Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"Thirty-one of the 48 sightings of Stejneger's beaked whale have come from Alaskan waters. It is suspected this species favors deep waters, including the Aleutian Trench and the Aleutian Basin, which is some 3,500 m deep, rather than the shallow waters of the Bering Sea. The whales were seen traveling in groups of 5-15; some individuals were large and some were small.  This species is also known as the sabre-toothed beaked whale, hinting at the shape of the adult male's teeth."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: True, F.W., 1885.  Contributions to the history of the Commander Islands. No. 5-Description of a new species of Mesoplodon, M. Stejnegeri, obtained by Dr. Leonard Stejneger, in Bering Island, 8:585.  Proceedings of theU.S. National Museum, 8:584-585.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Species description

Stejneger's beaked whales, sometimes known as the "Bering Sea beaked whale" or the "Saber-toothed whale," are little known members of the beaked whale family (Ziphiidae). As adults, Stejneger's beaked whales can reach lengths of about 18.5 ft (5.7 m) and weigh up to 3,520 lbs (1,600 kg). Females may be slightly larger than males. Males can be easily distinguished from females and juveniles by a pair of large, visible, forward-pointing tusk-like teeth that erupt from the arched lower jaw. Females and juveniles have teeth as well, but they remain hidden beneath the gum tissue of the mouth, and their jawline is generally less-curved. This species of beaked whale is difficult to observe and identify at sea due to a low profile at the surface and a small inconspicuous blow.

Stejneger's beaked whales have a relatively medium-sized, round body with a small wide-based, slightly "falcate" dorsal fin located far down (about two-thirds) the animal's back. The whale's head has a low sloping forehead and indistinct melon. Their coloration varies from dark gray to brownish and black. There is a dark cap that extends across the top of the head from eye to eye and the lower jaw is usually white or pale gray. The skin may be covered with linear and oval-shaped scars and other markings. Individuals, especially mature males, accumulate more scars and scratches with age. Mature males often will battle one another for access to females.

Stejneger's beaked whales are usually found singly or in small, tight social groups averaging between 3-15 individuals. These groups may contain animals of mixed sexes, ages and life stages, or can be segregated. Like most beaked whales, this species is difficult to approach and generally avoids vessels.

Stejneger's beaked whales usually make 5-6 shallow dives followed by a longer dive that lasts 10-15 minutes and may reach depths of 4,920 ft (1,500 m) (Shirihai and Jarrett 2006). While diving, they use suction to feed on small deep-water fish, tunicates, and cephalopods (e.g., squid) of the families Gonatidae and Cranchiidae in deep "mesopelagic" and "bathypelagic" waters.

Stejneger's beaked whales may become sexual mature when they reach about 14.8 ft (4.5 m) in length. A sexually mature female will give birth to a single calf that is about 7.5-8 ft (2.3-2.5 m) long and weighs about 175 lbs (80 kg). The calving season is generally between spring and autumn. The estimated lifespan of this species is at least 36 years.

Many species of beaked whales (especially those in the genus Mesoplodon) are very difficult to distinguish from one another (even when dead). At sea, they are challenging to observe and identify to the species level due to their cryptic, skittish behavior, a low profile, and a small, inconspicuous blow at the waters surface; therefore, much of the available characterization for beaked whales is to genus level only. Uncertainty regarding species identification of beaked whales often exists because of a lack of easily discernable or distinct physical characteristics.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Unknown

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Cold temperate to subarctic North Pacific (based on stranding records); apparently distributed across much of the southern Bering Sea, south to the northern Sea of Japan and to Monterey, California; strandings are fairly common in the Aleutians (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Stejneger's beaked whales are found in continental slope and oceanic waters of the North Pacific Basin, from southern California, north to the Bering Sea, and south to the Sea of Japan (presumably including at least the southern Okhotsk Sea – Mead 1989; MacLeod et al. 2006). This appears to be primarily a cold temperate and sub-arctic species, and this is probably the only species of the genus common in Alaskan waters. It is most commonly stranded in Alaska, especially along the Aleutian Islands. Also, there have been a large number of strandings (at least 34) from along the Sea of Japan coast of Japan, and many fewer along the Pacific coast. The large peak in strandings in this area in winter and spring suggests that the species may migrate north in summer (Mead 1989; Yamada 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mesoplodon stejnegeri ranges from the Bering Sea to California and Japan, inhabiting only the cool temperate waters of the Northern Pacific Ocean.

Biogeographic Regions: pacific ocean (Native )

  • Nowak, R. 1999. Walker's Mammals of the World, 6th Edition. Baltimore and London: The Johns Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stranding Distribution



Distributed throughout the cold temperate and subarctic waters of the North Pacific. On the eastern side of the North Pacific its distribution ranges from Saint Paul Island to southern California, with a majority of stranding records reported from the Alaskan coastlines. In the west it ranges from the Commander Islands to Japan. The center of its distribution seems to be the Aleutian Islands, where it has been known to strand in small groups. It is more likely that that this species frequents the Aleutian Basin and the Aleutian Trench rather than the shallow waters of the northern or eastern Bering Sea. Presence of Isistius scars suggests its movements are not restricted to cold temperate waters, but include temperate waters of North Pacific latitudes 38oN and lower where the Isistius populations are at greatest abundance.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian National Museum of Natural History Marine Mammal Project

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Stejneger's beaked whales have a distribution throughout the North Pacific that includes California, the Aleutian Islands, southwest Bering Sea, Kamchatka, Okhotsk Sea, and the Sea of Japan. Strandings of this species have commonly occurred in the Aleutian Islands of Alaska and on the west coasts of Japan. Scientists speculate that this species may migrate north in the summer (Jefferson et al. 2008). Information on the distribution of these whales mostly comes from stranding records.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Mesoplodon stejnegeri ranges in length from 3 to 7 m, although they are generally longer than 5.3 m. Females are normally longer than males, and the crania of females are larger than those of males.

Both sexes are uniformly gray to black, with light pale countershading ventrally, although males tend to be more uniformly dark.

Mesoplodon stejnegeri is distinguished from other Mesoplodons by tooth shape and position. Members of this species have two large, exposed, tusk-like teeth on the lower jaw (Nowak 1999). These teeth are also distinctively larger in males.

Scarring, which is present on most M. stejnegeri, results from intraspecific fighting over mates, and is inflicted by the teeth while the mouth is closed (Ridgway and Harrison 1989).

Range length: 3 to 7 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful; ornamentation

  • Ridgway, S., S. Harrison. 1989. Handbook of Marine Mammals, Volume 4: River Dolphins and the Larger Toothed Whales. New York: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tooth morphology

Tooth position

A single pair of teeth is positioned immediately ahead of the apex of the arch on the mouthline and are inclined anteriorly.

Tooth exposure

In adult males, nearly all the tooth that erupts from the lower jaw is exposed above the gumline. Teeth do not erupt above the gumline in females or juveniles.

Tooth shape

The anterior edge of the tooth is longer than the posterior.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian National Museum of Natural History Marine Mammal Project

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Skull morphology

Diagnostic features of the skull and mandible

On the vertex of the dorsal skull the premaxillary bone extends forward of the nasal and frontal bones. Separates from Berardius and Ziphius.

A sulcus (groove) running along the middle of the combined surfaces of the nasal bones so depresses their combined middle that it is the lateral portion of each nasal bone that reaches farthest forward on the vertex. Separates from Tasmacetus and Indopacetus.

When the skull is upright and the long axis of the anterior half of the beak is horizontal, a horizontal plane transecting the summit of either maxillary prominence transects the mesethmoid bone. Separates from Hyperoodon.

Tooth alveoli of mandible are posterior to the mandibular symphysis. Separates from Berardius, Ziphius, Tasmacetus, Indopacetus, Hyperoodon, M. bowdoini, M. bidens, M. carlhubbsi, M. grayi, M. europaeus, M. hectori, M. layardii, M. mirus, M. perrini, and M. traversii.

Right premaxilla extends posteriorly beyond the right nasal a distance exceeding 70% of dorsal length of right nasal. Separates from M. ginkgodens.

Antorbital notches form obtuse angles. Separates from M. peruvianus.

A transverse plane perpendicular to the long axis of the rostrum and transecting the apex of the left antorbital notch, very nearly also transects the anterior most point reached by the pterygoid sinus. Separates from M. densirostris.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian National Museum of Natural History Marine Mammal Program

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

External morphology

Head Shape

The melon is flattened compared to other Mesoplodon species. The melon slopes smoothly onto the medium length beak. The mouthline curves upward posteriorly, forming a prominent arch.

Coloration

Males are gray to black over a majority of their bodies. The head has a prominent black cap on dorsal surface encompassing the blowhole and converging laterally to encompass the eye. The flipper pocket is also darker than surrounding skin. Females and juveniles are dark brownish-grey dorsally with lateral areas grading to a much lighter ventral coloration. The head has a prominent black cap on dorsal surface encompassing the blowhole and converging laterally to encompass the eye. The flipper pocket is also darker than surrounding skin.

The ventral surface of the flukes may exhibit concentric, striations that radiate out laterally from insertion of caudal peduncle. These striations can vary from light gray to white. Diffuse mottling or spotted pigmentation may occur on the ventral body surface from the throat region to the caudal peduncle. These markings are consistent with scars caused by Penella sp. and / or the cookie cutter shark, Isistius brasiliensis. Penella sp. causes small 1-2 cm diameter punctate scars, while Isistius bites lightly pigmented circular to oval shaped scars 4-8 cm in diameter. Isistius scars are generally concentrated on the posterior half of body.

Size

Adult body length ranges between 5 to 6 m. Recorded maximum body length for adult males and females is 6.0 m and 5.4 m, respectively. Body length at birth is 2.2 m.

Most Likely Confused With:

Mesoplodon carlhubbsi

Mesoplodon densirostris

Mesoplodon ginkgodens

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian National Museum of Natural History Marine Mammal Program

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 500 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: up to 5.3 m

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Mesoplodon stejnegeri True, 1885
Catalog Number: USNM A21112
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): L. Stejneger
Year Collected: 1883
Locality: Bering Island, Commander Islands, Kamchatka, Russia, Bering Sea, Asia, North Pacific Ocean
  • Type: True, F. W. 1885. Proceedings of the United States National Museum. 8: 584-585.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Has been observed in waters 730-1560 m deep on the steep slope of the continental shelf as it drops off into the Aleutian Basin (Loughlin et al., 1982, J. Mamm. 63:697-700).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

cold temperate and subarctic, oceanic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Stejneger's beaked whale ranges in subarctic waters, mostly beyond the edge of the continental shelf, in slope and oceanic waters (Houston 1990; Loughlin and Perez 1985). They are presumably deep divers, feeding in the mesopelagic and bathypelagic zones, mainly on squids of the families Gonatidae and Cranchiidae. Examination of stomach contents supports this idea (e.g., Yamada et al. 1995).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Stejneger's beaked whales, Mesoplodon stejnegeri, inhabit the deep waters of the ocean far from the shorelines. These animals are rarely seen at sea. They prefer a habitat with cool water. Mesoplodon stejnegeri has been observed living sympatrically with Hubb's beaked whales where the ranges of the two species overlap off the coast of northern Japan to Oregon and British Columbia.

Habitat Regions: temperate ; saltwater or marine

Aquatic Biomes: pelagic

  • Loughlin, T., M. Perez. 13 December 1985. Mesoplodon stejnegeri. Mammalian Species, No. 250: pp. 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat

Stejneger's beaked whales prefer the cold temperate and subarctic waters of the North Pacific Ocean. They are generally found in deep, offshore waters from 2,500-5,000 ft (750-1,500 m), on or beyond the continental slope (Reeves et al. 2002).

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes squid.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Mesoplodon stejnegeri feeds primarily on deep-water squid. The diet includes both cephalopods and fish. A school of salmon was observed being chased by M. stejnegeri off the coast of Japan, and this species is sometimes trapped in salmon driftnets.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Has been observed in groups of up to 15 individuals of various sizes (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Nothing is known about the reproduction of M. stejnegeri, although it is speculated that litter size is one and parturition occurs in the spring and summer.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Although parental investment in this species has not been documented, because these animals are mammals we can infer that females provide a great deal of parental care. They are likely to provide their young with protection as well as food, in the form of milk, until the calves are able to care for themselves.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Loughlin, T., M. Perez. 13 December 1985. Mesoplodon stejnegeri. Mammalian Species, No. 250: pp. 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mesoplodon stejnegeri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCTTGTACCTACTATTTGGTGCCTGAGCAGGAATAGTGGGCACTGGCCTAAGCTTATTAATTCGTGCTGAATTAGGTCAACCTGGCACATTAATTGGAGATGACCAAGTTTATAATGTACTAGTAACAGCCCACGCCTTCGTAATAATTTTTTTCATAGTTATGCCTATTATAATCGGCGGGTTTGGAAACTGATTAGTCCCTTTAATAATTGGATCACCCGATATAGCCTTTCCTCGTATAAACAACATAAGCTTCTGACTACTTCCCCCTTCCTTCCTACTACTAATAGCATCCTCAATAATTGAAGCTGGTGCAGGCACAGGCTGAACTGTATATCCCCCTTTAGCTGGAAATCTAGCACATGCAGGAGCCTCTGTCGATCTTACTATTTTTTCCCTACACTTAGCAGGTGCATCTTCAATTTTAGGAGCTATTAACTTTATTACAACTATTATTAATATAAAACCTCCCGCTATAACTCAATATCAAACACCTTTATTCGTATGATCGATCCTAGTTACAGCAGTACTACTTCTACTGTCACTACCTGTTCTAGCAGCTGGAATTACTATACTATTAACAGACCGAAATCTAAATACAACCTTTTTTGACCCTGCAGGTGGGGGAGACCCAATCCTATATCAACATCTTNNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mesoplodon stejnegeri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NU - Unrankable

United States

Rounded National Status Rank: N2 - Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Occurs in cold temperate to subarctic North Pacific (based on stranding records); believed to be vulnerable to incidental take in gill nets, but there is little information available on the extent of such mortality.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Contributor/s

Justification
There is no information on global abundance or trends in abundance for this species. It is not believed to be uncommon but it is potentially vulnerable to low-level threats and a 30% global reduction over three generations cannot be ruled out (criterion A).

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These whales are a conservation concern. They are listed as Appendix II by CITES, and Data deficient by IUCN.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are no estimates of abundance, but the species does not seem to be rare, especially off the Aleutian Islands and in the Sea of Japan. It has been hypothesized that there may be a resident subpopulation in the Sea of Japan and southern Okhotsk Sea (Yamada 1997, Kakuda and Yamada 2001).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population trends

Population Trends

For management purposes, Stejneger's beaked whales inhabiting U.S. waters have been placed in the Alaska Stock and California/Oregon/Washington Stock. The estimated population for Mesoplodon spp. (Blainville's, Perrin's, Pygmy, Gingko-toothed, Hubb's, and Stejneger's beaked whales) in the California/Oregon/Washington stock is 575-1,000 animals. No current population estimates are available for this species of beaked whale and the status of the stocks is unknown. Scientists suggest that resident populations of this species may inhabit the southern Okhotsk Sea and the Sea of Japan. There are insufficient data to determine population trends for this species.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Believed to be vulnerable to incidental take in gill nets, but there is little information available on the extent of such mortality (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Stejneger's beaked whales were hunted in a Japanese fishery, along with Cuvier’s beaked whales. They are not presently the main targets of any hunt.

In the past, some individuals were taken in the Japanese salmon driftnet fishery in the Sea of Japan and in driftnets off the west coast of North America. Entanglement in fishing gear, especially gillnets in deep water, is probably the most significant threat.

This species, like other beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

As a cold water species, Stejneger’s beaked whale may be vulnerable to the effects of climate change as ocean warming may result in a contraction of the species range as it tracks the occurrence of its preferred water temperatures (Learmonth et al. 2006). The effect of such changes in range size on this species is unknown.

Evidence from stranded individuals of several similar species indicates that they have swallowed discarded plastic items, which may eventually lead to death (e.g. Scott et al. 2001); this species may also be at risk.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Incidental take/ bycatch in the driftnet and gillnet fisheries in the Sea of Japan and off the west coast of North America

Hunted in a Japanese fishery targeting beaked whales

Marine debris, they are known to have ingested dangerous items such as plastic bags and string (Jefferson et al. 2008)

Underwater sounds and anthropogenic noise may be harmful

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES. Research is needed to determine the impacts of potential threatening processes on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The meat of M. stejnegeri is considered palatable when cooked, but the Makah Indians of Washington reported cases of diarrhea after eating the blubber and flesh. Commercial fisheries, primarily in Japan, take a small number of M. stejnegeri yearly.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Stejneger's beaked whale

Stejneger's beaked whale!<-- This template has to be "warmed up" before it can be used, for some reason -->

Stejneger's Beaked Whale (Mesoplodon stejnegeri), sometimes known as the Bering Sea Beaked Whale or the Saber-toothed Whale is a poorly-known member of the genus Mesoplodon. Leonhard Hess Stejneger initially described the species in 1885 from a skull, and nothing more of the species was known for nearly a century. The late 1970s saw several strandings, but it was not until 1994 that the external appearance was described from fresh specimens. The most noteworthy characteristic of the males is the very large, saber-like teeth, hence the name.

Contents

Description

The body for this species is rather typical for a Mesoplodont, long and tapering at both ends. The beak of the whale is of medium length, and the mouthline forms an arch, though much smoother than other species. The teeth of the males are much larger than those of most other Mesoplodonts and point forwards and inwards right in front of the apex. Only Layard's beaked whale and the Spade Toothed Whale have longer teeth. The coloration is overall dark gray to black on the body with light coloration below, and around the head giving it a "helmeted" appearance. The coloration darkens with age, but females have a light pattern on the bottom of the flukes which become more apparent with age. Like most species, scars occur on the males (from other males) and cookie cutter shark bites are present on both sexes. The length is at least 5.25 meters (17 feet 6 inches) for males and 5.5 meters (18 feet) for females. They are likely around 2.1 to 2.3 meters long (7 to 8 feet) when born.

Population and distribution

This is the northernmost species of Beaked Whale in the Pacific Ocean, ranging up into the Bering Sea. They are distributed along both sides of the Pacific to Miyagi Prefecture, Japan and Monterey, California. They may migrate south in winter. As with most species of beaked whales, no population estimates have been made.

Behavior

The whales are typically found in groups of 3 to 4 and sometimes up to 15 animals in a very close group. The groups may have age and sex segregation. Adult males fight each other extensively, and some specimens have been found with healed jaw fractures.

Conservation

This species has been occasionally hunted in Japan in the past, and occasionally been caught in driftnets. It is uncertain how much this affects the population.

References

  1. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Mesoplodon stejnegeri. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 24 March 2009. Database entry includes a brief justification of why this species is of data deficient.

Sources

  • Encyclopedia of Marine Mammals. Edited by William F. Perrin, Bernd Wursig, and J.G.M Thewissen. Academic Press, 2002. ISBN 0-12-551340-2
  • Sea Mammals of the World. Written by Randall R. Reeves, Brent S. Steward, Phillip J. Clapham, and James A. Owell. A & C Black, London, 2002. ISBN 0-7136-6334-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Notes

Did you know?

• Stejneger's beaked whales receive their common and scientific name from Leonhard Stejneger, who was a naturalist and curator at the Smithsonian Institution, after he described the species from a single skull discovered on Bering Island in 1885 (Reeves et al. 2002).

• Male Stejneger's beaked whale's have an unusually shaped lower jaw and huge tusk-like teeth.

Public Domain

Supplier: J Medby

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Jones et al. (1992), Rice (1998), and Mead and Brownell (in Wilson and Reeder 1993, 2005) recognized M. carlhubbsi, M. bowdoini, and M. stejnegeri as separate species.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!