Articles on this page are available in 1 other language: Spanish (30) (learn more)

Overview

Brief Summary

Description

"Sperm whales can dive deeper than 1.6 km and stay under for 90 minutes, although shorter, shallower dives are more usual. They eat squid and octopus, which are sucked into the mouth whole. The whale's head is huge. In addition to containing a very large brain, it houses the wax-filled spermaceti organ. Scientists are still trying to learn what this organ does. It might help absorb excess nitrogen during dives, or help buoyancy. A third possibility is that it helps in communication. Sperm whales make intense clicking sounds - presumably to communicate - and the spermaceti organ might help the sounds resonate. Sperm whales are found in breeding schools and bachelor schools. Breeding schools consist of about 20-40 mature females and juveniles of both sexes, accompanied by one or more mature males. Up to 50 males are found in bachelor groups. Females are sexually mature at 7-13 years, and males at 18-21 years. Pregnancy lasts 14 or 15 months, and females calve only every 3-6 years. So large, so slow to reproduce, and once heavily hunted for their spermaceti, blubber, and ambergris, which forms in the intestines and was used in the perfume industry, sperm whales are now vulnerable. Since 1986, there has been a moratorium on hunting them."

Links:
Mammal Species of the World
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. 1:76.Tenth Edition, Vol. 1. Laurentii Salvii, Stockholm, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

PhylogenyCurrently a single species is recognised worldwide.MorphologyBody
  • somewhat laterally compressed
  • sides of the body have a wrinkled appearance
  • a thick, rounded, low dorsal hump
  • followed by a series of crenulations which run the length of the tail stock
  • pectoral flippers are wide and spatulate in shape
  • tail flukes are
    • broad
    • triangular
    • with a comparatively straight trailing edge
  • caudal peduncle is deep
  • often a post-anal keel (Jefferson et al, 2008)
  • colour ranges from black to dark blue-grey to pale grey.
    • most animals have white colouration around the
      • mouth
      • belly
      • ano-genital region (Jefferson et al, 2008)
    • Males may become much paler with age
Head
  • one-quarter to one-third the total body length (Jefferson et al, 2008)
  • squarish in side profile
  • generally smooth
  • single S-shaped blowhole located on the left at the front of the head
  • shape of the head is determined by the presence of the spermaceti organ
Spermaceti organ
  • which may contain up to 1900 litres of waxy oil
  • exact function not fully understood it may
    • assist in evacuating the lungs and absorbing nitrogen at extreme pressures
    • regulate buoyancy during deep diving
    • reverberate and focus sounds (Nowak, 2003)
Mouth
  • lower jaw is exceptionally narrow
    • shorter than the upper jaw
  • contains 18 to 26 pairs of conical, functional teeth
  • teeth of the lower jaw insert into sockets in the soft tissue of the upper jaw
  • upper jaw may possess small, vestigial teeth, but these remain buried in the soft tissue
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Sperm whales live in either nursery or bachelor groups. Nursery groups consist of a number of adult females and immature males and females (2) (6). Males leave these groups when they become mature and join bachelor groups, which consist of males of 7 to 27 years of age (6). Older males live in small groups or singly, and visit nursery groups to mate with females during the breeding season (6). Most groups of sperm whales tend to number between 10 and 15 individuals (4). Sperm whales use echolocation to find their prey in the dark ocean depths (6). When foraging, powerful sound waves are emitted from the large head; these can stun and even kill the squid, octopuses and fish on which they feed (4). These whales make deep dives to depths of up to 3,000 meters (almost 2 miles) that can last as long as two hours (2) (6). This is the deepest dive made by any species of mammal (6). Males reach maturity at 10 years of age, but they do not begin to mate until they are around 19 years old and a length of 13 metres. Females become mature at between 7 and 11 years, when they are around nine metres in length. A single calf is born between July and November after a gestation period of around 16 months. The calf is suckled for up to two years (4). Groups of females protect their young by adopting a defensive 'marguerite formation' in which the calves are placed in the centre of the group surrounded by a circle of females, facing tail outwards (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Sperm whales are the largest of the odontocetes and the most sexually dimorphic cetaceans, with males considerably larger than females. The sperm whale is distinguished by its extremely large head, which takes up to 25 to 35% of its total body length. It is the only living cetacean that has a single blowhole asymmetrically situated on the left side of the head near the tip. Sperm whales are mostly dark gray, but oftentimes the interior of the mouth is bright white, and some whales have white patches on the belly. Their flippers are paddle-shaped and small compared to the size of the body, and their flukes are very triangular in shape. They have small dorsal fins that are low, thick, and usually rounded.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Size
Sexual dimorphism is extreme in sperm whales:
  • Adult males may be over 18 metres in length, whilst females are up to 12 metres (Jefferson et al, 2008).
  • Physically mature males may weigh between 35,000 and 50,000 kg, with females weighing around one-third as much (Nowak, 2003).
The sperm whale is the largest toothed predator on Earth. Historical records describe much larger sperm whales than are seen today. An example is held by the Natural History Museum in London; a sperm whale lower jaw measuring 16 feet 4 inches (5 metres), collected from the Pacific Ocean and displayed at the Great Exhibition in 1851, is calculated to be from a whale which may have been close to 80 feet (approximately 24 metres) in length.

Life Expectancy
Longevity of sperm whales has been studied using tooth-sections. Dentinal growth layers are counted to determine age, with some animals estimated to be up to 70 years old (Rice, 1989). Females are thought to live longer than males (Ralls et al, 1980).

Reproduction
Females reach sexual maturity at around age 9 years, whilst males may be as old as 20 years before they become sexually active (Best, 2007). Gestation has been calculated variously at 14 to 19 months (Nowak, 2003). During the breeding season, mixed age and sex schools of sperm whales are joined by large, older males. These schools then become known as harem schools, with one adult male for every ten adult females (Nowak, 2003).

Predation
Sperm whales are a top predator. However, they may sometimes be attacked by killer whales and other odontocetes (Jefferson et al, 2008). Tablespoon-sized scoop marks and oval scarring on the back and flanks of sperm whales are evidence of attack by small sharks such as the cookie-cutter shark Isistius (Best, 2007). Other extensive scarring often found on the head and body may represent interactions with giant squid or other sperm whales.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Physeter catodon, the sperm whale, is the largest toothed predator on Earth. Males can be over 18m long, weighing up to 50,000kg.Mature female sperm whales tend to live in social groups of up to 15 mature females and their offspring, whereas mature males live alone or in smaller groups.The sperm whale is listed as vunerable to extinction by the IUCN. Commercial whaling was the biggest threat to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Physeter catodon is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth (rather than baleen). It is an easily recognisable whale both at a distance and at close range. It has a large and distinctly square upper jaw which projects above the narrow lower jaw. The body is black to charcoal grey in colour, while the inside of the mouth and the lips are white. The blowhole is positioned at the front of the head. A dorsal hump is present two-thirds down the body followed by a serrated midline. The flippers are almost rectangular.Sperm whales are usually found in medium to large groups of up to 50 individuals, although bulls are sometimes seen alone. The blow is unique amongst whales by being obliquely forward directed. The tail flukes will often appear before a deep dive. Dives may last up to 2 hours long (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The sperm whale is the largest of the toothed whales, with males growing up to 20 metres in length. It also has the largest brain of any living animal, and it was a sperm whale that was pitted against Captain Ahab in Herman Melville's classic novel, Moby Dick (2). Sperm whales have huge square heads, comprising almost a third of the total body length (2) (3); indeed the specific name macrocephalus means large head. Uniquely among cetaceans, the single blowhole is located on the left of the head rather than on the top (3) and so these whales are easily identified at a distance by their low, bushy spout, which is projected forward and slightly to the left (2). Further down the body toward the tail there is usually a large hump on the back, followed by a series of smaller bumps (3). The dark brown to bluish-black skin, which is splotched and scratched, is said to have a texture like that of a plum stone (2) (3). Males tend to be somewhat larger and heavier than females (3), and have larger heads in relation to their body size (6). The huge heads of sperm whales contain a large cavity, the spermaceti organ, filled with a waxy liquid called spermaceti oil. This wax can be cooled or heated, possibly by water sucked in through the blowhole, and thus shrinks and increases in density (helping the whale sink), or expands and decreases in density (helping the whale rise to the surface) (5). Whalers likened the substance to semen, and this is the origin of the common name of the species (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Sperm whales are found throughout the world's oceans in deep waters to the edge of the ice at both poles (Waring et al. 2009 and references therein).

According to Waring et al. (2009), results of multi-disciplinary research conducted in the Gulf of Mexico during the first decade of the 21st Century confirm speculation that Gulf of Mexico Sperm Whales constitute a stock that is distinct from other Atlantic Ocean stocks(s). Sperm whales were commercially hunted in the Gulf of Mexico by American whalers from sailing vessels until the early 1900s. In the northern Gulf of Mexico (i.e., U.S. Gulf of Mexico), systematic aerial and ship surveys indicate that sperm whales inhabit continental slope and oceanic waters, where they are widely distributed. Seasonal aerial surveys confirm that sperm whales are present in at least the northern Gulf of Mexico in all seasons. The best available estimates indicate a population of around 1,500 Sperm Whales in the northern Gulf of Mexico. (Waring et al. 2009 and references therein)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Soulanille, Elaine

Source: EOL Rapid Response Team

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

The sperm whale has a large geographic range (Rice 1989). It can be seen in nearly all marine regions, from the equator to high latitudes, but is generally found in continental slope or deeper water. The distribution extends to many enclosed or partially-enclosed seas, such as the Mediterranean Sea, Sea of Okhotsk, Gulf of California, and Gulf of Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Sperm whales roam the deep waters of all the oceans, though they seldom approach polar ice fields and are most common in temperate and tropical latitudes. They have also be seen occasionally near coastlines in the Gulf of Mexico, where they were once quite common.

Biogeographic Regions: arctic ocean (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans; Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Doel, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Gulf of St. Lawrence, Knokke, Koksijde, Mediterranean Sea, New Zealand Exclusive Economic Zone, North West Atlantic, Seychelles, St. Lawrence Estuary, Subantarctic Waters, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Mediterranean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Sperm whales inhabit all oceans of the world. They can be seen close to the edge of pack ice in both hemispheres and are also common along the equator, especially in the Pacific. Sperm whales are found throughout the world's oceans in deep waters between about 60° N and 60° S latitudes. Their distribution is dependent on their food source and suitable conditions for breeding, and varies with the sex and age composition of the group. Sperm whale migrations are not as predictable or well understood as migrations of most baleen whales. In some mid-latitudes, there seems to be a general trend to migrate north and south depending on the seasons (whales move poleward in the summer). However, in tropical and temperate areas, there appears to be no obvious seasonal migration.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout the world's oceans; adult females and young generally stay between 40 degrees north and 40 degrees south latitude. Nonbreeding males range into high latitude waters. Northern and southern hemisphere populations apparently are reproductively isolated from each other. See IUCN (1991) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Oceanic

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution
WorldwideThe sperm whale is found in all oceans and adjoining seas except polar ice fields (Rice, 1977). Generally, only large, older males venture to the extreme northern and southern portions of the range, pole-ward of about 40-50 degrees latitude (Jefferson et al, 2008).

Abundance
The most recent assessment of abundance using ‘best estimate’ model parameters puts the total global population of sperm whales at around 360,000 (Whitehead, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Equatorial to polar in all world's oceans.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Sperm whales are found in all of the oceans of the world, except the high Arctic (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Above weights are given for mature male giant sperm whales. Females only weigh about 1/3 as much as males. Males may reach 19 m while females are only 12 meters. Newborn calves measure about 4 m and are about 1/25 the weight of females.

The enormous (up to 1/3 of total body length), box-like head of Physeter catodon sets it apart from all other species. The head contains a spermaceti organ whose function is not entirely known. It may serve to focus and reflect sound or may be a cooling organ to diminish the whale's volume and its buoyancy during prolonged dives. The giant sperm whale has the largest of mammalian brains in terms of sheer mass (approximately 9 kg). The blowhole slit is S-shaped and positioned on the left side of the head. There are 18-28 functional teeth on each side of the lower jaws, but the upper teeth are few, weak and nonfunctional. The lower teeth fit into sockets in the upper jaw. The gullet of Physeter catodon is the largest among cetaceans; it is in fact the only gullet large enough to swallow a human.

The dorsal fin is replaced by a hump and by a series of longitudinal ridges on the posterior part of the back, and the pectoral fins are quite small, approximately 200 cm. long. Tail flukes are 400-450 cm. The blubber layer of the giant sperm whale is quite thick, up to 35 cm. With respect to coloration, males often become paler and sometimes piebald with age. Both sexes have white in the genital and anal regions and on the lower jaws.

Range mass: 35000 to 50000 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Male length: 16 m. Female length: 11 m. Female weight: 15 tons. Male weight: 45 tons.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 1830 cm

Weight: 4.8E7 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: Females 11-12 m. Males 15-18 m.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males may be twice as large as females.

Length:
Range: 11.0-18.3 m males; 8.3-12.5 m females

Weight:
Range: 11,000-57,000 kg males; 6,800-24,000 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

The enormous (up to 1/3 of total body length), box-like head of the sperm whale sets it apart from all other species.The blowhole slit is S-shaped and positioned forward on the left side of the head. There are 18-28 functional teeth on each side of the lower jaws, but the upper teeth are few, weak and nonfunctional. The lower teeth fit into sockets in the upper jaw. The gullet of is the largest among cetaceans; it is in fact the only gullet large enough to accomodate a human. The dorsal fin is replaced by a hump and a series of longitudinal ridges on the posterior part of the back. The flippers are quite small, approximately 200 cm. long. Tail flukes are 400-450 cm in width. The blubber layer of the sperm whale is quite thick, up to 35 cm. With respect to coloration, males often become paler and sometimes piebald with age. Both sexes have white in the genital and anal regions and on the lower jaws.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The habitat of the sperm whale is the open sea. More specifically, sperm whales can be found in almost all marine waters deeper than 1,000 m that are not covered by ice, except in the Black Sea and possibly the Red Sea (Rice 1989; Whitehead 2003). In some areas, particularly in the western North Atlantic, sperm whales, especially males, can occur in shallower waters (e.g., Scott and Sadove 1997). Females and young are usually restricted to waters at latitudes lower than about 40-50º and to areas where sea surface temperatures are greater than about 15ºC (Rice 1989). Sperm whales are generally more numerous in areas of relatively high primary productivity (Jaquet et al. 1996), although there are some exceptions, such as the Sargasso Sea and the central North Pacific gyre (Barlow and Taylor 2005).

The sperm whale is an animal of extremes in size (up to 18 m), sexual dimorphism (mature males have three times the mass of mature females), ecological imprint (sperm whales take roughly the same amount of biomass from the oceans as humans), and many other attributes (Whitehead 2003). The commercial value of the animal (a function of its size and the quality of sperm whale oil) drove two massive worldwide hunts: the technologically primitive “open-boat” hunt from 1712-~1920 (Starbuck 1878; Best 1983), and modern whaling using engine-driven whaling ships and harpoon guns from ~1910-1988 (Tonnessen and Johnsen 1982). The complex social structure of sperm whales may have been affected by whaling, lowering potential population growth rates, which are very low anyway (Whitehead 2003). On the positive side, sperm whales are very widely distributed (see above), and their primary prey, deep-water squid, are not yet major targets of fisheries.

The generation time (mean age of mothers) for sperm whales can be calculated if one assumes a set of population parameters, specifically age at first birth, mortality rate of mature females, and reproductive rate of mature females. There is uncertainty about these parameters, so two calculations were made using different assumptions:

a) Applying the population parameters most recently used for sperm whales by the International Whaling Commission’s Scientific Committee (International Whaling Commission 1982): age at first birth = 10 years; female reproductive rate in unexploited population = 0.20/year; female adult mortality = 0.055/yr): generation time = 27.3 years.

b) The estimates of mortality used by the International Whaling Commission are particularly problematic, and sperm whales likely have age-specific survival and reproductive rates. Thus it may be more realistic (Whitehead 2002) to use the well-established mortality schedule of killer whales (Orcinus orca; Olesiuk et al. 1990) and an age-specific pregnancy rate taken from the sperm whale data presented by Best et al. (1984; pregnancy rate for mature females = 0.257-0.0038xAge in years): generation time = 27.5

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Sperm whales swim through deep waters to depths of 2 miles, apparently limited in depth only by the time it takes to swim down and back to the surface. Their distributions are depend upon season and sexual/social status, however they are most likely to be found in waters inhabited by squid- at least 1,000 m deep and with cold-water upswellings. Because they are so well-adapted for deep water swimming, they are in real danger of stranding when they move inshore.

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The habitat of the Sperm Whale is difficult to categories due to the cosmopolitan nature of this species and its ability to inhabit all oceans. Sperm Whales tend to inhabit offshore areas with a water depth of 600 m or more, and are uncommon in waters less than 300 m deep. Female Sperm Whales are generally found in deep waters (at least 1000 m) of low latitudes (less than 40° N, except in the North Pacific where they are found as high as 50° N). These conditions generally correspond to sea surface temperatures greater than 15 °C, and while female Sperm Whales are sometimes seen near oceanic islands, they are typically far from land.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Pelagic, prefers deep water, sometimes around islands or in shallow shelf waters (e.g., 40-70 m; Scott and Sadove 1997). Tend to occur in highest densities near productive waters, and often near steep drop-offs or strong oceanographic features, e.g. edges of continental shelves, large islands, and offshore banks and over submarine trenches and canyons (Gosho et al. 1984, Reeves and Whitehead 1997, Gregr and Trites 2001, Whitehead 2003). Females generally restricted to waters with surface temperatures warmer than about 15 degrees C and rarely found in waters less than 1000 m deep. Males, although primarily found in deep water, are sometimes found in waters 200 to 1000 m deep (Reeves and Whitehead 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The sperm whale is an oceanic deep-sea species that may dive down to a few kilometers in depth.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Deep marine waters, warm and cold.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits the open ocean in offshore areas, although providing that water is deeper than 200 metres they may occasionally be seen closer to land (2). They occur in tropical to sub-polar waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Seasonal north-south migration; at higher latitudes in summer than in winter. Males move north in the summer to feed. In fall, both sexes migrate toward the equator. In winter, typically distributed south of 40 degrees N. Females, calves, and young remain in tropical or temperate waters while older males migrate to higher latitudes in summer. Males sometimes occur as far north as the Bering Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Physeter catodon feeds mainly on squid (especially giant squid), octopus and deepwater fishes, but it also take sharks and skates. It consumes approximately 3 per cent of its body weight in squid per day.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats primarily medium to large squids, sometimes also octopus and various fishes. Large males at high latitudes also take large quantities of demersal and mesopelagic sharks, skates and fishes (Gosho et al. 1984, Jefferson et al.1993, Perry et al. 1999, Whitehead 2003). Dives deeply when foraging, some dives over 1800 m have been recorded, but most are less than 500 m (Potter and Birchler, in Wilson and Ruff 1999). Apparently feeds throughout the year. Although species population depleted by whaling, may take about 75 million metric tons of food from the ocean each year; an amount similar to that taken by all human marine fisheries (Whitehead 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Large squid, octopuses, demersal fish, rays, sharks, sometimes crustaceans.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known predators

Physeter catodon (sperm whale) is prey of:
Homo sapiens

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Physeter catodon (sperm whale) preys on:
Cephalopoda

Based on studies in:
Antarctic (Marine)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / carrion / dead animal feeder
fruitbody of Psilocybe inquilinus feeds on dead washed up bone of Physeter catodon
Other: unusual host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: World population in the mid-1980s was estimated at 982,200 (410,700 in the southern ocean, 100,000 in Atlantic, 275,000 in eastern Pacific, 198,000 in western Pacific. Other estimates range from 700,000 to 2 million (Matthews and Moseley 1990). More recently, Whitehead (2003) estimated global population of very approximately 360,000 whales based on extrapolation from visual surveys. None of these estimates should be regarded as particularly precise (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Basic social unit is mixed school of adult females plus their calves and juveniles (usually about 20-40 individuals). As males grow older they leave this group and form bachelor schools (of variable sizes up to about 50 individuals). The largest males tend to be solitary (but see Christal and Whitehead 1997). Likely the world's deepest diving mammal (documented at 2,500 m.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Because sperm whales spend most of their time in deep waters, their diet consists of many larger organisms that also occupy deep waters of the ocean. Their principle prey are large squid weighing between 0.1 kg and 10 kg, but they will also eat large demersal and mesopelagic sharks, skates, and fishes. The average dive lasts about 35 minutes and is usually down 400 m, however dives may last over an hour and reach depths over 1000 m.

Female sperm whales reach sexual maturity around 9 years of age when they are roughly 9 m long. At this point, growth slows and they produce a calf approximately once every five years. After a 14-16 month gestation period, a single calf about 4 m long is born. Although calves will eat solid food before one year of age, they continue to suckle for several years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Sperm whale social units tend to comprise up to 15 mature females and their offspring, but larger aggregations of up to 30 may occur, possibly to enhance foraging opportunities (Best, 2007; Rice, 1989). When threatened or attacked, sperm whales may gather into a circle with their heads pointing inwards and with calves protected in the middle (Jefferson et al, 2008). Juvenile males separate from these mixed units around puberty, grouping together in so-called batchelor schools of up to 50 animals. As the males mature and grow larger, they detach from these batchelor groups and either become solitary or form much smaller groups of around 6 animals (Best, 1979).

Feeding
The major prey of sperm whales is cephalopods (octopuses, squid), though other invertebrates and fish have been found in stomach contents. Primary prey species include squids of the genera Architeuthis (giant squid), Moroteuthis, Gonatopsis, Histioteuthis and Galiteuthis (Jefferson et al, 2008). Sperm whales are exceptionally deep and long divers. Dives of over 2000 metres lasting more than one hour have been recorded, though stomach contents recovered from one individual taken at 3193 metres contained the remains of a bottom-dwelling shark, suggesting deeper dives may be possible (Watkins et al, 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
77.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 77 years (wild) Observations: This whale has the biggest brain among mammals weighting about 9.2 Kg (Ronald Nowak 1999).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

These whales have a polygamous mating system. During the breeding season, breeding schools composed of 1-5 large males and a mixed group of females and males of various ages form. At this point, there is intense competition among the males for females (including physical competition resulting in battle scars all over the heads of males). Only about 10-25% of fully adult males in a population are able to breed.

Mating System: polygynous

Females mature sexually at 8-11 years, and males mature at approximately 10 years, although males do not mate until 25-27 years old because they do not have a high enough social status in a breeding school until that point. Maximum known life span is 77 years. Gestation period is 14-16 months and a single calf is born, which nurses for up to 2 years. The reproductive cycle occurs in females every 2-5 years. The peak of the mating season is in the spring in both Northern and Southern hemispheres so that most calves are born in the fall.

Breeding interval: The reproductive cycle occurs in females every 2-5 years

Breeding season: The peak of the mating season is in the spring in both Northern and Southern hemispheres

Average number of offspring: 1.

Range gestation period: 14 to 16 months.

Range weaning age: 24 (high) months.

Average weaning age: 24 months.

Range age at sexual or reproductive maturity (female): 8 to 11 years.

Average age at sexual or reproductive maturity (male): 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 1e+06 g.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
3650 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gestation lasts 14-15 months. Births occur May-September in Northern Hemisphere, November-March in Southern Hemisphere. Single young is produced every 3-6 years. Young are weaned in about 1.5-3.5 years, though young may continue to nurse for several years. Females sexually mature at 7-11 years; pregnancy rate gradually declines after age 14. Males may not breed until about 25 years old. May up to at least 60-70 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating season takes place from late winter to early summer. Gestation period is approximately 14-15 months, young are 3.5-4.5 m long at birth. Calves nurse for up to 2 years.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Barcode

Statistics of barcoding coverage

Barcode of Life Data Systems (BOLD) Stats
                                                             
Specimen Records:3
Specimens with Sequences:2
Specimens with Barcodes:2
Public Records:2
Species:2
Species With Barcodes:1
  
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology

Barcode data: Physeter catodon

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0089-06|AJ277029|Physeter catodon| AACCGCTGATTATTCTCAACCAACCATAAGGACATCGGCACTCTATATCTACTATTCGGTGCCTGAGCGGGAATGGTGGGCACTGGCCTA---AGCTTGCTAATCCGCACCGAGTTAGGCCAACCCGGTACATTAATTGGGGAT---GACCAAGTCTACAACGTGCTGGTAACAGCTCACGCCTTTGTGATAATTTTCTTCATAGTCATACCCATCATAATTGGCGGTTTCGGAAACTGATTAGTTCCTCTAATA---ATCGGAGCACCTGACATAGCCTTTCCTCGTATAAATAACATGAGCTTCTGACTACTCCCCCCTTCATTCCTACTACTAATAGCTTCTTCAATAGTCGAAGCCGGCGCAGGTACAGGCTGGACTGTTTACCCCCCTCTAGCCGGAAATTTAGCACATGCAGGAGCATCCGTAGACCTT---ACCATCTTTTCCCTACACCTAGCTGGTGTCTCCTCAATCCTTGGAGCCATCAACTTTATTACAACCATTATCAACATAAAACCCCCAGCCATAACTCAATACCAAACACCTCTCTTCGTATGATCTATTTTAGTCACGGCTGTATTGCTCCTCCTATCCCTACCAGTCTTAGCAGCT---GGAATCACCATACTGTTAACCGACCGAAACCTAAATACAACTTTCTTTGACCCGGCAGGAGGAGGAGACCCTGTTTTGTATCAACACTTATTCTGATTCTTCGGTCACCCTGAGGTCTATATTCTAATCCTACCTGGCTTCGGAATAATCTCCCACATCGTAACTTATTATTCCGGGAAAAAA---GAGCCCTTTGGATATATGGGAATAGTCTGGGCTATAATCTCTATTGGATTCTTAGGCTTTATCGTATGAGCCCACCACATATTCACTGTAGGTATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Physeter catodon

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A1d

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Contributor/s

Justification
The cause of the population reduction in this species (commercial whaling) is reversible, understood, and is not currently in operation. For this reason, the species is assessed under criterion A1, not under A2, A3 or A4. Physeter macrocephalus is globally widespread (thus not qualifying as threatened under criterion B), and does not have a global population that warrants listing under criteria C-D. Empirical trend data for this species globally are unavailable. However, commercial whaling at a large scale for this species in the North Pacific and Antarctic within the last three generations (82 years) certainly resulted in a global decline during this period. Commercial whaling for this species has ceased and therefore this population is evaluated under the A1 criterion rather than under the A2-4 criteria. A peer-reviewed publication (Whitehead 2002) provides a model-based estimate of global trend that can be used to evaluate the population under the A1 criterion. The results from that study gave a 6% probability for Endangered, a 54% probability of meeting the Vulnerable category, and a 40% probability of falling into the Near Threatened category. The results suggest little chance that the population would meet the criteria for Endangered or for Least Concern. There is credible and realistic evidence for either the Vulnerable or Near Threatened category. Given that the results give greater probability for at least the Vulnerable category (60%), and that this is the more precautionary category, the species is classified as Vulnerable.

History
  • 1996
    Vulnerable
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Sperm whales were once quite abundant in the Gulf of Mexico, but due to commercial whaling operations, they are seldom seen in this area anymore. Worldwide however, sperm whales populations are more stable than that of many other whales, although they continue to be listed as endangered by USDI (1980). The sperm whale is now the most abundant of the great whales, having been hunted with less intensity that the baleen whales. Worldwide, sperm whales number about 1,500,000.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G3 - Vulnerable

Reasons: Occurs widely in all oceans; protected by international and national regulations; total population is large (several hundred thousand) but trend is difficult to determine; threatened by general deterioration of marine ecosystem.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Physeter macrocephalus, see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status
The IUCN Red List (2009) has the sperm whale listed as VU (vulnerable). The species is also currently listed as CITES Appendix I.

Threats
Commercial whaling activities were formerly the biggest threat to this species. Entanglement in fishing gear and collision with shipping are also considered potential threats, as are anthropogenic noise disturbance and chemical pollution.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Sperm Whale is listed as an endangered species under the ESA. IWC regulations have halted the commercial take of this species. Listed in CITES Appendices I and (for some countries) II. There is some concern over the number of Sperm Whales entangled in fishing gear.
  • IUCN Red Book, NMFS/NOAA Technical Memo
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1) and listed under Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The only recent quantitative analysis of sperm whale population trends (Whitehead 2002; Fig. 1 in linked PDF document, which constitutes an integral part of this assessment) suggests that a pre-whaling global population of about 1,100,000 had been reduced by about 29% by 1880 through “open-boat” whaling, and then to approximately 360,000 (67% reduction from initial) by the 1990s through modern whaling, although much uncertainty is associated with all these estimates (Fig. 1 in linked PDF document). There is no direct evidence that any part of the population has increased since the end of large-scale whaling in about 1980, although for most areas there is also no direct evidence that they have not. In some areas there is concern that populations are continuing to decline (see below).

The species has a huge geographic range (Rice 1989) and a global population size in the 100,000's (Whitehead 2002; Fig 1). Although there is considerable uncertainty about sperm whale population parameters and levels of exploitation, Whitehead (2002) estimated historical trajectories of sperm whale abundance incorporating many, but not all, sources of uncertainty (Fig. 1 in linked PDF document). That model was modified slightly (to produce an endpoint in 2003) and run to estimate the decline in global sperm whale population size between 1921 and 2003 (i.e. over approximately 3 generations; 82yr; see below for estimation of generation time) (H. Whitehead pers. comm.). As sperm whale population size seems to have changed rather little between about 1910-1930 (Whitehead 2002; Fig. 1 in linked PDF document), the calculations are probably quite robust with reference to the estimated generation time. Using the “best” estimates of the model parameters (as in Whitehead 2002), the population in 2003 would have been 44% of that in 1921. Of 1,000 runs using model parameters randomly selected from within reasonable ranges (as in Whitehead 2002), 6% gave populations in 2003 of <30% of that in 1922, 54% gave a 2003 population between 30-50% of that in 1992, and 40% suggested depletion levels of less than 50% over this time.

Arguments can be made that the model results are overly optimistic or overly pessimistic. Factors that would contribute to making the results overly optimistic that are not accounted for in the model include not accounting for under-reporting of illegal Soviet catches in the North Pacific and Antarctica and under-reporting of Japanese catches in the North Pacific (Kasuya and Brownell 2001), other continuing threats (described below), and factors such as continuing effects of social disruption from whaling that might inhibit recovery (consistent with an apparent lack of recovery in many areas). Factors that would contribute to making the results overly pessimistic include the assumption of a relatively low rate of increase in the model and the extrapolation of a relatively high estimate of g(0) (the proportion of whales detected on the trackline) from a single study to the global population. The direction of the effect of other uncertainties in model inputs, including the effects of sex-biased catches, is not certain. Despite these uncertainties, the Whitehead model provides the best available scientific evidence upon which to base this assessment. To reduce these uncertainties, future analyses would need to address the concerns identified above.

Efforts to assess the conservation status of sperm whales and the impact of historical whaling on contemporary structure are compromised by the absence of a good model of sperm whale population structure; pooling data may obscure distinct geographic patterns. While sperm whales are known to show long distance movements (Ivashin and Rovnin 1967; Mitchell 1975) and low genetic differentiation among ocean basins, several lines of evidence suggest that sperm whales past and present, have significant geographic structure. Analyses based on historical and contemporary data from tagging records (Rice 1974; Kasuya and Miyashita 1988), blood types (Fujino 1963), catch distributions, sighting patterns, size composition, lack of recovery from exploitation (Japan), timing of pregnancy (Best et al.1984), photo-identification (Whitehead 2003), genetics (Drouot 2004; Mesnick et al. 1999), cultural markers (Rendell and Whitehead 2003) and combinations thereof (Bannister and Mitchell 1980; Kasuya and Miyashita 1988) suggest evidence for structure in many regions. Over the past decade, several authors have investigated population structure in female sperm whales using sequence variation within the mitochondrial control region DNA (mtDNA) and/or polymorphic nuclear loci (microsatellites). In general, results tend to find low genetic differentiation among ocean basins and little evidence of subdivision within ocean basins, with the exception of some isolated basins such as the Mediterranean and Gulf of Mexico (Lyrholm et al. 1999; Mesnick et al. 1999; Drouot et al. 2004). However, factors such as low sample sizes, low mtDNA haplotypic diversity and social structure alone and together reduce the power to detect population structure. In addition, it is clear that biologically discrete populations of odontocetes can occur independently of strong geographic or oceanographic features. Alternative, non-geographic based hypotheses of population structure, such as dialect and differences in diet such as are found in killer whales, have not been thoroughly examined. For example, Rendell and Whitehead (2003) suggest that female populations seem to be culturally structured within oceans by “coda” vocalizations and may be genetically distinct (Rendell and Whitehead 2005, Rendell et al. 2005).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Unknown

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The greatest threat to sperm whales, extensive commercial whaling, has ceased. However, a number of other threats of various dimensions remain.

Sperm whales have had a long history of local whaling going back at least to the 1500s and intense commercial whaling beginning around 1712 and continuing to 1988. The “modern” highly mechanised phase was particularly intense around 1950, and at its peak killed around 25,000 whales per year, dramatically depleting the global population. In recent decades, some tens of whales were taken each year from small boats in Indonesia (Reeves 2002), although none have been taken in the last two years (H. Whitehead pers. comm.), and 10 are taken annually by Japan under IWC Special Permit (Clapham et al. 2003).

Entanglement in fishing gear, particularly gillnets, has been a particular problem in the Mediterranean Sea (Reeves and Notarbartolo di Sciara, 2006), but sperm whales die from entanglement in nets and lines in many other areas and in a variety of fisheries as well (e.g., Haase and Félix 1994; Barlow and Cameron 2003). Considering the widespread distribution of sperm whales, observations of occasional takes in relatively small scale gillnet fisheries (e.g. Barlow and Cameron 2003) suggest much larger takes in unobserved, unregulated high seas driftnet fisheries such as were common before the 1989 adoption of resolution 44/225 of the UN General Assembly.

Sperm whales sometimes take fish off fishing gear (most often demersal long-line gear), an activity known as “depredation.” Depredation of long-line catches appears to be a recent and increasing phenomenon, and now occurs in many regions (e.g., South East Alaska, Chile, South Georgia and several other southern ocean island areas, North Atlantic). This interaction has resulted in a few reported entanglements and deaths (e.g. Salas 1987; Hucke-Gaete et al. 2004), and has incurred hostility from some fishermen (National Marine Fisheries Service 1998; Donoghue et al. 2003), including shooting of whales (González and Olivarría 2002).

Sperm whale tissues have high levels of some contaminants (O'Shea 1999; Nielsen et al. 2000); however, any population-level effects on health are unknown. The effects of noise on sperm whales are also uncertain. Some evidence suggests that they are highly sensitive to noise (e.g., Watkins et al. 1985; Bowles et al. 1994) while other studies have found little or no effect (e.g., Madsen and Møhl 2000; Madsen et al. 2002). To date, all published studies of sperm whales and noise focus on short-term behavioural effects. Avoidance of sonar (Dawson pers. comm.) and seismic surveys (Mate et al. 1994; but see Madsen et al. 2002) has been observed but no mortality has been documented.

Whaling on sperm whales has at various times focussed almost exclusively on one sex or the other. Removals of large numbers of males may have had lingering effects on pregnancy rates in some subpopulations (Best 1979; Clarke et al. 1980; Whitehead et al. 1997) and large males are noticeably uncommon on some breeding grounds (Whitehead 2003). The removal of large numbers of females from social groups, and of older females in particular, may have lingering, socially disruptive effects. Furthermore, recovery might be inhibited via temporary or permanent loss of social cohesion and of socio-ecological knowledge such as is known to occur in other large-brained, long-lived social mammals (e.g., elephants, Poole and Thomsen 1989).

Maximum rates of increase for sperm whale populations are very low, possibly on the order of 1% per year (Whitehead 2002). Population growth/recovery can be expected to be low in the species.

Sperm whales face other threats at a more regional level. These include collisions with ships (Laist et al. 2001), for instance off the Canary Islands (André and Potter 2000) and in the Mediterranean (Pesante et al. 2002), and ingestion of marine debris in the Mediterranean (e.g., Viale et al. 1992).

Causes for optimism: On the one hand, the sperm whale is not being heavily whaled at present and seems relatively secure from this threat in the short and medium term. When not being actively hunted, the sperm whale has rather little interaction with humans: most of its habitat is far from land, and few of its food sources (principally deep-water squid) are of currently harvested (Clarke 1977). Some populations, for instance the animals in the western North Atlantic that were little affected by modern whaling, seem healthy with reasonably high population densities and evidence of satisfactory reproduction (Gordon et al. 1998; National Marine Fisheries Service 2000).

Causes for concern: on the other hand, the sperm whale, with a maximum rate of increase of around 1% per year (Whitehead 2002), is not well adapted to recover from population depletion. Furthermore, the population model considers only one anthropogenic threat, whaling, and thus posits that the sperm whale population has recovered since about 1980 (Fig. 1 in linked PDF document), when large-scale commercial whaling was rapidly coming to an end. This recovery is purely theoretical, and may not be occurring as sperm whales carry high levels of some chemical contaminants (O'Shea 1999; Nielsen et al. 2000), ocean noise is increasing (Gordon and Moscrop 1996), interactions with fisheries continue to result in sperm whale deaths (International Whaling Commission 1994), and the lingering, socially disruptive effects of whaling may be inhibiting recovery of this highly social species (Whitehead et al. 1997). Some regional populations of sperm whales are declining or are apparently not recovering from depletion. Even in the absence of whaling, the Mediterranean population appears to have declined over the past 20 years, with bycatch in driftnets a likely principal cause (Reeves and Notarbartolo di Sciara 2006). The southeastern Pacific sperm whale population, very heavily whaled during the period 1950-1980, has an extremely low recruitment rate (probably below replacement), perhaps because of the social disruption caused by intense whaling (Whitehead et al. 1997). The population of mature and maturing males in the Antarctic was also heavily whaled over the same period, but should have repopulated from less heavily exploited breeding populations at lower latitudes following the end of large-scale commercial whaling. However, systematic surveys of sperm whales in the Antarctic showed no substantial or statistically significant increase between 1978 and 1992 (Branch and Butterworth 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Historically hunted for spermaceti, ambergris, and oil. No longer threatened by direct catching, but entanglement in fishing gear may cause mortality in some areas. Potentially threatened by ocean pollution and ingestion of plastics. Since the introduction of fast ferries into the Canary Islands in 1999, significant increases in collisions fatal to whales, mainly sperm whales, have been observed (Tregenza et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Sperm whales have a long history of commercial exploitation (1). Large-scale hunting began in 1712 in the North Atlantic, based at Nantucket in America (4). They were not widely hunted for their meat, but for ambergris and spermaceti. Ambergris is a substance that collects around the indigestible beaks of squid in the stomach of the whale, and was highly prized for use as a fixative in the perfume industry. Although artificial alternatives are now available, some perfume makers prefer to use ambergris today. Spermatceti was used in the production of cosmetics and candles (7). Sperm whales still have an economic value today for meat in Japan. Since the 1980s, the International Whaling Commission brought an international moratorium on whaling into force. Despite this measure, Japan continues to hunt sperm whales, and relatively small numbers are taken each year with hand harpoons at Lamalera, Indonesia (1). Further threats include entanglement in fishing gear and collisions with boats (1). Although whaling has, with the exceptions outlined above, largely ceased, the after-effects of such prolonged and intensive hunting are still being felt today. It is thought that the selective hunting of the largest, breeding males will have decreased pregnancy rates, and the loss of the largest females from nursery groups would have decreased the survival of the groups (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is on Appendix I of CITES and Appendices I and II of CMS.

Management plans need both development and implementation. The International Whaling Commission manages sperm whale populations under the International Convention for the Regulation of Whaling, and Schedule of the Convention lists sperm whale seasons, sperm whale size limits and sperm whale catch limits (0 at present), as well as sanctuaries for all species in the Indian and Southern Oceans. However, no scheme for managing sperm whale populations is in place. Moreover, many range states are not members of the International Whaling Commission.

Regional subpopulations of sperm whales exist, and there has been an apparent lack of recovery in some areas or even continued decline (e.g., the Mediterranean (Reeves and Notarbartolo di Sciara 2006). Therefore, further assessments of the status of sperm whales should be conducted at the subpopulation level.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Studies needed that combine immunology, toxicology and demography and that involve populations occurring over a gradient of environments, to assess the effects of chemical pollution (Reeves and Reijnders 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Enforce international and national protection measures. Prevent habitat degradation caused by dumping of toxic wastes, sewage, and garbage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

As a species, the sperm whale is not facing immediate threat, but some populations need to be carefully monitored, and there is need for tight management of any exploitation (1). In the eastern tropical Pacific, recent whaling was extremely intensive, and birth rates at present are very low. The Mediterranean population is particularly susceptible to collisions with ships and entanglement with fishing gear (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Being fiercly aggressive, bull giant sperm whales posed a threat to small-boat whalers in the 19th century. Sperm whales are no match for modern whaling equipment, however. They have also been known to become entangled in trans-Atlantic telephone in dives 3/4 mile deep, but this type of incident is rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The head of the sperm whale contains 3-4 tons of spermaceti, a substance valued as a lubricant for fine machinery and a component of automatic transmission fluid. It is also used in making ointments and fine, smokeless candles (once it solidifies into a white wax upon exposure to air). Physeter catodon has also been a target of commercial whaling in years gone by, notably in areas around the Gulf of Mexico. The meat of the whale is not generally consumed. Instead, spermaceti is extracted from the head, and the teeth are often used as a medium for the artistic form of engraving and carving known as scrimshaw. The most important product obtained from giant sperm whales is the oil once used as fuel for lamps and now used as a lubricant and as the base for skin creams and cosmetics. A gummy substance called ambergris forms in the large intestines of sperm whales and can be found floating on the surface of the water or washed ashore once it is expelled. It was once believed to have medicinal qualities, but it is now used in connection with manufacture of perfumes, based on the fact that when it is exposed to air, it hardens and acquires a sweet, earthy smell. The island Ambergris Cay, just south of the Gulf of Mexico, was given its name because of the great quantities of this substance gathered along its shores.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Source of ambergris (formed in digestive system), which has been used as fixative in perfume industry. Formerly (prior to ban on whaling) a very important commercial species (source of oil, spermaceti, and meal), with annual harvests peaking in the 1960s at 29,000. See IUCN (1991) for information on historical exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Vulnerable (VU)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sperm whale

The sperm whale (Physeter macrocephalus) is a marine mammal species, order Cetacea, a toothed whale (odontocete) having the largest brain of any animal. The name comes from the milky-white waxy substance, spermaceti, found in the animal's head. The sperm whale is the only living member of genus Physeter. The now outdated synonym Physeter catodon refers to the same species. It is one of three extant species in the sperm whale superfamily, along with the pygmy sperm whale and dwarf sperm whale.

A mature male can grow to 20.5 metres (67 ft) long. It is the largest living toothed animal. For large males, the head can represent up to one-third of the animal's length. It has a cosmopolitan distribution across the oceans. The species feeds primarily on squid but to some extent on fish, diving as deep as 3 kilometres (9,800 ft), which makes it the deepest diving mammal. Its diet includes giant squid and colossal squid. The sperm whale's clicking vocalization is the loudest sound produced by any animal. The clicking is used for sonar and may also be used for other purposes.[3] These whales live in groups called social units. Units of females and their young live separately from sexually mature males. The females cooperate to protect and nurse their young. Females give birth every three to six years, and care for the calves for more than a decade. The sperm whale has few natural predators, since few are strong enough to successfully attack a healthy adult; orcas attack units and are capable of killing the calves. The sperm whale can live for more than 70 years.

Historically, the sperm whale was also known as the common cachalot; "cachalot" is derived from an archaic French word for "tooth". Over most of the period from the early 18th century until the late 20th century, the sperm whale was hunted to obtain spermaceti and other products, such as sperm oil and ambergris. Spermaceti found many important uses, such as candles, soap, cosmetics and machine oil. Due to its size, the sperm whale could sometimes defend itself effectively against whalers. In the most famous example, a sperm whale attacked and sank the American whaleship Essex in 1820. As a result of whaling, the sperm whale is currently listed as vulnerable by the IUCN.

Contents

Name

The name sperm whale is an apocopation of spermaceti whale. Spermaceti, originally mistaken for the whales' "sperm", is the semi-liquid, waxy substance found in the spermaceti organ or case in front of and above the skull bone and also in the junk, the area below the spermaceti organ and just above the upper jaw.[4] The case consists of a soft white, waxy substance saturated with spermaceti oil. The junk is composed of cavities filled with the same wax and spermaceti oil and intervening connective tissue.[4][5][6] The sperm whale is also known as the "cachalot", which is thought to derive from the archaic French for "tooth" or "big teeth", as preserved for example in cachau in the Gascon dialect (a word of either Romance[7] or Basque[8] origin). The etymological dictionary of Corominas says the origin is uncertain, but it suggests that it comes from the vulgar Latin cappula, plural of cappulum, sword hilt.[9] According to Encarta Dictionary, the word cachalot came to English "via French from Spanish or Portuguese cachalote, perhaps from [Portuguese] cachola, 'big head'". The term is retained in the Russian word for the animal, кашалот (kashalot), as well as in many other languages.

Description

Size

Average sizes[10] LengthWeight
Bull16 metres (52 ft)41,000 kilograms (40 long tons; 45 short tons)
Cow11 metres (36 ft)14,000 kilograms (14 long tons; 15 short tons)
Newborn4 metres (13 ft)1,000 kilograms (0.98 long ton; 1.1 short tons)

The sperm whale is the largest toothed whale, with adult males measuring up to 20.5 metres (67 ft) long and weighing up to 57,000 kilograms (56 long tons; 63 short tons).[5][11] By contrast, the second largest toothed whale, Baird's Beaked Whale measures 12.8 metres (42 ft) and weighs up to 15 short tons (14,000 kg).[12] The Nantucket Whaling Museum has a 5.5 metres (18 ft)-long jawbone. The museum claims that this individual was 80 feet (24 m) long; the whale that sank the Essex (one of the incidents behind Moby-Dick) was claimed to be 85 feet (26 m).[13][14] However, there is disagreement on the claims of adult males approaching or exceeding 80 feet (24 m) in length.[15]

Extensive whaling may have decreased their size, as males were highly sought, primarily after World War II.[14] Today, males do not usually exceed 18.3 metres (60 ft) in length or 51,000 kilograms (50 long tons; 56 short tons) in weight.[10] Another view holds that exploitation by overwhaling had virtually no effect on the size of the bull sperm whales, and their size may have actually increased in current times on the basis of density dependent effects.[16]

It is among the most sexually dimorphic of all cetaceans. At birth both sexes are about the same size,[10] but mature males are typically 30% to 50% longer and three times as massive as females.[5]

Appearance

The sperm whale's unique body is unlikely to be confused with any other species. The sperm whale's distinctive shape comes from its very large, block-shaped head, which can be one-quarter to one-third of the animal's length. The S-shaped blowhole is located very close to the front of the head and shifted to the whale's left.[5] This gives rise to a distinctive bushy, forward-angled spray.

Photo of vertical tail at the ocean's surface
The flukes of a sperm whale as it dives into the Gulf of Mexico (courtesy NMFS)
Sperm whale tail in Kaikoura, New Zealand

The sperm whale's flukes are triangular and very thick. The whale lifts its flukes high out of the water as it begins a feeding dive.[5] It has a series of ridges on the back's caudal third instead of a dorsal fin. The largest ridge was called the 'hump' by whalers, and can be mistaken for a dorsal fin because of its shape and size.[10]

In contrast to the smooth skin of most large whales, its back skin is usually wrinkly and has been likened to a prune by whale-watching enthusiasts.[17] Skin is normally a uniform grey in color, though it may appear brown in sunlight. Albinos have also been reported.[18][19][20]

Jaws and teeth

The sperm whales' lower jaw is very narrow and underslung.[21] The sperm whale has 18 to 26 teeth on each side of its lower jaw which fit into sockets in the upper jaw.[21] The teeth are cone-shaped and weigh up to 1 kilogram (2.2 lb) each.[22] The teeth are functional, but do not appear to be necessary for capturing or eating squid, and well-fed animals have been found without teeth. One hypothesis is that the teeth are used in aggression between males.[23] Mature males often show scars which seem to be caused by the teeth. Rudimentary teeth are also present in the upper jaw, but these rarely emerge into the mouth.[24]

Respiration and diving

Sperm whales, along with bottlenose whales and elephant seals, are the deepest-diving mammals.[5] Sperm whales are believed to be able to reach 3 kilometres (1.9 mi) and remain submerged for 90 minutes.[5][25] More typical dives are around 400 metres (1,300 ft) and 35 minutes in duration.[5] At these great depths, sperm whales had sometimes become entangled in transoceanic telephone cables and drowned[26] until improvements in laying and maintenance techniques were employed.[27]

Photo of sperm whale with exposed back at the surface
Sperm whale arching back in preparation to dive off Dominica

The sperm whale has adapted to cope with drastic pressure changes when diving. The flexible ribcage allows lung collapse, reducing nitrogen intake, and metabolism can decrease to conserve oxygen.[28][29] Myoglobin, which stores oxygen in muscle tissue, is much more abundant than in terrestrial animals.[30] The blood has a high red blood cell density, which contain oxygen-carrying hemoglobin. The oxygenated blood can be directed towards the brain and other essential organs only when oxygen levels deplete.[31][32][33] The spermaceti organ may also play a role by adjusting buoyancy (see below).[34]

While sperm whales are well adapted to diving, repeated dives to great depths have long term effects. Bones show pitting that signals decompression sickness in humans. Older skeletons showed the most extensive pitting, whereas calves showed no damage. This damage may indicate that sperm whales are susceptible to decompression sickness, and sudden surfacing could be lethal to them.[35]

Between dives, the sperm whale surfaces to breathe for about eight minutes before diving again.[5] Odontoceti (toothed whales) breathe air at the surface through a single, S-shaped blowhole. Sperm whales spout (breathe) 3–5 times per minute at rest, increasing to 6–7 times per minute after a dive. The blow is a noisy, single stream that rises up to 2 metres (6.6 ft) or more above the surface and points forward and left at a 45° angle.[36] On average, females and juveniles blow every 12.5 seconds before dives, while large males blow every 17.5 seconds before dives.[37]

Brain and senses

The brain is the largest known of any modern or extinct animal, weighing on average about 8 kilograms (18 lb),[40][41] though the sperm whale has a lower encephalization quotient than many other whale and dolphin species, lower than that of non-human anthropoid apes, and much lower than humans'.[41][42]

Nasal complex and spermaceti functions

Early on it was proposed that the nasal complex, which includes the spermaceti organ, the junk bodies, and other associated organs, was used as a battering ram (see below)[43] or for buoyancy regulation (see below);[34][44] however, researchers' current understanding suggest that the primary function of the spermaceti organ and the associated organs in the nose of the sperm whales are used as part of the world's most powerful natural sonar system.[38][45][46][47][48][49][50][51][52]

Due to light absorption by water, most of the ocean is dark beyond a few hundred meters thus limiting visual range. As a result, sperm whales and the other toothed whales (suborder odontoceti) have evolved a system of echolocation as the main way to find food in the darkness of the ocean similar to that used by bats to find food in the darkness of the night sky. When echolocating, the sperm whale emits a directionally focused beam of broadband clicks. Clicks are generated by the forcing of air through a pair of phonic lips (also known as "monkey lips" or "museau de singe") at the front end of the nose, just below the blowhole. The sound then travels backwards along the length of the nose through the spermaceti organ. Most of the sound energy is then reflected off an air sac which sits against the skull and down into the Junk Bodies, where the sound is focused by the junk's lens-like structure.[38][45][46][47][48][49][50][51] Some of the sound will reflect back into the spermaceti organ and back towards the front of the whale's nose where it will be reflected through the spermaceti organ a third time. This back and forth reflection which happens on the scale of a few milliseconds creates a multi-pulse click structure.[53] This multi—pulse click structure actually allows researchers to measure the whale's spermaceti organ using only the sound of its clicks and given the size of the spermaceti organ relates to the size of the whale, biologists can measure the whales by recording their echolocation clicks.[54][55] The lower jaw is the primary reception path for the echoes. A continuous fat-filled canal transmits received sounds to the inner ear.[39]

The source of the air forced through the phonic lips is the right nasal passage. While the left nasal passage opens to the blow hole, the right nasal passage has evolved to supply air to the phonic lips. It is thought that the nostrils of the land-based ancestor of the sperm whale migrated through evolution to their current functions, the left nostril becoming the blowhole and the right nostril becoming the phonic lips. [56]

The spermaceti organs may also help adjust the whale's buoyancy. It is hypothesized that before the whale dives, cold water enters the organ, and it is likely that the blood vessels constrict, reducing blood flow, and, hence, temperature. The wax therefore solidifies and reduces in volume.[34][44] The increase in specific density generates a down force of about 392 newtons (860 lb) and allows the whale to dive with less effort. During the hunt, oxygen consumption, together with blood vessel dilation, produces heat and melts the spermaceti, increasing its buoyancy and enabling easy surfacing.[57] However, more recent work[47] have found many problems with this theory including the lack of anatomical structures for the actual heat exchange.[58]

Herman Melville's Moby Dick suggests that the "case" containing the spermaceti had evolved as a kind of battering ram for use in fights between males.[43] However, there are almost no modern accounts of fights between male sperm whales.[52] Apart from a few famous exceptions of the well-documented sinking of the ships Essex and Ann Alexander by attackers estimated to weigh only one-fifth as much as the ships, this hypothesis is not well supported in current scientific literature.[59]

Ecology, behaviour, and life history

Distribution

The sperm whale is among the most cosmopolitan species. It prefers ice-free waters over 1,000 metres (3,300 ft) deep.[2] Although both sexes range through temperate and tropical oceans and seas, only adult males populate higher latitudes.[18]

It is relatively abundant from the poles to the equator and is found in all the oceans. It inhabits the Mediterranean Sea, but not the Black Sea,[10] while its presence in the Red Sea is uncertain.[2] The shallow entrances to both the Black Sea and the Red Sea may account for their absence.[60] The Black Sea's lower layers are also anoxic and contain high concentrations of sulphur compounds such as hydrogen sulphide.[61]

Populations are denser close to continental shelves and canyons.[18] Sperm whales are usually found in deep off-shore waters, but may be seen closer to shore in areas where the continental shelf is small and drops quickly to depths of 310–920 metres (1,020–3,020 ft).[10] Coastal areas with significant sperm whale populations include the Azores and the Caribbean island of Dominica.[62]

Reproduction

Photo of rectangular-shaped whale from the side having rough, bark-like skin towards the rear, two small pectoral fins, articulated flukes and a mottled white area above the eye
Young sperm whale

Sperm whales can live 70 years or more.[10][18][63] They are a prime example of a species that has been K-selected, i.e., their reproductive strategy is associated with stable environmental conditions and comprises a low birth rate, significant parental aid to offspring, slow maturation, and high longevity.[5]

How they choose mates has not been definitively determined. There is evidence that males have dominance hierarchies, and there is also evidence that female choice influences mating.[64] Gestation requires 14 to 16 months, producing a single calf.[10] Lactation proceeds for 19 to 42 months, but calves may suckle up to 13 years (although usually less).[10] Calves can suckle from females other than their mothers.[10] Females generally have birth intervals of three to six years.[10]

Females reach sexual maturity between 7 and 13 years; males follow beginning at 18 years. Upon reaching sexual maturity, males move to higher latitudes, where the water is colder and feeding is more productive. Females remain at lower latitudes.[10] Males reach their full size at about age 50.[5]

Social behavior

Diagram showing silhouettes of 10 inward-facing whales surrounding a single, presumably injured group member
Diagram of Marguerite formation

Females stay in groups of about a dozen individuals and their young.[5] Mature males leave their "natal unit" somewhere between 4 and 21 years of age. Mature males sometimes form loose "bachelor groups" with other males of similar age and size.[5] As males grow older, they typically live solitary lives.[5] Mature males have beached themselves together, suggesting a degree of cooperation which is not yet fully understood.[5]

The most common non-human attacker of sperm whales is the orca, but pilot whales and the false killer whale also sometimes harass them.[65][66] Orcas prey on target groups of females with young, usually making an effort to extract and kill a calf. Female sperm whales repel these attacks by encircling their calves. The adults either face inwards to use their tail flukes against the orcas, or outwards, fighting with their teeth.[5] This Marguerite formation, named after the flower, is also used by whales to support an injured unit member. Early whalers exploited this behavior, attracting a whole unit by injuring one of its members.[67] If the orca pod is extremely large, its members may sometimes be able to kill adult female sperm whales. Large mature male sperm whales have no non-human predators, and are believed to be too large, powerful and aggressive to be threatened by orcas.[68]

Feeding

Photo of whale skin with many overlapping circular indentation
A piece of sperm whale skin with giant squid sucker scars

Sperm Whales usually dive between 300 to 800 metres (980 to 2,600 ft), and sometimes 1–2 kilometres (3,300–6,600 ft) to search for food.[69] Such dives can last more than an hour.[69] They feed on several species, notably the giant squid, the colossal squid, octopuses, and diverse fish like demersal rays, but the main part of their diet consists of medium-sized squid.[70] Some prey may be taken incidentally while eating other items.[70] Most of what is known about deep sea squid has been learned from specimens in captured sperm whale stomachs, although more recent studies analysed fecal matter. One study, carried out around the Galápagos, found that squid from the genera Histioteuthis (62%), Ancistrocheirus (16%), and Octopoteuthis (7%) weighing between 12 and 650 grams (0.026 and 1.4 lb) were the most commonly taken.[71] Battles between sperm whales and colossal squid (which have been measured to weigh nearly 500 kilograms (1,100 lb)) have never been observed by humans; however white scars are believed to be caused by the large squid. One study published in 2010 collected evidence that suggests that female sperm whales may collaborate when hunting Humboldt squid.[72]

An older study, examining whales captured by the New Zealand whaling fleet in the Cook Strait region, found a 1.69:1 ratio of squid to fish by weight.[73] Sperm whales sometimes steal Sablefish and Toothfish from long lines. Long-line fishing operations in the Gulf of Alaska complain that sperm whales take advantage of their fishing operations to eat desirable species straight off the line, sparing the whales the need to hunt.[74] However, the amount of fish taken is very little compared to what the sperm whale needs per day. Video footage has been captured of a large male sperm whale "bouncing" a long line, to gain the fish.[75] Sperm whales are believed to prey on the megamouth shark, a rare and large deep-sea species discovered in the 1970s.[76] In one case, three sperm whales were observed attacking or playing with a megamouth.[77]

The sharp beak of a consumed squid lodged in the whale's intestine may lead to the production of ambergris, analogous to the production of pearls.[78] The irritation of the intestines caused by squid beaks stimulates the secretion of this lubricant-like substance. Sperm whales are prodigious feeders and eat around 3% of their body weight per day. The total annual consumption of prey by sperm whales worldwide is estimated to be about 100,000,000 short tons (91,000,000 t) — a figure greater than the total consumption of marine animals by humans each year.[79]

It is not well understood why the sperm whale's head is so large in comparison to the lower jaw. One theory is that the sperm whale's ability to echolocate through its head aids in hunting. However, squid, its main prey, may have acoustic properties too similar to seawater to reflect sounds.[80] The sperm whale's head contains a structure called the phonic lips, also known as the monkey lips, through which it blows air. This can create clicks that have a source level exceeding 230 decibels re 1 micropascal referenced to a distance of 1 metre (3.3 ft) – in other words, it is by far the loudest sound made by any animal, and 10–14 dB louder than a powerful rifle sounds in air at 1 metre (3.3 ft) away.[81] It has been hypothesised that clicks attempt to stun prey. Experimental studies attempting to duplicate this effect have been unable to replicate the supposed injuries, casting doubt on this idea.[82]

Taxonomy and naming

Skeleton in Kaliningrad

The sperm whale belongs to the order Cetacea, the order containing all whales and dolphins. It is a member of the suborder Odontoceti, the suborder containing all the toothed whales and dolphins. It is the sole extant species of its genus, Physeter, in the family Physeteridae. Two species of the related extant genus Kogia, the pygmy sperm whale Kogia breviceps and the dwarf sperm whale K. simus, are placed either in this family or in the family Kogiidae.[83] In some taxonomic schemes the families Kogiidae and Physeteridae are combined as the superfamily Physeteroidea (see the separate entry on the sperm whale family).[84]

The sperm whale is one of the species originally described by Linnaeus in 1758 in his 18th century work, Systema Naturae. He recognised four species in the genus Physeter.[85] Experts soon realised that just one such species exists, although there has been debate about whether this should be named P. catodon or P. macrocephalus, two of the names used by Linnaeus. Both names are still used, although most recent authors now accept macrocephalus as the valid name, limiting catodon's status to a lesser synonym.[a]

Evolutionary history

Fossil record

Although the fossil record is poor,[86] several extinct genera have been assigned to the clade Physeteroidea, which includes the last common ancestor of the modern sperm whale, pygmy sperm whale and dwarf sperm whale, plus all of that ancestor's descendants. These fossils include Ferecetotherium, Idiorophus, Diaphorocetus, Aulophyseter, Orycterocetus, Scaldicetus, Placoziphius, Zygophyseter and Acrophyseter.[80][84][87] Ferecetotherium, found in Azerbaijan and dated to the late Oligocene (about 28 to 23 million years ago), is the most primitive fossil that has been found which possesses sperm whale-specific features such as an asymmetric rostrum ("beak" or "snout").[88] Most sperm whale fossils date from the Miocene period, 23 to 5 million years ago. Diaphorocetus, from Argentina, has been dated to the early Miocene. Fossil sperm whales from the Middle Miocene include Aulophyseter, Idiorophus and Orycterocetus, all of which were found on the west coast of the United States, and Scaldicetus, found in Europe and Japan.[88][89] Orycterocetus fossils have also been found in the North Atlantic Ocean and the Mediterranean Sea, in addition to the west coast of the United States.[90] Placoziphius, found in Europe, and Acrophyseter, from Peru, are dated to the late Miocene.[84][88]

Evolutionary family tree of sperm whales,[91]
including simplified summary of extinct groups ()[80]

Fossil sperm whales differ from modern sperm whales in tooth count and the shape of the face and jaws.[88] For example Scaldicetus had a tapered rostrum.[89] Genera from the Oligocene and early and middle Miocene, with the possible exception of Aulophyseter, had teeth in their upper jaws.[88] Acrophyseter, from the late Miocene, also had teeth in both the upper and lower jaws as well as a short rostrum and an upward curving mandible (lower jaw).[84] These anatomical differences suggest that fossil species may not have necessarily been deep-sea squid eaters like the modern sperm whale, but that some genera mainly ate fish.[88] Zygophyseter, dated from the middle to late Miocene and found in southern Italy, had teeth in both jaws and appears to have been adapted to feed on large prey, rather like the modern Orca (Killer Whale).[80]

Phylogeny

The traditional view has been that Mysticeti (baleen whales) and Odontoceti (toothed whales) arose from more primitive whales early in the Oligocene period, and that the super-family Physeteroidea, which contains the sperm whale, dwarf sperm whale, and pygmy sperm whale, diverged from other toothed whales soon after that, over 23 million years ago.[86][88] In 1993–1996 molecular phylogenetics analyses by Milinkovitch and colleagues, based on comparing the genes of various modern whales, suggested that the sperm whales are more closely related to the baleen whales than they are to other toothed whales, which would have meant that Odontoceti were not monophyletic, in other words did not consist of a single ancestral toothed whale species and all its descendants.[91] However more recent studies, based on various combinations of comparative anatomy and molecular phylogenetics, criticised Milinkovitch's analysis on technical grounds and reaffirmed that the Odontoceti are monophyletic.[91][92][93]

These analyses also confirm that there was a rapid evolutionary radiation (diversification) of the Physeteroidea in the Miocene period.[80] The Kogiidae (dwarf and pygmy sperm whales) diverged from the Physeteridae (true sperm whales) at least 8 million years ago.[92]

Relationship with humans

Historical hunting

Spermaceti, obtained primarily from the spermaceti organ, and sperm oil, obtained primarily from the blubber in the body, were much sought after by 18th, 19th, and 20th century whalers. These substances found a variety of commercial applications, such as candles, soap, cosmetics, machine oil, other specialized lubricants, lamp oil, pencils, crayons, leather waterproofing, rust-proofing materials and many pharmaceutical compounds.[94][95][96][97] Ambergris, a solid, waxy, flammable substance produced in the digestive system of sperm whales, was also sought as a fixative in perfumery.

Painting of a sperm whale destroying a boat, with other boats in the background
Sperm whaling

Prior to the early 18th century, hunting was mostly by indigenous Indonesians.[98] Legend has it that sometime in the early 18th century, around 1712, Captain Christopher Hussey, while cruising for right whales near shore, was blown offshore by a northerly wind, where he encountered a sperm whale pod and killed one.[99] Although the story may not be true, sperm whales were indeed soon exploited by American whalers. Judge Paul Dudley, in his Essay upon the Natural History of Whales (1725), states that one Atkins, ten or twelve years in the trade, was among the first to catch sperm whales sometime around 1720 off the New England coast.[100]

There were only a few recorded catches during the first few decades (1709-1730s) of offshore sperm whaling. Instead sloops concentrated on Nantucket Shoals where they would have taken right whales or went to the Davis Strait region to catch bowhead whales. By the early 1740s, with the advent of spermaceti candles (before 1743), American vessels began to focus on sperm whales. The diary of Benjamin Bangs (1721–1769) shows that, along with the bumpkin sloop he sailed, he found three other sloops flensing sperm whales off the coast of North Carolina in late May 1743.[101] On returning to Nantucket in the summer 1744 on a subsequent voyage he noted that "45 spermacetes are brought in here this day," another indication that American sperm whaling was in full swing.[101]

Drawn map of Massachusetts, highlighting Nantucket, south of the state's main area
Nantucket in red, is an island off the state of Massachusetts where much sperm whaling originated

American sperm whaling soon spread from the east coast of the American colonies to the Gulf Stream, the Grand Banks, West Africa (1763), the Azores (1765), and the South Atlantic (1770s). From 1770 to 1775 Massachusetts, New York, Connecticut, and Rhode Island ports produced 45,000 barrels of sperm oil annually, compared to 8,500 of whale oil.[102] In the same decade the British began sperm whaling, employing American ships and personnel.[103] By the following decade the French had entered the trade, also employing American expertise.[103] Sperm whaling increased until the mid-19th century. Spermaceti oil was important in public lighting (for example, in lighthouses, where it was used in the United States until 1862, when it was replaced by lard oil, in turn replaced by petroleum) and for lubricating the machines (such as those used in cotton mills) of the Industrial Revolution. Sperm whaling declined in the second half of the 19th century, as petroleum came in to broader use. In that sense, it may be said to have protected whale populations from even greater exploitation.[104][105] Sperm whaling in the 18th century began with small sloops carrying only one or two whaleboats. The fleet's scope and size increased over time, and larger ships entered the fishery. In the late 18th century and early 19th century sperm whaling ships sailed to the Pacific, the Indian Ocean, Japan, the coast of Arabia, Australia and New Zealand.[103][106][107] Hunting could be dangerous to the crew, since sperm whales (especially bulls) will readily fight to defend themselves against attack, unlike most baleen whales. When dealing with a threat, sperm whales will use their huge head effectively as a battering ram.[108] Arguably the most famous sperm whale counterattack occurred on November 20, 1820, when a whale claimed to be about 25.9 metres (85 ft) long rammed and sank the Nantucket whaleship Essex. Only 8 out of 21 sailors survived to be rescued by other ships.[109] This instance is popularly believed to have inspired Herman Melville's famous book "Moby-Dick".[110]

Sperm whale scrimshaw

The sperm whale's ivory-like teeth were often sought by 18th and 19th-century whalers, who used them to produce inked carvings known as scrimshaw. Thirty teeth of the sperm whale can be used for ivory. Each of these teeth (up to 8 inches long and 3 inches across), are hollow for the first half of their length. Like walrus ivory, sperm whale ivory has two distinct layers. However, sperm whale ivory contains a much thicker inner layer. Though a widely practiced art in the 19th century, scrimshaw using genuine sperm whale ivory declined substantially after the retirement of the whaling fleets in the 1880s. Currently the Endangered Species Act and CITES, the Convention on International Trade in Endangered Species of Wild Fauna and Flora, prevents the sales of or trade in sperm whale ivory harvested after 1973 or in scrimshaw crafted from it.

Modern whaling was more efficient than open-boat whaling, employing steam-powered ships and exploding harpoons. Initially, modern whaling activity focused on large baleen whales, but as these populations were taken, sperm whaling increased. This was especially true during World War II when spermaceti, the fine waxy oil produced by sperm whales, was in high demand for lubricating the American war machine[clarification needed]. In both the 1941-2 and 1942-3 seasons, the Norwegian expedition took over 3,000 sperm whales off the coast of Peru alone. After the war whaling continued unabated to obtain oil for cosmetics and high-performance machinery, such as automobile transmissions.

The hunting led to the near extinction of large whales including sperm whales until bans on whale oil use were instituted in 1972. The International Whaling Commission gave the species full protection in 1985 but hunting by Japan in the northern Pacific Ocean continued until 1988.[105]

It is estimated that the historic worldwide population numbered 1,100,000 before commercial sperm whaling began in the early 18th century.[2] By 1880 it had declined by an estimated 29 per cent.[2] From that date until 1946 the population appears to have recovered somewhat as whaling pressure lessened, but after the Second World War, the population declined even further, to only 33 per cent of the pre-whaling era.[2] It has been estimated that in the 19th century between 184,000 and 236,000 sperm whales were killed by the various whaling nations,[111] while in the modern era, at least 770,000 were taken, the majority between 1946 and 1980.[112]

Sperm whale tooth in a hand

Sperm whales increase the levels of primary production and carbon export by depositing iron rich faeces into surface waters of the Southern Ocean. The iron rich faeces causes phytoplankton to grow and take up more carbon from the atmosphere. When the phytoplankton dies, it sinks to the deep ocean and takes the atmospheric carbon with it. By reducing the abundance of sperm whales in the Southern Ocean, whaling has resulted in an extra 2 million tonnes of carbon remaining in the atmosphere each year.[113]

Remaining sperm whale populations are large enough that the species' conservation status is rated as vulnerable rather than endangered.[2] However, the recovery from the whaling years is a slow process, particularly in the South Pacific, where the toll on breeding-age males was severe.[114]

Current conservation status

The number of sperm whales throughout the world is unknown, but is thought to be in the hundreds of thousands.[2] The conservation outlook is brighter than for many other whales. Historically, Japan has taken ten sperm whales a year, and until 2006 tens of these whales were hunted off Indonesia. They are protected practically worldwide, and commercial whaling has ceased.[2] Fishermen do not target the creatures that sperm whales eat.[2] However, long-line fishing operations in the Gulf of Alaska have complained about sperm whales stealing fish from their lines.[74]

Entanglement in fishing nets and collisions with ships represent the greatest threats to the sperm whale population currently.[18] Other current threats include ingestion of marine debris, ocean noise, and chemical pollution.[115] The IUCN regards the sperm whale as being "vulnerable".[2] The species is listed as endangered on the United States Endangered Species Act.[116]

The species is listed on Appendix I[117] and Appendix II[117] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix I[117] as this species has been categorized as being in danger of extinction throughout all or a significant proportion of their range and CMS Parties strive towards strictly protecting these animals, conserving or restoring the places where they live, mitigating obstacles to migration and controlling other factors that might endanger them. It is listed on Appendix II[117] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements. It is also covered by the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS) and Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MOU).

Cultural importance

Rope-mounted teeth are important cultural objects throughout the Pacific. In New Zealand, the Māori know them as "rei puta"; such whale tooth pendants were rare objects because sperm whales were not actively hunted in traditional Māori society.[118] Whale ivory and bone were taken from beached whales. In Fiji the teeth are known as tabua and they were traditionally given as gifts for atonement or esteem (called sevusevu), and were important in negotiations between rival chiefs.[119] Friedrich Ratzel in The History of Mankind reported in 1896 that, in Fiji, whales' or cachalots' teeth were the most-demanded article of ornament or value. They occurred often in necklaces.[120] Today the tabua remains an important item in Fijian life. The teeth were originally rare in Fiji and Tonga, which exported teeth, but with the Europeans' arrival, teeth flooded the market and this "currency" collapsed. The oversupply led in turn to the development of the European art of scrimshaw.[121]

Herman Melville's novel Moby-Dick is based on a true story about a sperm whale that attacked the whaleship Essex.[122][123] Melville associated the sperm whale with the Bible's Leviathan.[123][124] The fearsome reputation perpetuated by Melville was based on bull whales' ability to fiercely defend themselves from attacks by early whalers, occasionally resulting in the destruction of the whaling ships.

Jules Verne's Twenty Thousand Leagues Under the Sea, mentions cachalots (perhaps incorrectly) as preying on fellow whales.

The sperm whale was designated as the Connecticut state animal by the CT General Assembly in 1975. It was selected because of its specific contribution to the state's history and because of its present-day plight as an endangered species.[125]

Photo from above of barely-submerged whale with man in foreground
Female in Dominican Pod, 2005

Watching sperm whales

Sperm whales are not the easiest of whales to watch, due to their long dive times and ability to travel long distances underwater. However, due to the distinctive look and large size of the whale, watching is increasingly popular. Sperm whale watchers often use hydrophones to listen to the clicks of the whales and locate them before they surface. Popular locations for sperm whale watching include the picturesque Kaikoura on New Zealand's South Island, Andenes and Tromsø in Arctic Norway; as well as the Azores, where the continental shelf is so narrow that whales can be observed from the shore,[62][126] and Dominica[127] where a long-term scientific research program, The Dominica Sperm Whale Project, has been in operation since 2005.[128]

Ambergris

Ambergris

Ambergris is a solid, waxy, flammable substance of a dull gray or blackish color produced in the digestive system of and regurgitated or secreted by sperm whales. Freshly produced ambergris has a marine, fecal odor. However, as it ages, it acquires a sweet, earthy scent commonly likened to the fragrance of rubbing alcohol without the vaporous chemical astringency. The principal historical use of ambergris was as a fixative in perfumery, though it has now been largely displaced by synthetics.

See also

Notes

Footnotes

  • a Until 1974 the species was generally known as P. catodon. In that year, however, Husson & Holthuis proposed that the correct name should be P. macrocephalus, the second name in the genus Physeter published by Linnaeus concurrently with P. catodon. This proposition was based on the grounds that the names were synonyms published simultaneously, and, therefore, the ICZN principle of "First Reviser" should apply. In this instance, it led to the choice of P. macrocephalus over P. catodon, a view re-stated in Holthuis, 1987. This has been adopted by most subsequent authors, although Schevill (1986 and 1987) argued that macrocephalus was published with an inaccurate description and that therefore only the species catodon was valid, rendering the principle of "First Reviser" inapplicable. At the present time, the name P. catodon is used in the Catalogue of Life. However, this is expected to be changed to follow the most recent version of ITIS, which has recently altered its usage from P. catodon to P. macrocephalus following L. B. Holthuis, and recent (2008) discussions with relevant experts (refer cited ITIS page for additional information).[5][129][130][131][132][133]

Citations

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300131. 
  2. ^ a b c d e f g h i j k Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Physeter macrocephalus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ "Sperm Whale "Voices" Used to Gauge Whales' Sizes". http://news.nationalgeographic.com/news/2003/11/1103_031103_tvspermwhale.html. Retrieved 2011-12-28. 
  4. ^ a b Wahlberg, M., Frantzis, A., Alexiadou, P., Madsen, P. T., and Møhl, B. (December 2005). "Click production during breathing in a sperm whale (Physeter macrocephalus) (L)". The Journal of the Acoustical Society of America 118 (6): 3404–3407. doi:10.1121/1.2126930. PMID 16419786. 
  5. ^ a b c d e f g h i j k l m n o p q Whitehead, H. (2002). "Sperm whale Physeter macrocephalus". In Perrin, W., Würsig B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. pp. 1165–1172. ISBN 0-12-551340-2. 
  6. ^ Whitehead, H. (2003). "The Peculiar Anatomy of the Sperm Whale: The Spermaceti Organ". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 8–9. ISBN 0-226-89518-1. 
  7. ^ Haupt, P. (1907). "Jonah's Whale". Proceedings of the American Philosophical Society 46 (185): 155. ISBN 978-1-4223-7345-3. http://books.google.com/?id=7lgLAAAAIAAJ&pg=PA151&lpg=PA151&dq=Haupt,+P.+%281907%29.+%22Jonah%27s+Whale%22.+Proceedings+of+the+American+Philosophical+Society#v=onepage&q=&f=false. Retrieved 2010-03-05. 
  8. ^ M. Fеrnandez-Casado (2000). "El Cachalote". Galemys 12 (2): 3. http://www.secem.es/GALEMYS/PDF%20de%20Galemys/12%20%282%29.%20pdf/1%20Fern%E1ndez-Casado%203-22.pdf. Retrieved 2010-03-05. 
  9. ^ Corominas, Joan (1987). Breve diccionario etimológico de la lengua castellana. Madrid: Gredos. ISBN 84-249-1332-9. 
  10. ^ a b c d e f g h i j k l Shirihai, H. and Jarrett, B. (2006). Whales Dolphins and Other Marine Mammals of the World. Princeton: Princeton Univ. Press. pp. 21–24. ISBN 0-691-12757-3. 
  11. ^ "Physeter macrocephalus, Sperm Whale". http://marinebio.org/species.asp?id=190. Retrieved 2008-11-09. 
  12. ^ Shirihai, H. and Jarrett, B. (2006). Whales Dolphins and Other Marine Mammals of the World. Princeton: Princeton Univ. Press. pp. 112–115. ISBN 0-691-12757-3. 
  13. ^ Maury, M. (1853). Explanations and Sailing Directions to Accompany the Wind and Current Charts. C. Alexander. p. 297. http://books.google.com/?id=DH8TAAAAYAAJ&dq=maury+sperm+whale&pg=PA313&lpg=PA313&q=%22sperm+whale%22#PPA297,M1. Retrieved 2008-11-06. 
  14. ^ a b "Sperm Whale". http://www.spermwhales.info. Retrieved 2008-10-12. 
  15. ^ [|Ellis, Richard] (2011). The Great Sperm Whale: A Natural History of the Ocean's Most Magnificent and Mysterious Creature. Zoology. 179. USA: University Press of Kansas. p. 432. ISBN 978-0-7006-1772-2. Zbl 0945.14001. 
  16. ^ Kasuya, Toshio (July 1991). "Density dependent growth in North Pacific sperm whales". Wiley (USA: Marine Mammal Science) 7 (3): 230–257. doi:10.1111/j.1748-7692.1991.tb00100.x. http://onlinelibrary.wiley.com/doi/10.1111/j.1748-7692.1991.tb00100.x/abstract. 
  17. ^ Mark Carwardine (1994). On the Trail of the Whale. Chapter 1. Thunder Bay Publishing Co. ISBN 1-899074-00-7. 
  18. ^ a b c d e Reeves, R., Stewart, B., Clapham, P. & Powell, J. (2003). Guide to Marine Mammals of the World. New York: A.A. Knopf. pp. 240–243. ISBN 0-375-41141-0. 
  19. ^ "Sperm Whale (Physeter macrocephalus): Species Accounts". http://animals.jrank.org/pages/3164/Sperm-Whales-Physeteridae-SPERM-WHALE-Physeter-macrocephalus-SPECIES-ACCOUNTS.html. Retrieved 2008-10-12. 
  20. ^ "Offshore Cetacean Species". CORE. http://www.coreresearch.org/education/offshorespecies.htm. Retrieved 2008-10-12. 
  21. ^ a b Jefferson, T.A., Webber, M.A. & Pitman, R.L. (2008). Marine Mammals of the World: a comprehensive guide to their identification. London: Elsevier. pp. 74–78. ISBN 978-0-12-383853-7. 
  22. ^ "American Cetacean Society Fact Sheet". http://www.acsonline.org/factpack/spermwhl.htm. Retrieved 2007-03-19. [dead link]
  23. ^ "Sperm Whale Facts". http://www.whale-images.com/sperm_whale_facts.jsp. Retrieved 2007-12-26. .
  24. ^ Whitehead, H. (2003). Sperm Whales Social Evolution in the Ocean. Chicago: University of Chicago Press. p. 4. ISBN 0-226-89518-1. 
  25. ^ "Sperm Whale". Oceana. http://na.oceana.org/en/explore/creatures/sperm-whale. Retrieved 2009-08-20. 
  26. ^ The Southwestern Company: "The Volume Library 1", page 65, 1987, ISBN 0-87197-208-5
  27. ^ [1] Carter, L., Burnett, D., Drew, S., Marle, G., Hagadorn, L., Bartlett-McNeil D., & Irvine N. (2009, December). Submarine cables and the oceans: connecting the world. p. 31
  28. ^ Kooyman, G. L.& Ponganis, P. J. (October 1998). "The Physiological Basis of Diving to Depth: Birds and Mammals". Annual Review of Physiology 60 (1): 19–32. doi:10.1146/annurev.physiol.60.1.19. PMID 9558452. 
  29. ^ Tyack, P., Johnson, M., Aguilar Soto, N., Sturlese, A. & Madsen, P. (October 18, 2006). "Extreme diving of beaked whales". Journal of Experimental Biology 209 (Pt 21): 4238–4253. doi:10.1242/jeb.02505. PMID 17050839. http://jeb.biologists.org/cgi/content/full/209/21/4238. 
  30. ^ Noren, S. R. & Williams, T. M. (June 2000). "Body size and skeletal muscle myoglobin of cetaceans: adaptations for maximizing dive duration". Comparative Biochemistry and Physiology - Part A: Molecular & Integrative Physiology 126 (2): 181–191. doi:10.1016/S1095-6433(00)00182-3. 
  31. ^ Marshall, C. (2002). "Morphology, Functional; Diving Adaptations of the Cardiovascular System". In Perrin, W., Würsig B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 770. ISBN 0-12-551340-2. 
  32. ^ "Aquarium of the Pacific - Sperm Whale". Aquarium of the Pacific. http://www.aquariumofpacific.org/onlinelearningcenter/print/sperm_whale/. Retrieved 2008-11-06. 
  33. ^ Shwartz, Mark (March 8, 2007). "Scientists conduct first simultaneous tagging study of deep-diving predator, prey". Stanford Report. http://news-service.stanford.edu/news/2007/march14/squid-031407.html. Retrieved November 6, 2008. 
  34. ^ a b c Clarke, M. (1978). "Structure and Proportions of the Spermaceti Organ in the Sperm Whale". Journal of the Marine Biological Association of the United Kingdom 58: 1–17. doi:10.1017/S0025315400024371. http://sabella.mba.ac.uk/2028/01/Structure_and_proportions_of_the_spermaceti_organ_in_the_sperm_whale.pdf. Retrieved 2008-11-05. 
  35. ^ Moore MJ, Early GA (2004). "Cumulative sperm whale bone damage and the bends". Science 306 (5705): 2215. doi:10.1126/science.1105452. PMID 15618509. 
  36. ^ Sharks and Whales (Cawardine 2002), p. 333.
  37. ^ Whitehead, H. (2003). "Foraging". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 156–161. ISBN 0-226-89518-1. 
  38. ^ a b c Cranford, T.W. (2000). "In Search of Impulse Sound Sources in Odontocetes". In Au, W.W.L, Popper, A.N. & Fay, R.R.. Hearing by Whales and Dolphins (Springer Handbook of Auditory Research series). Springer-Verlag, New York. ISBN 0-387-94906-2. 
  39. ^ a b Whitlow, W. (2002). "Echolocation". In Perrin, W., Würsig B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 359–367. ISBN 0-12-551340-2. 
  40. ^ "Sperm Whales (Physeter macrocephalus)". U.S. Department of Commerce NOAA Office of Protected Resources. http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/spermwhale.htm. Retrieved 2008-11-07. 
  41. ^ a b Marino, L. (2004). "Cetacean Brain Evolution Multiplication Generates Complexity". International Journal of Comparative Psychology 17: 3–4. http://www.dauphinlibre.be/CetaceanBrainEvolutionIJCP.pdf. 
  42. ^ Dicke, U.; Roth, G. (August September 2008). "Intelligence Evolved". Scientific American Mind: pp. 71–77. 
  43. ^ a b "Spermaceti as battering ram?" (PDF). Archived from the original on October 2, 2006. http://web.archive.org/web/20061002033440/http://autodax.net/Carrieretal2002.pdf. Retrieved 2007-03-19. 
  44. ^ a b Clarke, M. (1978). "Physical Properties of Spermaceti Oil in the Sperm Whale". Journal of the Marine Biological Association of the United Kingdom 58: 19–26. doi:10.1017/S0025315400024383. http://sabella.mba.ac.uk/2029/01/Physical_properties_of_spermaceti_oil_in_the_sperm_whale.pdf. Retrieved 2008-11-05. 
  45. ^ a b Zimmer, W.M.X., Tyack, P.L., Johnson, M.P. & Madsen, P.T. (2005). "Three dimensional beam pattern of regular sperm whale clicks confirms bent-horn hypothesis". Journal of the Acoustical Society of America 117: 1473–1485. 
  46. ^ a b Norris, K.S. & Harvey, G.W. (1972). "A theory for the function of the spermaceti organ of the sperm whale". In Galler, S.R, Schmidt-Koenig, K, Jacobs, G.J. & Belleville, R.E.. Animal orientation and navigation. NASA, Washington, D.C.. pp. 397–417. 
  47. ^ a b c Cranford, T.W. (1999). "The Sperm Whale's Nose: Sexual Selection on a Grand Scale?". Marine Mammal Science 15 (4): 1133–1157. doi:10.1111/j.1748-7692.1999.tb00882.x. 
  48. ^ a b Madsen, P.T., Payne, R., Kristiansen, N.U., Wahlberg, M., Kerr, I. & Møhl, B. (2002). "Sperm whale sound production studied with ultrasound time/depth-recording tags". Journal of Experimental Biology 205: 1899–1906. 
  49. ^ a b Møhl, B. (2001). "Sound transmission in the nose of the sperm whale Physeter Catodon: a post-mortem study". Journal of Comparative Physiology A 187: 335–340. 
  50. ^ a b Møhl, B., Wahlberg, M., Madsen, P.T., Miller, L.A. & Surlykke, A. (2000). "Sperm whale clicks: directionality and sound levels revisited". Journal of the Acoustical Society of America 107: 638–648. 
  51. ^ a b Møhl, B., Wahlberg, M., Madsen, P.T., Heerfordt, A. & Lund, A. (2003). "The monopulsed nature of sperm whale clicks". Journal of the Acoustical Society of America 114: 1143–1154. 
  52. ^ a b Whitehead, H. (2003). "Relationships between breeding males". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 277–279. ISBN 0-226-89518-1. 
  53. ^ Backus, R.H. & Schevill, W.E. (1966). "Physeter clicks". In Norris, K.S.. Whales, dolphins and porpoises. University of California Press, Berkeley, CA. pp. 510–527. 
  54. ^ Goold, J.C. (1996). "Signal processing techniques for acoustic measurement of sperm whale body lengths". Journal of the Acoustical Society of America 100: 3431–3441. 
  55. ^ Gordon, J.C.D. (1991). "Evaluating a method for determining the length of sperm whales (Physeter Catodon) from their vocalizations". Journal of Zoology, London 224: 301–314. 
  56. ^ "Whale Sounds". http://collections.tepapa.govt.nz/exhibitions/whales/segment.aspx?irn=163. Retrieved 2011-12-28. 
  57. ^ Clarke, M.R. (November 1970). "Function of the Spermaceti Organ of the Sperm Whale". Nature 228 (5274): 873–874. doi:10.1038/228873a0. PMID 16058732. 
  58. ^ Whitehead, H. (2003). "the function and evolution of a big nose". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 317–321. ISBN 0-226-89518-1. 
  59. ^ Carrier, D., Deban, S. & Otterstrom, J. (2002). "The face that sank the Essex: potential function of the spermaceti organ in aggression". The Journal of Experimental Biology 205 (Pt 12): 1755–1763. PMID 12042334. http://autodax.net/Carrieretal2002.pdf. 
  60. ^ Whitehead, H. (2003). "Oceanographic Habitat of the Sperm Whale". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. p. 33. ISBN 0-226-89518-1. 
  61. ^ Murray, J. W., Jannasch, H. W., Honjo, S., Anderson, R. F., Reeburgh, W. S., Top, Z., Friederich, G. E., Codispoti, L. A. & Izdar E. (March 30, 1989). "Unexpected changes in the oxic/anoxic interface in the Black Sea". Nature 338 (6214): 411–413. doi:10.1038/338411a0. 
  62. ^ a b Whitehead, H. (2003). "Sperm Whales and Humans". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 23–24. ISBN 0-226-89518-1. 
  63. ^ Whitehead, H. & Weilgart, L. (2000). "The Sperm Whale". In Mann, J., Connor, R., Tyack, P. & Whitehead, H.. Cetacean Societies. The University of Chicago Press. p. 169. ISBN 0-226-50341-0. 
  64. ^ Whitehead, H. (2003). "Mating Systems". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 271–285. ISBN 0-226-89518-1. 
  65. ^ Pitman RL, Ballance LT, Mesnick SI, Chivers SJ (2001). "Killer whale predation on sperm whales: Observations and implications". Marine Mammal Science 17 (3): 494–507. doi:10.1111/j.1748-7692.2001.tb01000.x. http://md1.csa.com/partners/viewrecord.php?requester=gs&collection=ENV&recid=5136745&q=&uid=788845644&setcookie=yes. 
  66. ^ Whitehead, H. & Weilgart, L. (2000). "The Sperm Whale". In Mann, J., Connor, R., Tyack, P. & Whitehead, H.. Cetacean Societies. The University of Chicago Press. p. 165. ISBN 0-226-50341-0. 
  67. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  68. ^ Estes, J. (2006). Whales, Whaling, and Ocean Ecosystems. University of California Press. p. 179. ISBN 0-520-24884-8. http://books.google.com/?id=daY_utPoJGAC&pg=PA179&lpg=PA179&dq=%22sperm+whale%22+%22killer+whale%22+predator+male#PPA179,M1. Retrieved 2008-11-03. 
  69. ^ a b Whitehead, H. (2003). "Vertical Movements: The Sperm Whale's Dive". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. p. 79. ISBN 0-226-89518-1. 
  70. ^ a b Whitehead, H. (2003). "The Diet of a Sperm Whale: The Walnut, the Pea and the Half-Pound Steak". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 43–55. ISBN 0-226-89518-1. 
  71. ^ Smith S. & Whitehead, H. (2000). "The Diet of Galapagos sperm whales Physeter macrocephalus as indicated by fecal sample analysis". Marine Mammal Science 16 (2): 315–325. doi:10.1111/j.1748-7692.2000.tb00927.x. 
  72. ^ Perkins, S.. "Sperm Whales Use Teamwork to Hunt Prey". http://www.wired.com/wiredscience/2010/02/sperm-whale-teams/. Retrieved 2010-02-24. 
  73. ^ Gaskin D. & Cawthorn M. (1966). "Diet and feeding habits of the sperm whale (Physeter macrocephalus L.) in the Cook Strait region of New Zealand". New Zealand Journal of Marine and Freshwater Research 1 (2): 156–179. doi:10.1080/00288330.1967.9515201. 
  74. ^ a b "Sneaky Cetaceans". Arctic Science Journeys. http://seagrant.uaf.edu/news/04ASJ/05.28.04sneaky-cetaceans.html. Retrieved 2008-11-04. 
  75. ^ "Whale Buffet". Archived from the original on 2007-02-07. http://web.archive.org/web/20070207232120/http://www.cbc.ca/quirks/archives/05-06/mar18.html#3. Retrieved 2007-03-19. 
  76. ^ http://www.flmnh.ufl.edu/fish/Sharks/Megamouth/Mega13.htm
  77. ^ Compagno, L. J. V. (2001). Sharks of the World Volume 2 Bullhead, mackerel and carpet sharks. FAO Species Catalogue for Fishery Purposes. pp. 74–78. ftp://ftp.fao.org/docrep/fao/009/x9293e/x9293e00.pdf. 
  78. ^ Dannenfeldt K.H. (1982). "Ambergris: The Search for Its Origin". Isis 73 (3): 382–397. doi:10.1086/353040. PMID 6757176. 
  79. ^ Ellis, R. (1994). Monsters of the Sea. The Lyons Press. p. 245. ISBN 1-59228-967-3. 
  80. ^ a b c d e Bianucci, G. & Landini, W. (September 8, 2006). "Killer sperm whale: a new basal physeteroid (Mammalia, Cetacea) from the Late Miocene of Italy". Zoological Journal of the Linnean Society 148 (1): 103–131. doi:10.1111/j.1096-3642.2006.00228.x. 
  81. ^ Møhl, B., Wahlberg, M., Madsen, P. T., Heerfordt A. and Lund A. (August 2003). "The monopulsed nature of sperm whale clicks". The Journal of the Acoustical Society of America 114 (2): 1143–1153. doi:10.1121/1.1586258. 
  82. ^ Benoit-Bird K. Au W. & Kastelein R. (August 2006). "Testing the odontocete acoustic prey debilitation hypothesis: No stunning results". The Journal of the Acoustical Society of America 120 (2): 1118–1123. doi:10.1121/1.2211508. PMID 16938998. 
  83. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300126. 
  84. ^ a b c d Lambert, O., Bianucci, G. & de Muizon, C. (August 2008). "A new stem-sperm whale (Cetacea, Odontoceti, Physeteroidea) from the Latest Miocene of Peru". Comptes Rendus Palevol 7 (6): 361–369. doi:10.1016/j.crpv.2008.06.002. 
  85. ^ (Latin) Linnaeus, Carolus (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata.. Holmiae. (Laurentii Salvii).. pp. 824. 
  86. ^ a b Fordyce, R.E., and Barnes, L.G. (May 1994). "The Evolutionary History of Whales and Dolphins". Annual Review of Earth and Planetary Sciences 22: 419–455. doi:10.1146/annurev.ea.22.050194.002223. http://www.saddleback.edu/faculty/thuntley/papers/fordyce_barnes_1994.pdf. Retrieved 2008-10-04. 
  87. ^ Stucky, R.E. and McKenna, M.C. (1993). "Mammalia". In Benton, M.J.. The Fossil Record. London.: Chapman & Hall. pp. 739–771. 
  88. ^ a b c d e f g Mchedlidze. G. A. (2002). "Sperm whales, evolution". In Perrin, W. F., Würsic, B. & Thewissen, J. G. M.. Encyclopedia of Marine Mammals. Academic Press, San Diego. pp. 1172–1174. ISBN 0-12-551340-2. 
  89. ^ a b Hirota, K. & Barnes, L. G. (April 5, 2006). "A new species of Middle Miocene sperm whale of the genus Scaldicetus (Cetacea; Physeteridae) from Shiga-mura, Japan". Island Arc 3 (4): 453–472. doi:10.1111/j.1440-1738.1994.tb00125.x. 
  90. ^ Bianucci, G., Landrini, W. & Varola, W. (September–October 2004). "First discovery of the Miocene northern Atlantic sperm whale Orycterocetus in the Mediterranean". Geobios 37 (5): 569–573. doi:10.1016/j.geobios.2003.05.004. 
  91. ^ a b c Nikaido, M., Matsuno, F., Hamilton, H., Brownwell, R., Cao, Y., Ding, W., Zuoyan, Z., Shedlock, A., Fordyce, R. E., Hasegawa, M. & Okada, N. (June 19, 2001). "Retroposon analysis of major cetacean lineages: The monophyly of toothed whales and the paraphyly of river dolphins". Proceedings of the National Academy of Sciences of the United States of America 98 (13): 7384–7389. doi:10.1073/pnas.121139198. PMC 34678. PMID 11416211. http://www.pnas.org/content/98/13/7384.full. Retrieved 2008-11-01. 
  92. ^ a b Whitehead, H. (2003). "Evolutionary History of the Sperm Whale". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 2–3. ISBN 0-226-89518-1. 
  93. ^ Heyning, J. (August 23, 2006). "Sperm Whale Phylogeny Revisited: Analysis of the Morphological Evidence". Marine Mammal Science 13 (4): 596–613. doi:10.1111/j.1748-7692.1997.tb00086.x. 
  94. ^ Wilson, D. (1999). The Smithsonian Book of North American Mammals. Vancouver: UBC Press. p. 300. ISBN 0-7748-0762-8. 
  95. ^ The Southampton Oceanography Centre & A deFontaubert. "The status of natural resources on the high seas". IUCN. p. 63. http://cmsdata.iucn.org/downloads/highseas.pdf. Retrieved 2008-10-11. 
  96. ^ Jamieson, A. (1829). A Dictionary of Mechanical Science, Arts, Manufactures, and Miscellaneous Knowledge. H. Fisher, Son & Co.. p. 566. 
  97. ^ "Aquarium of the Pacific - Sperm Whale". http://www.aquariumofpacific.org/onlinelearningcenter/print/sperm_whale/. Retrieved 2008-10-11. 
  98. ^ Whitehead, H. (2003). "Sperm Whales and Humans". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. p. 14. ISBN 0-226-89518-1. 
  99. ^ Simons, B.. "Christopher Hussey Blown Out (Up) to Sea". Nantucket Historical Association. http://www.nha.org/history/hn/HNsimons-hussey.htm. 
  100. ^ Dudley, P. (1725). "An Essay upon the Natural History of Whales, with a Particular Account of the Ambergris Found in the Sperma Ceti Whale". Philosophical Transactions (1683-1775), Vol. 33. The Royal Society. p. 267. http://www.capecodhistory.us/18th/Dudley-whales-1724.htm. 
  101. ^ a b Dolin, E. (2007). Leviathan: The History of Whaling in America. W. W. Norton. pp. 98–100. ISBN 0-393-06057-8. 
  102. ^ Starbuck, A. (1878). History of the American Whale Fishery from its Earliest Inception to the Year 1876. ISBN 0-665-35343-X. http://mysite.du.edu/~ttyler/ploughboy/starbuck.htm#sectiond. 
  103. ^ a b c Bockstoce, J. (December 1984). "From Davis Strait to Bering Strait: The Arrival of the Commercial Whaling Fleet in North America's West Arctic". Arctic 37 (4): 528–532. http://pubs.aina.ucalgary.ca/arctic/Arctic37-4-528.pdf. 
  104. ^ Estes, J. (2006). Whales, Whaling, and Ocean Ecosystems. University of California Press. p. 329. ISBN 0-520-24884-8. 
  105. ^ a b Whitehead, H. (2003). "Sperm whales and humans". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 13–21. ISBN 0-226-89518-1. 
  106. ^ Stackpole, E. A. (1972). Whales & Destiny: The Rivalry between America, France, and Britain for Control of the Southern Whale Fishery, 1785-1825. The University of Massachusetts Press. ISBN 0-87023-104-9. 
  107. ^ Baldwin, R., Gallagher, M., and van Waerebeek, K.. "A Review of Cetaceans from Waters off the Arabian Peninsula". p. 6. http://www.whalecoastoman.com/ArabPeninsula.pdf. Retrieved 2008-10-15. 
  108. ^ [2] (2011).
  109. ^ "The Wreck of the Whaleship Essex". BBC. http://www.bbc.co.uk/dna/h2g2/classic/A671492. Retrieved 2008-10-11. 
  110. ^ [3] (2011).
  111. ^ Davis, L, Gallman, R. & Gleiter, K. (1997). In Pursuit of Leviathan: Technology, Institutions, Productivity, and Profits in American Whaling, 1816-1906 (National Bureau of Economic Research Series on Long-Term Factors in Economic Dev). University of Chicago Press. p. 135. ISBN 0-226-13789-9. 
  112. ^ Over 680,000 officially reported at "Whaling Statistics". http://luna.pos.to/whale/sta.html. Retrieved 2008-10-15. . In addition, studies have found that official reports understated USSR catches by at least 89,000 "Sperm Whale (Physeter macrocephalus) California/Oregon/Washington Stock". http://www.nmfs.noaa.gov/pr/pdfs/sars/po2007whsp-cow.pdf. Retrieved 2008-10-16. . Furthermore, other countries, such as Japan have been found to have understated catches "The RMS - A Question of Confidence: Manipulations and Falsifications in Whaling". http://www.wdcs.org/submissions_bin/rmsreview.pdf. Retrieved 2008-10-16. 
  113. ^ Lavery, Trish L., Ben Roudnew, Peter Gill, Justin Seymour, Laurent Seuront, Genevieve Johnson, James G. Mitchell & Victor Smetacek (2010). "Iron defecation by sperm whales stimulates carbon export in the Southern Ocean". Proceedings of the Royal Society B 277 (1699): 3527–3531. doi:10.1098/rspb.2010.0863. PMC 2982231. PMID 20554546. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2982231. 
  114. ^ Whitehead, H. (2003). "Ghosts of Whaling Past". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 360–362. ISBN 0-226-89518-1. 
  115. ^ Whitehead, H. (2003). "New Threats to Sperm Whales". Sperm Whales Social Evolution in the Ocean. University of Chicago Press. pp. 362–368. ISBN 0-226-89518-1. 
  116. ^ "Sperm whale (Physeter catodon) species profile". Environmental Conservation Online System. United States Fish and Wildlife Service. November 16, 2010. http://ecos.fws.gov/speciesProfile/profile/speciesProfile.action?spcode=A02T. 
  117. ^ a b c d "Appendix I and Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  118. ^ "Museum of New Zealand Te Papa Tongarewa Collections Online Search - Rei puta". http://collections.tepapa.govt.nz/search.aspx?term=Rei%20puta. Retrieved 2009-03-15. 
  119. ^ Arno, A. (2005). "Cobo and tabua in Fiji: Two forms of cultural currency in an economy of sentiment". American Ethnologist 32 (1): 46–62. doi:10.1525/ae.2005.32.1.46. http://cat.inist.fr/?aModele=afficheN&cpsidt=16581746. Retrieved 2008-10-06. 
  120. ^ Ratzel, Friedrich. "Dress and Weapons of the Melanesians: Ornament", The History of Mankind. (London: MacMillan, 1896). Accessed 21 October 2009.
  121. ^ Constantine, R. (2002). "Folklore and Legends". In Perrin, W., Würsig, B. & Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 449. ISBN 0-12-551340-2. 
  122. ^ "Chapter 3. Romances of Adventure. Section 2. Herman Melville. Van Doren, Carl. 1921. The American Novel". Bartleby.com. http://www.bartleby.com/187/5.html. Retrieved 2008-10-19. 
  123. ^ a b Zwart, H. (2000). What is a Whale? Moby Dick, marine science and the sublime. Tubingen Attempo. pp. 185–214. http://www.filosofie.science.ru.nl/research/hra/whale.pdf. 
  124. ^ Edwards, B.. "The Playful Learnings". Australasian Journal of American Studies: 9. http://www.anzasa.arts.usyd.edu.au/a.j.a.s/Articles/1_06/EdwardsArticle.pdf. 
  125. ^ "The State Animal". State of Connecticut Sites, Seals and Symbols (Reproduced from the Connecticut State Register & Manual: State of Connecticut). http://vvv.state.ct.us/emblems/animal.htm. Retrieved December 26, 2010. 
  126. ^ "Whale and dolphin watching in the Azores". Wildlife Extra. http://www.wildlifeextra.com/go/whales/azores/. Retrieved 2008-09-26. 
  127. ^ "Whale Watching Dominica". http://www.dominica.dm/site/whalewatching.cfm. Retrieved 2008-09-26. 
  128. ^ "The Dominica Sperm Whale Project". http://whitelab.biology.dal.ca/dswp/index.html. Retrieved 2011-11-15. 
  129. ^ Husson A.M., Holthuis L.B. (1974). "Physeter macrocephalus Linnaeus, 1758, the valid name for the sperm whale". Zoologische Mededelingen 48: 205–217. http://www.repository.naturalis.nl/record/318605. 
  130. ^ Holthuis L. B. (1987). "The scientific name of the sperm whale". Marine Mammal Science 3 (1): 87–89. doi:10.1111/j.1748-7692.1987.tb00154.x. 
  131. ^ Schevill W.E. (1986). "The International Code of Zoological Nomenclature and a paradigm: the name Physeter catodon Linnaeus 1758". Marine Mammal Science 2 (2): 153–157. doi:10.1111/j.1748-7692.1986.tb00036.x. 
  132. ^ Schevill W.E. (1987). "Reply to L. B. Holthuis "The scientific name of the sperm whale". Marine Mammal Science 3 (1): 89–90. 
  133. ^ Whitehead, H. (2003). Sperm Whales Social Evolution in the Ocean. University of Chicago Press. p. 3. ISBN 0-226-89518-1. 

References

Further reading

  • Heptner, V. G.; Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, Volume II, part 3 (1996). Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: There is disagreement over the correct specific name. Linnaeus used both macrocephalus and catodon in the 10th edition of Systema Naturae. Leatherwood and Reeves (1983) and many other authors have used the name P. macrocephalus. Recently, Schevill (1986) argued that catodon is the correct name, whereas Holthius (1987) responded that macrocephalus is correct. Jones et al. (1986) stated that the change to catodon was unjustified because it was based on a misinterpretation of the International Code of Zoological Nomenclature. Jones et al. (1992), Baker et al. (2003), and Rice (1998) used P. macrocephalus as the name for the sperm whale. Mead and Brownell (in Wilson and Reeder 1993, 2005) and Nowak (1991) used the name P. catodon.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!