[59]

As of 2008, the IUCN regards the gray whale as being of "Least Concern" from a conservation perspective. However, the specific subpopulation in the northwest Pacific is regarded as being "Critically Endangered".[2] The northwest Pacific population is also listed as endangered by the U.S. government’s National Marine Fisheries Service under the U.S. Endangered Species Act. The IWC Bowhead, Right and Gray Whale subcommittee in 2011 reiterated the conservation risk to western gray whales is large because of the small size of the population and the potential anthropogenic impacts.[21]

In their breeding grounds in Baja California, Mexican law protects whales in their lagoons while still permitting whale watching.[citation needed] Gray whales are protected under Canada's Species at Risk Act which obligates Canadian governments to prepare management plans for the whales and consider the interests of the whales when permitting development.[citation needed]

Gray Whale migrations off of the Pacific Coast were observed, initially, by Marineland of the Pacific in Palos Verdes, California. The Gray Whale Census, an official Gray Whale migration census that has been recording data on the migration of the Pacific Gray Whale has been keeping track of the population of the Pacific Gray Whale since 1985. This census is the longest running census of the Pacific Gray Whale. Census keepers volunteer from December 1 through May, from sun up to sun down, seven days a week, keeping track of the amount of Gray Whales migrating through the area off of Los Angeles. Information from this census is listed through the American Cetacean Society of Los Angeles (ACSLA).

Threats

According to the Government of Canada's Management Plan for gray whales, threats to the eastern North Pacific population of gray whales include:[60]

  • Increased human activities in their breeding lagoons in Mexico
  • Climate change
  • Acute noise
  • The threat of toxic spills
  • Aboriginal whaling
  • Entanglement with fishing gear
  • Boat collisions
  • Impacts from fossil fuel exploration and extraction

Western gray whales are facing, the large-scale offshore oil and gas development programs near their summer feeding ground, as well as fatal net entrapments off Japan during migration, which pose significant threats to the future survival of the population.[21]

The substantial nearshore industrialization and shipping congestion throughout the migratory corridors of the western gray whale population represent potential threats by increasing the likelihood of exposure to ship strikes, chemical pollution, and general disturbance (Weller et al. 2002).[22]

Offshore gas and oil development in the Okhotsk Sea within 20 km of the primary feeding ground off northeast Sakhalin Island is of particular concern. Activities related to oil and gas exploration, including geophysical seismic surveying, pipelaying and drilling operations, increased vessel traffic, and oil spills, all pose potential threats to western gray whales. Disturbance from underwater industrial noise may displace whales from critical feeding habitat. Physical habitat damage from drilling and dredging operations, combined with possible impacts of oil and chemical spills on benthic prey communities also warrants concern.[22][61]

Captivity

Because of their size and need to migrate, gray whales have rarely been held in captivity, and then only for brief periods of time.

In 1972, a three-month-old gray whale named Gigi (II) was captured for brief study by Dr. David W. Kenney, and then released near San Diego.[62]

In January 1997, the newborn baby whale J.J. was found helpless near the coast of Los Angeles, California, 4.2 m (14 ft) long and 800 kilograms (1,800 lb) in weight. Nursed back to health in SeaWorld San Diego, she was released into the Pacific Ocean on March 31, 1998, 9 m (30 ft) long and 8,500 kilograms (19,000 lb) in mass. She shed her radio transmitter packs three days later.[63]

See also

References

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b Reilly SB, Bannister JL, Best PB, Brown M, Brownell Jr. RL, Butterworth DS, Clapham PJ, Cooke J, Donovan GP, Urbán J & Zerbini AN (2008). "Eschrichtius robustus". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 2013-01-18. 
  3. ^ Recovery Strategy for the Grey Whale (Eschrichtius robustus), Atlantic Population, in Canada. Dsp-psd.pwgsc.gc.ca (2012-07-31). Retrieved on 2012-12-20.
  4. ^ American Cetacean Society Fact Sheet on Gray Whale.
  5. ^ Gray Whale. Worldwildlife.org. Retrieved on 2012-12-20.
  6. ^ Perrin, William F.; Würsig, Bernd G. and Thewissen, J. G. M. (2009). Encyclopedia of marine mammals. Academic Press. p. 404. ISBN 978-0-12-373553-9. 
  7. ^ a b Thomas, Pete (2010-05-10). "Gray whale off Israel called 'most amazing sighting in history of whales'". GrindTV.com. Retrieved 12 May 2010. 
  8. ^ The Paleobiology Database Eschrichtiidae entry accessed on 26 December 2010
  9. ^ Arnason, U., Gullberg A. & Widegren, B. (1993). "Cetacean mitochondrial DNA control region: sequences of all extant baleen whales and two sperm whale species". Molecular Biology and Evolution 10 (5): 960–970. PMID 8412655. 
  10. ^ Sasaki, T. et al. (2005). "Mitochondrial Phylogenetics and Evolution of Mysticete Whales". Systematic Biology 54 (1): 77–90. doi:10.1080/10635150590905939. PMID 15805012. 
  11. ^ Gray (1864). "Eschrichtius". Ann. Mag. Nat. Hist. 3 (14): 350. 
  12. ^ Pyenson, Nicholas D.; Lindberg, David R. (2011). "What Happened to Gray Whales during the Pleistocene? The Ecological Impact of Sea-Level Change on Benthic Feeding Areas in the North Pacific Ocean". In Goswami, Anjali. PLoS ONE 6 (7): e21295. doi:10.1371/journal.pone.0021295. PMC 3130736. PMID 21754984. 
  13. ^ Cope (1869). "Rhachianectes". Proc. Acad. Nat. Sci. Philadelphia 21: 15. 
  14. ^ Cederlund, BA (1938). "A subfossil gray whale discovered in Sweden in 1859". Zoologiska Bidrag Fran Uppsala 18: 269–286. 
  15. ^ a b c Mead JG, Mitchell ED (1984). "Atlantic gray whales". In Jones ML, Swartz SL, Leatherwood S. The Gray Whale. London: Academic Press. pp. 33–53. 
  16. ^ a b Bryant, PJ (1995). "Dating Remains of Gray Whales from the Eastern North Atlantic". Journal of Mammalogy 76 (3): 857–861. doi:10.2307/1382754. JSTOR 1382754. 
  17. ^ Waser, Katherine (1998). "Ecotourism and the desert whale: An interview with Dr. Emily Young". Arid Lands Newsletter. 
  18. ^ "Eschrichtius robustus". Integrated Taxonomic Information System. Retrieved March 18, 2006. 
  19. ^ Erxleben (1777). "Balaena gibbosa". Systema regni animalis: 610. 
  20. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  21. ^ a b c d "Report of the Scientific Committee, Tromsø, Norway, 30 May to 11 June 2011 Annex F: Sub-Committee on Bowhead, Right and Gray Whale". IWC Office. 
  22. ^ a b c d e "Eschrichtius robustus (western subpopulation)". IUCN Red List. 
  23. ^ Alter, SE; Rynes, E.; Palumbi, S. R. (September 2007). "DNA evidence for historic population size and past ecosystem impacts of gray whales". Proceedings of the National Academy of Sciences 104 (38): 15162–15167. doi:10.1073/pnas.0706056104. 
  24. ^ "California Group Seeks Protections For Gray Whale". Santa Cruz Sentinel. November 2010. Retrieved 2011-02-25. 
  25. ^ "Gray Whale Population Studies". NOAA, National Marine Fisheries Service, Southwest Fisheries Science Center, Protected Resource Division. 2010. Retrieved 2011-02-25. 
  26. ^ Rice DW (1998). Marine Mammals of the World. Systematics and Distribution. Special Publication Number 4. Lawrence, Kansas: The Society for Marine Mamalogy. 
  27. ^ Macé M. (2003). "Did the Gray Whale calve in the Mediterranean?". Lattara 16: 153–164. 
  28. ^ a b Macy O (1835). The History of Nantucket:being a compendious account of the first settlement of the island by the English:together with the rise and progress of the whale fishery, and other historical facts relative to said island and its inhabitants:in two parts. Boston: Hilliard, Gray & Co. ISBN 1-4374-0223-2. 
  29. ^ a b Van Deinse, AB (1937). "Recent and older finds of the gray whale in the Atlantic". Temminckia 2: 161–188. 
  30. ^ a b Dudley, P (1725). "An essay upon the natural history of whales". Philosophical Transactions of the Royal Society of London 33 (381–391): 256–259. doi:10.1098/rstl.1724.0053. JSTOR 103782. 
  31. ^ Rugh, David J. and Fraker, Mark A. (June, 1981). "Gray Whale (Eschrichtius robustus) Sightings in Eastern Beaufort Sea". Arctic. Retrieved 2010-07-15. 
  32. ^ צפריר רינת 08.05.2010 16:47 עודכן ב: 16:50. "לווייתן אפור נצפה בפעם הראשונה מול חופי ישראל – מדע וסביבה – הארץ". Haaretz.co.il. Retrieved 2012-06-26. 
  33. ^ "Satellites witness lowest Arctic ice coverage in history". Retrieved 2007-09-14. 
  34. ^ Walker, Matt (30 May 2010). "Mystery gray whale sighted again off Spain coast". BBC News. Retrieved 8 June 2010. 
  35. ^ "Western Pacific Gray Whale, Sakhalin Island 2010". Oregon State University, Marine Mammal Institute. February, 2011. Retrieved 2011-02-25. 
  36. ^ a b c d Rice, D., Wolman, A. and Braham, H. (1984). "The Gray Whale, Eschrichtius robustus". Marine Fisheries Review 46 (4): 7–14. 
  37. ^ a b c Jones, Mary Lou. "The Reproductive Cycle in Gray Whales Based on Photographic Resightings of Females on the Breeding Grounds from 1977–82". Rep. Int. Whal. Comm (t2): 177. 
  38. ^ a b c Swartz, Steven L.; Taylor, Barbara L.; Rugh, David J. (2006). "Gray whale Eschrichtius robustus population and stock identity". Mammal Review 36: 66. doi:10.1111/j.1365-2907.2006.00082.x. 
  39. ^ "GRAY WHALE: ZoomWhales.com". Enchantedlearning.com. Retrieved 2012-06-26. 
  40. ^ Weller et al. 1999. 
  41. ^ Fadeev. 2003. 
  42. ^ Reeves et al. 2005. 
  43. ^ Vladimirov (1994).  Missing or empty |title= (help)
  44. ^ Weller et al. (1999).  Missing or empty |title= (help)
  45. ^ Kato et al. (2006).  Missing or empty |title= (help)
  46. ^ Zhu and Yue (1998).  Missing or empty |title= (help)
  47. ^ Brownell and Chun (1977).  Missing or empty |title= (help)
  48. ^ Davis, T.N. (1979-09-06). "Recovery of the Gray Whale". Alaska Science Forum. Retrieved 2009-01-25. 
  49. ^ Niemann, G. (2002). Baja Legends. Sunbelt Publications. pp. 171–173. ISBN 0-932653-47-2. 
  50. ^ Lang, A. (January 19, 2011). "Demographic distinctness of the Pacific Coast Feeding Group of Gray Whales (Eschrictius robustus)". NOAA Fisheries Service, Protected Resource Division, Southwest Fisheries Science Center. Retrieved 2011-02-25. 
  51. ^ Kasuya, T. 2002. Japanese whaling, in Encyclopedia of Marine Mammals. W. F. Perrin, B. Wursig, and J.G.M. Thewissen, eds. San Diego: Academic Press, pp. 655–662.
  52. ^ a b Weller, D. et al (2002). The western gray whale: a review of past exploitation, current status and potential threats 4 (1). J. Cetacean Res. Manage. pp. 7–12. 
  53. ^ a b c d e Henderson, David A. (1972). Men & Whales at Scammon’s Lagoon. Los Angeles: Dawson’s Book Shop. 
  54. ^ Scammon, Charles Melville, and David A. Henderson (1972). Journal aboard the bark Ocean Bird on a whaling voyage to Scammon’s Lagoon, winter of 1858–59. Los Angeles: Dawson’s Book Shop. 
  55. ^ Tønnessen, Johan; Arne Odd Johnsen (1982). The History of Modern Whaling. University of California Press, Berkeley. ISBN 0-520-03973-4. 
  56. ^ Brownell Jr., R. L. and Swartz, S. L. 2006. The floating factory ship California operations in Californian waters, 1932–1937. International Whaling Commission, Scientific Committee.
  57. ^ [1][dead link]
  58. ^ Jón Guðmundsson lærði 1966. Ein stutt udirrietting um Íslands adskiljanlegu náttúrur. ed. Halldór Hermannsson, Cornell University Library, Ithaca, New York.
  59. ^ Mapes, Lynda V.; Ervin, Keith (2007-09-09). "Gray whale shot, killed in rogue tribal hunt". The Seattle Times. 
  60. ^ Minister of Fisheries and Oceans (2008). Species at Risk Management Plans. Ottawa: SARA Public Registry. p. 58 http://www.pac.dfo-mpo.gc.ca/consultation/fisheries-peche/mamm-mar/mm-man-gest/grey-grises/docs/2008-04-08-eng.pdf.  Missing or empty |title= (help)[dead link]
  61. ^ Reeves et al (2005).  Missing or empty |title= (help)
  62. ^ "Captured Gray Whale to Be Freed, Tracked", The Los Angeles Times (1972-03-13), p. B2.
  63. ^ J.J. the Gray Whale. Seaworld.org. Retrieved on 2012-12-20.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly known as E. gibbosus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!