Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

The northern bottlenose whale is the only species of the genus Hyperoodon that lives in the North Atlantic, but there is an unidentified species of whale living in the North Pacific that may turn out to belong to this genus. The northern bottlenose whale has a long, tube-like snout, different in shape from the beaked face of the other whales of the ziphiid family. This species prefers deep water and may avoid shallows. It has been caught in nets at depths below 1,000 m and has been known to stay submerged for up to two hours. In the Arctic Ocean, the whales stay near the boundaries between cold polar currents and warmer Atlantic currents, where the food supply is rich. Squid and a variety of fish make up most of their diet. Their growth pattern has been measured by counting annual growth rings that appear naturally in their teeth, much like tree growth rings. Males reach full size at 20 years and females, which tend to be smaller, at 15 years. Life span is estimated to be at least 37 years.

Links:
Mammal Species of the World
  • Original description: Forster, 1770.  In Kalm, Travels into North America, 1:18.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

This species is highly inquisitive and frequently approaches boats. This has made them more susceptible to scientific study, whale watching and unfortunately hunting than the other beaked whales (2). This is a social species that travels in groups of four to ten members strong (5) (7). They feed on deep-water squid, as well as other invertebrates and various fish species (2), using sonar to detect their prey; when hunting they dive to depths of 1,000 metres or more (2). This species is unusual as it spends the whole year in cold water, and does not make seasonal migrations like most other whales (2). The average life span of this whale is thought to be somewhere between 30 and 40 years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The northern bottlenose whale has a bulbous forehead and an obvious tube-like beak, these features are more pronounced in older male individuals (2). The specific part of the scientific name, ampullatus, means 'flask' and refers to the bottle-like shape of the head (5). Young individuals are dark on the dorsal surface (back) with a light belly, and become paler as they age (6). In males a whitish patch develops on the forehead, which becomes larger as the male gets older (6). The robust body is spindle-shaped, and the dorsal fin is triangular (7) and placed far behind centre. Northern bottlenose whales have two teeth on the lower jaw; these only erupt on males (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Hyperoodon ampullatus is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth (rather than baleen). It is a member of the beaked whale family with the characteristic V-shaped crease on the throat and the short dorsal fin set relatively far back. The Northern bottlenose whale is a large beaked whale that can reach up to 10 m in length. The lower jaw has a single pair of teeth (exposed only in adult males). It has a very distinct beak and a very steep, often bulbous forehead. It has a dark grey to chocolate brown dorsal and lateral colouration and somewhat lighter below. Much of the face may be light grey in colour. Adults are often covered with scratches and scars.The northern bottlenose whale may be confused with Cuvier's beaked whale Ziphius cavirostris but can be recognised by having a very distinct beak and a very steep, often bulbous forehead. Northern bottlenose whales are usually found in small pods of 4 to 35 individuals, with some degree of either age or sex segregation. It can be seen, on occasion, to leap clear out of the water. Dives may last up to 2 hours long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, Northern North Atlantic, Portuguese Exclusive Economic Zone, Spanish Exclusive Economic Zone, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Northern bottlenose whales are found only in the North Atlantic, from New England, USA to Baffin Island and southern Greenland in the west and from the Strait of Gibraltar to Svalbard in the east (c. 38ºN to 72ºN; Mead 1989; Gowans 2002). There are reports from the Mediterranean Sea (Cañadas and Sagarminaga 2000), and some extra-limital records from the Baltic Sea. The best-known subpopulation of the northern bottlenose whale, the best known of all beaked whales, occurs in the waters over “The Gully,” a large submarine canyon off Nova Scotia, Canada (44ºN, 59ºW; Reeves et al. 1993). However, there have been strandings and at least one sighting as far south as North Carolina in the western Atlantic (Mead 1989). The Gully is the southernmost area of consistent northern bottlenose whale presence in the western Atlantic (Wimmer and Whitehead 2004). In the eastern Atlantic, bottlenose whales are occasionally observed off the Azores (Steiner et al. 1998), and have been seen as far south as the Cape Verde Islands (15ºN; Ruud 1937). The pelagic distribution extends from the ice edges south to approximately 30°N.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of Hyperoodon ampullatus (the northern bottlenose whale) extends from the polar ice of the North Atlantic southwest to Long Island Sound and southeast to the Cape Verde Islands.

Biogeographic Regions: atlantic ocean (Native )

  • MacDonald, D. 1987. The Encyclopedia of Mammals. New York, New York: Facts on File Publications.
  • Minasian, S., K. Balcomb, L. Foster. 1984. The World's Whales. Washington, D.C.: Smithsonian Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern East and West Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Deep arctic and cooler temperate waters of the North Atlantic, from Nova Scotia to about 70 degrees N in Davis Strait, along the east coast of Greenland to 77 degrees N, and from the United Kingdom to the west coast of Spitzbergen (IUCN 1991). Strandings have occurred south in the western Atlantic to Rhode Island. The Gully southeast of Sable Island and the northern Labrador Sea near the entrance to Hudson Strait are areas of known concentration (Leatherwood and Reeves 1983, Reeves and Mitchell 1993). Has strayed to the Mediterranean (Mead and Brownell, in Wilson and Reeder 1993), the White Sea, and the North Sea (IUCN 1991). Remains widely distributed and locally abundant in some areas (Reeves and Mitchell 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in the north Atlantic only. In the UK it occurs in small numbers around the Northern and Western Isles of Scotland, the northern North Sea and along the continental shelf break to the west of Ireland. It is observed most frequently off western Norway and the Barents Sea (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Individuals of this species can reach up to 9.8m in length, but most are around 6.7-7.6m at the age of sexual maturity (7-14 years). They are sexually dimorphic, with males being up to 25% larger than females. The size of individuals in the Gully population (off Nova Scotia) is believed to be some 0.7m shorter than that of other Northern bottlenose whales. Individual whales may live up to 37 years (Herman 1980, MacDonald 1987, Whitehead et al. 1997a).

Northern bottlenose whales are varied in color, ranging from greenish-brown to chocolate and gray. Individuals may be blotted with patches of grayish-white and coloration is generally lighter on the flanks and underbelly, fading to a white or cream color. Young calves are generally chocolate colored in appearance (Evans 1987, Tinker 1988).

The body is long, robust and cylindrical and the beak is short, resembling a bottle in shape. Both sexes have large, protruding melons that are often vertical anteriorly in older animals and turn yellowish-white with age in males. The melon of the female is not as prominent as that of the male.The posteriorly-curved dorsal fin is 30-38cm in height and is located at a distance of 1/3 the total body length from the tail. The tail fluke lacks a medial notch and the flippers are small and pointed (Minasian et al. 1984, Tinker 1988).

The dentition of the species is highly reduced, with males possessing one or occasionally two pairs of short teeth in the tip of the lower jaw. These teeth never erupt in females, may never fully erupt in males, and often fall out with age (Minasian et al. 1984).

Range mass: 5800 to 7500 kg.

Range length: 9.8 (high) m.

Sexual Dimorphism: male larger

  • Herman, L. 1980. Cetacean Behavior: Mechanisms and Functions. Malabar, Florida: Robert E. Krieger Publishing Company.
  • Whitehead, H., A. Faucher, S. Gowans, S. McCarrey. 1997a. Status of the Northern Bottlenose Whale, Hyperoodon ampullatus, in The Gully, Nova Scotia. The Canadian Field-Naturalist, 111: 287-292.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 9100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 9-9.5 m males; 8-8.5 m females

Weight:
Average: 10,000 kg males; 7,500 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

Varied in color, ranging from greenish-brown to chocolate and gray. Individuals may be mottles with patches of grayish-white. Coloration is generally lighter on the flanks and underbelly, fading to a white or cream color.The beak is short and cylindrical, resembling a bottle in shape. Both sexes have large, protruding melons that are often vertical anteriorly in older animals and turn yellowish-white with age in males. The melon of the female is not as prominent as that of the male.The posteriorly-curved dorsal fin is 30-38cm in height and is located at a distance of 1/3 the total body length from the tail. The tail flukes lack a medial notch, and the flippers are small and pointed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
These cold temperate to subarctic whales are found in deep waters, mostly seaward of the continental shelf (and generally over 500-1,500 m deep) and near submarine canyons. They sometimes travel several kilometers into broken ice fields, but are more common in open water. Few whales were caught in shallow waters over the continental shelf off Labrador and in waters less than 1000 m deep off the west coast of Norway.

The species occupies a very narrow niche; the primary food source is squid of the genus Gonatus (Hooker et al. 2001; Whitehead et al. 2003). The whales may also occasionally eat fish (such as herring and redfish), sea cucumbers, starfish, and prawns. They do much of their feeding on or near the bottom in very deep water (> 800 m, and as deep as 1,400 m; Hooker and Baird 1999).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

H. ampullatus is most commonly found in waters at least 1000m deep and often forages at or near the north atlantic ice shelf in sheltered embayments during the spring and summer.

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Reeves, R., E. Mitchell, H. Whitehead. 1993. Status of the Northern Bottlenose Whale, Hyperoodon ampullatus. The Canadian Field-Naturalist, 107: 490-508.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

cold temperate to subarctic, oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

deep waters offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 78 specimens in 1 taxon.
Water temperature and chemistry ranges based on 62 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.580 - 22.450
  Nitrate (umol/L): 0.303 - 9.648
  Salinity (PPS): 31.475 - 36.512
  Oxygen (ml/l): 5.034 - 7.861
  Phosphate (umol/l): 0.051 - 0.736
  Silicate (umol/l): 0.913 - 5.167

Graphical representation

Temperature range (°C): 1.580 - 22.450

Nitrate (umol/L): 0.303 - 9.648

Salinity (PPS): 31.475 - 36.512

Oxygen (ml/l): 5.034 - 7.861

Phosphate (umol/l): 0.051 - 0.736

Silicate (umol/l): 0.913 - 5.167
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Cold temperate to arctic marine waters, often in water 1000 m or more in depth; ice edges and broken pack ice (Leatherwood and Reeves 1983). Cold, deep water along and seaward of the edge of the continental shelf (Reeves and Mitchell 1993, Reeves et al. 1993). Sometimes penetrates up to several miles into ice-covered areas but more frequently occurs in open ocean. Young are born in the water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 The northern bottlenose whale is an offshore species. It may be seen breathing at the surface or diving down to a depth of up to 1,000 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This whale is a cold-temperate to sub-arctic species and prefers deep waters off the continental slope (4), and normally occurs in water deeper than 1,000 metres (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Moves northward to edge of pack ice in Davis Straight in spring and summer (Leatherwood and Reeves 1983). In the eastern Atlantic, moves northward April-July, southward July-September (see IUCN 1991). In general, migratory movements are poorly documented (Reeves and Mitchell 1993, Reeves et al. 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hyperoodon ampullatus feeds primarily on squid (e.g. Gonatus fabricii), although sea cucumbers (Holothuroidea), herring (Clupea harrengus), cuttlefish (Sepiidae), sea stars (Asteroidea), and other benthic invertebrates supplement the diet. Utilizing a feeding method similar to that of Physeter macrocephalus (the sperm whale), northern bottlenose whales make deep, sustained dives to capture prey. Dives last up to 70min and diving depths range from 80 to 800m with a maximum recorded dive depth of 1453m. Breathing intervals of 10min are common between deep dives and individuals frequently resurface in close proximity to where a dive began (Herman 1980, Hooker and Baird 1999, Minasian et al. 1984, Reeves 1993, Walker 1975).

Animal Foods: fish; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Easts mainly squid, also sometimes herring, sea stars, and other bottom invertebrates and deep water fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Frequently found traveling in groups of 5-15, also in pairs or singly. According to IUCN (1991), occurs most frequently in groups of 2-4. Approaches ships, may remain with wounded companions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
37.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 37 years (wild) Observations: Longevity is estimated to be at least 37 years, but probably longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of Hyperoodon ampullatus is believed to be polygynous, with a single mature male associating with a group of females during the mating season.

Mating System: polygynous

Females become sexually mature at a length of 6.7-7m (8-14 years) and males reach maturity at 7.3-7.6m (7-9 years) (Evans 1987, MacDonald 1987, Minasian et al. 1984).

Mating occurs in spring and early summer and calves are born from April to June. Data from the Gully population near Nova Scotia indicates that the mating and calving period for this population may be from June to August. The gestation period for all Northern bottlenose whales is around twelve months and females exhibit a calving interval of two to three years. (Whitehead et al. 1997a, MacDonald 1987, Reeves et al. 1993, Tinker 1988).

Breeding interval: Females exhibit a calving interval of two to three years

Breeding season: Mating occurs in spring and early summer

Average gestation period: 12 months.

Average weaning age: 12 months.

Range age at sexual or reproductive maturity (female): 8 to 14 years.

Range age at sexual or reproductive maturity (male): 7 to 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average gestation period: 365 days.

Average number of offspring: 1.

Calves are around 3.5m in length at birth and weaning occurs at around one year of age.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding and parturition occur in spring. Gestation lasts about 1 year. Litter size is 1. Calves are weaned after a year or more. Interval between pregnancies probably is 2-3 years (mean probably 2). Minimum age at sexual maturity is 7-11 years. Maximum known longevity apparently is 27 years in females, 37 years in males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hyperoodon ampullatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGCTGACTATTCTCAACTAACCACAAAGACATTGGCACTCTATACTTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACTGGCCTAAGCTTATTAATCCGCGCTGAACTAGGTCAGCCTGGCATACTAATCGGAGATGACCAAGTTTATAACGTACTAGTAACAGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATACCCATCATGATCGGTGGATTTGGGAATTGGTTAGTTCCTTTAATAATTGGATCTCCCGATATAGCCTTCCCCCGTATAAACAACATAAGTTTCTGATTACTTCCCCCCTCCTTCCTACTACTAATAGCATCCTCAATAATTGAAGCTGGCGCAGGCACAGGTTGAACTGTATATCCTCCCTTAGCTGGAAACCTAGCACATGCAGGAGCTTCAGTCGACCTTACCATTTTCTCTTTACACTTAGCAGGTGCATCCTCAATTCTAGGGGCCATTAACTTCATTACAACTATTATCAACATAAAACCCCCCGCTATAACTCAATACCAAACACCCCTATTCGTATGATCAGTCCTAGTCACAGCAGTGTTACTCCTACTATCACTACCTGTTCTAGCAGCTGGAATTACTATACTATTAACTGACCGAGACTTAAACACAACCTTCTTTGATCCTGCAGGAGGAGGAGACCCAATTCTATACCAACATCTCTTCTGATTCTTCGGCCACCCCGAAGTATACATTCTGATTCTACCGGGCTTTGGGATAATCTCACACATCGTAACCTACTATTCAGGAAAAAAAGAACCCTTTGGGTACATAGGAATAGTTTGAGCTATAGTCTCTATTGGGTTCTTAGGCTTCATCGTATGAGCCCACCATATATTCACAGTCGGAATAGACGTTGACACACGAGCATACTTCACATCAGCCACCATAATTATTGCTATCCCCACAGGAGTCAAAGTTTTCAGCTGACTAGCAACGCTTCATGGGGGAAACATTAAATGGTCTCCCGCTTTAATATGAGCCCTAGGCTTCATTTTCCTTTTTACAGTAGGCGGCCTAACCGGTATCGTCCTAGCCAATTCATCTTTAGATATCGTGCTCCACGATACTTATTACGTAGTTGCCCATTTTCACTATGTACTCTCAATAGGAGCCGTATTTGCCATCATAGGAGGGTTCGTCCACTGATTCCCCCTATTCTCAGGATATACACTTAACTCAACATGAGCAAAAAGTTCATTCGTAATTATATTTGTAGGTGTGAACCTAACATTTTTCCCTCAACACTTCCTAGGTCTATCCGGTATACCCCGACGATATTCAGACTACCCAGATGCTTACACAACATGAAATACTATCTCATCAATAGGTTCCTTCATTTCACTAACAGCAGTCATACTAATAATTTTCATTATCTGAGAAGCATTCGCCTCCAAACGGGAAGTCCTAACAGTAGATCTCACATCCACTAACCTTGAGTGACTAAATGGATGCCCTCCACCATACCACACATTCGAAGAACCAGCATTCGTTAATCCGAAGTGATCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hyperoodon ampullatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Justification
As with similar species, threats that could cause widespread declines include high levels of anthropogenic sound, especially military sonar and seismic surveys. The population remains depleted from whaling. However, the decline took place more than three generations ago; the combination of possible declines driven by vulnerability to high-level anthropogenic sound sources is believed sufficient that a 30% global reduction over three generations (53 years; Taylor et al. 2007) cannot be ruled out (criterion A).

History
  • 1996
    Lower Risk/conservation dependent
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Vulnerable
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The IUCN relieved Hyperoodon ampullatus of its "vulnerable" listing in 1991, an currently lists it as "Lower Risk, subjec to continued conservation." COSEWIC (Committee on the Status of Endangered Wildlife in Canada) assigned the species to its "vulnerable" category in 1996. Though not listed under the U.S. Endangered Species Act, trade in northern bottlenose whales is restricted by CITES, the species is included in Appendix I. These whales have not been hunted commercially since 1973.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: data deficient

  • Simmonds, M., J. Hutchinson. 1996. The Conservation of Whales and Dolphins. New York, New York: John Wiley & Sons.
  • Elderkin, M. August 20,1998. "Nova Scotia species at risk with official COSEWIC status" (On-line). Accessed October 13,1999 at http://www.gov.ns.ca/NATR/wildlife/endngrd/specie98.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive. All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. This species is listed on Appendix II of the Bonn Convention and Appendix III of the Bern Convention (3). All cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (4). Whaling is illegal in UK waters under the Fisheries Act of 1981. The UK recognises the authority of the International Whaling Commission concerning matters relating to regulation of whaling (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Global abundance has not been estimated. A rough estimate open to questions is that about 40,000 occur in the eastern North Atlantic (NAMMCO Annual Report 1995), including an estimated 5,827 (CV=16%) in the high latitudes of the eastern North Atlantic (Gunnlaugsson and Sigurjónsson 1990). Estimates for Icelandic and Faroese waters were 3,142 and 287 whales respectively, although allowance was not made in the surveys for animals not observed because of their long dives. A subpopulation of c. 163 individuals (95% CI 119-214) occurs in the Gully (Scotian Shelf). About 57% of this subpopulation is found in a 20 x 8 km core area at the entrance of the canyon at any time. Mark-recapture analysis of fifteen years of data suggest that this population is stable (Whitehead and Wimmer 2005). Most subpopulations of the species are probably still depleted, due to large kills in the past; over 65,000 animals were killed in a multinational hunt that operated in the North Atlantic from c. 1850 to the early 1970’s (Mitchell 1977; Reeves et al. 1993).

A study by Christensen and Ugland (1983) resulted in an estimated initial (pre-whaling) population size of about 90,000 whales, reduced to some 30,000 by 1914. The population size by the mid-1980s was said to be about 54,000, roughly 60% of the initial stock size.

Historic catch distributions indicated the existence of at least six centers of abundance, each potentially representing a separate stock (Benjaminsen 1972): i) the Gully; ii) northern Labrador-Davis Strait; iii) northern Iceland; iv) and v), off Andenes and Møre, Norway, and vi) around Svalbard, Spitzbergen. Anecdotal reports from whalers suggest a north/south seasonal migration could occur in some regions but there is little strong evidence for this and whales are reported in the Gully year round. They inhabit the most northerly waters of the Barents and Greenland seas in summer (May to August).

The small resident population in the Gully is largely isolated from populations to the north (Labrador) and northwest (northern Iceland); the whales there are smaller and appear to breed at a different time of year (Whitehead et al. 1997b and are genetically distinct at both mitochondrial and nuclear markers, refuting the hypothesis of seasonal migrations between these regions (Dalebout et al. 2006). Little is known about populations in central and western North Atlantic (Reyes et al. 1993). For statistical consideration, Christensen (1975) assumed that all the bottlenose whales caught east of Greenland belonged to a single subpopulation, while Mitchell (1977) defined Cape Farewell (Greenland) to divide west and east North Atlantic catches (Culik 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This is one of only a few species of beaked whales to be hunted commercially on a large scale. Hunts occurred from the 1850s to the 1970s, and over 65,000 whales were killed (with many more struck but lost; Reeves et al. 1993). They have also been hunted in a drive fishery in the Faroe Islands, with over 800 taken there (Bloch et al. 1996).

By far the major bottlenose whaling nation has been Norway, though some hunting was also done by the UK, Canada and Denmark (Faroes). The northern bottlenose was sought after for its oil (including a form of spermaceti oil in the head) and later for pet food. No hunting of this species has been conducted by Norway since 1973 (Jefferson et al. 1993, Reyes, 1991. The species has been essentially unexploited for almost 30 years, with only a few animals taken in some years in the Faroe Islands (on average 2.2 whales per year in the period 1709-2002). The aggregate population was certainly reduced by whaling, and the extent of recovery is uncertain (Reeves et al. 2003). Mitchell (1977) considered that the population was severely depleted in both the early and modern whaling periods. Few incidental catches have been reported (Reyes 1991).

There are no major fisheries for squid in the Northeast Atlantic, but future developments could represent some threat. This species, like other beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

Predicted impacts of global climate change on the marine environment may affect this species of whale, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Currently there are no known major range-wide threats. Populations in the eastern North Atlantic may be depleted as a result of former whaling (Leatherwood and Reeves 1983). Population in the "Gully" off Nova Scotia is potentially threatened by oil and gas development, commercial shipping traffic, and fishing activities (Whitehead et al. 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threats to the northern bottle-nosed whale are thought to be chemical and noise pollution, prey depletion, human disturbance, and hunting (7). This species has been hunted more than any of the other species of beaked whales (2). The extent to which populations of this species have been reduced by hunting is unclear, and the current status of the population is unknown (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is included in Appendix I of CITES.

The species was included in the International Whaling Commission schedule in 1977, with recommendations that northern bottlenose whales be granted Protected Stock status with zero catch limit (Klinowska 1991). Populations or stocks are not defined; this, together with estimates of present abundance), should be the focus of future studies (Culik 2004; Dalebout et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, the northern bottle-nosed whale is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters. Whaling is illegal in UK waters, and the International Whaling Commission (IWC) introduced a world moratorium on commercial whaling in 1982 (2), which came into effect in 1986 (9) (although Norway and Japan have continued whaling activities) (2). Seven European countries have signed the Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS), including the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (4). Increased awareness of this species may help to secure its future (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The Northen bottlenose whale was hunted for centuries for the spermaceti oil contained in its head and as a souce of food for native peoples. Scottish, English, and Norwegian whalers hunted H. ampullatus commercially from the mid-1800's until 1973. Because of its behavior of approaching large vessels and defending injured group members, whalers found Northern bottlenose whales easy to hunt. This whale's behavior and the fact that the spermaceti oil contained in its head was of almost equal quality to that of the Sperm whale resulted in overhunting and gross reductions in Northern bottlenosed whale populations around the turn of the century (Bloch et al. 1996, Reeves et al. 1993).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Significant numbers were harvested by commercial whalers in the late 1800s-early 1900s and in the mid-1900s (through the early 1970s); used for head oil and for food for pets and fur-farm animals (IUCN 1991). No longer hunted regularly anywhere in range (Reeves and Mitchell 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!