Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

Description

"Baird’s beaked whale is the longest species of the Ziphiidae, which is a family of medium-sized whales. The name ""beaked whale"" comes from the way the long snout, or rostrum, tapers to a tip. From above, the rostrum looks like the neck of a bottle, and another common name for the species is giant bottlenose whale. Berardius has four teeth in the lower jaw. Two of the teeth project from the jaw and may be used for fighting: it is common for the skin of both males and females to be heavily covered in tooth-scars all over the body. The whales feed in deep water, diving for as long as an hour at a time to eat squid, octopus, skates, and other species that are found 2000 m below the surface. Fifty or more whales often travel together, occasionally breaching and slapping their flippers.

Links:
Mammal Species of the World
  • Original description: Stejneger, 1883.  Proceedings of theU.S. National Museum, 6:75.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Baird's beaked whales are found in deep oceanic waters of the North Pacific Ocean and the adjacent Japan, Okhotsk, and Bering Seas. Their range extends to the southern Gulf of California in the eastern Pacific, and to the island of Honshu, Japan in the western Pacific. They may occur in the vicinity of drift ice in the northern Sea of Okhotsk. Off the Pacific coast of Japan, they migrate into waters over the continental slope from May to October, but where they go in winter is not known. They also occur in the Sea of Japan. Their distributional limits in oceanic waters of the mid-Pacific are also not well known (Balcomb 1989; Kasuya 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Berardius bairdii have a limited range within the northern Pacific ocean. They can be found in waters near Japan and southern California and as far north as the Bering Sea. They prefer deeper water, beyond the 1000 meter line (Minasian, S.,K Balcomb, III and L Foster, 1984. Watson, L. 1981).

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Northern North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Temperate waters of the northern North Pacific and contiguous seas; three stocks recognized off Asian coast: Sea of Japan, Okhotsk Sea, and Pacific Ocean; off North America, occurs from Alaska to Mexico (Reeves and Mitchell 1992, 1993). See also IUCN (1991). Abundance uncertain, but not rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average length of B. bairdii is 10.3 meters for males and 11.2 meters for females. Calves are about 4.5 meters at birth. They are medium to large sized whales and often grouped with the great whales. They are the largest of the Ziphiidae family. Their bodies are long and cylindrical with a characteristic beak where the lower jaw extends about 10 centimeters beyond the tip of the the upper jaw. Their blow hole is low and wide. Their heads are angled backwards when they breathe so that their front teeth and beaks are visible (Minasian et al. 1984; Watson 1981).

B. bairdii have two pairs of teeth, the first pair protruding 9 centimeters from the extended lower jaw. The second pair is roughly 20 centimeters behind the first and grow to about 5 centimeters. The teeth of the female are slightly smaller than those of the male. B. bairdii are a blueish grey color, often with a brown tinge. Their undersides are usually lighter with three patches of white on the throat, between the flippers, and near the navel and anus. These spots range in size from barely visible to an almost continuous stripe across the belly. Two grooves run along the underside of the jaw in a wishbone shape. Females tend to be lighter in color than males, who often have tooth scars on their beaks. B. bairdii have trangular fins about 30 centimeters tall and set far back on the body (Minasian et al. 1984, Watson 1981).

Average mass: 9000 kg.

Range length: 10.3 to 11.2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Average mass: 1.138e+07 g.

  • Minasian, S., K. Balcomb, III, L. Foster. 1984. The World's Whales. U.S.: The Smithsonian Institute.
  • Watson, L. 1981. Sea Guide to Whales of the World. London: Hutchinson and Co..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 1000 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Females are slightly larger than males.

Length:
Range: up to 11.9 m males; up to 12.8 m females

Weight:
Range: up to 14,200 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Berardius bairdii Stejneger, 1883
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Year Collected: 1882
Locality: Bering Island, Stare Gavan, Commander Islands, Kamchatka, Russia, Bering Sea, Asia, North Pacific Ocean
  • Type: Stejneger, L. 1883. Proc. U. S. Nat. Mus. 6: 75.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Though they may be seen close to shore where deep water approaches the coast, Baird's beaked whales' primary habitats appear to be over or near the continental slope and near oceanic seamounts (Kasuya 2002) in temperate oceanic waters 1,000 to 3,000 m deep. Off the Pacific coast of Japan, these whales have been recorded in waters ranging between 23°C and 29°C, with a southern limit lying at the 15°C isotherm at a depth of 100 m. In the northern Okhotsk Sea the species has been recorded in waters less than 500 m deep, which could be explained by the availability of prey species in shallower waters at higher latitudes (Reyes 1991).

Baird's beaked whales feed mainly on deepwater and bottom-dwelling gadiform fishes, cephalopods, and crustaceans (Balcomb 1989; Kasuya 2002), as well as some pelagic fish, such as mackerel, sardines, and saury. The diet off the Pacific coast of Japan consists of 82% fish and 18% cephalopods, while in the southern Sea of Okhotsk the proportions are 13% and 87%, respectively. They may do much of their feeding at depths of 800-1,200 m.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

From June to August, B. bairdii can be found in warm waters near Japan and California and near British Columbia in September. In the fall, the whales migrate north towards the Bering Sea and spend their winters in cold water near the Aleutian islands. This may be due to seasonal distribution of squid. They prefer deep water, beyond the 1000 meter line (Minasian,S.,K Balcomb, III and L Foster, 1984. Watson, L. 1981).

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 129 specimens in 1 taxon.
Water temperature and chemistry ranges based on 118 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 4.603 - 18.831
  Nitrate (umol/L): 0.026 - 16.473
  Salinity (PPS): 31.430 - 33.781
  Oxygen (ml/l): 5.364 - 7.961
  Phosphate (umol/l): 0.349 - 1.734
  Silicate (umol/l): 2.121 - 35.231

Graphical representation

Temperature range (°C): 4.603 - 18.831

Nitrate (umol/L): 0.026 - 16.473

Salinity (PPS): 31.430 - 33.781

Oxygen (ml/l): 5.364 - 7.961

Phosphate (umol/l): 0.349 - 1.734

Silicate (umol/l): 2.121 - 35.231
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Observed mainly over the continental slope and in pelagic areas with submarine escarpments and seamounts; deep diver (Reeves and Mitchell 1992, 1993). In most areas, occurs in waters deeper than 1000 m (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Seasonal movements are not well understood; evidently absent in winter from some continental slope areas that are inhabited in summer and fall (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

These whales are deep divers and feed most often on squid, particularly Gonatus fabricii. They also eat octopus, lobster, crab, rockfish, and herring. Occasionally they eat starfish and sea cucumbers (Watson, L. 1981).

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats squid and deep-sea fishes; feeding dives of 1000 m or more apparently are routine (IUCN 1991, Reeves and Mitchell 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Occurs in groups of typically 4-10, sometimes up to 30 (Reeves and Mitchell 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
71.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 84 years (wild) Observations: These animals reach sexual maturity in about 10 years but they only reach physical maturity in about 20 years (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Most B. bairdii reach sexual maturity when they are about 9.4 meters long for males and 10 meters long for females. They mate in mid-summer in warm waters near Japan and California. The gestation period is thought to be approximately ten months, though pregnancies of up to 17 months have been reported. Calves are born between late November and early May. A mother will usually produce one calf every three years. The average lifespan is about 70 years (Minasian,S.,K Balcomb, III and L Foster, 1984. Watson, L. 1981).

Breeding interval: A mother will usually produce one calf every three years.

Breeding season: They mate in mid-summer in warm waters near Japan and California.

Average number of offspring: 1.

Range gestation period: 17 (high) months.

Average gestation period: 10 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
2922 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4383 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Based on Japanese whaling data: mating may peak in October-November, with most births in March and April; gestation apparently lasts about 17 months; lactation probably lasts more than 1 year; males sexually mature at about 6-10 years, females at 10-14 years; apparent pregnancy rate is about 30%; may live several decades (see Reeves and Mitchell 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Berardius bairdii

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0600-06|NC_005274|Berardius bairdii| AATCGCTGACTATTCTCAACCAACCACAAAGACATCGGCACCCTATATCTACTATTTGGTGCCTGAGCAGGAATAGTGGGCACCGGTTTA---AGTTTGTTAATCCGTACTGAATTAGGTCAACCAGGAACACTAATTGGGGAT---GATCAACTTTATAATGTACTAGTAACAGCTCATGCCTTCGTGATGATCTTTTTCATAGTTATACCCATCATAATCGGTGGCTTTGGAAACTGACTAGTTCCCTTAATA---ATCGGATCGCCCGACATAGCTTTTCCTCGTATAAATAACATAAGCTTTTGACTACTCCCTCCCTCCTTCCTTCTACTAATGGCATCCTCAATAATCGAAGCTGGTGCAGGTACAGGTTGAACCGTATACCCCCCTCTAGCCGGAAACCTAGCACATGCAGGAGCCTCAGTTGACCTC---ACCATTTTCTCTCTACATTTAGCAGGTGCATCCTCAATCTTAGGGGCTATTAATTTCATTACAACCATTATTAACATGAAACCACCTGCCATAACTCAATACCAAATGCCCCTATTTGTATGATCAGTCCTAGTCACAGCAGTCCTACTCCTGCTATCATTACCCGTTCTAGCAGCC---GGAATTACTATACTATTAACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGGGGAGGAGATCCGATTCTATATCAACACCTATTCTGATTCTTCGGCCATCCCGAAGTCTATATTCTAATTCTACCCGGCTTCGGAATAATCTCACACATCGTAACTTACTATTCAGGGAAAAAA---GAACCTTTCGGATATATAGGAATGGTTTGAGCCATAGTTTCTATCGGATTCCTAGGCTTTATTGTATGAGCCCATCATATATTCACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Berardius bairdii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Justification
There is limited information on global abundance and none on trends in abundance for this species. It is not believed to be uncommon but it is potentially vulnerable to low-level threats and a 30% global reduction over three generations (81 years; Taylor et al. 2007) cannot be ruled out (criterion A).

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Three subpopulations of Baird’s beaked whales are recognized in the western North Pacific (Sea of Japan, Okhotsk Sea, and Pacific Ocean), where these whales have been exploited for centuries. There are an estimated 1,100 Baird’s beaked whales in the eastern North Pacific, including about 228 (CV=51%) off the US west coast (Barlow et al. 2006, Caretta et al. 2006). Abundance in Japanese waters has been estimated at about 7,000 individuals (5,029 off the Pacific coast, 1,260 in the eastern Sea of Japan, and 660 for the southern Okhotsk Sea – Miyashita 1986; Kasuya 2002; Barlow et al. 2006). These are likely underestimates because visual survey methods often do not account for the fact that the whales dive for long periods and are inconspicuous when they surface (Barlow 1999). There is no information on trends in the global abundance of this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Baird’s beaked whales are one of the few species of ziphiids to be commercially hunted (Kasuya 2002; Kasuya and Ohsumi 1984). Small numbers have been hunted by the Soviets, Canadians and Americans, whereas hunts by Japan have been major. The Japanese fishery started in the early 1600s and underwent several expansions and declines. At its peak, after World War II, over 300 whales were killed annually. Now the industry operates with a quota of 8 for the Sea of Japan, 2 for the southern Okhotsk Sea and 52 for the Pacific coasts (Kasuya 2002).

Incidental catches have been recorded, but are generally not common. Some Baird's beaked whales have been caught in Japanese salmon driftnets (Reeves and Mitchell 1993).

This species, like other beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006)

Predicted impacts of global climate change on the marine environment may affect this species of whale, given its cool-temperate to sub-polar habitat, although the nature of likely impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There has been no agreement in the IWC on whether or not it has the competence to classify or set catch limits for this species, even though it is included in the IWC definition of "bottlenose whale" (the only species so regulated is the northern bottlenose whale, Hyperoodon ampullatus). At the 2000 annual meeting of the IWC Scientific Committee, Japan explicitly expressed its unwillingness to subject its research and management program for this species to international scrutiny (IWC 2001).

Although the IWC does not control the annual quota of Baird's beaked whales, it is assumed that the present catch levels over a short period would not seriously affect the subpopulation, but research is needed to obtain information that will allow a full assessment of its status.

It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

These whales have been a long time resource for Japanese coastal whaling industries. In the 1950's, due to new fishing technologies, up to 382 whales were taken each year. With declining numbers and emphasis on other species, the number of B. bairdii caught has diminished (Watson, L. 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested in limited numbers in Japanese waters; national catch limit was 60/year in 1988, formerly up to a few hundred (IUCN 1991, Reeves and Mitchell 1992, 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Possibly a subspecies of B. arnuxii, in which case Berardius would be a monotypic genus (see Mead and Brownell, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!