Articles on this page are available in 2 other languages: Chinese (Simplified) (1), Spanish (27) (learn more)

Overview

Brief Summary

Description

"Cuvier’s beaked whales are rarely seen, because they stay in deep water and tend to avoid boats. They are known to live in every ocean, except near the North and South Poles, and most seas. They are robust animals with small dorsal fins and small, narrow flippers. Males have a pair of small, sharp teeth that erupt from the tip of the lower jaw, and usually have white scars on their bodies from fighting with other males. They swim in pods of up to about seven individuals, and feed primarily on deep-water squids.

Links:
Mammal Species of the World
  • Original description: "Cuvier, G., 1823.  Recherches sur les ossements fossiles, G. Dufour et E. d'Ocagne, Paris. 5(1):350."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Very seldom seen at sea, almost everything known about Cuvier's beaked dolphin is based on studies of stranded animals (2) (5) (7). Consequently very little is known about the behaviour and ecology of this elusive species. Nonetheless, recent studies using digital tags are beginning to shed light on its extraordinary foraging habits. In particular, this species has been recorded diving to depths of nearly 1,900 metres, the deepest dives ever reported for any air-breathing mammal. Leaving the surface for up to 85 minutes at a time, the whales use echolocation to hunt prey in the lightless depths (6). Very little analysis has been undertaken on the stomach contents of this species, but deep sea-squid are thought to be the main source of food, with fish, and, to a lesser extent, crustaceans, also being taken (1) (2) (5). Although often seen alone, groups of two to seven whales are most common (5) (7). Its inconspicuousness at sea is jointly attributed to its low, diffuse blow and its tendency to avoid vessels (2). The lifespan of Cuvier's beaked whale is thought to be at least 25 years (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

In 1823, after mistaking a fragment of skull for a fossil, the French naturalist Georges Cuvier described a seemingly extinct species of whale. Several decades after his death, it became apparent that, far from being extinct, Cuvier's beaked whale was actually a relatively abundant, living species, occurring in offshore waters of all the world's oceans (1) (2) (4). Like the other beaked whales, this enigmatic cetacean has a robust, cigar-shaped body, a small dorsal fin set well back on the body, and relatively small flippers (2). The gently sloping forehead of this species grades into a short, stubby beak, while the lower jaw juts out well beyond the upper jaw (2) (5). Skin colouration varies considerably amongst individual whales, but most lie somewhere between dark slate-grey and rusty brown (4) (5). With age, and especially in males, the head, neck and back become lighter, such that the heads of very old males appear almost completely white (2) (4) (5). However, an even more distinct feature of adult males, are two large, cylindrical teeth which protrude somewhat incongruously from the tip of the lower jaw (4) (5). The extensive linear scarring, commonly seen on the sides of males, is evidence of the damage these teeth can inflict when males fight amongst each other for females (2) (4) (5). In addition, both sexes often have white oval scars, which are most likely inflicted by lampreys or cookie-cutter sharks (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Ziphius cavirostris is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth (rather than baleen). It is a member of the beaked whale family with the characteristic V-shaped crease on the throat and the short dorsal fin set relatively far back. Cuvier's beaked whale is a medium-sized beaked whale that can reach up to 7.5 m in length.The lower jaw has a single pair of teeth (exposed only in adult males). It has an indistinct beak and a concave forehead in front of the blowhole. Cuvier's beaked whale has a dark brown or grey dorsal and lateral colouration with lighter areas around the head and belly. Adults are often covered with a wide array of white scratches and scars.Cuvier's beaked whale may be confused with the northern bottlenose whale Hyperoodon ampullatus but can be recognised by its indistinct beak and its concave forehead. Cuvier's beaked whales are usually found in small groups of up to 7 individuals but may be seen alone. It rarely breeches, and when diving, it will often show the tail flukes. Dives may last up to 40 minutes long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Irish Exclusive economic Zone, Italian Exclusive Economic Zone, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Pacific Ocean, Portuguese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, Wimereux, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Mediterranean Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Cuvier's beaked whales may have the most extensive range of any beaked whale species (Heyning 1989, 2002). They are widely distributed in offshore waters of all oceans, from the tropics to the polar regions in both hemispheres. Their range covers most marine waters of the world, with the exception of shallow water areas, and very high-latitude polar regions. They are found in many enclosed seas, such as the Gulf of California, Gulf of Mexico, Caribbean Sea, Sea of Japan, and the Sea of Okhotsk (but not in the Baltic or Black Seas). This is the only species of beaked whale regularly found in the Mediterranean Sea (Podesta et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

These whales have a worldwide distribution in deep waters below the 10 degree isotherm (Minasian et al. 1984, Watson 1981).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The distribution of Cuvier's beaked whales is poorly known and is based mainly on stranding records (Leatherwood et al. 1976). In the western Atlantic, strandings have been reported from Nova Scotia along the eastern USA coast south to Florida, around the Gulf of Mexico, and within the Caribbean.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Worldwide in all ocean basins from tropical to subpolar waters. Seldom seen alive; known mainly from occasional stranded specimens. Stranded specimens have been recorded from Cape Cod and the North Sea south to Tierra del Fuego and the Cape of Good Hope in the Atlantic, and from the southern Bering Sea south to Australia and New Zealand in the Pacific (the most frequently sighted medium-sized cetacean in the eastern tropical Pacific). Also Mediterranean, Caribbean, Sea of Japan, and Indian Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

With a distribution that comprises all the oceans and most of the seas, with the exception of very high polar regions, Cuvier's beaked whale is one of the most widespread and abundant beaked whales in the world (1) (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

-Ziphius cavirostris- is a medium-sized whale with an average body length of 6.4 meters. The female is usually a little larger and can be up to 7 meters long. Calves are 2.1 meters at birth. -Z. cavirostris- has a spindle shaped body that is a little stouter than other ziphiids. They have a small head (about 10% of their body length) and a distinct neck. As with all ziphiids, they have two grooves along the throat. They have a stubby beak which is almost indistinct in larger animals and a scooped out hollow behind the blowhole. Adult males have two large teeth on the lower jaw that grow up to 8 centimeters. In the females, the teeth never break through the gums. Some individuals have been found with 15-40 vestigial teeth that never erupted. -Z. cavirostris- have small rounded flippers that fold into depressions or "flipper pockets" on their flanks. They have a relatively tall fin (40 centimeters) that is shaped like a shark fin. There is a small notch in the center of their broad flukes.

The coloration of -Z. cavirostris- varies among individuals. In the Indopacific waters, the whales are often sienna colored, ranging from a dark yellow to a deep brown. Their backs are usually darker than their bellies, but some have a reversed coloration: pale backs with black stomachs. The head is almost always totally white, especially in older males. In the Atlantic waters, -Z. cavirostris- have a grey blue color, often with the same pale head coloration. They have dark spots around the eye. Juveniles are usually lighter than adults (Minasian et al. 1984, Watson 1981).

Average mass: 3000 kg.

Average mass: 2.701e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Length:
Range: "5.1-6.9 m "

Weight:
Average: 2,500 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 610 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Ziphius cavirostris Cuvier, 1823
Catalog Number: USNM A21975
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull; Skeleton
Collector(s): G. Manigault
Year Collected: 1861
Locality: Charleston, Charleston Harbor, Charleston, South Carolina, United States, North America, North Atlantic Ocean
  • Type: Cope, E. D. 1865. Proc. Acad. Nat. Sci. Philadelphia. 17: 280.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Ziphius cavirostris Cuvier, 1823
Catalog Number: USNM A20993
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): L. Stejneger
Year Collected: 1882
Locality: Bering Island, Commander Islands, Kamchatka, Russia, Bering Sea, Asia, North Pacific Ocean
  • Type: Stejneger. 1883. Proc. U. S. Nat. Mus. 6: 77.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Although Cuvier’s beaked whales can be found nearly anywhere in deep (>200 m) waters, they seem to prefer waters near the continental slope, especially those with a steep sea bottom. Off Japan, whaling records indicate that Z. cavirostris is most commonly found in waters deeper than 1,000 m (Heyning 1989). The species is known around many oceanic islands, and in some enclosed seas. It is rarely found close to mainland shores, except in submarine canyons or in areas where the continental shelf is narrow and coastal waters are deep (Heyning 1989, 2002) and is mostly a pelagic species that appears to be confined by the 10°C isotherm and the 1,000 m bathymetric contour (Houston 1991; Robineau and di Natale 1995).

Cuvier's beaked whales, like all beaked whales, appear to prefer deep waters for feeding. Dives of up to 40 minutes have been documented. Although few stomach contents have been examined, they appear to feed mostly on deep-sea squid, but also sometimes take fish and some crustaceans (MacLeod et al. 2003). They apparently feed both near the bottom and in the water column. As with other beaked whales, suction appears to be used to draw prey items into the mouth at close range (Heyning and Mead 1996).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

-Z. cavirostris- have a worldwide distribution, though they seldom go north of the 10 degree isotherm. They are deep divers and prefer waters beyond the 1000 meter line (Watson 1981).

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

from tropics to polar regions, oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 386 specimens in 1 taxon.
Water temperature and chemistry ranges based on 347 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.323 - 28.819
  Nitrate (umol/L): 0.036 - 27.134
  Salinity (PPS): 31.810 - 36.478
  Oxygen (ml/l): 4.517 - 7.716
  Phosphate (umol/l): 0.055 - 1.878
  Silicate (umol/l): 0.787 - 24.641

Graphical representation

Temperature range (°C): 1.323 - 28.819

Nitrate (umol/L): 0.036 - 27.134

Salinity (PPS): 31.810 - 36.478

Oxygen (ml/l): 4.517 - 7.716

Phosphate (umol/l): 0.055 - 1.878

Silicate (umol/l): 0.787 - 24.641
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Generally but not always in deeper, offshore tropical and temperate waters, usually outside the 1000 m contour (Houston 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Cuvier's beaked whale is an oceanic deep-sea whale, diving to several hundred metres in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cuvier's beaked whale is normally found in waters deeper than 200 metres, rarely close to the coast unless the continental shelf is particularly narrow and steep (1). Recent studies indicate that this species forages on average at depths of around 1000 metres (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal distribution is poorly known; apparently year-round resident in some areas (e.g., off New Zealand, the British Isles, western North America, and Japan) (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Ziphius cavirostris eats mainly squid and deep water fish. They also eat crabs and starfish (Watson 1981).

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet consists mainly of squid and open-ocean, mesopelagic, and deep-water fishes (Leatherwood and Reeves 1983, IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary (adult males) or usually in tight schools of 3-10, sometimes as many as 25 (Leatherwood and Reeves 1983). In the eastern tropical Pacific, group size was 1-7 (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
36.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 62 years (wild) Observations: Estimates suggest these whales may live up to 62 years (Ronald Nowak 2003). Average lifespan is probably over 30 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Both sexes mature at about 5 meters long. There is thought to be a sex ratio of 67% males to 33% females. Little is known about the reproduction of this species because there does not seem to be a specific breeding season. The whales breed and calves are born all year round. The average lifespan is at least 35 years (  http://www.ims.usm.edu/~musweb/ziphcav.htm. Minasian et al. 1984, Watson 1981).

Breeding season: The whales breed year round

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average gestation period: 365 days.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Smallest sexually mature individuals are a little over 5 m long, at which size males are apparently about 11 years old.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Deep divers manage temperature: beaked whales
 

Veins and arteries of Cuvier's beaked whales manage heat through different configurations of counter-current heat exchangers.

   
  "In general, mammals possess two venous returns from their extremities: one deep and warmed; one superficial and cooled (Fig. 11). In the deep veins, which are adjacent to nutrient arterial supplies, countercurrent heat exchange (CCHE) occurs if the temperature of the arteries is higher than that of the veins (Figs 11-13; Schmidt-Nielsen, 1990; Scholander, 1940; Scholander and Schevill, 1955); warmed blood is returned and body heat is trapped in the core…Three examples of CCHEs found in cetaceans are…a flat array of juxtaposed arteries and veins found in the reproductive coolers of cetaceans…a vascular bundle, an array of relatively straight, parallel channels, an optimum configuration for CCHE (Scholander, 1940), such as is found in the chevron canals of cetacea…[and] a periarterial venous rete (PAVR), which is a rosette of veins surrounding an artery. These CCHEs are found in the circulation of cetacean fins (Figs 13d and 13e), flukes and flippers (Scholander, 1940; Scholander and Schevill, 1955)…Superficial veins of a cetacean can supply cooled blood to the body core (Fig. 12a). The veins carrying this blood feed into bilaterally paired reproductive coolers (Figs 12d-g) (Rommel et al., 1992; Pabst et al., 1998). In addition to providing thermoregulation for the reproductive system, cooled blood from the periphery is also returned to the heart via large epidural veins (Figs 12d; Figs 13 and 14), which perform some of the functions of the azygous system in other mammals (Rommel et al., 1993; Tomlinson, 1964). In deep divers, such as beaked whales and sperm whales, these epidural veins are even larger than those observed in delphinids (S. Rommel, pers. obs.)." (Rommel et al. 2006:197-198)
  Learn more about this functional adaptation.
  • Rommel, S.A.; Costidis, A.M.; Fernández, A.; Jepson, P.D.; Pabst, D.A.; McLellan, W.A.; Houser, D.S.; Cranford, T.W.; Van Helden, A.L.; Allen, D.M.; Barros, N.B. 2006. Elements of beaked whale anatomy and diving physiology and some hypothetical causes of sonar-related stranding. Journal of Cetacean Research Management. 7(3): 189-209.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ziphius cavirostris

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCTTATATTTACTATTTGGTGCCTGAGCAGGGATAGTAGGTACCGGTCTAAGCTTATTAATCCGAGCCGAACTAGGTCAACCTGGCACATTAATTGGAGATGATCAAGTTTACAACGTGCTAGTAACAGCCCACGCCTTTGTAATAATCTTTTTCATGGTTATACCCATCATAATCGGCGGGTTCGGAAATTGACTAGTTCCTTTAATAATTGGATCTCCAGATATAGCCTTTCCTCGTATAAACAACATAAGCTTCTGATTACTTCCTCCTTCCTTCTTACTACTGATAGCATCCTCAATAATTGAAGCTGGCGCAGGCACAGGCTGAACTGTGTATCCTCCCTTAGCCGGAAATCTTGCACACGCAGGAGCCTCAGTTGACCTTACTATTTTCTCCTTACATTTAGCAGGTACATCCTCAATTCTAGGGGCTATCAACTTCATTACAACTATCATTAACATAAAACCACCCGCTATAACTCAATACCAAACACCTCTATTTGTATGATCTGTCCTAGTTACGGCAGTGCTACTCCTATTATCTCTACCTGTCCTAGCAGCTGGAATTACTATACTGCTAACAGACCGAAATCTAAACACAACCTTCTTTGATCCTGCAGGAGGAGGAGACCCAATCCTATATCAACACCTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ziphius cavirostris

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Justification
Global trend or abundance data for this species are unavailable but abundance is at least 100,000. This species also has a very large range. As with other beaked whales, threats that could cause widespread declines include high levels of anthropogenic sound, especially military sonar and seismic surveys, and bycatch. The combination of the large global range and relatively high abundance with possible declines driven by more localized threats is believed sufficient to rule out a 30% global reduction over three generations (criterion A).

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Though not enough whales are taken to be a threat to the species, deaths may also occur from entanglement in gilnets, float lines from lobster traps, and long lines (  http://www.ims.usm.edu/~musweb/ziphcav.htm).

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Global abundance has not been estimated for Cuvier’s beaked whales, but abundance has been estimated for several study areas. Wade and Gerrodette (1993) estimated an abundance of about 20,000 (CV=27%) Cuvier’s beaked whales in the eastern tropical Pacific, but a re-analysis of the same data increased that to about 80,000 after accounting for diving animals that were missed (Ferguson and Barlow 2001). Other dive-corrected estimates of Cuvier’s beaked whale abundance include 1,884 (CV=68%) off the U.S. west coast (Barlow 2003) and 15,242 (CV=143%) in Hawaiian waters (Barlow 2006). Cuvier’s beaked whales are undoubtedly among the most common and abundant of all the beaked whales, and worldwide abundance is likely to be well over 100,000. There is no information on trends in the global abundance of this species.

This is the only widely-distributed beaked whale species for which a global assessment of genetic diversity has been conducted. The results of this study suggest that there is probably little movement of Cuvier’s beaked whales among different ocean basins, and that there may even be a distinct subpopulation in the Mediterranean Sea (Dalebout et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There is good evidence of large-scale reductions in many predatory fish populations (e.g., Baum et al. 2003, 2005; Sibert et al. 2006; Polacheck 2006) and over-fishing and collapse of several important “prey” fish stocks world-wide (e.g., Jackson et al. 2001). The effects of such fish population reductions and subsequent ecosystem changes on world-wide populations these whales are unknown but could result in population declines.

Never the main target of commercial whalers, Cuvier’s beaked whales have sometimes been taken as bycatch in other direct fisheries, such as those in the Caribbean islands, Indonesia, Taiwan, Peru, and Chile (Heyning 1989; Jefferson et al. 1993). In the Japanese Berardius fishery, Z. cavirostris have been taken on an opportunistic basis, with catches varying from 3 to 35 animals taken yearly (Omura and Kimura 1955). Although the Berardius fishery still continues, there have been no direct takes of Z. cavirostris in recent years (Nishiwaki and Oguro 1972).

Mignucci-Giannoni et al. (1999) conducted an assessment of cetacean strandings in waters off Puerto Rico, the United States and the British Virgin Islands to identify the factors associated with reported mortality events between 1867 and 1995. The most common human-related cause categories observed were entanglement and accidental captures, followed by animals being shot or speared.

Bycatch of Cuvier’s beaked whales has been reported in several fisheries. Julian and Beeson (1998) report a mortality of 22-44 individuals per year in the California/Oregon drift gillnet fishery from 1992 to 1995. Mora Pinto et al. (1995) report on bycatches from Colombian fisheries. Notarbartolo di Sciara (1990) reported on bycatch in the Italian swordfish fishery. Bycatch in the western North Atlantic is very low, with one animal reported between 1994 and 1998 (Waring et al. 2001).

Evidence from stranded individuals of several similar species indicates that they have swallowed discarded plastic items, which may eventually lead to death (e.g. Scott et al. 2001); this species may also be at risk.

In recent years, there has been increasing concern that loud underwater sounds, such as active sonar and seismic operations, may be harmful to beaked whales (Malakoff 2002). The use of active sonar from military vessels has been implicated in a number of mass strandings of Cuvier’s beaked whales, including in the Mediterranean Sea during 1996 (Frantzis 1998), the Bahamas during 2000 (Balcomb and Claridge 2001), the Madeira Islands in 2000 (Frietas 2004) and the Canary Islands in 2002 (Jepson et al. 2003). Mass strandings of Cuvier’s beaked whales in Japan also appear to be correlated with locations of naval exercises (Brownell et al. 2006). A stranding of two Cuvier’s beaked whales in the Gulf of California was closely correlated with a seismic survey (Malakoff 2002).

Predicted impacts of global climate change on the marine environment may affect this species of whale, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

With Cuvier's beaked whales found stranded more often than any other species of beaked whale, its global population is thought to be relatively large (1) (5). Coupled with its widespread distribution, this species is not believed to be undergoing significant declines. Nonetheless, there are a variety of threats that may be causing localised declines in its abundance (1). Although historically it has never been hunted in significant numbers, it is regularly reported as by-catch in other fisheries. Furthermore, overfishing may be reducing the amount of 'prey' available to species such as Cuvier's beaked whale. Probably the greatest current concern is the effect of acoustic pollution, associated with sonar and seismic exploration, on this species (1) (5) (7). In recent years, mass strandings of Cuvier's beaked whale have been found to correlate closely with military activities (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

In 2004, the Parties to the UNEP CMS Agreement on the Conservation of Cetaceans of the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS) adopted a resolution recommending that human activities introducing high-intensity noise in the marine environment be avoided in the agreement area where high concentrations of Cuvier’s beaked whales may occur. The agreement’s Scientific Committee is currently modelling Mediterranean sighting data to generate predictive Ziphius habitat maps for that purpose.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Given concerns on the effect of acoustic pollution on Cuvier's beaked whale and other beaked whales, efforts are being made to develop strategies that will reduce the chances of beaked whales being accidentally exposed to sonar and other high-intensity noise sources (1). In particular, the Agreement on the Conservation of Cetaceans of the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS) has made recommendations that management measures be implemented to avoid use of military sonar in areas known to contain habitat especially suited to Cuvier's beaked whale. In addition, ACCOBAMS is encouraging further research to assess the impact of acoustic pollution on cetaceans, and most notably beaked whales (1) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

About 20 individuals are taken by Japanese whalers each year. This is a relatively small number and they are not regularly hunted (Watson 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Very infrequently harvested in small cetacean fisheries in some areas (e.g., Japan, Lesser Antilles); used for human food. Stranded specimens in the Commander Islands have been used for animal food. See IUCN (1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cuvier's beaked whale

Cuvier's beaked whale!<-- This template has to be "warmed up" before it can be used, for some reason -->

Cuvier's Beaked Whale (Ziphius cavirostris)[1] is the most widely distributed of all the beaked whales. It is the only member of the genus Ziphius. Another common name for the species is Goose-beaked Whale on account of the fact that its head is said to be shaped like the beak of a goose. Georges Cuvier first described it in 1823 from part of a skull found in France in 1804.

Contents

Physical description

Cuvier's Beaked Whale has a short beak in comparison with other species in its family, with a slightly bulbous melon. The melon is white or creamy in color and a white strip runs back to the dorsal fin about two-thirds of the way along the back. The rest of the body color varies by individual: some are dark grey; others a reddish-brown. Individuals commonly have white scars and patches caused by cookiecutter sharks. The dorsal fin varies in shape from triangular to highly falcate. The fluke of the whale is about one-quarter the body length. The whale grows up to about 7 meters (23 ft) in length and weighs 2–3 tonnes (2.0–3.0 LT; 2.2–3.3 ST). They live for forty years.

The Cuvier's Beaked Whale is difficult to distinguish from many of the mesoplodont whales at sea.

Range and habitat

Their range is known mainly from strandings. It is widespread across the Atlantic, Pacific and Indian Oceans. Individuals have been found as far north as the Shetland Islands and as far south as Tierra del Fuego. Deep waters are preferred in anything from cool to tropical habitats.

Because of identification difficulties, the global population is unknown.

Conservation

Japanese whalers in the past opportunistically killed Cuvier's. As with many other cetacean species many individuals are believed to be killed each year by gillnets.

Beaked Whales may also be sensitive to noise. A higher incidence of strandings has been recorded in noisy seas such as the Mediterranean. Multiple mass strandings (beachings) have occurred following operations by the Spanish Navy.[2]

Specimens

  • MNZ MM002092, collected Cape Kidnappers, Hawkes Bay, New Zealand, 14 October 1988.

References

  • Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Ziphius cavirostris. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 26 February 2009. Database entry includes justification for why this species is listed as least concern.
  1. Cuvier's Beaked Whale in the Encyclopedia of Marine Mammals Thomas A. Jefferson, 1998. ISBN 0-12-551340-2
  2. National Audubon Society Guide to Marine Mammals of the World Reeves et al., 2002. ISBN 0-375-41141-0.
  3. Whales, Dolphins and Porpoises Carwardine, 1995. ISBN 0-7513-2781-6

In the news

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!