Articles on this page are available in 1 other language: Spanish (2) (learn more)

Overview

Brief Summary

Description

"The narwhal's tusk is a tooth - an upper-jaw tooth that grows through the lip and keeps on growing. Narwhals have just two teeth, both in the upper jaw. Usually the right tooth remains small and the left one grows to become the tusk. It can weigh more than 10 kg and grow to 3 m long; an average-size male narwhal, not counting the tusk, is 4.76 m long. Very rarely, males grow two tusks, and now and then a female develops a tusk. Tusks probably play a role in breeding competition. Narwhals migrate, wintering in pack ice and summering in deep sounds and fjords. They make deep dives - satellite transmitters are beginning to provide information on their diving habits - and feed near the bottom, probably capturing their prey by suction and swallowing it whole. Killer whales and polar bears are predators, and humans hunt them for their skin, meat, and ivory tusks."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:75, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Narwhals live in groups of two to ten individuals which may congregate with other groups to form herds of hundreds of individuals (3). They move very slowly and erratically when hunting, searching for fish, squid and shrimps during dives of between 7 and 20 minutes. They are very vocal, clicking and squeaking whilst travelling. Like many cetaceans, surfacing narwhals slap their flippers against the surface and raise their heads and tusks out of the water (9). Narwhals are thought to migrate annually and in very large groups, moving to spend the winter within the heavy pack ice of the Arctic. Predators of narwhals include Greenland sharks, orcas, polar bears, and walruses (3). Mating takes place between March and May and gestation lasts around 15 months, with births in July and August of the following year. The calves are born tail first and males do not grow their tusks until they have been weaned at around one year of age. Females give birth just once every three years (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Famous for its unicorn-like single tusk, narwhals have inspired legends in many cultures and are still revered across the world. The smooth, white tusk is normally found only on males and is the result of extreme growth of the left elongated maxillary tooth that protrudes through the upper lip in a spiral form. It is believed by the majority of the scientific community that the tusk is a secondary sexual characteristic (8). Females occasionally grow a tusk and males have been seen with two, or none. The largest tusk ever measured was a massive 267 centimetres. Narwhals have a conical body shape and flexible neck with a mottled blue, black, grey and white body fading onto the underside. Older males can be distinguished by their white bodies with mottling only on the top of the back. The dorsal fin is just a low, inconspicuous ridge and the tail fin is concave (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Narwhal (Monodon monoceros) is an arctic cetacean, famous for its tusk, belong to Monodontidae (one of two whale species in the family along with Delphinapterus luecas). They live in arctic coastal waters and rivers. They are known as seasonal migrants that travel between bays and fjords in the summer and deep offshore area heavily packed in ice in the winter. In summer months, they move closer to coast which is an ice-free waters (usually in shallow one) then move offshore in winter to a deeper waters with densely packed ice on top of it though sometime surfacing in small leads in the ice (Laidre et al, 2002). They prefer deep or offshore waters almost in all area of occurrence and rarely seen south of 65oN latitude (Hay and Manfield, 1989). Supported by their ability to do deep dives and blubber up to 35% of their body weight insulation, living in a deep freezing water by the winter is not a problem.

  • Laidre, K.L., Heide-Jørgensen,M.P., & Dietz, R. 2002. Diving behaviour of narwhal (Monodon monoceros) at two coastal localities in the Canadian High Arctic. Canadian Journal of Zoology, 80, 624-635.
  • Hay, K. A. and Mansfield, A. W. 1989. Narwhal Monodon monoceros Linneaus, 1758. In: S. H. Ridgway and R. Harrison (eds), Handbook of marine mammals, pp. 145-176. Academic Press, London, UK.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Denny Sahala Seri

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Narwhal: A small tooth whale found offshore and in dense sea ice known for its tusk
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mottled black and white (young are gray); No dorsal fin, but dorsal ridge; Males have long tusk from left upper lip; Melon head
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Narwhals primarily inhabit the Atlantic sector of the Arctic. The principal distribution is from the central Canadian Arctic (Peel Sound – Prince Regent Inlet and northern Hudson Bay) eastward to Greenland and into the eastern Russian Arctic (around 180°E). They are rarely observed in the far eastern Russian Arctic, Alaska, or the western Canadian Arctic. In summer, narwhals spend approximately two months in high Arctic ice-free shallow bays and fjords; they overwinter in offshore, deep, ice-covered habitats along the continental slope (Heide-Jørgensen and Dietz 1995). The whales migrate annually between these disjunct seasonal areas of concentration, with the migratory periods lasting approximately two months (Koski and Davis 1994; Innes et al. 2002; Heide-Jørgensen et al. 2002; Dietz et al. 2001; Heide-Jørgensen et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Narwhals (Monodon monoceros) are regularly found eastwards from the Canadian Arctic to central Russia, but occur infrequently or rarely in eastern Siberia, Alaska, and the western Canadian Arctic. They mostly remain above the Arctic Circle year-round, but stragglers have been recorded around Newfoundland, Europe, and the eastern Mediterranean (Minasian, 1984).

Biogeographic Regions: arctic ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic Ocean, European waters (ERMS scope), United Kingdom Exclusive Economic Zone
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Locally abundant in the high Arctic. Local concentrations occur in Davis Strait, Baffin Bay and adjacent waters, and the Greenland Sea. Smaller numbers occur in Hudson Strait, northern Hudson Bay, Foxe Basin, and Barents Sea. Presence in the Beaufort, Bering, and eastern Chukchi seas is exceptional. Also occurs in "Soviet" Arctic (Leatherwood and Reeves 1983). Most common in the eastern Canadian arctic and west Greenland area (IUCN 1991, which see for further details on distribution).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The narwhal occurs patchily throughout Arctic waters and in the north Atlantic Ocean. The highest narwhal density is found in the eastern Canadian Arctic Ocean and Greenland. It is also found in the waters of Iceland, Svalbard in Norway, Alaska (US), and Russia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length, exclusive of the tusk, is 360-620 cm, pectoral fin length is 30-40 cm, and expanse of the tail flukes is 100-120 cm. According to Reeves and Tracey (1980) average head and body length is about 470 cm in males and 400 cm in females and average weight is 1,600 kg in males and 900 kg in females. About one-third of the weight is blubber. Coloration becomes paler with age. Adults have brownish or dark grayish upper parts and whitish underparts, with a mottled pattern of spots throughout. The head is relatively small, the snout blunt, and the flipper is short and rounded. There is no dorsal fin, but there is an irregular ridge about 5 cm high and 60-90 cm long on the posterior half of the back. The posterior margins of the tail flukes are strongly convex, rather than concave or straight as in most cetaceans.

There are only two teeth, both in the upper jaw. In females the teeth usually are not functional and remain embedded in the bone. In males the right tooth remains embedded, but the left tooth erupts, protrudes through the upper lip, and grows forward in a counterclockwise spiral pattern to form a long, straight tusk. The tusk is about one-third to one-half as long as the head and body and sometimes reaches a length of 300 cm and a weight of 10 kg. In rare cases the right tooth also forms a tusk, but both tusks are always twisted in the same direction. Occasionally one or even two tusks develop in a female. The distal end of the tusk has a polished appearance, and the remainder is usually covered by a reddish or greenish growth of algae. There is an outer layer of cement, an inner layer of dentine, and a pulp cavity that is rich in blood. Broken tusks are common, but the damaged end is filled by new dentine growth (Reeves & Tracey, 1980).

Range mass: 900 to 1600 kg.

Range length: 400 to 470 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; ornamentation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 500 cm

Weight: 1600000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 4.7 m males; 4.1 m females

Weight:
Average: 1,580 kg males; 960 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
In all areas of their occurrence, narwhals prefer deep or offshore waters (Hay and Mansfield 1989). Narwhals from Canada and West Greenland have high site fidelity to the winter pack ice of Davis Strait and Baffin Bay in regions along the continental slope with high gradients in bottom temperatures, predictable open water (et al. 2004a). The wintering grounds may be the most important habitat for narwhals. Intense benthic feeding behavior has been documented between November and March in Baffin Bay and Davis Strait (Laidre et al. 2003; Laidre and Heide-Jørgensen 2005a), in contrast to low feeding activity during the summer period. This suggests a major portion of the annual energy intake is obtained in winter (Laidre et al. 2004a; Laidre and Heide-Jørgensen 2005a). This may also be true for the Greenland Sea, but has yet to be documented.

Fish, squid, and shrimp make up the narwhal’s diet (Hay and Mansfield 1989; Heide-Jorgensen 2002), especially Arctic fish species, such as Greenland halibut, Arctic cod, and polar cod (the latter of which are often associated with undersides of ice) (Laidre and Heide-Jørgensen 2005a). Narwhals feed mostly in deep water and possibly at or near the bottom. Dives of up to nearly 1,500 m and 25 minutes are documented (Laidre et al. 2003), and there are some seasonal differences in the depth and intensity of diving (Laidre et al. 2002; Laidre et al. 2003). Predators include killer whales, polar bears, and possibly occasionally Greenland sharks and walruses (Hay and Mansfield 1989).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Monodon monoceros occupies one of the most northerly habitats of any cetacean species, between 70°N and 80°N, and seems to have more specific habitat requirements, and thus a more restricted range, than other cetaceans. Narwhals are rarely found far from loose pack ice and they prefer deep water. There are large concentrations in the Davis Strait, around Baffin Bay, and in the Greenland Sea. The advance and retreat of the ice initiates migration.

During summer, narwhals occupy deep bays and fjords; the best known and probably largest narwhal population in the world inhabits the deep inlets, sounds and channels of the eastern Canadian Arctic and north-west Greenland. When ice cover is low in larger, deeper water bodies, they move to smaller water bodies, which are steep-sided and deep. These traditional summering areas at the heads of fjords are probably important areas for calving. The narwhal’s preference for deep water in summer separates them from beluga whales which spend the summer mainly in shallow estuaries and bays (Klinowska, 1991).

Range depth: 400 to 800 m.

Habitat Regions: polar

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Bays, fiords, and inlets in warmer months; moves south into deeper water when ice begins to form. Not often far from loose pack ice. Near northern Baffin Island in summer, made both shallow dives and deep (to 257 m) dives to bottom (Martin et al., 1994, Can. J. Zool. 72:118-125). Probably dive to depths of more than 1000 meters (Reeves, in Wilson and Ruff 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Arctic, Atlantic waters of Canada and Greenland; Offshore and in deep water within dense sea ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although traditionally thought of as deep-water cetaceans, narwhals actually forage at all depths, remaining close to the pack ice of the Arctic Ocean (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migrates between northerly summer range and winter range to south. Inshore movement in summer dramatic and predictable, coincides with breakup of ice cover. Annual migrations appear responsive to ice formation and drift. (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Narwhals have a varied diet, feeding upon squid, fish and crustaceans. With few functional teeth this animal is thought to use suction and the emission of a jet of water to dislodge prey such as bottom-living fish and molluscs. Their highly flexible necks aid in scanning a broad area and the capture of more mobile prey.

Foods eaten include: Polar cod, Greenland halibut, flounder, salmon, herring, crustaceans and  cephalopods (octopuses and squids).

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Known prey includes squid, polar cod, demersal fishes, and crustaceans (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Narrow range of prey which include Greenland halibut, squid, and polar cod; Echolocate prey with sonar
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Narwhals harbour several species of commensal animals such as whale lice and certain nematodes. They act to limit the populations of their prey species.

Commensal/Parasitic Species:

  • Nematods
  • Cestodes
  • Trematodes
  • Acanthocephalans
  • Whale lice

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Some have suggested that the tusk is used for anti-predatory functions, this is unsupported by evidence. Nonetheless, the tusk, which can grow to 3 m, would be a formidable weapon.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Monodon monoceros is prey of:
Orcinus
Somniosus microcephalus
Homo sapiens
Ursus maritimus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Monodon monoceros preys on:
benthonic invertebrates
Boreogadus saida
non-insect arthropods
Actinopterygii
Mollusca
Crustacea

Based on studies in:
Arctic (Marine)
Canada, high Arctic (Ice cap)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
  • M. S. W. Bradstreet and W. E. Cross, Trophic relationships at High Arctic ice edges, Arctic 3(1)5:1-12, from p. 9 (1982).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: About 18,800 occur in Canadian waters in summer; no population trend is evident (Strong 1988). Total population in the 1980s probably was somewhere between 25,000 and 50,000 (Evans 1992; see also IUCN 1991). Further information on populations is needed (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Large aggregations sometimes observed; these are subdivided into cohesive units of 20 or fewer individuals. Different sexes and ages may segregate or mix.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Size at birth 1.5m (15 feet); Sexual maturity at 5-7 years; Females have calves every 3 years; Longevity over 60 years, possibly more than 100; Behavior; Vocal and gregarious
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Monodon monoceros may live up to 50+ years in the wild, yet attempts at captive breeding have been unsuccessful. Upon reaching the captive establishment, M. monoceros have only survived from 1 to 4 months. Considering the adult male can grow to 7m long, the species is usually too big to keep in captivity except at the largest of establishments (Klinowska, 1991).

Range lifespan

Status: wild:
30 to 55 years.

Range lifespan

Status: captivity:
1 to 4 months.

Average lifespan

Status: wild:
40.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 50 years (wild) Observations: It is estimated that these animals may live more than 50 years. Attempts to keep animals in captivity have so far failed (Margaret Klinowska 1991).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The mating system of narwhals is unknown.

Monodon monoceros is a seasonal breeder. The gestation period is about 15.3 months, with mating occurring in March-May and calving in July-August of the following year. Lactation duration is unknown, but thought to be comparable to the white whale (Delphinapterus leucas) of 20 months. The interval between successive conceptions is normally three years.  Monodon monoceros copulate vertically in the water, belly to belly. Infant narwhals are usually implanted in the left uterine horn. A single calf is often the result of gestation, yet some twins have been recorded. Birth takes place tail first (Klinowska, 1991). The newborn is born with 25 mm of blubber. Calves usually measure between 1.5 and 1.7 m and weigh 80 kg. Physical maturity is attained at a length of 4 m and a weight of 900 kg in females and 4.7 m and 1600 kg in males. This usually corresponds to 4 to 7 years of age (Reeves & Tracey, 1980).

Breeding season: March to May

Range number of offspring: 1 to 2.

Range gestation period: 12 to 15.3 months.

Average gestation period: 13 months.

Range weaning age: 12 to 24 months.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 4 to 7 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 80000 g.

Average number of offspring: 1.

Young narwhals are capable of swimming soon after birth. They are nursed and protected by their mothers for extended periods after birth.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in March-May. Single calf is born in summer after gestation of about 14-15 months. Lactation exceeds 1 year, may extend up to 2 years. Calving interval most often is 3 years. Males probably sexually mature in 8-9 years, females in about 4-7 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Tusks sense chemicals: Narwhal
 

The tusks of male narwhals may detect chemicals related to ice formation, salinity, or prey using a vast network of fluid-filled tubules connected to the tusk's central nerve.

   
  "It could be a jousting tool or an ice-breaker. It has even been attributed to the legendary unicorn. But the true purpose of the narwhal's spectacular spiral tusk has remained a mystery.

"Now Martin Nweeia at Harvard School of Dental Medicine and his colleagues have come up with another explanation. They believe the tusk, which can measure up to 2.75 metres, could act as a sensor, helping the narwhal to survive in its Arctic home by detecting chemicals associated with prey, ice formation and salt concentrations.

"Two tusks taken from recently caught narwhals were examined under an electron microscope. This revealed a vast network of around 10 million fluid-filled tubules connecting the tusk's central nerve to the surrounding water. Such tubules exist in human teeth, but are only exposed at areas of gum recession, where they cause extreme sensitivity. 'The last place you would expect to have something so sensitive is a cold Arctic environment,' says Nweeia. A further surprise came when a laser was used to map the chemical composition of the tusk, a technique called reflectance microspectroscopy. It revealed that the narwhal's tusk is 'inside out'. Most teeth are hard on the outside and soft inside, but the narwhal's tusk has a soft protein-rich exterior, while the inside is more mineralised. 'Everything about these findings is counter-intuitive,' says Nweeia." (Geddes 2005:6)
  Learn more about this functional adaptation.
  • Linda Geddes. 2005. What's the point of the narwhal's tusk?. New Scientist. 188(2531/2532):
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monodon monoceros

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAAACCGATGACTATTCTCTACCAATCACAAGGACATTGGCACCCTATACTTACTATTTGGTGCCTGAGCAGGAATAGTAGGAACCGGCCTAAGCTTATTAATTCGTGCTGAACTAGGCCAACCTGGCTCACTTATCGGAGACGACCAGATCTATAATGTATTAGTAACAGCTCACGCCTTCGTGATAATCTTCTTTATAGTAATGCCTATTATAATCGGGGGGTTTGGAAACTGACTAGTCCCTTTAATAATCGGAGCCCCTGATATAGCTTTCCCTCGTCTAAACAACATAAGCTTTTGACTGCTTCCTCCTTCTTTCCTACTATTAATAGCATCTTCAATAATTGAAGCCGGCGCAGGCACAGGCTGAACTGTGTATCCTCCTCTAGCAGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTGACTATTTTCTCCCTACATCTGGCCGGCGTATCTTCAATCCTCGGAGCCATCAACTTCATTACAACTATCATTAACATAAAACCACCCGCTATAACCCAATACCAAACACCTTTATTCGTATGATCAGTCCTAATTACAGCAATCTTACTCCTATTATCACTACCTGTTCTAGCAGCCGGAATTACCATACTACTAACCGATCGAAACCTAAACACAACCTTTTTCGACCCTGCAGGAGGAGGCGACCCAGTCCTATATCAACACCTGTTCTGATTTTTTGGTCACCCCGAAGTATATATCCTAATTCTACCTGGCTTTGGGATAATCTCACATATCGTAACCTATTATTCGGGAAAAAAAGAACCTTTTGGATATATGGGGATAGTGTGGGCTATGGTTTCTATTGGCTTCCTGGGTTTTATTGTATGAGCTCACCACATATTTACAGTCGGAATAGACGTTGACACACGAGCATATTTCACATCAGCCACCATAATTATCGCTATTCCCACAGGAGTAAAAGTCTTCAGCTGACTGGCAACCCTCCATGGAGGAAACATTAAATGATCTCCAGCCCTAATATGAGCCCTAGGCTTTATCTTCCTGTTCACAGTAGGAGGTTTAACCGGTATTATCCTAGCTAACTCATCCTTAGACGTTATTCTCCACGACACATACTATGTAGTTGCCCATTTCCACTATGTACTTTCAATGGGAGCTGTTTTCGCCATCATAGGGGGTTTCGTCCACTGATTTCCACTATTTTCAGGTTATACACTCAATTCAACATGAACAAAAATTCAATTCGTGATCATATTCGTAGGTGTAAACATAACATTCTTTCCACAGCACTTTCTCGGCCTATCTGGAATACCCCGCCGATACTCTGATTACCCAGATGCCTACACAACATGAAACACCATTTCATCAATAGGCTCTTTCATCTCACTGACAGCAGTCATACTAATAATCTTCATTATTTGAGAAGCGTTTGCATCCAAACGAGAAGTATCAACAGTAGATCTCACTTCTACAAACCTCGAGTGATTAAACGGATGTCCTCCACCATACCATACATTTGAAGAACCAGCATACATCAACTCAAAAGGTTCAAGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monodon monoceros

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R.R., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J. (Cetacean Red List Authority)

Justification
The narwhal was assessed previously (1996) as Data Deficient. The aggregate circumpolar population of narwhals is probably greater than 80,000 (all ages). At the global level the species does not qualify for a threatened status under any of the criteria, although there is substantial uncertainty about numbers and trends in large parts of the range and clear evidence of decline for specific subpopulations (NAMMCO/JCNB 2005). The intense hunting (including associated loss due to wounding and sinking) in Greenland and Canada gives cause for concern, particularly given the lack of reliable data on hidden mortality and serious injury. Given that uncertainty, and the fact that cessation of national and international, taxon-specific conservation programs that currently monitor and manage hunting could result in the narwhal’s qualifying for threatened status (under criterion A) within five years, the species should be listed as Near Threatened. The narwhal is unquestionably a conservation-dependent species.

Across the global range of the species, subpopulations are subject to differing levels of threat and warrant individual assessment. Therefore, a caveat for the global listing as Near Threatened is that it assumes national and international management authorities will continue to monitor and manage harvest levels. Hunting with modern equipment in specific parts of Greenland and Canada represents the most long-standing and consistent threat to narwhals throughout their range. Several small and/or depleted subpopulations (e.g. West Greenland and Hudson Bay) warrant individual assessment as an immediate priority.

History
  • 1996
    Data Deficient
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Monodon monoceros is listed as CITES Appendix II and IUCN Data Deficient. As in most ivory bearing mammals around the world, destruction of individuals for their ivory is a constant threat.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: near threatened

  • Klinowska, M. 1991. Dolphins, Porpoises and Whales. The IUCN Red Data Book. Gland, Switzerland: IUCN.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1) and listed on Appendix II of CITES (5). It is also listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (6) and on Appendix II of the Berne Convention on the Conservation of European Wildlife and Natural Habitats (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population is probably in excess of 80,000 animals. The narwhals that summer in the Canadian High Arctic constitute the largest fraction, probably in excess of 70,000 animals (Innes et al. 2002; NAMMCO/JCNB 2005). In addition, some thousands of narwhals probably summer in the bays and fjords along the East Baffin Island coastline (NAMMCO/JCNB 2005). Another summering aggregation, centred in northern Hudson Bay, numbers about 3,500 animals (COSEWIC 2004). Two summering aggregations in West Greenland (Inglefield Bredning and Melville Bay) total over 2,000 animals (Heide-Jørgensen 2004; NAMMCO/JCNB 2005) and in East Greenland a rough estimate of the total number of animals in the summering aggregations is >1,000 (Gjertz 1991; NAMMCO/JCNB 2005). Surveys in Central West Greenland in late winter estimated 2,800 animals in 1998 and 1999 (Heide-Jørgensen and Acquarone 2002), however, these surveys covered unknown proportions of whales from different summering aggregations in West Greenland (likely Inglefield Bredning) and possibly Canada. Some areas in Canada with summering aggregations remain unsurveyed, although these likely contain small numbers.

The estimated generation length for the narwhal according to Taylor et al. (2007) is 24 years, which means that the 3-generation window is 1936-2008.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Narwhal populations are potentially threatened by hunting, climate change, and industrial activities. Narwhals were never the targets of large-scale commercial hunting except for a brief period of perhaps several decades of the early 20th century in the eastern Canadian Arctic (Mitchell and Reeves 1981). They were hunted opportunistically by commercial whalers, explorers and adventurers in many areas. For many centuries, narwhals have been hunted by the Inuit for human food, dog food and tusk ivory (Born et al. 1994). The mattak (skin and adhering blubber) is highly prized as food and provides a strong incentive for the hunt (Reeves 1993), but in recent years the cash value of ivory and the need for cash to buy snowmobiles have both greatly increased. Potential future threats include habitat degradation from oil exploration and development (e.g., in West Greenland) and increased shipping in the high Arctic (NW and NE passages), all of which is bound to increase with the dramatic, ongoing reduction in sea ice.

In West Greenland, catches have declined since 1993 with no significant sex bias. Heide-Jorgensen (2002) estimated the annual catch rate at 550 between 1993 and 1995. In 2004, the estimated catch in West Greenland was 294 (NAMMCO/JCNB 2005), including whales that were struck and lost. In contrast to West Greenland, there has been an 8% increase in catches in East Greenland since 1993 (NAMMCO/JCNB 2005).

The narwhal is actively hunted only in Canada and Greenland. In the eastern Canadian Arctic, the average reported landed catch per year from selected communities was 373 between 1996 and 2004 (NAMMCO/JCNB 2005). In Canada the majority of the communities take a greater proportion of males than females throughout the seasons. Annual catch statistics in Canada substantially underestimate the total numbers of narwhals killed due primarily to the incomplete reporting of whales that are struck and killed but lost (IWC 2000; NAMMCO/JCNB 2005; Nicklen 2007).

Narwhals supplied various staples in the traditional subsistence economy. Today the main products are mattak and ivory (Reeves 1993; Reeves and Heide-Jørgensen 1994; Heide-Jørgensen 1994; Nicklen 2007). Narwhal tusks from Canada and Greenland are sold in specialty souvenir markets domestically and also have been exported. However, in Greenland, the export of tusks is currently banned. In Canada, the quota system that had been in place since the 1970s was replaced by a community-based management system implemented in the late 1990s and early 2000s (COSEWIC 2004). The hunt is managed by local hunter and trapper organizations with harvest limits established in some communities. Compliance has been questionable (COSEWIC 2004). Under this system, removals from some summering aggregations are probably sustainable, however, there is concern that removals from other summering aggregations may not be (NAMMCO/JCNB 2005). In Greenland, a quota system was introduced in 2004 by the Greenland Ministry of Fisheries and Wildlife. The quota was set at 300 narwhals (of which 294 were taken), divided among municipalities of West Greenland. Compliance reportedly has been good (NAMMCO/JCNB 2005) although there is concern that catch limits may be set too high (IWC 2007, p. 52).

The effects of climate change on narwhals are uncertain. Narwhals are well adapted to a life in the pack ice as indicated by the fact that there is very little open water in their winter habitat (Laidre and Heide-Jørgensen 2005b). They spend much of their time in heavy ice and are vulnerable to ice entrapments where hundreds can become trapped in a small opening in the sea ice (savssat) and die. This occurs when sudden changes in weather conditions (such as shifts in wind or quick drops in temperature) freeze shut leads and cracks they were using. When entrapped whales are discovered by hunters, they normally are killed. A recent assessment of the sensitivity of all Arctic marine mammals to climate change ranked the narwhal as one of the three most sensitive species, primarily due to its narrow geographic distribution, specialized feeding and habitat choice, and high site fidelity (Laidre et al. in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Subsistence hunting evidently does not pose a significant threat at current levels, but further data are needed; potentially threatened by pollution and activities associated with development of mineral and hydrocarbon resources (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hunted by the Inuit as a subsistence food, narwhals are also hunted for their ivory tusks which are sold as curios or to be carved. The price of narwhal ivory has increased significantly since the 1970s and continues to rise. Narwhals are also susceptible to climate fluctuations and long-term climate change, and as pack ice recedes, their range declines. Narwhals are known to have been trapped under fast-forming ice, preventing them from forming a breathing hole (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES and CMS Appendix II.

The European Union (EU), with stronger CITES rules than other countries, has established an import ban on tusks (active since December 2004). Although Denmark belongs to the EU, it is unclear whether the ban on trade in narwhal ivory between Greenland and Denmark is being enforced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: See IUCN (1991) for a discussion of conservation measures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1976 the Narwhal Protection Regulations were produced as part of the Canadian Fisheries Act. It contained legislation that required fishing to be limited to quotas, conferring total protection onto mothers and calves, requiring that full use be made of narwhal carcasses, and requiring the full labelling of every tusk obtained. However, these regulations are sometimes poorly enforced. The narwhal is protected in the United States, although the Inuit are exempt from these laws for subsistence hunting only. It is fully protected in Russia and Norway (3), and quotas limit the catch in west Greenland (8). Laws requiring the declaration of narwhal catch, both intentional and by-catch, are necessary throughout this species' range (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects to humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Historically narwhals were a staple food source of many Arctic peoples. Arctic people used the narwhals body for a number of other uses. The blubber can be rendered for oil, the sinew used as thread, and the tusks traded and carved.

Positive Impacts: food ; ecotourism ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Long subjected to subsistence harvest for meat, blubber, skin, sinews, and tusk. Still hunted for subsistence (probably around 1000 killed annually in Canada and Greenland); no commercial harvest, though tusk enters international trade. See IUCN (1991) for a summary of historical exploitation.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Near Threatened (NT)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Narwhal

The narwhal, or narwhale, (Monodon monoceros) is a medium-sized toothed whale that lives year-round in the Arctic. One of two living species of whale in the Monodontidae family, along with the beluga whale, narwhal males are distinguished by a long, straight, helical tusk, actually an elongated upper left canine. Found primarily in Canadian Arctic and Greenlandic waters, rarely south of 65°N latitude, the narwhal is a uniquely specialized Arctic predator. In the winter, it feeds on benthic prey, mostly flatfish, at depths of up to 1500 m under dense pack ice.[3] Narwhals have been harvested for over a thousand years by Inuit people in northern Canada and Greenland for meat and ivory, and a regulated subsistence hunt continues to this day. While populations appear stable, the narwhal is particularly vulnerable to climate change due to a narrow geographical range and specialized diet.[4]

Contents

Taxonomy and etymology

The narwhal was one of the many species originally described by Linnaeus in his Systema Naturae.[5] Its name is derived from the Old Norse word nár, meaning "corpse", in reference to the animal's greyish, mottled pigmentation, like that of a drowned sailor.[6] The scientific name, Monodon monoceros, is derived from Greek: "one-tooth one-horn"[6] or "one-toothed unicorn".

The narwhal is most closely related to the beluga whale. Together, these two species comprise the only extant members of the Monodontidae family, sometimes referred to as the "white whales". The Monodontidae are distinguished by medium size (at around 4 m (13 ft) in length), forehead melons, short snouts, and the absence of a true dorsal fin.[7] The white whales, dolphins (Delphinidae) and porpoises (Phocoenidae) together comprise the Delphinoidea superfamily, which are of likely monophyletic origin. Genetic evidence suggests the porpoises are more closely related to the white whales, and that these two families constitute a separate clade which diverged from the Delphinoidea within the past 11 million years.[8]

Description

This narwhal skull has double tusks, a rare trait in narwhals. Usually, males have a single long tusk, the canine on the left side of the upper jaw. (Zoologisches Museum in Hamburg)

These are medium-sized whales, being around the same size as a beluga whale. Total length in both sexes, excluding the "tusk" of the male, can range from 3.95 to 5.5 m (13 to 18 ft).[9] Males, at an average length of 4.1 m (13 ft 5 in), are slightly larger than females, at an average of 3.5 m (11 ft 6 in). Typical adult body weight can range from 800 to 1,600 kg (1,800 to 3,500 lb).[9] Males attain sexual maturity at 11 to 13 years of age, when they are approximately 3.9 m (12 ft 10 in) long, and females attain maturity at 5 to 8 years old, when they are 3.4 m (11 ft 2 in) long.[9] The pigmentation of the narwhal is a mottled pattern, with blackish-brown markings over a white background. They are darkest when born and become whiter in color with age, with white patches developing on the navel and genital slit at sexual maturity. Old males may be almost pure white.[6][9][10]

The most conspicuous characteristic of the male narwhal is its single extremely long tusk, a canine tooth[11] that projects from the left side of the upper jaw and forms a left-handed helix. The tusk seems to grow slightly throughout life from 1.5 to 3.1 m (4 ft 11 in to 10 ft 2 in). Despite its formidable appearance, the tusk is hollow and weighs only around 10 kg (22 lb). About one in 500 males has two tusks, which occurs when the right canine, normally small and less straight, also grows out. A female narwhal has a shorter, and straighter tusk.[12] She may also produce a second tusk, but this occurs rarely, and there is a single recorded case of a female with dual tusks.[13]

The most broadly accepted theory for the role of the tusk is as a secondary sexual characteristic, similar to the mane of a lion or the tail feathers of a peacock.[6] This hypothesis was notably discussed and defended at length by Charles Darwin, in The Descent of Man, and Selection in Relation to Sex (1871). It may help determine social rank, maintain dominance hierarchies, or help young males develop skills necessary for performance in adult sexual roles. Narwhals have rarely been observed using their tusk for fighting,[14] other aggressive behavior or for breaking sea ice in their Arctic habitat.[6] Some narwhals have a second, small tooth in their mouths, but are essentially toothless.[9] The tusk may be a sensory organ.[15]

Distribution

The frequent (solid) and rare (striped) occurrence of narwhal populations

The narwhal is found predominantly in the Atlantic and Russian areas of the Arctic Ocean. Individuals are commonly recorded in the northern part of Hudson Bay, Hudson Strait, Baffin Bay; off the east coast of Greenland; and in a strip running east from the northern end of Greenland round to eastern Russia (170° East). Land in this strip includes Svalbard, Franz Joseph Land, and Severnaya Zemlya.[6] The northernmost sightings of narwhal have occurred north of Franz Joseph Land, at about 85° North latitude.[6] Most of the world's narwhals are concentrated in the fjords and inlets of Northern Canada and western Greenland.

Behavior and diet

Narwhals "tusking"

Narwhals have a relatively restricted and specialized diet. Their prey is predominantly composed of Greenland halibut, polar and Arctic cod, cuttlefish, shrimp and Gonatus squid. Additional items found in stomachs have included wolffish, capelin, skate eggs and sometimes rocks, accidentally ingested when whales feed near the bottom.[3][9][16][17] Due to the lack of well-developed dentition in the mouth, narwhals are believed to feed by swimming towards prey until it is within close range and then sucking it with considerable force into the mouth. It is thought that the beaked whales, who have similarly reduced dentition, also suck up their prey.[18]

Narwhals are a migratory species. As spring comes, these leads open up into channels and the narwhals return to the coastal bays.[4]

Narwhals exhibit seasonal migrations, with a high fidelity of return to preferred, ice-free summering grounds, usually in shallow waters. In summer months, they move closer to coasts, usually in pods of 10–100. In the winter, they move to offshore, deeper waters under thick pack ice, surfacing in narrow fissures in the sea ice, or leads.[17] Narwhals from Canada and West Greenland winter regularly in the pack ice of Davis Strait and Baffin Bay along the continental slope with less than 5% open water and high densities of Greenland halibut.[3] Feeding in the winter accounts for a much larger portion of narwhal energy intake than in the summer[3][17] and, as marine predators, they are unique in their successful exploitation of deep-water arctic ecosystems.

Most notable of their adaptations is the ability to perform deep dives. When on their wintering grounds, the narwhals make some of the deepest dives ever recorded for a marine mammal, diving to at least 800 meters (2,625 feet) over 15 times per day, with many dives reaching 1,500 meters (4,921 feet). Dives to these depths last around 25 minutes, including the time spent at the bottom and the transit down and back from the surface.[19] In the shallower summering grounds, narwhals dive to depths between 30 and 300 meters (90–900 feet).

Narwhals normally congregate in groups of about five to ten individuals, sometimes up to 20 outside the summer. Groups may be "nurseries" with only females and young or can contain only post-dispersal juveniles or adult males ("bulls"), though mixed groups can occur at any time of the year.[9] In the summer, several groups come together, forming larger aggregations. Such aggregations can contain from 500 to over 1000 individuals.[9] At times, bull narwhals rub their tusks together in an activity called "tusking".[16] This behavior is thought to maintain social dominance hierarchies.[16]

Mortality and conservation

A polar bear scavenging a narwhal carcass
Narwhal fluke

Normally, narwhals can live quite a long life, with lifespans of up to at least 50 years recorded. Mortality often occurs when the narwhals suffocate after they fail to leave before the surface of the Arctic waters freeze over in the late fall.[9] Starvation can also threaten their lives, especially in young whales. Although almost all modern predation of narwhals is by humans, a few natural predators also attack them on occasion. The primary natural predators are polar bears, who attempt to swipe narwhals at breathing holes and mainly target young whales, and killer whales (or orcas), pods of which can overwhelm a narwhal. Greenland sharks and walruses may take a few small young or weak and wounded adults, though this is likely quite rare.[9] Inuit people are allowed to hunt this whale species legally for subsistence. Narwhal has been extensively hunted the same way as other sea mammals, such as seals and whales, for its large quantities of fat which constituted one of the most important resources of the native people living in arctic regions. Almost all parts of the narwhal, meat, skin, blubber and organs are consumed. Mattak, the name for raw skin and blubber, is considered a delicacy, and the bones are used for tools and art.[6] The skin is an important source of vitamin C which is otherwise difficult to obtain. In some places in Greenland, such as Qaanaaq, traditional hunting methods are used, and whales are harpooned from handmade kayaks. In other parts of Greenland and Northern Canada, high-speed boats and hunting rifles are used.[6]

The head of a lance made from a Narwhal tusk with a meteorite iron blade

Narwhal have been found to be one of the most vulnerable arctic marine mammals to climate change. The study quantified the vulnerabilities of 11 year-round Arctic sea mammals.[4][20] Narwhals that have been brought into captivity tend to die of unnatural causes.[15] The world population is currently estimated to be around 75,000 individuals.[4] Approximately 25,000–50,000 breeding narwhal are believed to exist in the wild worldwide.[9]

Humans and narwhals

In Inuit legend, the narwhal's tusk was created when a woman with a harpoon rope tied around her waist was dragged into the ocean after the harpoon had struck a large narwhal. She was transformed into a narwhal herself, and her hair, which she was wearing in a twisted knot, became the characteristic spiral narwhal tusk.[21]

Image of narwhal from Brehms Tierleben

Some medieval Europeans believed narwhal tusks to be the horns from the legendary unicorn.[22] As these horns were considered to have magic powers, such as the ability to cure poison and melancholia, Vikings and other northern traders were able to sell them for many times their weight in gold. The tusks were used to make cups that were thought to negate any poison that may have been slipped into the drink. During the 16th century, Queen Elizabeth received a carved and bejeweled narwhal tusk for £10,000—the cost of a castle (approximately £1.5–2.5 million in 2007, using the retail price index).[23] The tusks were staples of the cabinet of curiosities.[24] The truth of the tusk's origin developed gradually during the Age of Exploration, as explorers and naturalists began to visit Arctic regions themselves. In 1555, Olaus Magnus published a drawing of a fish-like creature with a horn on its forehead, correctly identifying it as a "Narwal".[24] The narwhal was one of two possible explanations of the giant sea phenomenon written by Jules Verne in his book Twenty Thousand Leagues Under the Sea. The other possible explanation was a man-made vessel, but that was not likely in the opinion of the narrator.

Herman Melville wrote a section on the narwhal in Moby Dick, in which he claims a narwhal tusk hung for "a long period" in Windsor Castle after Sir Martin Frobisher had given it to Queen Elizabeth.[25]

See also

References

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R.R., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K. (2008). Monodon monoceros. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 18 December 2008.
  3. ^ a b c d Laidre, K (2004). "Deep-ocean predation by a high Arctic cetacean". ICES Journal of Marine Science 61 (1): 430–440. doi:10.1016/j.icesjms.2004.02.002. 
  4. ^ a b c d Laidre, K. L.; Stirling, I.; Lowry, L.; Wiig, Ø.; Heide-Jørgensen, M. P. and Ferguson, S. (2008). "Quantifying the sensitivity of arctic marine mammals to climate-induced habitat change". Ecological Applications 18 (2): S97–S125. doi:10.1890/06-0546.1. PMID 18494365. 
  5. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 824. 
  6. ^ a b c d e f g h i Heide-Jørgensen, M. P. and Laidre, K. L. (2006). Greenland’s Winter Whales: The beluga, the narwhal and the bowhead whale. Ilinniusiorfik Undervisningsmiddelforlag, Nuuk, Greenland. ISBN 978-87-7975-299-3. 
  7. ^ Brodie, Paul (1984). In Macdonald, D. The Encyclopedia of Mammals. New York: Facts on File. pp. 200–203. ISBN 0-87196-871-1. 
  8. ^ Waddell, V.G.; Milinkovitch, M.C.; Bérubé, M. and Stanhope, M.J. (2000). "Molecular Phylogenetic Examination of the Delphinoidea Trichotomy: Congruent Evidence from Three Nuclear Loci Indicates That Porpoises (Phocoenidae) Share a More Recent Common Ancestry with White Whales (Monodontidae) Than They Do with True Dolphins (Delphinidae)". Molecular Phylogenetics and Evolution 15 (2): 314–318. doi:10.1006/mpev.1999.0751. PMID 10837160. 
  9. ^ a b c d e f g h i j k Macdonald, D.W.; Barrett , P. (1993). Mammals of Europe. New Jersey: Princeton University Press. ISBN 0-691-09160-9. 
  10. ^ "Monodon monoceros". Fisheries andAquaculture Department: Species Fact Sheets. Food and Agriculture Organization of the United Nations. Retrieved 2007-11-20. 
  11. ^ Nweeia, Martin T., et al.; Eichmiller, Frederick C.; Hauschka, Peter V.; Tyler, Ethan; Mead, James G.; Potter, Charles W.; Angnatsiak, David P.; Richard, Pierre R. et al. (2012). "Vestigial tooth anatomy and tusk nomenclature for Monodon monoceros". The Anatomical Record 295 (6): 1006–16. doi:10.1002/ar.22449. PMID 22467529. 
  12. ^ Narwhal Whale Tusk. www.narwhalwhales.com. Retrieved on 2013-04-21.
  13. ^ Carwardine, Mark (1995). DK Handbooks: Whales Dolphins and Porpoises. Dorling Kindersley. ISBN 1-56458-620-0. 
  14. ^ Silverman, H. B. and Dunbar, M. J. (1980). "Aggressive tusk use by the narwhal (Monodon monoceros L.)". Nature 284 (5751): 56–57. doi:10.1038/284057a0. 
  15. ^ a b Broad, William (December 13, 2005). "It's Sensitive. Really.". The New York Times.  mirror
  16. ^ a b c "The Biology and Ecology of Narwhals". National Oceanic and Atmospheric Administration. Retrieved 2009-01-15. 
  17. ^ a b c Laidre, K.L. and Heide-Jørgensen, M. P. (2005). "Winter feeding intensity of narwhals". Marine Mammal Science 21 (1): 45–57. doi:10.1111/j.1748-7692.2005.tb01207.x. 
  18. ^ ANIMAL BYTES – Narwhal. Seaworld.org. Retrieved on 2013-04-21.
  19. ^ Laidre, K. L.; Heide-Jørgensen, M. P.; Dietz, R.; Hobbs, R. C. and Jørgensen, O. A. (2003). "Deep-diving by narwhals, Monodon monoceros: differences in foraging behavior between wintering areas?". Marine Ecology Progress Series 261: 269–281. doi:10.3354/meps261269. 
  20. ^ Borenstein, Seth (25 April 2008). "Narwhals more at risk to Arctic warming than polar bears". Associated Press. Retrieved 2008-04-27. 
  21. ^ Bastian, Dawn E; Judy K. Mitchell (2004). Handbook of Native American Mythology. ABC-CLIO. pp. 54–55. ISBN 1-85109-533-0. 
  22. ^ Daston, Lorraine and Katharine Park. Wonders and the Order of Nature, 1150–1750. New York: Zone Books, 2001.
  23. ^ Purchasing Power of British Pounds from 1264 to 2007. measuringworth.com
  24. ^ a b Shepard, Odell (1956). The Lore of the Unicorn. Harper and Row Publishers. 
  25. ^ Melville, Herman (1851). Moby-Dick; or, The Whale. Harper and Brothers. 

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!