Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Brief Summary

Description

"Pygmy sperm whales are usually seen in small groups of six or fewer individuals, but there are few documented sightings. They tend to stay in deep water, beyond the continental shelf, and not much is known about their behavior. Calves are about 1.2 m long at birth (an adult's total length ranges from 2.7 to 3.4 m); gestation lasts 9 to 11 months; and the calf nurses for about a year. Although strandings are relatively frequent in the southeastern United States, sometimes because the whales have swallowed plastic bags, these animals are sighted so infrequently that they are considered uncommon for conservation purposes. Pygmy sperm whales are believed to feed mostly on cephalopods, and may mistake floating plastic bags for squid."

Links:
Mammal Species of the World
  • Original description: Blainville 1838.  Ann. Franc. Etr. Anat. Phys., 2:337.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

 Kogia breviceps is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth. It is an easily recognisable small whale with a stocky body reaching up to 4 m in length. It has a large and distinctly square upper jaw which projects above the narrow lower jaw. The blowhole is positioned at the front of the head and directed forward obliquely. A small dorsal fin is present two-thirds down the body and the tail flukes are small. The flippers are almost spear-shaped. The body is blue-black to charcoal grey in colour, while the underside is white and the inside of the mouth and the lips are white. There is often a crescent-shaped, light mark between the eye and the flipper.Pygmy sperm whales are usually found either alone, or in small groups of up to 5 individuals. The blow is unique amongst whales by being obliquely forward directed. The tail flukes will often appear before a deep dive. Dive duration is unknown (Kinze, 2002). It is often confused with the dwarf sperm whale, Kogia sima, but the dwarf sperm whale does not occur in British and Irish waters (Jefferson et al., 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Pygmy Sperm Whales are known from deep waters (outer continental shelf and beyond) in tropical to warm temperate zones of all oceans (McAlpine 2002). This species appears to prefer somewhat more temperate waters than does the Dwarf Sperm Whale. The range of Kogia breviceps is poorly known, though a lack of records of live animals may be more due to inconspicuous behaviour rather than rarity. Most information stems from strandings (especially females with calves), which may give an inaccurate picture of the actual distribution at sea (Culik 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Kogia breviceps is confined to warmer waters (Minasian et al. 1984, Watson 1981).

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Comores, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Tanzania, United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Worldwide in tropical, subtropical, and warm temperate oceans, though degree of continuity of populations is unknown. Rarely observed at sea, though strandings indicate that it may be common, at least seasonally, close to shore in some areas. Strandings are most common along the east coast of North America and south to Cuba and Texas, in southern Africa, southeastern Australia, and the Tasman Sea and South Pacific coasts of New Zealand (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

K. breviceps is a small whale averaging about 3 meters in length for both sexes. Calves are about 55 kilograms at birth. They have a swollen nose and head, which takes up about 15% of their body length. Their head is conical with a small underslung jaw that opens beneath the upper jaw in a shark-like manner. The flippers are short, broad, and far forward on the body. They have a small curved dorsal fin. K. breviceps is a steely grey color with a distinct pink tinge. In the water they often look purple. They are a paler grey on the belly. Between the eye and the flipper is a small white/pale grey bracket mark. This is often called a "false gill", further attributing to its resemblance to a shark. There is another similar pale spot in front of the eye. Scarring is rare. They have a short rostrum which makes their wide skull triangular. K. breviceps have 12-16 teeth on each side and their blowhole is slightly displaced to the left. These two traits distinguish the pygmy sperm whale, K. breviceps, from the dwarf sperm whale, K. simus (Minasian et al. 1984, Watson 1981).

Average mass: 363 kg.

Average mass: 424600 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 370 cm

Weight: 408000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Length:
Range: 2.7-3.4 m

Weight:
Range: 318-408 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

False gill markings and underslung lower jaw.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Nomen nudem for Kogia breviceps (de Blainville, 1838)
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Other
Collector(s): H. Howland
Year Collected: 1883
Locality: Spring Lake, Monmouth, New Jersey, United States, North America, North Atlantic Ocean
  • Nomen nudem: True. 1884. United States National Museum Bulletin. 27: 630, tab. table.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Kogia breviceps (de Blainville, 1838)
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Partial Skull
Collector(s): A. Grayson
Year Collected: 1868
Locality: Mazatlan, Off, Sinaloa, Mexico, Gulf Of California, North America, North Pacific Ocean
  • Type: Gill. 1871. Amer. Nat. 4: 738.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Kogia breviceps is rarely seen at sea; it tends to live a long distance from shore and has inconspicuous habits. According to Caldwell and Caldwell (1989) K. breviceps lives in oceanic waters beyond the edge of the continental shelf while K. sima lives over or near the edge of the shelf. However, this separation was not apparent in the study by Mullin et al. (1994) who, by aerial observation, found both species over water depths of 400-600 m in the north-central Gulf of Mexico. These waters of the upper continental slope were also characterized by high zooplankton biomass (Baumgartner et al. 2001).

Studies of feeding habits, based on stomach contents of stranded animals, suggest that this species feeds in deep water, primarily on cephalopods and, less often, on deep-sea fishes and shrimps (dos Santos and Haimovici 2001; McAlpine et al. 1997). In South Africa, they take at least 67 different prey species and appear to feed in deeper waters than do Dwarf Sperm Whales (Ross 1979).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

K. breviceps prefer warm tropical waters. They may migrate to more temperate waters in the summer months. They also stay in deep waters (Watson 1981).

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

tropical to warm temperate, oceanic, mostly near continental slope
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 92 specimens in 1 taxon.
Water temperature and chemistry ranges based on 81 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 13.695 - 27.360
  Nitrate (umol/L): 0.026 - 2.657
  Salinity (PPS): 32.419 - 36.649
  Oxygen (ml/l): 4.638 - 6.154
  Phosphate (umol/l): 0.055 - 0.510
  Silicate (umol/l): 1.127 - 4.150

Graphical representation

Temperature range (°C): 13.695 - 27.360

Nitrate (umol/L): 0.026 - 2.657

Salinity (PPS): 32.419 - 36.649

Oxygen (ml/l): 4.638 - 6.154

Phosphate (umol/l): 0.055 - 0.510

Silicate (umol/l): 1.127 - 4.150
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Stomach contents suggest mainly pelagic distribution, usually seaward of continental shelf; may also occur in coastal waters (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The pygmy sperm whale is an oceanic deep-sea species that may dive down to a few hundred metres in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

K. breviceps eat mostly squid, shrimp, fish, and crabs with what seems to be a preference for deepwater foraging (Watson 1981).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats mostly squid and cuttlefish; sometimes crabs, shrimp, and fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Solitary or in groups of up to about 6.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 17 years (wild) Observations: These animals can live 17 years in the wild (David Macdonald 1985), and possibly more.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Mating usually takes place in the summer. Gestation lasts for about 9 months and the calf is born in the spring. (  http://www.nsrl.ttu.edu/tmot1/kogibrev.htm., Watson 1981).

Breeding season: Mating usually takes place in the summer

Average number of offspring: 1.

Average gestation period: 9 months.

Average weaning age: 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 82000 g.

Average gestation period: 335 days.

Average number of offspring: 1.

The calf stays with its mother and is nursed for about 12 months. Calves are about 1.2 meters long and about 55 kilograms at birth.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts perhaps 11 months. Most calving apparently occurs between fall and spring. Stranded females that were both pregnant and lactating indicate capability of annual reproduction or that lactation is prolonged (Leatherwood and Reeves 1983, IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Kogia breviceps

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0123-06|AJ554055|Kogia breviceps| AATCGCTGATTGTTTTCAACTAACCATAAAGACATCGGCACCTTGTATCTACTGTTCGGTGCCTGAGCAGGGATAGTAGGCACTGGTTTG---AGCCTACTGATTCGCGCTGAACTAGGCCAGCCAGGCACACTTATCGGGGAT---GACCAGGTCTATAATGTGTTAGTAACAGCCCACGCCTTCGTGATAATCTTCTTTATAGTTATGCCTATCATGATTGGCGGCTTCGGAAACTGACTAGTTCCCCTGATA---ATCGGGGCCCCTGATATAGCATTCCCTCGTATAAACAACATAAGCTTCTGACTACTCCCCCCCTCATTTCTACTATTAATAGCATCCTCAATAGTCGAGGCCGGTGCAGGTACAGGTTGAACAGTTTACCCCCCTCTAGCCGGAAACCTAGCACACGCAGGGGCTTCCGTCGACCTA---ACCATCTTTTCCCTACATTTAGCTGGTGTCTCTTCAATCCTTGGGGCTATCAACTTTATCACAACTATCATCAATATAAAACCCCCTGCCATAACCCAATATCAAACACCTCTTTTTGTGTGATCTGTCCTGGTCACAGCGGTCTTGCTCCTTCTATCCTTGCCCGTCTTAGCAGCT---GGAATCACTATATTGTTAACCGATCGAAATTTAAACACAACCTTCTTCGATCCTGCAGGAGGGGGAGACCCTATTCTATACCAACACCTATTTTGATTCTTTGGCCATCCTGAAGTCTATATCCTAATCCTACCTGGCTTCGGAATGATCTCACACATCGTAACTTACTACTCCGGAAAAAAA---GAGCCTTTCGGATATATGGGAATAGTTTGAGCCATGATCTCTATTGGATTCCTAGGCTTTATCGTATGAGCTCACCACATATTTACAGTAGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Kogia breviceps

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Contributor/s

Justification
There is considerable uncertainty about the status of this species, which may span a range from Least Concern to a threatened category. There is no information on abundance or on trends in global abundance. As a relatively uncommon species it is potentially vulnerable to low-level threats and a 30% global reduction over three generations (36 years; Taylor et al. 2007) cannot be ruled out.

History
  • 1996
    Lower Risk/least concern
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Not much is known about this species. The infrequency of sightings is often assumed as rareness. It is vulnerable to Hawaiian fisheries and gillnets, float lines, and long lines

(  http://swfsc.ucsd.sars.Pygmy_HI.htm, Watson 1981).

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no estimates of global abundance. Abundance of this and similar whales is often underestimated using visual survey methods because they dive for long periods and are inconspicuous when they surface (Barlow 1999). The frequency with which they strand in some areas (such as Florida and South Africa) suggests that they may not always be as uncommon as sightings would suggest. Recent genetic studies suggest the there is some gene flow between the Atlantic and Indo-Pacific oceans (S. J. Chivers pers. comm.).

Delineations between stocks are often difficult to determine, therefore assessments should be considered ongoing processes. In the case of the Pygmy Sperm Whale, concern that sightings may be confused with the cogener K. sima (the Dwarf Sperm Whale) further complicates the estimation of abundance. There are estimated to be about 247 (CV = 106%) off California, Oregon, and Washington (Barlow 2003); 7,251 (CV=77%) off Hawaii (Barlow 2006); 742 of both species of Kogia (CV=29%) in the northern Gulf of Mexico (Mullin et al. 2004); and 395 of both species (CV=40/75%) in the western North Atlantic (Waring et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Although they have never been taken in large numbers and have never been hunted commercially, small numbers of the species have been taken in coastal whaling operations off Japan, Indonesia, Taiwan, the Lesser Antilles, and Sri Lanka (Jefferson et al. 1993).

A few have been killed in gillnet fisheries of Sri Lanka, Taiwan and California, and it is likely they are killed in gillnets elsewhere as well (Jefferson et al. 1993; Barlow et al. 1997). Perez et al. (2001) reported on occasional bycatch in fisheries in the northeast Atlantic (mostly gillnet and purse seine operations). However, although it is taken in small numbers both directly and incidentally in fisheries, Baird et al. (1996) found no serious threats to its status.

A young male Pygmy Sperm Whale stranded alive on Galveston Island, Texas, USA and died in a holding tank 11 days later. During necropsy, the first two stomach compartments (forestomach and fundic chamber) were found to be completely occluded by various plastic bags (Laist et al. 1999). Such ingestion of plastics, with associated gut-blockage, appears to be a common issue in this species.

This species, like beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

In 2005, a large series of unusual stranding events over about 3 weeks in and around Taiwan included several Kogia (Wang and Yang 2006; Yang et al. 2008) with at least 2 Pygmy Sperm Whales (Yang et al. 2008). It is unknown if military, seismic or other loud noise-producing human activities resulted in these strandings.

There are high levels of unexplained strandings in the Gulf of Mexico and the Atlantic coast of Florida (Waring et al. 2006).

Predicted impacts of global climate change on the marine environment may affect Pygmy Sperm Whales, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: No known significant threats; rarely incurs incidental mortality associated with fisheries (IUCN 1991; Baird et al. 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES. Research is needed to determine the impact of threats on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

There is little economic benefit to humans from K. breviceps. They are relatively uncommon so few are taken by the Japanese and an occasinal one is take by Indonesians (  http://swfsc.ucsd.sars.Pygmy_HI.htm, Watson 1981).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Infrequently harvested in small cetacean fisheries in various areas (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pygmy sperm whale

The pygmy sperm whale (Kogia breviceps) is one of three species of toothed whale in the sperm whale family. They are not often sighted at sea, and most of what is known about them comes from the examination of stranded specimens.

Contents

Taxonomy

Illustration from the 19th century

There has been debate and differing opinion as to the correct classification of the pygmy and dwarf sperm whales (see sperm whale family for details). The two were widely considered to be the same species, until 1966, when a scientist at the Smithsonian Institution definitively identified them as separate species.[3] The pygmy sperm whale was first named by Henri Marie Ducrotay de Blainville in 1838.[4]

Physical description

The pygmy sperm whale is not much larger than many dolphins. They are about 1.2 metres (3 ft 11 in) at birth, growing to about 3.5 metres (11 ft) at maturity. Adults weigh about 400 kilograms (880 lb). The underside is a creamy, occasionally pinkish, colour and the back and sides are a bluish grey; there is, however, considerable intermixing between the two colours. The shark-like head is large in comparison to body size, given an almost swollen appearance when viewed from the side. There is a whitish marking, often described as a "false gill", behind each eye.[5][6]

The lower jaw is very small and slung low. The blowhole is displaced slightly to the left when viewed from above facing forward. The dorsal fin is very small and hooked; its size is considerably smaller than that of the dwarf sperm whale and may be used for diagnostic purposes. The pygmy sperm has between 20 and 32 teeth, all of which are set into the lower jaw. Unusually, this species teeth lack enamel due to a mutation in the necessary gene,[7] although enamel is present in very young individuals.[6]

Internal anatomy

Like its giant cousin, the sperm whale, the pygmy sperm whale has a spermaceti organ in its forehead (see sperm whale for a discussion of its purpose). It also has a sac in its intestines that contains a dark red fluid. The whale may expel this fluid when frightened, perhaps to confuse and disorient predators.[8]

Pygmy sperm whales have from 50 to 55 vertebrae, and from twelve to fourteen ribs on either side, although the latter are not necessarily symmetrical, and the hindmost ribs do not connect with the vertebral column. Each of the flippers has seven carpals, and a variable number of phalanges in the digits, reportedly ranging from two in the first digit to as many as ten in the second digit. There is no true innominate bone, which is replaced by a sheet of dense connective tissue. The hyoid bone is unusually large, and presumably has a role in the whale's suction feeding.[6]

The dura of pygmy sperm whales contains a concentration of magnetite crystals beneath the rostral floor of the brain.[6] The melon has a dense inner core composed primarily of wax esters, and a more liquid cortex containing triglycerides, and lies directly behind the spermaceti organ. Both the melon and the spermaceti organ are encased in a thick fibrous coat, resembling a bursa.[9] The whale produces sound by moving air through the right nasal cavity, which includes a valvular structure, or "museau de singe", with a thickened vocal reed, functioning like the vocal cords of humans. Both the melon and spermaceti organ are believed to be involved in focusing sound.[10]

The stomach has three chambers. The first chamber, or forestomach, is non-glandular, and opens directly into the second, fundic chamber, which is lined by digestive glands. A narrow tube runs from the second to the third, or pyloric, stomach, which is also glandular, and connects, via a sphincter, to the duodenum. Although fermentation of food material apparently occurs in the small intestine, there is no caecum.[11]

Reproduction

Although firm details concerning pygmy sperm whale reproduction are limited, they are believed to mate from April to September in the southern hemisphere.[6] Gestation lasts eleven months and, unusually for cetaceans, the female gives birth to the calf head-first[12]. Newborn calves are about 1.2 metres (3 ft 11 in) in length, and are weaned at around one year of age.[6]

Behaviour

The whale makes very inconspicuous movements. It rises to the surface slowly, with little splash or blow, and will remain there motionless for some time. In Japan the whale was historically known as the "floating whale" because of this. Its dive is equally lacking in grand flourish - it simply drops out of view. The species has a tendency to back away from rather than approach boats. Breaching has been observed, but is not common.[citation needed]

Pygmy sperm whales are normally either solitary, or found in pairs[13] but have been seen in groups of up to six.[citation needed] Dives have been estimated to last an average of eleven minutes, although longer dives of up to 45 minutes have been reported.[6] The ultrasonic clicks of pygmy sperm whales range from 60 to 200 kHz, peaking at 125 kHz,[14] and the animals also make much lower frequency "cries" at 1 to 2 kHz.[15]

Analysis of stomach contents suggests that pygmy sperm whales feed primarily on cephalopods, most commonly including bioluminescent species found in midwater environments. The most common prey are reported to include glass squid, and lycoteuthid and ommastrephid squid, although the whales also consume other squid, and octopuses. They have also been reported to eat some deep-sea shrimps, but, compared with dwarf sperm whales, relatively few fish.[6]

Predators may include great white sharks[16] and killer whales.[17]

Population and distribution

Pygmy sperm whales are found throughout the tropical and temperate waters of the Atlantic, Pacific and Indian Oceans.[6] However, they are rarely sighted at sea, so most data comes from stranded animals - making a precise range and migration map difficult. They are believed to prefer off-shore waters, and are most frequently sites in waters ranging from 400 to 1,000 metres (1,300 to 3,300 ft) in depth, especially where upwelling water produces local concentrations of zooplankton and animal prey.[18] Their status is usually described as rare, but occasional patches of higher density of strandings suggest it may be rather more common than previously supposed. The total population is unknown.

Fossils identified as belonging to Kogia breviceps have been recovered from Miocene deposits in Italy, as well as from Japan and southern Africa.[6]

Human interaction

Pygmy sperm whales have never been hunted on a wide scale. Land-based whalers have hunted them from Indonesia, Japan and the Lesser Antilles. Individuals have also been recorded killed in drift nets. Some stranded animals have been found with plastic bags in their stomachs - which may be a cause for concern. It is not known whether these activities are causing long-term damage to the survival of the species.

Pygmy sperm whales do not do well in captivity. The longest recorded survival in captivity is 21 months, and most captive individuals die within one month, mostly due to dehydration or dietary problems.[19]

Conservation

The pygmy sperm whale is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS) and the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS). The species is further included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU) and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU)

Specimens

  • MNZ MM002651, collected Hawke's Bay, New Zealand, no date data.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300128. 
  2. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Kogia breviceps. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ Handley, C. O. Jr. 1966. A synopsis of the genus Kogia (pygmy sperm whales). pp. 62-69 In: K. S. Norris (ed.), Whales, dolphins and porpoises. University of California Press, Berkeley
  4. ^ "Kogia breviceps (de Blainville, 1838)". Collections Online. Museum of New Zealand Te Papa Tongarewa. http://collections.tepapa.govt.nz/objectdetails.aspx?oid=755468. Retrieved 17 July 2010. 
  5. ^ Roest, A.I. (1970). "Kogia simus and other cetaceans from San Luis Obispo County, California". Journal of Mammalogy 51 (2): 410-317. http://www.jstor.org/stable/1378507. 
  6. ^ a b c d e f g h i j Bloodworth, B.E. & Odell, D.K. (2008). "Kogia breviceps (Cetacea: Kogiidae)". Mammalian Species: Number 819: pp. 1 – 12. doi:10.1644/819.1. 
  7. ^ http://rspb.royalsocietypublishing.org/content/278/1708/993.short?rss=1
  8. ^ Scott, M.D. & Cordaro, J.G. (1987). "Behavioral observations of the dwarf sperm whale, Kogia simus". Marine Mammal Science 3 (4): 353-354. doi:10.1111/j.1748-7692.1987.tb00322.x. 
  9. ^ Cranford, T.W., et al. (1996). "Functional morphology and homology in the odontocete nasal complex: implications for sound generation". Journal of Morphology 228 (2): 223-285. doi:10.1002/(SICI)1097-4687(199606)228:3<223::AID-JMOR1>3.0.CO;2-3. 
  10. ^ Clarke, M.R. (2003). "Production and control of sound by the small sperm whale, Kogia breviceps and K. sima and their implications for other Cetacea". Journal of the Marine Biological Association of the United Kingdom 83 (2): 241-263. doi:10.1017/S0025315403007045h. 
  11. ^ Hagey, L.R. et al. (1993). "Biliary bile acid composition of the Physeteridae (sperm whales)". Marine Mammal Science 9 (1): 23-33. doi:10.1111/j.1748-7692.1993.tb00423.x. 
  12. ^ Huckstadt, L.A. & Antezana, T. (2001). "An observation of parturition in a stranded Kogia breviceps". Marine Mammal Science 17 (2): 362-365. doi:10.1111/j.1748-7692.2001.tb01277.x. 
  13. ^ Willis, P.M. & Baird, R.W. (1998). "Status of the dwarf sperm whale, Kogia simus, with special reference to Canada". Canadian Field Naturalist 112 (1): 114-125. http://biodiversitylibrary.org/page/34257458. 
  14. ^ Marten, K. (2000). "Ultrasonic analysis of pygmy sperm whale (Kogia breviceps) and Hubbs' beaked whale (Mesoplodon carlhubbsi) clicks". Aquatic Mammals 26 (1): 45-48. http://www.aquaticmammalsjournal.org/share/AquaticMammalsIssueArchives/2000/AquaticMammals_26-01/26-01_Marten.pdf. 
  15. ^ Thomas, J.A. et al. (1990). "A new sound from a stranded pygmy sperm whale". Aquatic Mammals 16 (1): 28-30. http://www.aquaticmammalsjournal.org/share/AquaticMammalsIssueArchives/1990/Aquatic_Mammals_16_1/16.1Thomas.pdf. 
  16. ^ Long, D.J. (1991). "Apparent predation by a white shark Carcharadon charcharias on a pygmy sperm whale Kogia breviceps". Fishery Bulletin 89 (3): 538-540. http://fishbull.noaa.gov/893/long.pdf. 
  17. ^ Dunphy-Daly, M.M., et al. (2008). "Temporal variation in dwarf sperm whale (Kogia sima) habitat use and group size off Great Abaco Island, Bahamas". Marine Mammal Science 24 (1): 171-182. doi:10.1111/j.1748-7692.2007.00183.x. 
  18. ^ Davis, R.W., et al. (1998). "Physical habitat of cetaceans along the continental slope in the north-central and western Gulf of Mexico". Marine Mammal Science 14 (3): 490-607. doi:10.1111/j.1748-7692.1998.tb00738.x. 
  19. ^ Manire, C.A., et al. (2004). "An approach to the rehabilitation of Kogia spp.". Aquatic Mammals 30 (2): 257-270. doi:10.1578/AM.30.2.2004.257. 
  • Pygmy and Dwarf Sperm Whales by Donald F. McAlpine in Encyclopedia of Marine Mammals pp. 1007–1009 ISBN 978-0-12-551340-1
  • Whales Dolphins and Porpoises, Mark Carwardine, Dorling Kindersley Handbooks, ISBN 0-7513-2781-6
  • National Audubon Society Guide to Marine Mammals of the World, Reeves, Stewart, Clapham and Powell, ISBN 0-375-41141-0
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Placed in Physeteridae by some authors (e.g., Mead and Brownell (in Wilson and Reeder 1993, 2005). However, Jones et al. (1992), Baker et al. (2003), and Rice (1998) regarded Kogiidae as a family distinct from Physeteridae. Formerly regarded as conspecific with K. simus. Because of the uncertainty of identification, literature on K. breviceps published prior to the revision by Handley (1966) could refer to either K. breviceps or K. simus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!