Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

"Beluga are a Northern Hemisphere species, and have a thick layer of blubber that enables them to live in icy polar waters. They breed in the winter. The mother's pregnancy lasts about a year, and the calf nurses for two years on her rich milk. Beluga visit warm-water estuaries during the summer, possibly because warmth may accelerate the annual molting, or shedding, of their outer skin. After they molt, they are bright white. They are social animals who live in groups called ""pods,"" which may consist of several hundred individuals. Beluga make a variety of squeaks and chirps while traveling. Sailors who could hear them through the sides of their wooden ships called them ""sea canaries."" Polar bears and killer whales are known predators."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the beluga whale  More images, video and sound
  • Original description: Pallas, P.S., 1776.  Reise durch verschiedene Provinzen des Russischen Reichs, p. 85. St. Petersbourg, viii, Pt. 2, nxxvi.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Belugas are highly social animals, and in the summer months thousands of individuals can be seen gathered in estuaries; often females with calves will come together whilst males form large bachelor groups (3). Females are sexually mature at around five years of age, they give birth to a single calf after a gestation period that lasts just over a year (6). Mother and calf have an extremely strong bond, swimming very closely together, and the calf will continue to feed on its mothers milk until well into its second year (3). Belugas are able to dive to depths of over 1,000 metres but spend most of their time on the surface of the water swimming slowly. During winter months it may be necessary for individuals to create breathing holes in the ice, which they can do with their heavy head (7). The flippers are capable of a wide-range of movement and enable belugas to manoeuvre themselves effectively (3). In summer months, large numbers of belugas gather in estuaries in order to moult; they rub themselves on the gravel bed and shed the yellow, withered skin of the previous year to once again become gleaming white (3). Belugas feed on a wide variety of fish, bottom-dwelling invertebrates and worms; most of the prey is found on the seabed and it is thought that the highly flexible lips may be used to suck prey into the mouth (8). Sounds can be used to detect prey; the enlarged melon is an electro-receptor for sounds that are sent out from the nasal passages (3). These whales are thought to live for up to 50 years, killer whales and polar bears prey upon them, and belugas are particularly vulnerable if trapped by the ice (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The snow-white beluga whale is one of the most distinctive of all cetaceans (a group that includes, dolphins, whales and porpoises). The stocky body ends in a particularly small head, and adults develop their striking white colouring as they mature (2). Belugas lack a dorsal fin, their genus name 'Delphinapterus' means 'dolphin-without-a-wing' (3) (6), but there is a ridge of toughened skin along the back that tends to be more pronounced in mature males (6). Unlike most cetaceans, belugas have an extremely flexible neck and can turn their head almost 90 degrees to the side; their lips are also flexible, forming a variety of facial expressions (3). Belugas use a wide range of vocalisations such as clicks, grunts, squeals, screeches and whistles (6). These sounds can be heard through the hulls of ships and the beluga was nicknamed the 'sea canary' by early Arctic sailors (3). They have a very thick layer of blubber which may be up to 15 centimetres thick that provides insulation in the freezing arctic waters (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Beluga Whale: A gregarious white whale of Arctic coasts primarily inhabiting areas with sea ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Newborns dark gray, subadults light gray, adults white; No dorsal fin, but dorsal ridge; Head with prominent melon and short beak; Flexible neck allows them to turn their heads
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

East Pacific; Eastern Atlantic Ocean, Europe and Northern Asia (excluding China); Indo-West Pacific; Western Atlantic Ocean
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subarctic area
  • UNESCO-IOC Register of Marine Organisms
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Beluga whales inhabit the arctic and sub-arctic waters along the coast of Canada, Alaska, Greenland, Norway, and the Soviet Union. About 500 of them inhabit the waters of the St. Lawrence River.

Biogeographic Regions: arctic ocean (Native ); pacific ocean (Native )

  • Bonner, W. 1989. Whales of the World. New York: Facts on File Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Beluga whales are distributed in high latitudes of the Northern Hemisphere from the west coast of Greenland westwards to Svalbard (Stewart and Stewart 1989; O'Corry-Crowe 2002). Records from the Sea of Japan and Baltic Sea are considered extralimital, but resident populations occur in cold temperate latitudes in Cook Inlet (Alaska, US) and the St. Lawrence River system (Canada). Satellite telemetry, genetic studies, and organochlorine analyses show belugas have strong matrilineally driven seasonal site fidelity to fjords and estuaries for summering and they migrate to separate wintering grounds (O’Corry-Crowe et al. 1997, Richard et al. 2001, de March et al. 2002, Innes et al. 2002, O’Corry-Crowe et al. 2002, Palsbøll et al. 2002).

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Arctic and sub-Arctic waters of North America and Eurasia. Southernmost regular range in the Western Hemisphere: St. Lawrence River estuary (isolated resident population), Gulf of Alaska, James Bay (Stewart and Stewart 1989). See Reeves and Mitchell (1989) for information on status in Ungava Bay and eastern Hudson Bay. See Richard (1993) for information on status in western and southern Hudson Bay. See Doidge and Finley (1993) for information on status of the Baffin Bay population. See also IUCN (1991) for further details regarding distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Belugas are found in Arctic waters around northern Russia, North America, Greenland and the Norwegian archipelago of Svalbard (3). Most populations migrate north in the spring, then south in the autumn once the ice starts to form (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

The beluga is also known as the white whale for its milky white skin. It is the only species of whale that is entirely white, although it is born gray and fades gradually with age. These whales lack a dorsal fin, but have a shallow ridge along their back. Their appendages are narrower and pointier than that of the narwhal. Belugas also have a melon-shaped head, which is the center for echolocation. They are 3 to 5 meters and length and weigh an average of 1.6 tons (3500lbs). Fifty percent of their weight is fat, a marked increase relative to other non-arctic whales, whose body is only twenty percent fat. The blubber is 10cm thick in belugas. Belugas are sexually dimorphic, with the males being slightly larger than the females. Females average 1,350 kg and males 1,500 kg in weight.

Average mass: "1,350-1,500" kg.

Range length: 300 to 460 cm.

Average length: 400 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 1.43e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 4300 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 3.4-4.9 m males; 3.3-4 m females

Weight:
Range: 800-1,500 kg males; 540-790 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: Belugas are white-colored whales with a fusiform body shape and a large melon on the head. This melon is thought by some to focus echolocation tones, although this is in question. The melon can also be used as an indicator of health (poorly nourished belugas have low flat melons while well fed individuals have round melons) and of emotional state--agressive individuals raise their melons forward. There are no dorsal fins. Thirty-eight teeth are present. Males are larger than females.
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

inshore including estuaries and rivers in summer, sometimes offshore
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

mostly coastal, also in estuaries and rivers
  • UNESCO-IOC Register of Marine Organisms
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The habitat of beluga whales includes inlets, fjords, channels, bays, and the shallow waters of the artic seas that are warmed by continuous sunlight. They are also found at the mouths of river during summertime, where they feed, socialize, and deliver their offspring. These waters are usually 8 to 10 degrees celsius.

Range depth: 0 to 350 m.

Habitat Regions: saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; benthic ; coastal ; brackish water

Other Habitat Features: estuarine

  • Paine, S. 1995. The World of the Arctic Whales. San Francisco: Sierra Club.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Belugas are relatively well-studied as a result of carcass sampling in association with hunting, along with a considerable amount of satellite-linked radio-tracking (Richard et al. 1998a,b; Richard et al. 2001; Lydersen et al. 2001; Heide-Jørgensen et al. 2003a; Hobbs et al. 2005).

Belugas occur seasonally (mainly in summer) in coastal waters as shallow as 1–3 m deep but also in deep offshore waters (800 m). They typically enter estuaries and sometimes move upstream into rivers; there are records of individuals or small groups ranging hundreds of kilometers from the sea. They occupy estuaries, continental shelf and slope waters, and deep ocean basins in conditions of open water, loose ice, and heavy pack ice. Belugas generally prefer to overwinter in shallow or coastal areas, usually with light or highly moveable ice cover (Barber et al. 2001, Richard et al. 2001, Suydam et al. 2001, Heide-Jørgensen et al. 2003a) and may occur as fully Arctic populations (Richard et al. 1998b, Richard et al. 2001, Suydam et al. 2001) or sub-Arctic populations (Hobbs et al. 2005).

Some Belugas undertake large-scale annual migrations between summering and wintering sites, while others remain in the same area year-round, shifting offshore only when excluded from coastal habitat by fast-ice formation (Hobbs et al. 2005). Large numbers of migratory Belugas occur along the northwestern and northern Alaskan coast, in the Canadian high Arctic, and in western Hudson Bay. At certain times of the year, those whales migrate thousands of kilometers, in some cases as far as 80oN into dense pack ice (Suydam et al. 2001) or thousands of kilometers into the North Water polynya or to the pack ice off West Greenland (Richard et al. 1998a,b; Richard et al. 2001; Heide-Jørgensen et al. 2003a). Non-migratory belugas that generally make seasonal shifts in distribution of less than a few hundred kilometers are found in Cook Inlet, Cumberland Sound, Svalbard, and the Gulf of St. Lawrence (Lydersen et al. 2001; Kingsley 2002; Hobbs et al. 2005).

While the general features of Beluga whale habitat can be described for the relatively well-studied populations, the importance of those features is not well understood (Laidre et al. in press). For example, the summer occupation of nearshore/estuarine waters has been ascribed alternatively to feeding (Seaman et al. 1982), to warm water providing a thermal advantage to neonates (Sergeant and Brodie 1969), and to the presence of fresh water and coarse substrates facilitating skin shedding during molt (St. Aubin et al. 1990, Frost et al. 1993). The relative importance of each of those factors likely varies based on the environmental conditions (e.g., water temperatures and prey availability) specific to each of the summering areas (Frost and Lowry 1990a). Similarly, it is unclear why belugas sometimes move into deep, ice-covered waters. One potential reason would be to avoid Killer Whale (Orcinus orca) predation (Frost et al. 1992). However, the movements into the ice appear excessive for what would be needed to avoid killer whales (Suydam et al. 2001) and actually could expose belugas to predation by Polar Bears (Ursus maritimus) (Lowry et al. 1987a) as well as increase the risk of entrapment in the ice. It is possible belugas move into ice-covered offshore regions for feeding, primarily on Arctic Cod (Boreogadus saida), but few data are available to test this hypothesis. Similarly, the associations of belugas with features such as the continental shelf break (Moore 2000) may be related to oceanographic processes that produce good feeding conditions (Laidre et al. in press).

Dives may last up to 25 min. and can reach depths of 800 m. The Beluga has a diverse diet, which varies greatly from area to area. Although various species of fish are considered to be the primary prey items (including salmon, herring, and Arctic Cod), Belugas also feed on a wide variety of molluscs (such as squid and octopus) and benthic crustaceans (shrimps and crabs). Polar Bears and Killer Whales are known predators of belugas throughout their Arctic range (Frost et al. 1992).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Marine

Comments: Inhabits the open ocean as well as shallow coastal waters, rivers, estuaries; shallow waters such as estuaries of large rivers are used in summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.367 - 14.365
  Nitrate (umol/L): 1.715 - 3.963
  Salinity (PPS): 31.835 - 33.295
  Oxygen (ml/l): 6.009 - 7.040
  Phosphate (umol/l): 0.419 - 0.635
  Silicate (umol/l): 2.009 - 3.312

Graphical representation

Temperature range (°C): 7.367 - 14.365

Nitrate (umol/L): 1.715 - 3.963

Salinity (PPS): 31.835 - 33.295

Oxygen (ml/l): 6.009 - 7.040

Phosphate (umol/l): 0.419 - 0.635

Silicate (umol/l): 2.009 - 3.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic and subarctic, often in or near sea ice or glacial ice; Coastal waters and estuaries, shelf break, and deep basins; Circumpolar but discontinuous distributionShelf & coastal, North Pacific to Chukchi & Beaufort Seas
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The beluga whale inhabits cold arctic waters, usually near to the ice edge (3). Summer is spent in shallow bays and estuaries, whereas in winter, the beluga whale occurs in areas of loose pack ice, where wind and ocean currents keeps cracks for breathing holes open (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Population that summers around Somerset Island in eastern Canadian high arctic migrates through Lancaster Sound and winters mainly in Baffin Bay and Davis Strait (Droidge and Finley 1992, 1993). heavy pack ice and landfast ice; in spring may follow ice edges closely, penetrate areas with ice cracks (Stewart and Stewart 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Belugas feast on a variety of prey including smelt, flatfish, flounder, sculpins, salmon, and cod. They also feed on invertebrates such as crab, shrimp, clams, worms, octopus, squid, and other bottom dwelling creatures. Since they don’t have many big, sharp teeth to grab their prey, they use suction to trap it into their mouths. Consequently, everything must be eaten whole. Prey cannot be too large, therefore, or the beluga will choke on it.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats various benthic and pelagic prey in shallow and coastal waters; most important prey varies, includes capelin, various cods, sand lance, char, herring, cisco, whitefish, smelt, burbot, salmon, sculpin, decapods, squid, octopus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wide range of prey including primarily fish, cephalopods, and crustaceans; Echolocate prey with sonar
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Belugas consume many fish, especially since they travel in herds of between one hundred and a thousand. This undoubtedly causes some regulation of fish populations. Belugas also seem to have a parasite called Pharurus pallasii, thought to infect the hearing organs. However, it is not known if this parasite is harmful to the beluga.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The known predators of belugas are killer whales and polar bears. Polar bears will attack belugas in the same way they would attack a seal, which entails lying in wait at breathing holes. Killer whales come around August. Belugas can usually hear killer whales, so this makes it difficult for killer whales to attack them. Also, the conspicuous fin makes it almost impossible for a killer whale to maneuver in ice. Humans used to hunt belugas for their skin and oil, but that is not so common anymore.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Delphinapterus leucas is prey of:
Orcinus
Homo sapiens
Ursus maritimus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Delphinapterus leucas preys on:
benthonic invertebrates
Vertebrata
non-insect arthropods
Actinopterygii
aquatic or marine worms
Mollusca
Crustacea

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Travels in small groups of 2-10, also forms summer congregations of hundreds or thousands. Mature males tend to travel together, as do females, calves, and immatures (Stewart and Stewart 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

large variety of fish, various crustaceans and other bottom living invertebrates
  • North-West Atlantic Ocean species (NWARMS)
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication is achieved by using the melon for echolocation. Belugas have a high frequency level of communication. Their voices are so loud that they sound like birds, which is why they were once nicknamed “sea canaries”. They are considered to be among the most vocal species of cetaceans. They use their vocalizations for echolocation, mating, and communication. Their voices sound like chirps, whistles, and squawks. Belugas also use body language such as grinding their teeth or splashing around. Some communication undoubtedly occurs when babies are in contact with their mothers.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; echolocation ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

There is either thought to be spontaneous ovulation with an extremely long gestation period or delayed implantation with a shorter gestation period, but it is unknown. Their development is similar to that of most other mammals. (Lentifer 1988)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size at birth 1.5m (5 feet); Sexual maturity at 5-8 years; Females have calves every 2-3 years; Longevity over 35 years, possibly more then 50 years; Behavior; Vocal and gregarious
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The life span for females is thought to be about 32 years and that for males about 40 years. Predation and ice entrapment are common causes of premature death.

Range lifespan

Status: wild:
32 to 40 years.

Typical lifespan

Status: wild:
25 to 30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: It is estimated that these animals may live up to 40 years in the wild (David Macdonald 1985). One wild born specimen was still alive in captivity at about 34 years of age (Richard Weigl 2005). Maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The mating system of these whales has not been described.

Belugas tend to mate from late February to early April. The males chase down the females, making all sorts of noises. The male throws down his tail and bends violently, then he throws his head up and down as his melon vibrates to ward off any other males who might attempt to mate with this female.

The male and female swim in harmony and caress each other, until she swims underneath his belly. She puts her belly up against his and they continue to swim in harmony with each other. They mate only with absolute consent. (Paine, 1995)

Gestation lasts about fourteen months. However, it is a possibility that these creatures have delayed implantation. A calf is born during the summer months of May through July. The calf is very well developed and has a grayish coloration. The nursery pod stays around during the delivery and then all of them take off except a young teenage nursemaid. This usually happens near rivers because the water is ten degrees warmer there. This is important for the calf, which does not have as much blubber as a full grown adult. The baby stays in-between the two females as they swim pulling him with the current. The calf is totally dependent on the mother’s milk for a year, but lactation lasts 1.5 to 2 years.

It takes 4 to 7 years for females to sexually mature, and it takes 7 to 9 years for males. (Bonner, 1989)

Females reproduce every 2 to 3 years. Females stop reproducing in their early twenties. (Lentifer, 1989)

Breeding interval: Female belugas generally reproduce once every two to three years.

Breeding season: Breeding occurs from late February through early April.

Range number of offspring: 1 to 1.

Average gestation period: 14 months.

Range weaning age: 12 to 24 months.

Range time to independence: 12 to 24 months.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 7 to 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; viviparous ; delayed implantation

Average birth mass: 66000 g.

Average gestation period: 416 days.

Average number of offspring: 1.

Offspring are precocious, and able to swim along side their mothers from birth. The mother provides protection and guidance for the offspring, as well as milk. A female beluga can lactate for up to two years.

Parental Investment: precocial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Bonner, W. 1989. Whales of the World. New York: Facts on File Publications.
  • Lentifer, J. 1988. Selected Marine Mammals of Alaska: Species Accounts with Research and Management Recomendations. Washington, D.C.: Marine Mammals Commission.
  • Paine, S. 1995. The World of the Arctic Whales. San Francisco: Sierra Club.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mates generally in spring. Gestation lasts 14-15 months. Single young (rarely 2); births peak in late March in western Greenland, late June in western Hudson Bay and Bering Sea, July in the Gulf of St. Lawrence. Lactation lasts 20-24 months. Age of first pregnancy: 4-7 years (Stewart and Stewart 1989). Calving interval probably is 3 years for most adult females. Females live up to about 20 years, males to about 30 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Delphinapterus leucas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATCTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACCGGCCTAAGCTTGTTAATTCGTGCTGAATTAGGCCAACCTGGCTCACTTATTGGAGACGACCAAATTTATAACGTACTAGTAACAGCCCACGCCTTCGTGATAATCTTCTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGAAACTGACTTGTCCCTTTAATAATCGGAGCCCCCGACATGGCTTTCCCTCGTCTAAATAACATAAGCTTTTGACTGCTTCCTCCTTCTTTCCTACTACTAATAGCATCCTCAATAGTTGAAGCCGGCGCAGGCACAGGCTGAACTGTGTACCCCCCTCTAGCAGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTTACTATTTTCTCTCTACATCTAGCCGGCGTATCTTCAATCCTCGGGGCTATCAACTTCATTACAACTATTATTAACATAAAACCACCCGCTATAACCCAATACCAAACACCTTTATTCGTATGATCAGTCTTAATTACAGCAGTCTTACTCCTATTATCACTACCTGTCCTAGCAGCCGGAATTACCATGCTACTAACTGATCGAAACCTAAACACAACCTTTTTCGACCCTGCAGGAGGAGGCGACCCAGTCCTATATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Delphinapterus leucas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Currently, beluga populations have been estimated at 60,000 to a 100,000 so there is no need for conservation efforts, although it couldn’t hurt.

US Federal List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Jefferson, T.A., Karkzmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R., Rojas-Bracho, L., Secchi, E., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J.

Contributor/s

Justification
At the global level the species does not qualify for a threatened status under any of the criteria although there is substantial uncertainty about numbers and trends for at least some large parts of the range, especially in the Russian Arctic. Given that uncertainty, and the fact that cessation of national and international, taxon-specific conservation programs that currently monitor and manage hunting could result in the Beluga’s qualifying for threatened status (under criterion A3) within five years, the species should be listed as Near Threatened. The Beluga whale is unquestionably a conservation-dependent species.

The species was assessed previously (1996) as Vulnerable (VU A1abd). The main reason for the change to Near Threatened is that the decline criterion for Vulnerable is not met for some of the largest subpopulations, and they have a disproportionate effect on the assessment of the species as a whole. Also, estimates of current population size for several of the larger stocks are substantially higher than previous estimates (due to better survey methods and not necessarily because of increases in numbers).

Across the global range of Belugas, subpopulations are subject to differing levels of threat and warrant individual assessment. Some subpopulations clearly qualify for threatened status and only one of these – the Cook Inlet subpopulation – has been assessed thus far (as CR) (Lowry et al. 2006). Those other potentially threatened subpopulations (e.g. West Greenland, eastern Hudson Bay, St. Lawrence River, Ungava Bay) that are well-defined and well-studied should be assessed separately as soon as feasible.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1). Listed on Appendix II of CITES (4), and listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population consists of numerous subpopulations with varying degrees of differentiation (hereafter the terms subpopulation and stock are used interchangeably). The International Whaling Commission’s Scientific Committee (IWC 2000) organized information on belugas on the basis of 29 provisional management stocks. Some of the stock boundaries overlap spatially and seasonally, complicating assessment. Many of the subpopulations or stocks maintain distinct or contiguous geographical ranges during the summer months but mix during the spring and autumn migrations and share common wintering quarters. While good abundance estimates are available for some Beluga subpopulations/stocks, the sizes of others are virtually unknown. Total numbers worldwide are well above 150,000 animals, with many portions of the range unsurveyed. The following estimates for subpopulations/stocks or regions range from relatively precise abundance estimates to rough approximations of numbers in the late 1990s or early 2000s:

Alaska
Cook Inlet: The number of Beluga whales in Cook Inlet is estimated from counts by aerial observers and aerial video group counts (Hobbs et al. 2000b; Lowry et al. 2006). The most recent published estimate at the time of the present assessment (May 2008) was 302 (CV=0.16) in 2006 (Angliss and Outlaw 2007). In addition, the National Marine Fisheries Service had indicated via a web posting that the point estimate from the 2007 aerial survey was 375.

Bristol Bay: Most recently (1994), the number of Beluga whales in Bristol Bay was estimated at 1,555 (Lowry and Frost 1999). This estimate was based on a maximum count of 503 animals, which was corrected using radio-telemetry data for the proportion of animals that were diving (Lowry and Frost 1999) and for the proportion of newborns and yearlings not observed due to their small size and colouration. Surveys in 1999 and 2000 resulted in maximum counts of 690 and 531, which can be extrapolated to population estimates of 2,133 and 1,642, respectively (L. Lowry, University of Alaska Fairbanks pers. comm. to K. Laidre, 1/07).

Eastern Bering Sea: Aerial surveys of Norton Sound, the summering site for the eastern Bering Sea stock, were conducted in 2000. Preliminary analyses produced an uncorrected estimate of 5,868 animals; when corrected for animals not visible at the surface and for newborn and yearling animals not observed due to their small size and dark coloration, the estimated population size for Norton Sound is 18,142 (CV=0.24) (R. Hobbs, AFSC-NMML pers. comm. 01/07; Angliss and Outlaw 2005).

Eastern Chukchi Sea: Frost et al. (1993) estimated the minimum size of the eastern Chukchi stock of belugas at 1,200, based on counts of animals from aerial surveys conducted during 1989-91. The total corrected abundance estimate for the eastern Chukchi stock is 3,710.

Shared Alaska/Canada
Eastern Beaufort Sea/Beaufort Sea: The most recent aerial survey, conducted in July 1992, resulted in an uncorrected estimate of 19,629 (CV=0.229) (Harwood et al. 1996). The corrected population estimate was 39,258 animals (Angliss and Outlaw 2005).

Canada
Cumberland Sound: This stock numbers about 1,500 animals and is thought to have increased since the 1980s (COSEWIC 2004)

Ungava Bay: The Ungava Bay stock is too small to estimate. Hammill et al. (2004) recently estimated it at <50 animals; none were seen on a survey conducted in 2001.

West Hudson Bay: There are estimated to be more than 23,000 Belugas in western Hudson Bay and more than 1,300 along the southern Hudson Bay coast (Richard 1991).

East Hudson Bay: Belugas in Eastern Hudson Bay have declined from 4,200 (SE 300) in 1985 to 3,100 (SE 800) in 2004 (corrected estimates) (Hammill et al. 2005).

St Lawrence River: The St. Lawrence subpopulation is estimated to be in the order of 900–1,000 individuals. There is no evidence of a significant trend in abundance since 1988 (COSEWIC 2004).

Eastern High Arctic/Baffin Bay: A survey in 1996 estimated 21,213 Belugas (95% CI 10,985 to 32,619) in the waters surrounding Somerset Island: Barrow Strait, Peel Sound and Prince Regent Inlet (Innes et al. 2002). This estimate takes into account both whales missed by observers and those that might have been unavailable for detection due to diving behaviour. It includes whales that move to West Greenland during the winter.

Shared Canada/Greenland
West Greenland: Aerial surveys flown in late winter in West Greenland between 1981 and 1994 found that Beluga numbers had decreased by 62% during that period, probably because of over-harvesting (Heide-Jørgensen and Reeves 1996). Further surveys in 1998 and 1999 confirmed the decline and found 7,941 (95% CI: 3650-17278) belugas in West Greenland, including whales missed by the observers and whales that were submerged during the survey (Heide-Jørgensen and Acquarone 2002). Heide-Jørgensen et al. (2003) estimate that approximately 30% of the Eastern Canadian high Arctic/Baffin Bay beluga stock migrates to West Greenland for overwintering.

Svalbard
Belugas have never been surveyed around Svalbard. Pods numbering into the thousands are sighted irregularly around the archipelago, and pods ranging from a few to a few hundred individuals are seen regularly (Gjertz and Wiig 1994, Kovacs and Lydersen 2006).

Russia
Eastern and Central Russian Arctic: There are no rigorous abundance estimates for the Eastern and Central Russian Arctic (Boltunov and Belikov 2002). Rough estimates of a few thousand in Anadyr Gulf and a few thousand in the western Chukchi and eastern East Siberian Seas were summarized in a table compiled by the IWC Scientific Committee (IWC 2000). In addition to those animals, belugas from Alaskan stocks (e.g. eastern Bering Sea, eastern Chukchi Sea, and Beaufort Sea stocks) move into eastern Russian waters during the winter. The IWC table mentioned above (IWC, 2000) indicates a rough estimate of 18,000–20,000 in the Okhotsk Sea.

Western Russian Arctic: Belugas in the Western Russian Arctic occupy four major areas: (1) southern Barents and White seas, (2) southern Barents and Kara seas, (3) coastal waters of the Kara Sea, and (4) western portion of the Laptev Sea. They may share wintering grounds to some extent. Surveys have not yet been conducted in the Barents and Kara seas and the number of Belugas inhabiting these regions is unknown. The White Sea hosts a resident population of belugas numbering about 1,000 over-wintering individuals. In summer, this number is augmented by animals from the Barents Sea.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hunting for human consumption is the biggest known threat to belugas across certain portions of their range. The most immediate concerns relate to continuing harvests from small and depleted subpopulations (IWC 2000). The strong philopatry of belugas, which causes them to return to the same estuaries year after year, makes them highly vulnerable to overexploitation. This behavioural trait is undoubtedly the most important natural factor that has led to the extirpation of Belugas from some parts of their range by a combination of commercial and subsistence hunting (e.g. in southwestern Greenland and some river mouths in Ungava Bay, Canada).

Known or potential threats include a variety of human activities in addition to hunting: oil and gas development, expansion of fisheries (with possible implications for bycatch and resource depletion), hydroelectric development (in Hudson Bay), and industrial and urban pollution. Climate change will likely increase the scale and distribution of these activities. Hydroelectric development may affect belugas because of their dependence on estuarine conditions. Areas such as the McKenzie Delta and West Greenland are subject to oil exploration, which often includes seismic surveys, offshore drilling, and artificial island construction. These activities are undertaken in the summer months in the same areas occupied by belugas at this time of year. In a study of responses of belugas to ice-breaking ships, the Belugas typically moved rapidly along ice edges away from approaching ships and showed strong avoidance reactions to approaching ships at distances of 35–50 km (Finley et al. 1990).

Climate change is another potential threat. Belugas may experience climate-induced geographic shifts or altered reproductive success due to persistent changes in extent of sea ice (Tynan and DeMaster, 1997, Laidre et al in press). Belugas are also susceptible to savssats or ice entrapments when sea ice conditions change rapidly.

Threats from contaminants are of concern in some areas. Studies of the small, geographically isolated subpopulation in the St. Lawrence River have found that concentrations of both total PCBs and chlorinated PCB congeners are much higher in these belugas than in Arctic belugas. Some scientists believe that the increased occurrence of opportunistic bacterial infections, parasitic infestation, gastric ulcers and other disorders in St. Lawrence belugas is evidence of a link between immune system dysfunction and PCB exposure (Martineau et al., 1994).

To summarize, in some parts of the species’ range, particularly in Canada and Greenland, intensive hunting represents an ongoing major threat, and in a few instances this is compounded by the less direct and less easily quantified threats (realized and potential) of disturbance by vessel traffic (e.g. St. Lawrence estuary, river mouths in eastern Hudson Bay), habitat modification (e.g. large hydroelectric dams in rivers flowing into Hudson Bay and James Bay), contaminants (e.g. St. Lawrence estuary), climate change (including secondary effects from opening of Arctic and sub-Arctic waters to year-round ship traffic, oil an gas development, commercial fishing), and possibly incidental catch in fisheries (e.g. St. Lawrence estuary).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Population decline in Gulf of St. Lawrence (from 5000 to 500) and elsewhere is attributed to loss of suitable habitat, pollution, and especially historic over-exploitation (Stewart and Stewart 1989, IUCN 1991, Dold 1993). This population shows a high rate of intestinal cancer, possibly related to water pollution (Farnsworth, NY Times, 22 August 1995). Lungworms may be an important cause of morbidity and mortality of young in the St. Lawrence estuary (Measures et al. 1995). The Southeast Baffin Island population is thought to be declining as a result of excessive harvest (Richard 1991). There is also concern that excessive harvest, especially in western Greenland, may be threatening the Baffin Bay population that summers around Somerset Island (Droidge and Finley 1992, 1993). Potentially threatened also by development of hydrocarbon resources and increased disturbance from ship traffic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In some parts of the Beluga Whale’s range, particularly in Canada and Greenland, intensive hunting represents an ongoing threat to Belugas. In a few instances this is compounded by the less direct and less easily quantified threats of disturbance by vessel traffic (e.g., St. Lawrence estuary, river mouths in eastern Hudson Bay), habitat modification (e.g., large hydroelectric dams in rivers flowing into Hudson Bay and James Bay), contaminants (e.g., St. Lawrence estuary), and possibly incidental catch in fisheries (wherever entangling gear overlaps the animals’ range) (IUCN 2009).

Global climate change may also have serious negative impacts on Beluga Whales. The most serious impacts of climate change on Belugas may not come directly from the effects of weather conditions, but rather indirectly from the role that regional warming and reduced sea ice play in changing human activities. Extensive ice cover and extreme winter conditions (including both darkness and cold) have always limited human activities in the Arctic, and many regions have remained inaccessible to ships and other vessels. As Arctic ice cover declines and the passages between northern landmasses become more navigable, humans will gain easier access to formerly pristine areas that have long served as refuges for Belugas (IUCN 2009).

The number of vessels sailing through the Arctic for gas and oil exploration/extraction, commercial shipping (for both transportation and tourism), and fishing has already increased. Further reductions in sea ice are likely to accelerate this trend in coming decades. With the increase in ship traffic, ship strikes are likely to become an increasingly significant cause of Beluga injury and death. Belugas detect and respond to the presence of icebreaking ships over great distances (up to 50 km). Industrial noise (e.g., from ships, seismic surveys, and offshore drilling), likely disrupts Beluga behaviour and may impair the ability of Belugas to communicate, forage efficiently and generally sense their environment. Noise-producing activities are already ongoing or planned in many areas used by large populations of Belugas, including the Beaufort and Chukchi seas, West Greenland, and Hudson Bay (IUCN 2009).

Pollution may become an increasingly significant problem for Belugas with increasing industrialization and urbanization of the Arctic. Many toxic contaminants become concentrated as they move up the food chain. Because Belugas and other cetaceans are at or near the top of the food chain and have long life spans, they accumulate relatively high concentrations of certain toxins in their blubber and other organs. These may contribute to a range of health problems in the animals themselves and are also of concern to the people who hunt Belugas for food (IUCN 2009).


Loss of sea ice and increased ocean temperatures will affect the distribution, composition, and productivity of prey communities and in turn influence the ability of Belugas to find and catch suitable prey. Given the great uncertainties about how Arctic and sub-Arctic ecosystems function and about how they will be affected by climate change, it is difficult to confidently predict impacts of climate change on Beluga prey populations (IUCN 2009).


As weather patterns become more unpredictable and extreme due to climate change, it is possible that Belugas and other Arctic whales will become more susceptible to ice entrapment. Such events have always occurred and are assumed to contribute to natural mortality in most Beluga populations. However, it is feared that the frequency and scale of the mortality from ice entrapment will increase as the climate changes (IUCN 2009).

As Arctic waters become warmer and patterns of circulation, salinity, and nutrient input change, species that previously were not present in the Arctic will be able to move farther north and remain there for longer. This could have two major types of effects on Belugas. First, species such as Minke and Humpback whales as well as seals and other predators may directly compete with Belugas for food resources. Second, species such as Killer Whales may have more opportunities to prey on Belugas. Both of these factors could negatively affect Beluga populations (IUCN 2009).

One population (or "distinct population segment" in the curious language of the U.S. Endangered Species Act), the Cook Inlet Beluga Whale of Cook Inlet in southeastern Alaska, was listed as endangered by the U.S. National Oceanic and Atmospheric Administration (NOAA) in October of 2008. In December of 2009, NOAA proposed designating more than a third of Cook Inlet as critical habitat for the remaining ~300 Cook Inlet Beluga Whales.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Belugas have traditionally been hunted for their blubber for many centuries, but only with the advent of commercial whaling did the harvest become too large to sustain (6) (9). These whales are particularly vulnerable, due to their high fidelity for certain migratory routes (3). Perhaps the most pertinent threat to the beluga today, is habitat deterioration in the form of the industrial development and pollution of coastal habitats with which they are particularly associated (3). Some populations are declining principally as a result of pollution; belugas in the St Lawrence River Estuary, for example, accumulate so many toxins that deformed calves are prevalent and dead individuals are treated as toxic waste (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Although the Beluga was hunted intensively on a commercial basis in many parts of its range during the 20th century, the only known direct removals at present are for food (subsistence use) and the aquarium trade (there is a limited live-capture fishery in Russia). A regional management body, the Joint Committee on Narwhal and Beluga/North Atlantic Marine Mammal Commission (JCNB/NAMMCO), exists in Canada and Greenland with the expectation that it will ensure the conservation of Belugas. This body sets or recommends catch limits for Beluga populations within member countries. Catch levels from subpopulations range anywhere from <10 to a few hundred animals per year. Removals from some subpopulations/stocks are considered sustainable, however, there is concern and evidence that removals from other subpopulations/stocks are not (e.g. Eastern Hudson Bay and West Greenland) (Alvarez and Heide-Jørgensen 2004, COSEWIC 2004, NAMMCO/JCNB 2005).

It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Today the widespread hunting of beluga whales is prohibited under the International Moratorium on Commercial Whaling (11); however, small quotas are permitted to local people who depend upon the harvest (6). The Alaska and Inuvialuit Beluga Whale Committee was established in 1988 and encourages dialogue between native hunters, conservationists and government representatives as well as carrying out stock and hunting assessment of the Alaskan and Canadian populations of belugas (12). Some protection from industrial development is being provided at locations where these whales commonly occur but careful monitoring of existing stocks will be needed to secure the future of this attractive cetacean (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Belugas hinder fishermen from getting any fish. Much of the hunting of belugas has died down since the seventies.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Belugas were once hunted for food and other items such as oil. These provided humans with a profit. Now, because of their large social groupings, they provide ecotourists with entertainment.

Positive Impacts: food ; ecotourism ; research and education; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Long subjected to subsistence harvest, and formerly to commercial harvest, throughout range (IUCN 1991). Currently harvested by subsistence hunters (e.g., Alaskan natives and Canadian Inuit, and Greenland natives). Displayed in some marine aquaria.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Cook Inlet beluga whale : Critically Endangered (CR)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category

Near Threatened (NT)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Beluga whale

"White Whale" redirects here. For other uses, see White Whale (disambiguation).

The beluga whale or white whale (Delphinapterus leucas) is an Arctic and sub-Arctic cetacean. It is one of two members of the family Monodontidae, along with the narwhal, and the only member of the genus Delphinapterus. This marine mammal is commonly referred to simply as the melonhead, beluga or sea canary due to its high-pitched twitter.[9]

It is adapted to life in the Arctic, so has anatomical and physiological characteristics that differentiate it from other cetaceans. Amongst these are its unmistakable all-white colour and the absence of a dorsal fin. It possesses a distinctive protuberance at the front of its head which houses an echolocation organ called the melon, which in this species is large and plastic (deformable). The beluga's body size is between that of a dolphin's and a true whale’s, with males growing up to 5.5 m (18 ft) long and weighing up to 1,600 kg (3,500 lb). This whale has a stocky body; it has the greatest percentage of blubber. Its sense of hearing is highly developed and it possesses echolocation, which allows it to move about and find blowholes under sheet ice.

Belugas are gregarious and they form groups of up to 10 animals on average, although during the summer months, they can gather in the hundreds or even thousands in estuaries and shallow coastal areas. They are slow swimmers, but can dive down to 700 m (2,300 ft) below the surface. They are opportunistic feeders and their diets vary according to their locations and the season. They mainly eat fish, crustaceans and other deep-sea invertebrates.

The majority of belugas live in the Arctic and the seas and coasts around North America, Russia and Greenland; their worldwide population is thought to number around 150,000. They are migratory and the majority of groups spend the winter around the Arctic ice cap; when the sea ice melts in summer, they move to warmer river estuaries and coastal areas. Some populations are sedentary and do not migrate over great distances during the year.

The native peoples of North America and Russia have hunted belugas for many centuries. They were also hunted commercially during the 19th century and part of the 20th century. Whale hunting has been under international control since 1973. Currently, only certain Inuit groups are allowed to carry out subsistence hunting of belugas. Other threats include natural predators (polar bears and killer whales), contamination of rivers, and infectious diseases.

From a conservation perspective, the beluga was placed on the International Union for Conservation of Nature’s Red List in 2008 as being "near threatened"; the subpopulation from the Cook Inlet in Alaska is considered Critically Endangered and is under the protection of the United States' Endangered Species Act.[2][10] Of seven Canadian beluga populations, the two inhabiting eastern Hudson Bay and Ungava Bay are listed as endangered.

Belugas are one of the cetaceans most commonly kept in captivity in aquariums and wildlife parks in North America, Europe and Asia; they are popular with the public due to their colour and expression.

Taxonomy[edit]

Skull of a cross between a narwhal and a beluga whale, at the Zoological Museum, Copenhagen

The beluga was first described in 1776 by Peter Simon Pallas.[1] It is a member of the Monodontidae family, which is in turn part of the toothed whale suborder.[1] The Irrawaddy dolphin was once placed in the same family; recent genetic evidence suggests these dolphins belong to the Delphinidae family.[11][12] The narwhal is the only other species within the Monodontidae besides the beluga.[13] A skull has been discovered with intermediate characteristics supporting the hypothesis that hybridization is possible between these two families.[14]

The name of the genus, Delphinapterus, means "dolphin without fin" (from the Greek δελφίν (delphin) dolphin and απτερος (apteros), without fin) and the species name leucas means "white" (from the Greek λευκας (leukas), white).[15] The Red List of Threatened Species gives both beluga and white whale as common names, though the former is now more popular. The English name comes from the Russian белуха (belukha), which derives from the word белый (bélyj), meaning "white".[15] Note that the name beluga in Russian refers to a totally unrelated species, see Beluga (sturgeon).

The whale is also colloquially known as the sea canary on account of its high-pitched squeaks, squeals, clucks and whistles. A Japanese researcher says he taught a beluga to "talk" by using these sounds to identify three different objects, offering hope that humans may one day be able to communicate effectively with sea mammals.[16] A similar observation has been made by Canadian researchers, where a Beluga which died in 2007 "talked" when he was still a sub-adult. Another example is NOC, a beluga whale who could mimic the rhythm and tone of human language.There have been many other reports that beluga whales in the wild have imitated human voices.[17]

Evolution[edit]

Skeleton of D. leucas

Mitochondrial DNA studies have shown modern cetaceans last shared a common ancestor between 30 and 34 million years ago.[18] The Monodontidae family separated relatively early from the other odontoceti; it split from the Delphinoidea family between 11 and 15 million years ago, and from the Phocoenidae, its closest relatives in evolutionary terms, more recently still.[19]

The beluga's earliest known ancestor is the prehistoric Denebola brachycephala from the late Miocene period (9–10 million years ago).[20][21] A single fossil from the Baja California peninsula indicates the family once inhabited warmer waters.[22] The fossil record also indicates, in comparatively recent times, the beluga's range varied with that of the polar ice packs expanding during ice ages and contracting when the ice retreated.[23] Counter-evidence to this theory comes from the finding in 1849 of fossilised beluga bones in Vermont in the United States, 240 km (150 mi) from the Atlantic Ocean. The bones were discovered during construction of the first railroad between Rutland and Burlington in Vermont, when workers unearthed the bones of a mysterious animal in Charlotte. Buried nearly 10 ft (3.0 m) below the surface in a thick blue clay, these bones were unlike those of any animal previously discovered in Vermont. Experts identified the bones as those of a beluga. Because Charlotte is over 150 mi (240 km) from the nearest ocean, early naturalists were at a loss to explain the presence of the bones of a marine mammal buried beneath the fields of rural Vermont. The remains were found to be preserved in the sediments of the Champlain Sea, an extension of the Atlantic Ocean within the continent resulting from the rise in sea level at the end of the ice ages some 12,000 years ago.[24] Today, the Charlotte whale is the official Vermont State Fossil (making Vermont the only state whose official fossil is that of a still extant animal).

Description[edit]

Front view

Its body is round, particularly when well fed, and tapers less smoothly to the head than the tail. The sudden tapering to the base of its neck gives it the appearance of shoulders, unique among cetaceans. The tailfin grows and becomes increasingly and ornately curved as the animal ages. The flippers are broad and short—making them almost square-shaped.

Longevity[edit]

Preliminary investigations suggested a beluga’s life expectancy was rarely more than 30 years.[25] The method used to calculate the age of a beluga is based on counting the layers of dentin and dental cement in a specimen's teeth, which were originally thought to be deposited once or twice a year. The layers can be readily identified as one layer consists of opaque dense material and the other is transparent and less dense. It is therefore possible to estimate the age of the individual by extrapolating the number of layers identified and the estimated frequency with which the deposits are laid down.[26] A 2006 study using radiocarbon dating of the dentine layers showed the deposit of this material occurs with a lesser frequency (once per year) than was previously thought. The study therefore estimated belugas can live for 70 or 80 years.[27]

Size[edit]

The species presents a moderate degree of sexual dimorphism, as the males are 25% longer than the females and are sturdier.[28] Adult male belugas can range from 3.5 to 5.5 m (11 to 18 ft), while the females measure 3 to 4.1 m (9.8 to 13.5 ft).[29] Males weigh between 1,100 and 1,600 kg (2,400 and 3,500 lb), occasionally up to 1,900 kg (4,200 lb) while females weigh between 700 and 1,200 kg (1,500 and 2,600 lb).[30][31] They rank as mid-sized species among toothed whales.[32]

Both sexes reach their maximum size by the time they are 10 years old.[33] The beluga's body shape is stocky and fusiform (cone-shaped with the point facing backwards), and they frequently have folds of fat, particularly along the ventral surface.[34] Between 40% and 50% of their body weight is fat, which is a higher proportion than for cetaceans that do not inhabit the Arctic, where fat only represents 30% of body weight.[35][36] The fat forms a layer that covers all of the body except the head, and it can be up to 15 cm (5.9 in) thick. It acts as insulation in waters with temperatures between 0 and 18 °C, as well as being an important reserve during periods without food.[37]

Color[edit]

Head of a beluga showing the large frontal prominence that houses the melon and its distinctive white colouring

The adult beluga is rarely mistaken for any other species, because it is completely white or whitish-grey in colour.[38] Calves are usually born grey[29] and by the time they are a month old, have turned dark grey or blue grey. They then start to progressively lose their pigmentation until they attain their distinctive white colouration, at the age of seven years in females and 9 in males.[38] The white colouration of the skin is an adaptation to life in the Arctic that allows belugas to camouflage themselves in the polar ice caps as protection against their main predators, polar bears and killer whales.[39] Unlike other cetaceans, the belugas seasonally shed their skin.[40] During the winter, the epidermis thickens and the skin can become yellowish, mainly on the back and fins. When they migrate to the estuaries during the summer, they rub themselves on the gravel of the riverbeds to remove the cutaneous covering.[40]

Head and neck[edit]

Spiracle in the back of a beluga’s head

Like most toothed whales it has a compartment found at the centre of the forehead that contains an organ used for echolocation called a melon, which contains fatty tissue.[41] The shape of the beluga's head is unlike that of any other cetacean, as the melon is extremely bulbous, lobed, and visible as a large frontal prominence.[41] Another distinctive characteristic it possesses is the melon is malleable; its shape is changed during the emission of sounds.[13] The beluga is able to change the shape of its head by blowing air around its sinuses to focus the emitted sounds.[42][43] This organ contains fatty acids, mainly isovaleric acid (60.1%) and long-chain branched acids (16.9%), a very different composition from its body fat, and which could play a role in its echolocation system.[44]

Unlike many dolphins and whales, the seven vertebrae in the neck are not fused together, allowing the animal to turn its head laterally without needing to rotate its body.[45] This gives the head a lateral manoeuvrability that allows an improved field of view, helps in catching prey and evading predators, and movement in deep water.[39] The rostrum has about eight to 10 small blunt and slightly curved teeth on each side of the jaw and a total of 36 to 40 teeth.[46] Belugas do not use their teeth to chew, but for catching hold of their prey; they then tear them up and swallow them nearly whole.[47] Belugas only have a single spiracle, which is located on the top of the head behind the melon, and has a muscular covering, allowing it to be completely sealed. Under normal conditions, the spiracle is closed and an animal must contract the muscular covering to open the spiracle.[48] A beluga's thyroid gland is larger than that of terrestrial mammals – weighing three times more than that of a horse – which helps it to maintain a greater metabolism during the summer when it lives in river estuaries.[49] It is the marine cetacean that most frequently develops hyperplastic and neoplastic lesions of the thyroid.[50]

Fins[edit]

A beluga showing its tail fin in shallow water in Vancouver Aquarium, Canada

The fins retain the bony vestiges of the beluga’s mammalian ancestors, and are firmly bound together by connective tissue.[34] The fins are small in relation to the size of the body, rounded and oar-shaped, and slightly curled at the tips.[15] These versatile extremities are mainly used as a rudder to control direction, to work in synchrony with the tailfin and for agile movement in shallow waters up to 3 m (10 ft) deep.[33] The fins also contain a mechanism for regulating body temperature, as the arteries feeding the fin’s muscles are surrounded by veins that dilate or contract to gain or lose heat.[34][51] The tailfin is flat with two oar-like lobes, it does not have any bones, and is made up of hard, dense, fibrous connective tissue. The tailfin has a distinctive curvature along the lower edge.[34] The longitudinal muscles of the back provide the ascending and descending movement of the tailfin, which has a similar thermoregulation mechanism to the pectoral fins.[34]

Belugas have a dorsal ridge, rather than a dorsal fin.[29] The absence of the dorsal fin is reflected in the genus name of the species—apterus the Greek word for "wingless". The evolutionary preference for a dorsal ridge rather than a fin is believed to be an adaptation to under-ice conditions, or possibly as a way of preserving heat.[13] The crest is hard and, along with the head, can be used to open holes in ice up to 8 cm (3 in) thick.[52]

Senses[edit]

Emission and reception of sounds in a toothed whale
  • Hearing: The beluga has a very specialized sense of hearing and its auditory cortex is highly developed. It can hear sounds within the range of 1.2 kHz to 120 kHz, with the greatest sensitivity between 10 and 75 kHz,[53] where the average hearing range for humans is 0.02 to 20 kHz.[54] The majority of sounds are most probably received by the lower jaw and transmitted towards the middle ear. In the toothed whales, the lower jawbone is broad with a cavity at its base, which projects towards the place where it joins the cranium. A fatty deposit inside this small cavity connects to the middle ear.[55] Toothed whales also possess a small external auditory hole a few centimetres behind their eyes; each hole communicates with an external auditory conduit and an eardrum. It is not known if these organs are functional or simply vestigial.[55]
  • Vision: Belugas are able to see within and outside of water, but their vision is relatively poor when compared to dolphins.[56] Their eyes are especially adapted to seeing under water, although when they come into contact with the air, the crystalline lens and the cornea adjust to overcome the associated myopia (the range of vision under water is short).[56] A beluga's retina has cones and rods, which also suggests they can see in low light. The presence of cone cells indicates they can see colours, although this suggestion has not been confirmed.[56] Glands located in the medial corner of their eyes secrete an oily, gelatinous substance that lubricates the eye and helps flush out foreign bodies. This substance forms a film that protects the cornea and the conjunctiva from pathogenic organisms.[56]
  • Touch: Studies on captive animals show they seek frequent physical contact with other belugas.[39]
  • Taste: Areas in the mouth have been found that could act as chemoreceptors for different tastes, and they can detect the presence of blood in water, which causes them to react immediately by displaying typical alarm behaviour.[39]
  • Smell: Like the other toothed whales, their brains lack olfactory bulbs and olfactory nerves, which suggests they do not have a sense of smell.[41]

Behaviour[edit]

Aerial view of a pod of belugas swimming at the surface

These cetaceans are highly sociable and they regularly form small groups, or pods, that may contain between two and 25 individuals, with an average of 10 members.[57] Pods tend to be unstable, meaning individuals tend to move from pod to pod. Radio tracking has even shown belugas can start out in one pod and within a few days be hundreds of miles away from that pod.[58] These pods contain animals of both sexes,[59] and are led by a dominant male.[46] Many hundreds and even thousands of individuals can be present when the pods join together in river estuaries during the summer. This can represent a significant proportion of the total population and when they are most vulnerable to being hunted.[60]

They are cooperative animals and frequently hunt in coordinated groups.[61] The animals in a pod are very sociable and often chase each other as if they are playing or fighting, and they often rub up against each other.[62]

In captivity, they can be seen to be constantly playing, vocalizing and swimming around each other.[63] They show a great deal of curiosity towards humans and frequently approach the windows in the tanks to observe them.[64] Belugas may also playfully spit at humans or other whales. It is not unusual for an aquarium handler to be drenched by one of his charges. Some researchers believe spitting originated with blowing sand away from crustaceans at the sea bottom.

Belugas also show a great degree of curiosity towards humans in the wild, and frequently swim alongside boats.[65] They also play with objects they find in the water; in the wild they do this with wood, plants, dead fish and with bubbles they have created.[35] During the breeding season, adults have been observed carrying objects such as plants, nets and even the skeleton of a dead reindeer on their heads and backs.[63] Captive females have also been observed displaying this behaviour, carrying items such as floats and buoys, after they have lost a calf; experts consider this interaction with the objects could be acting as a substitute behaviour.[66]

Swimming and diving[edit]

Beluga coming to the surface to breathe

Belugas are slower swimmers than the other toothed whales, such as the killer whale and the common bottlenose dolphin, because they are less hydrodynamic and have limited movement of their tailfins, which produce the greatest thrust.[67] They frequently swim at between 3 and 9 km/h (1.9 and 5.6 mph), although they are able to maintain a speed of 22 km/h for up to 15 min.[46] Unlike most cetaceans, they are capable of swimming backwards.[33][68] Belugas swim on the surface between 5% and 10% of the time, while for the rest of the time they swim at a depth sufficient to cover their bodies.[33] They do not jump out of the water like dolphins or killer whales.[15]

These animals usually only dive to depths of up to 20 m (66 ft),[69] although they are capable of diving to greater depths. Individual captive animals have been recorded at depths between 400 and 647 m below sea level,[70] while animals in the wild have been recorded as diving to a depth of more than 700 m, with the greatest recorded depth being 872 m.[71] A dive normally lasts 3 to 5 min, but they can last up to 15 to 18 min.[46][71][72] In the shallower water of the estuaries, a diving session may last around two minutes; the sequence consists of five or six rapid, shallow dives followed by a deeper dive lasting for up to one minute.[33] The average number of dives per day varies between 31 and 51.[71]

All cetaceans, including belugas, have physiological adaptations designed to conserve oxygen while they are under water.[73] During a dive, these animals will reduce their heart rate from 100 beats a minute to between 12 and 20.[73] Blood flow is diverted away from certain tissues and organs and towards the brain, heart and lungs, which require a constant oxygen supply.[73] The amount of oxygen dissolved in the blood is 5.5%, which is greater than that found in land-based mammals and is similar to that of Weddell seals (a diving marine mammal). One study found a female beluga had 16.5 litres of oxygen dissolved in her blood.[74] Lastly, the beluga’s muscles contain high levels of the protein myoglobin, which stores oxygen in muscle. Myoglobin concentrations are several times greater than for terrestrial mammals, which helps prevent oxygen deficiency during dives.[75]

Beluga whales often accompany Bowhead whales, for curiosity and to secure polynya feasible to breath as bowheads are capable of breaking through ices from underwater by headbutting.[76]

Diet[edit]

Pacific salmon, the staple diet of belugas from Alaska

Belugas play an important role in the structure and function of marine resources in the Arctic Ocean, as they are the most abundant toothed whales in the region.[77] They are opportunistic feeders; their feeding habits depend on their locations and the season.[28] For example, when they are in the Beaufort Sea, they mainly eat Arctic cod (Boreogadus saida) and the stomachs of belugas caught near Greenland were found to contain rose fish (Sebastes marinus), Greenland halibut (Reinhardtius hippoglossoides) and northern shrimp (Pandalus borealis),[78] while in Alaska their staple diet is Pacific salmon (Oncorhynchus kisutch).[79] In general, the diets of these cetaceans consist mainly of fish; apart from those previously mentioned, other fish they feed on include capelin (Mallotus villosus), smelt, sole, flounder, herring, sculpin and other types of salmon.[80] They also consume a great quantity of invertebrates, apart from shrimp, such as squid, crabs, clams, octopus, sea snails, bristle worms and other deep-sea species.[80][81] Animals in captivity eat 2.5% to 3% of their body weight per day, which equates to 18.2 to 27.2 kg.[82]

Foraging on the seabed typically takes place at depths between 20 and 40 m,[83] although they can dive to depths of up to 700 m in search of food.[71] Their flexible necks provide a wide range of movement while they are searching for food on the ocean floor. Some animals have been observed to suck up water and then forcefully expel it to uncover their prey hidden in the silt on the seabed.[61] As their teeth are neither large nor sharp, belugas have to use suction to bring their prey into their mouths; it also means their prey has to be consumed whole, which in turn means it cannot be too large or the belugas run the risk of it getting stuck in their throats.[84] They also join together into coordinated groups of five or more to feed on shoals of fish by steering the fish into shallow water, where the belugas then attack them.[61] For example, in the estuary of the Amur River, where they mainly feed on salmon, groups of six or eight individuals will join together to surround a shoal of fish and prevent their escape. Individuals will then take turns feeding on the fish.[52]

Reproduction[edit]

Underwater photo of calf swimming slightly below and behind its mother
Female and calf

Estimations of the age of sexual maturity for beluga whales vary considerably; the majority of authors estimate males reach sexual maturity when they are between four and seven years old, and females reach maturity when they are between four and nine years old.[85] The average age at which females first give birth is 8.5 years old and fertility begins to decrease when they are 25 years old, with no births recorded for females older than 41.[85]

Female belugas typically give birth to one calf every three years.[29] Most mating occurs usually February through May, but some mating occurs at other times of year.[13] The beluga may have delayed implantation.[13] Gestation has been estimated to last 12 to 14.5 months,[29] but information derived from captive females suggests a longer gestation period of up to 475 days (15.8 months).[86]

Calves are born over a protracted period that varies by location. In the Canadian Arctic, calves are born between March and September, while in Hudson Bay, the peak calving period is in late June, and in Cumberland Sound, most calves are born from late July to early August.[87] Births usually take place in bays or estuaries where the water is warm with a temperature of 10 to 15 °C.[57] Newborns are about 1.5 m (4.9 ft) long, weigh about 80 kg (180 lb); and are grey in colour.[46] They are able to swim alongside their mothers immediately after birth.[88] The newborn calves nurse under water and initiate lactation a few hours after birth; thereafter, they feed at intervals of around an hour.[61] Studies of captive females have indicated their milk composition varies between individuals and with the stage of lactation; it has an average fat content of 28%, 11% protein, 60.3% water and less than 1% residual solids.[89] The milk contains about 92 cal per ounce.[90]

The calves remain dependent on their mothers for nursing for the first year, when their teeth appear.[57] After this, they start to supplement their diets with shrimps and small fish.[41] The majority of the calves continue nursing until they are 20 months old, although occasionally lactation can continue for more than two years,[46] and lactational anoestrus may not occur. Alloparenting (care by females different from the mother) has been observed in captive belugas, including spontaneous and long-term milk production. This suggests this behaviour, which is also seen in other mammals, may be present in belugas in the wild.[91]

Communication and echolocation[edit]

Vocalizations of Delphinapterus leucas published by NOAA

Belugas use sounds and echolocation for movement, communication, to find breathing holes in the ice, and to hunt in dark or turbid waters.[42] They produce a rapid sequence of clicks that pass through the melon, which acts as an acoustic lens to focus the sounds into a beam that is projected forward through the surrounding water.[90] These sounds spread through the water at a speed of nearly 1.6 km per second, some four times faster than the speed of sound in the air. The sound waves rebound from objects in the water and return as echoes that are heard and interpreted by the animal.[42] This enables them to determine the distance, speed, size, shape and even the internal structure of the objects within the beam of sound. They also use this ability when moving around the thick ice sheets of the Arctic, to find polinyas (areas of unfrozen water) for breathing, or air pockets trapped under the frozen sheet ice.[57]

Some evidence indicates belugas are highly sensitive to the noise pollution produced by humans. In one study, the maximum frequencies produced by an individual located in San Diego Bay, California were between 40 and 60 kHz. The same individual produced sounds with a maximum frequency of 100 to 120 kHz on being transferred to Kaneohe Bay in Hawaii. The difference in frequencies is thought to be a response to the difference in environmental noise in the two areas.[92]

These cetaceans communicate using sounds of such high frequency, their calls sometimes sound like bird songs; for this reason belugas have been given the nickname "canaries of the sea".[93] Like the other toothed whales, belugas do not possess vocal cords and the sounds are probably produced by the movement of air between the nasal sacks, which are located near to the blowhole.[42]

Belugas are amongst the most vocal cetaceans.[94] They use their vocalisations for echolocation, during mating, and in communication. They possess a large repertoire, as they can emit up to 11 different sounds, such as cackles, whistles, trills and squawks.[42] They also make sounds by grinding their teeth or splashing, but they rarely use body language to make visual displays with their pectoral fins or tailfins, nor do they perform somersaults or jumps in the way other species do, such as dolphins.[42]


Distribution[edit]

Circumpolar distribution of beluga populations showing the main subpopulations

The beluga inhabits a discontinuous circumpolar distribution in Arctic and sub-Arctic waters.[95] During the summer, they can mainly be found in the deep waters ranging from 76°N to 80°N, particularly along the coasts of Alaska, northern Canada, western Greenland, and northern Russia.[95] The southernmost extent of their range includes isolated populations in the St. Lawrence River in the Atlantic,[96] and the Amur River delta, the Shantar Islands, and the waters surrounding Sakhalin Island in the Sea of Okhotsk.,.[97]

Migration[edit]

Belugas have a seasonal migratory pattern.[98] When the summer sites become blocked with ice during the autumn, they move to spend the winter in the open sea alongside the pack ice or in areas covered with ice, surviving by using polynyas to surface and breathe.[99] In summer after the sheet ice has melted, they move to coastal areas with shallower water (1–3 m deep), although sometimes they migrate towards deeper waters (>800 m).[98] In the summer, they occupy estuaries and the waters of the continental shelf, and on occasion, they even swim up the rivers.[98] A number of incidents have been reported where groups or individuals have been found hundreds or even thousands of kilometres from the ocean.[100][101] One such example comes from 9 June 2006, when a young beluga carcass was found in the Tanana River near Fairbanks in central Alaska, nearly 1,700 kilometers (1,100 mi) from the nearest ocean habitat. Belugas sometimes follow migrating fish, leading Alaska state biologist Tom Seaton to speculate it had followed migrating salmon up the river at some point in the previous autumn.[102] The rivers they most often travel up include: the Northern Dvina, the Mezen, the Pechora, the Ob and the Yenisei in Asia; the Yukon and the Kuskokwim in Alaska, and the Saint Lawrence in Canada.[95] Spending time in a river has been shown to stimulate an animal's metabolism and facilitates the seasonal renewal of the epidermal layer.[49] In addition, the rivers represent a safe haven for newborn calves where they will not be preyed upon by killer whales.[13] Calves often return to the same estuary as their mother in the summer, meeting her sometimes even after becoming fully mature.[103]

The migration season is relatively predictable, as it is basically determined by the amount of daylight and not by other variable physical or biological factors, such as the condition of the sea ice.[104] Vagrants may travel further south to areas such as Irish[105] and Scottish waters,[106] islands of Orkney[107] and Hebrides,[108] and to Japanese waters.[109][110] There had been several vagrant individuals [111] demonstrated seasonal residencies at Volcano Bay,[112][113][114][115] and a unique whale were used to return annually to areas adjacent to Shibetsu in Nemuro Strait in the 2000s.[116]

Some populations are not migratory and certain resident groups will stay in well-defined areas, for example in Cook Inlet, the estuary of the Saint Lawrence River and Cumberland Sound.[117] The population in Cook Inlet stays in the waters furthest inside the inlet during the summer and until the end of autumn, then during the winter, they disperse to the deeper water in the centre of the inlet, but without completely leaving it.[118][119]

In April, the animals that spend the winter in the centre and southwest of the Bering Sea move to the north coast of Alaska and the east coast of Russia.[117] The populations living in the Ungava Bay and the eastern and western sides of Hudson Bay overwinter together beneath the sea ice in Hudson Strait. The populations of the White Sea, the Kara Sea and the Laptev Sea overwinter in the Barents Sea.[117] In the spring, the groups separate and migrate to their respective summer sites.[117]

Habitat[edit]

Beluga in the mouth of the Churchill River in the Hudson Bay, Canada

Belugas exploit a varied range of habitats; they are most commonly seen in shallow waters close to the coast, but they have also been reported to live for extended periods in deeper water, where they feed and give birth to their young.[117]

In coastal areas, they can be found in coves, fjords, canals, bays and shallow waters in the Arctic Ocean that are continuously lit by sunlight.[35] They are also often seen during the summer in river estuaries, where the feed, socialise and give birth to young. These waters usually have a temperature of between 8 and 10 °C.[35] The mudflats of Cook Inlet in Alaska are a popular location for these animals to spend the first few months of summer.[120] In the eastern Beaufort Sea, female belugas with their young and immature males prefer the open waters close to land; the adult males live in waters covered by ice near to the Canadian Arctic Archipelago, while the younger males and females with slightly older young can be found nearer to the ice shelf.[121] Generally, the use of different habitats in summer reflects differences in feeding habits, risk from predators, and reproduction factors for each of the subpopulations.[28]

Population[edit]

The global beluga population is made up of a number of subpopulations. The scientific committee of the International Whaling Commission recognises the following 29 subpopulations of these animals.[2][28]

Beluga subpopulations.

1. Cook Inlet
2. Bristol Bay
3. Eastern Bering Sea
4. Eastern Chukchi Sea
5. Beaufort Sea
6. Severnaya Zemlya
7. Western Greenland to Iceland
8. Cumberland Sound

 

9. Frobisher Bay
10. Ungava Bay
11. Foxe Basin
12. Baffin Island
13. Western Hudson Bay
14. Hudson Bay (South)
15. James Bay
16. Eastern Hudson Bay
17. Saint Lawrence River

 

18. Svalbard
19. Franz Josef Land
20. Gulf of Ob
21. Yenisei Gulf
22. Onega Bay
23. Mezen Bay
24. Dvina Bay
25. Laptev Sea

 

26. Western Chukchi Sea
    – East Siberian Sea
27. Gulf of Anadyr
28. Shelikhov Gulf
29. SakhalinAmur River
30. Shantar Islands

The estimation of population sizes is complicated because the boundaries for some of these groups overlap geographically or seasonally. The IUCN estimated the world beluga population in 2008 to be well in excess of 150,000.[2]

Threats[edit]

Hunting[edit]

Main article: Whaling
Illustration from 1883 showing Iñupiat hunting party harpooning a beluga in Cook Inlet, Alaska

The native populations of the Canadian, Alaskan and Russian Arctic regions hunt Belugas for their meat, blubber and skin. The cured skin is the only cetacean skin that is sufficiently thick to be used as leather.[122] Belugas were easy prey for hunters due to their predictable migration patterns and the high population density in estuaries and surrounding coastal areas during the summer months.[122]

Commercial whaling by European and American whalers during the 18th and 19th centuries decreased beluga populations in the Canadian Arctic.[122] The animals were hunted for their meat and blubber, while the Europeans used the oil from the melon as a lubricant for clocks, machinery and for lighting in lighthouses.[122] Mineral oil replaced whale oil in the 1860s, but the hunting of these animals continued unabated. In 1863, the cured skin could be used to make horse harnesses, machine belts for saw mills and shoelaces. These manufactured items ensured the hunting of belugas continued for the rest of the 19th century and the beginning of the 20th century.[123] Between 1868 and 1911, Scottish and American whalers killed more than 20,000 belugas in Lancaster Sound and Davis Strait.[122]

During the 1920s, fishermen in the Saint Lawrence River estuary considered belugas to be a threat to the fishing industry, as they eat large quantities of cod, salmon, tuna and other fish caught by the local fishermen.[123] The presence of belugas in the estuary was therefore considered to be undesirable; in 1928, the Government of Quebec offered a reward of 15 dollars for each dead beluga.[124] The Quebec Department of Fisheries launched a study into the influence of these cetaceans on local fish populations in 1938. The unrestricted killing of belugas continued into the 1950s, when the supposed voracity of the belugas was found to be overestimated and did not adversely affect fish populations.[123]

The Arctic’s native peoples still carry out subsistence hunting of belugas to obtain food and raw materials. This practice is a part of their culture, but doubts still remain whether the number of whales killed may be unsustainable.[125] The number of animals killed is about 200 to 550 in Alaska and around 1,000 in Canada.[126] However, in areas such as Cook Inlet, Ungava Bay and western Greenland, previous levels of commercial whaling have put the species in danger of extinction and continued hunting by the native peoples may mean some populations will continue to decline.[125] The Canadian sites are the focus of discussions between the local communities and the Canadian government, with the objective of permitting sustainable hunting that does not put the species at risk of extinction.[127]

Predation[edit]

Polar bear next to the remains of a beluga whale

The only natural predators of belugas are polar bears and killer whales.[30]

During the winter, belugas commonly become trapped in the ice without being able to escape to open water, which may be several kilometres away.[128] Polar bears take particular advantage of these situations and are able to locate the belugas using their sense of smell. The bears swipe at the belugas and drag them onto the ice to eat them.[30] They are able to capture large individuals in this way; in one documented incident a bear weighing between 150 and 180 kg was able to capture an animal that weighed 935 kg.[129]

Killer whales are able to capture both young and adult belugas.[30] They live in all the seas of the world and share the same habitat as belugas in the sub-Arctic region. Attacks on belugas by killer whales have been reported in the waters of Greenland, Russia, Canada and Alaska.[130][131] A number of killings have been recorded in Cook Inlet, and experts are concerned the predation by killer whales will impede the recovery of this subpopulation, which has already been badly depleted by hunting.[130] The killer whales arrive in the autumn at the beginning of August, but the belugas are occasionally able to hear their presence and evade them. The groups near to or under the sea ice have a degree of protection, as the killer whale’s large dorsal fin, up to 2 m in length, impedes their movement under the ice and does not allow them to get sufficiently close to the breathing holes in the ice.[35]

Contamination[edit]

Russian scientists working on the White Whale Program place transmitters onto whales in Sea of Okhotsk

The beluga is considered an excellent sentinel species (indicator of environment health and changes), because it is long-lived, at the top of the food web, bears large amounts of fat and blubber, is relatively well-studied for a cetacean, and still somewhat common.

Human pollution can be a threat to beluga’s health when they congregate in river estuaries. Chemical substances such as DDT and heavy metals such as lead, mercury and cadmium have been found in individuals of the Saint Lawrence River population.[132] Local beluga carcasses contain so many contaminants, they are treated as toxic waste.[133] Levels of polychlorinated biphenyls between 240 and 800 ppm have been found in beluga’s brains, liver and muscles, with the highest levels found in males.[134] These levels are significantly greater than those found in Arctic populations.[135] These substances have a proven adverse effect on these cetaceans, as they cause cancers, reproductive diseases and the deterioration of the immune system, making individuals more susceptible to pneumonias, ulcers, cysts, tumours and bacterial infections.[135] Although the populations that inhabit the river estuaries run the greatest risk of contamination, high levels of zinc, cadmium, mercury and selenium have also been found in the muscles, livers, and kidneys of animals that live in the open sea.[136]

From a sample of 129 beluga adults from the Saint Lawrence River examined between 1983 and 1999, a total of 27% had suffered cancer.[137] This is a higher percentage than that documented for other populations of this species and is much higher than for other cetaceans and for the majority of terrestrial mammals; in fact, the rate is only comparable to the levels found in humans and some domesticated animals.[137] For example, the rate of intestinal cancer in the sample is much higher than for humans. This condition is thought to be directly related to environmental contamination, in this case by polycyclic aromatic hydrocarbons, and coincides with the high incidence of this disease in humans residing in the area.[137] The prevalence of tumours suggests the contaminants identified in the animals that inhabit the estuary are having a direct carcinogenic effect or they are at least causing an immunological deterioration that is reducing the inhabitants' resistance to the disease.[138]

Indirect human disturbance may also be a threat. While some populations tolerate small boats, most actively try to avoid ships. Whale-watching has become a booming activity in the St. Lawrence and Churchill River areas, and acoustic contamination from this activity appears to have an effect on belugas. For example, there appears to be a correlation between the passage of belugas across the mouth of the Saguenay River, which has decreased by 60%, and the increase in the use of recreational motorboats in the area.[139] A dramatic decrease has also been recorded in the number of calls between animals (decreasing from between 3.4 to 10.5 calls/min to 0 or <1) after exposure to the noise produced by ships, the effect being most persistent and pronounced with larger ships such as ferries than with smaller boats.[140] Belugas can detect the presence of large ships (for example icebreakers) from up to 50 km away and they will move rapidly in the opposite direction or perpendicular to the ship following the edge of the sea ice for distances of up to 80 km to avoid them. The presence of shipping produces avoidance behaviour, causing deeper dives for feeding, the break-up of groups, and asynchrony in dives.[141]

Pathogens[edit]

Lifecycle of the Anisakis simplex parasite, which causes anisakiasis in marine mammals

As with any animal population, a number of pathogens cause death and disease in belugas, including viruses, bacteria, protozoa and fungi, which mainly cause skin, intestinal and respiratory infections.[142]

Papillomaviruses have been found in the stomachs of belugas in the Saint Lawrence River. Animals in this location have also been recorded as suffering infections caused by herpesviruses and in certain cases to be suffering from encephalitis caused by the protozoa Sarcocystis. Cases have been recorded of ciliate protozoa colonising the spiracle of certain individuals, but they not thought to be pathogens or at least they are not very harmful.[143]

The bacterium Erysipelothrix rhusiopathiae, which probably comes from eating infected fish, poses a threat to belugas kept in captivity, causing anorexia and dermal plaques and lesions that can lead to septicemia.[143] This condition can cause death if it is not diagnosed and treated in time with antibiotics such as ciprofloxacin.[144][145]

A study of infections caused by parasitic worms in a number of individuals of both sexes found the presence of larvae from a species from the Contracaecum genus in their stomachs and intestines, Anisakis simplex in their stomachs, Pharurus pallasii in their ear canals, Hadwenius seymouri in their intestines and Leucasiella arctica in their rectums.[146]

Relationship with humans[edit]

Captivity[edit]

Photo of two white whales cheek-to-cheek with two trainers
Beluga whales in an aquarium interacting with trainers

Belugas were among the first whale species to be kept in captivity. The first beluga was shown at Barnum's Museum in New York City in 1861.[147] For most of the 20th century, Canada was the predominant source for belugas destined for exhibition. Until the early 1960s, they were taken from the St. Lawrence River estuary and from 1967 from the Churchill River estuary. This continued until 1992, when the practice was banned.[148] Since Canada ceased to be the supplier of these animals, Russia has become the largest provider.[148] Individuals are caught in the Amur River delta and the far eastern seas of the country, and then are either transported domestically to aquaria in Moscow, St. Petersburg, and Sochi, or exported to foreign nations, including Canada.[148]

Today, it remains one of the few whale species kept at aquaria and marine parks across North America, Europe, and Asia.[148] As of 2006, 30 belugas were in Canada and 28 in the United States, and 42 deaths in captivity had been reported up to that time.[148] A single specimen can reportedly fetch up to US$100,000 on the market. The beluga's popularity with visitors reflects its attractive colour and its range of facial expressions. The latter is possible because while most cetacean "smiles" are fixed, the extra movement afforded by the beluga's unfused cervical vertebrae allows a greater range of apparent expression.[45]

To provide some enrichment while in captivity, aquaria (a) train belugas to perform behaviors for the public[149] and for medical exams, such as blood draws[150] and ultrasound,[151] (b) provide toys,[149] and (c) allow the public to play recorded[152] or live[153] music.

Most belugas found in aquaria are caught in the wild, as captive-breeding programs have not had much success so far.[154] For example, despite best efforts, as of 2010, only two male whales had been successfully used as stud animals in the Association of Zoos and Aquariums (AZA) beluga population, Nanuq at SeaWorld San Diego and Naluark at the Shedd Aquarium in Chicago, USA. Nanuq has fathered 10 calves, five of which survived birth.[155] Naluark at Shedd Aquarium has fathered four living offspring.[156] Naluark has been relocated to Mystic Aquarium in the hope that he will breed with two of their females.[157] The first beluga calf born in captivity in Europe was born in L'Oceanogràfic marine park in Valencia, Spain in November 2006.[158] However, the calf died after 25 days after suffering metabolic complications, infections and from not being able to feed properly.[159]

To prevent captive whales from dying, researchers from the Vancouver Aquarium Marine Science Centre are finding ways to prevent fungi from entering their habitats and they are constantly checking their health. Healthy captive belugas are important because they are one of the few whales found in many marine aquariums. High numbers of captive deaths would add to the threat to the beluga population, though their carcasses contribute to scientific research.[citation needed]

Between 1960 and 1992, the United States Navy carried out a program that included the study of marine mammals' abilities with echolocation, with the objective of improving the detection of underwater objects. The program started with dolphins, but a large number of belugas were also used from 1975 on.[160] The program also included training these mammals to carry equipment and material to divers working underwater, the location of lost objects, surveillance of ships and submarines, and underwater monitoring using cameras held in their mouths.[160] A similar program was implemented by the Russian Navy during the Cold War, in which belugas were also trained for antimining operations in Arctic waters.[132]

In 2009 during a free-diving competition in a tank of icy water in Harbin, China, a captive beluga brought a cramp-paralyzed diver from the bottom of the pool up to the surface by holding her foot in its mouth, saving the diver's life.[161][162]

Whale watching[edit]

Beluga at the confluence of the Saint Lawrence and Saguenay Rivers

Whale watching has become an important activity in the recovery of the economies of towns in Hudson Bay near to the Saint Lawrence and Churchill Rivers. The best time to see belugas is during the summer, when they meet in large numbers in the estuaries of the rivers and in their summer habitats.[163] The animals are easily seen due to their high numbers and their curiosity regarding the presence of humans.[163]

However, the boat’s presence poses a threat to the animals, as it distracts them from important activities such as feeding, social interaction and reproduction. In addition, the noise produced by the motors has an adverse effect on their auditory function and reduces their ability to detect their prey, communicate, and navigate.[164] To protect these marine animals during whale watching activities, the US National Oceanic and Atmospheric Administration has published a “Guide for observing marine life”. The guide recommends boats carrying the whale watchers keep their distance from the cetaceans and it expressly prohibits chasing, harassing, obstructing, touching or feeding them.[165]

Some regular migrations do occur into Russian EEZ of Sea of Japan such as to Rudnaya Bay where diving with wild Belugas become a less known but popular attraction.[166]

Human speech[edit]

Male belugas in captivity can mimic the pattern of human speech, several octaves lower than typical whale calls. It is not the first time a beluga has been known to sound human and often shout like children, in the wild.[167] One captive beluga, after overhearing divers using an underwater communication system, caused one of the divers to surface by imitating their order to get out of the water. Subsequent recordings confirmed that the beluga had become skilled at imitating the patterns and frequency of human speech. After several years, this beluga ceased making these sounds.[168]

Conservation status[edit]

Video explaining conservation efforts in the Sea of Okhotsk, Russia
Photo of stamp showing two adults and one juvenile, swimming
Pictured on Faroe Islands stamp

As of 2008, the beluga is listed as "near threatened" by the IUCN due to uncertainty about threats to their numbers and the number of belugas over parts of its range (especially the Russian Arctic), and the expectation that if current conservation efforts cease, especially hunting management, the beluga population is likely to qualify for "threatened" status within five years. Prior to 2008, the beluga was listed as "vulnerable", a higher level of concern. IUCN cited the stability of the largest subpopulations and improved census methods that indicate a larger population than previously estimated.[2]

Subpopulations are subject to differing levels of threat and warrant individual assessment. The nonmigratory Cook Inlet subpopulation is listed as "Critically Endangered" by the IUCN as of 2006[2] and is listed as Endangered under the Endangered Species Act as of October 2008.[10][169][170] This was due to overharvesting of belugas prior to 1998. The population has failed to recover, though the reported harvest has been small. The most recently published estimate as of May 2008 was 302 (CV=0.16) in 2006.[171] In addition, the National Marine Fisheries Service indicated the 2007 aerial survey's point estimate was 375.

Legal protection[edit]

The US Congress passed the Marine Mammal Protection Act of 1972 outlawing the persecution and hunting of all marine mammals within US coastal waters. The Act has been amended a number of times to permit subsistence hunting by native peoples, temporary capture of restricted numbers for research, education and public display, and to decriminalise the accidental capture of individuals during fishing operations.[172] The act also states that all whales in US territorial waters are under the jurisdiction of the National Marine Fisheries Service, a division of NOAA.[172]

To prevent hunting, belugas are protected under the 1986 International Moratorium on Commercial Whaling; however, hunting of small numbers of belugas is still allowed. Since it is very difficult to know the exact population of belugas because their habitats include inland waters away from the ocean, it is easy for them to come in contact with oil and gas development centres. To prevent whales from coming in contact with industrial waste, the Alaskan and Canadian governments are relocating sites where whales and waste come in contact.

The beluga whale is listed on appendix II[173] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II[173] as it has an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements. All toothed whales are protected under the CITES that was signed in 1973 to regulate the commercial exploitation of certain species.[174]

The isolated beluga population in the Saint Lawrence River has been legally protected since 1983.[175] In 1988 Canadian Department of Fisheries and Oceans and Environment Canada, a governmental agency that supervises national parks, implemented the Saint Lawrence Action Plan[176] with the aim of reducing industrial contamination by 90% by 1993; as of 1992, the emissions had been reduced by 59%.[125]

Cultural references[edit]

Engravings on beluga bones

Pour la suite du monde, is a Canadian documentary film released in 1963 about traditional beluga hunting carried out by the inhabitants of L'Isle-aux-Coudres on the Saint Lawrence River.[177]

White Whale Records was an American record company that operated between 1965 and 1971 in Los Angeles, California, it was the record company of The Turtles. The company’s logo was the silhouette of a beluga with the words "White Whale" above it.[178]

The children’s singer Raffi released an album called Baby Beluga in 1980. The album starts with the sound of whales communicating, and includes songs representing the ocean and whales playing. The song "Baby Beluga" was composed after Raffi saw a recently born beluga calf in Vancouver Aquarium.[179]

Yamaha’s Beluga motorcycle (Riva 80/CV80) which had an 80 cc engine was produced from 1981 until 1987 and sold throughout the world, particularly in Canada, the USA, the Netherlands, Belgium, Sweden and Japan.[180]

The Beluga class submarine (project 1710 Mackerel) was an experimental Russian submarine whose prototype operated until 1997, with the whole project being discontinued in the mid-2000s.[181]

The fuselage design of the Airbus Beluga, one of the world’s biggest cargo planes, is very similar to that of a beluga; it was originally called the Super Transporter, but the nickname Beluga became more popular and was then officially adopted.[182]

The German company SkySails GmbH & Co. KG, a subsidiary of the Beluga Shipping group based in Hamburg, tested a new propulsion system for ships that involved a large wing similar to that used in paragliding and which has demonstrated a reduction in fuel use between 10% and 35%. The programme to prove the efficiency of the system was called Project Beluga, as it involved the ship MS Beluga Skysails. The company’s insignia, a beluga’s tailfin, was printed on the giant wing, which had a surface area of 160 m2.[183]

A 2002 episode of science fiction series Dark Angel entitled 'Dawg Day Afternoon' claims that Beluga whales are the result of a hybridisation between a humpback whale and a dolphin, although there is no evidence for this.

See also[edit]

Footnotes[edit]

  1. ^ The use of Order Cetartiodactyla, instead of Cetacea with Suborders Odontoceti and Mysticeti, is favored by most evolutionary mammalogists working with molecular data [3][4][5][6] and is supported the IUCN Cetacean Specialist Group[7] and by Taxonomy Committee [8] of the Society for Marine Mammalogy, the largest international association of marine mammal scientists in the world. See Cetartiodactyla and Marine mammal articles for further discussion.

References[edit]

  1. ^ a b c Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d e f Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R.R., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K. (2008). "Delphinapterus leucas". IUCN Red List of Threatened Species. Version 2010.3. International Union for Conservation of Nature. 
  3. ^ Agnarsson, I.; May-Collado, LJ. (2008). "The phylogeny of Cetartiodactyla: the importance of dense taxon sampling, missing data, and the remarkable promise of cytochrome b to provide reliable species-level phylogenies". Mol Phylogenet Evol. 48 (3): 964–985. doi:10.1016/j.ympev.2008.05.046. PMID 18590827. 
  4. ^ Price, SA.; Bininda-Emonds, OR.; Gittleman, JL. (2005). "A complete phylogeny of the whales, dolphins and even-toed hoofed mammals – Cetartiodactyla". Biol Rev Camb Philos Soc. 80 (3): 445–473. doi:10.1017/s1464793105006743. PMID 16094808. 
  5. ^ Montgelard, C.; Catzeflis, FM.; Douzery, E. (1997). "Phylogenetic relationships of artiodactyls and cetaceans as deduced from the comparison of cytochrome b and 12S RNA mitochondrial sequences". Molecular Biology and Evolution 14 (5): 550–559. doi:10.1093/oxfordjournals.molbev.a025792. PMID 9159933. 
  6. ^ Spaulding, M.; O'Leary, MA.; Gatesy, J. (2009). "Relationships of Cetacea -Artiodactyla- Among Mammals: Increased Taxon Sampling Alters Interpretations of Key Fossils and Character Evolution". PLoS ONE 4 (9): e7062. Bibcode:2009PLoSO...4.7062S. doi:10.1371/journal.pone.0007062. PMC 2740860. PMID 19774069. 
  7. ^ Cetacean Species and Taxonomy. iucn-csg.org
  8. ^ "The Society for Marine Mammalogy's Taxonomy Committee List of Species and subspecies".
  9. ^ Harris, Patricia; Lyon, David; (8 April 2007) Boston Globe Enter close quarters: colonial to nuclear subs. Section: Travel; Page 8M.
  10. ^ a b Rosen, Yereth (17 October 2008). "Beluga whales in Alaska listed as endangered". Reuters. Archived from the original on 20 October 2008. Retrieved 17 October 2008. 
  11. ^ Arnold, P. (2002). "Irrawaddy Dolphin Orcaella brevirostris". In Perrin, W., Würsig B. and Thewissen, J. Encyclopaedia of Marine Mammals. Academic Press. p. 652. ISBN 0-12-551340-2. 
  12. ^ Grétarsdóttir, S.; Árnason, Ú. (1992). "Evolution of the common cetacean highly repetitive DNA component and the systematic position of Orcaella brevirostris". Journal of Molecular Evolution 34 (3): 201–208. doi:10.1007/BF00162969. PMID 1588595. 
  13. ^ a b c d e f O'Corry-Crowe, G. (2002). "Beluga Whale Delphinapterus leucas". In Perrin, W., Würsig B. and Thewissen, J. Encyclopaedia of Marine Mammals. Academic Press. pp. 94–99. ISBN 0-12-551340-2. 
  14. ^ Heide-Jørgensen, Mads P.; Reeves, Randall R. (1993). "Description of an Anomalous Monodontid Skull from West Greenland: A Possible Hybrid?". Marine Mammal Science 9 (3): 258–68. doi:10.1111/j.1748-7692.1993.tb00454.x. 
  15. ^ a b c d Leatherwood, Stephen; Reeves, Randall R. (1983). The Sierra Club Handbook of Whales and Dolphins (1 ed.). San Francisco: Sierra Club Books. p. 320. ISBN 978-0-87156-340-8. 
  16. ^ "Japanese whale whisperer teaches beluga to talk". meeja.com.au. 16 September 2008. Retrieved 16 September 2008. 
  17. ^ Kusma, Stephanie (23 October 2012). "Ein "sprechender" Beluga-Wal" [A "talking" Beluga whale] (in German). Neue Zürcher Zeitung. Archived from the original on 23 October 2012. Retrieved 25 October 2012. 
  18. ^ Arnason, U.; Gullberg, A. (1996). "Cytochrome b nucleotide sequences and the identification of five primary lineages of extant cetaceans". Molecular Biology and Evolution 13 (2): 407–17. doi:10.1093/oxfordjournals.molbev.a025599. PMID 8587505. 
  19. ^ Waddell, Victor G.; Milinkovitch, Michel C.; Bérubé, Martine; Stanhope, Michael J. (2000). "Molecular Phylogenetic Examination of the Delphinoidea Trichotomy: Congruent Evidence from Three Nuclear Loci Indicates That Porpoises (Phocoenidae) Share a More Recent Common Ancestry with White Whales (Monodontidae) Than They Do with True Dolphins (Delphinidae)". Molecular Phylogenetics and Evolution 15 (2): 314–8. doi:10.1006/mpev.1999.0751. PMID 10837160. 
  20. ^ Barnes, Lawrence G. Fossil odontocetes (Mammalia: Cetacea) from the Almejas Formation, Isla Cedros, Mexico. University of California, Museum of Paleontology. p. 46. ASIN B0006YRTU4. 
  21. ^ "Denebola brachycephala". ZipcodeZoo.com. Retrieved 1 August 2010. 
  22. ^ Barnes, L. G. (1977). "Outline of Eastern North Pacific Fossil Cetacean Assemblages". Systematic Zoology 25 (4): 321–343. doi:10.2307/2412508. JSTOR 2412508. 
  23. ^ Perrin, William F.; Würsig, Bernd G. and Thewissen, J. G. M. (2009). Encyclopaedia of marine mammals (2 ed.). Acadenmic Press. p. 214. ISBN 978-0-12-373553-9. 
  24. ^ "Charlotte, The Vermont Whale – An Electronic Museum". University of Vermont. Retrieved 2 August 2010. 
  25. ^ Burns J.J.; Seaman G.A. (1983). "Investigations of belukha whales in coastal waters of western and northern Alaska, 1982–1983: marking and tracking of whales in Bristol Bay". Biology and ecology. US Dept Commer, NOAA, OCSEAP Final Rep, II 56: 221–357. 
  26. ^ Goren, Arthur D.; Brodie, Paul F.; Spotte, Stephen; Ray, G. Carleton; Kaufman, H. W.; Gwinnett, A. John; Sciubba, James J.; Buck, John D. (1987). "Growth Layer Groups (GLGs) in the Teeth of an Adult Belukha Whale (Delphinapterus leucas) of Known Age: Evidence for Two Annual Layers". Marine Mammal Science 3 (1): 14–21. doi:10.1111/j.1748-7692.1987.tb00148.x. 
  27. ^ Stewart, R.E.A.; Campana, S.E.; Jones, C.M.; Stewart, B.E. (2006). "Bomb radiocarbon dating calibrates beluga (Delphinapterus leucas) age estimates". Can. J. Zool 84 (12): 1840–1852. doi:10.1139/Z06-182. 
  28. ^ a b c d Convention on Migratory Species – CMS. "Delphinapterus leucas (Pallas, 1776". Retrieved 3 August 2010. 
  29. ^ a b c d e Shirihai, H. and Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton: Princeton Univ. Press. pp. 97–100. ISBN 0-691-12757-3. 
  30. ^ a b c d Reeves, R., Stewart, B., Clapham, P. & Powell, J. (2003). Guide to Marine Mammals of the World. New York: A.A. Knopf. pp. 318–321. ISBN 0-375-41141-0. 
  31. ^ Aquatic Species at Risk – Beluga Whale (St. Lawrence Estuary population). Fisheries and Oceans Canada
  32. ^ Stewart BE and Stewart REA (1989). "Delphinapterus leucas". Mammalian Species 336 (336): 1–8. doi:10.2307/3504210. JSTOR 3504210. 
  33. ^ a b c d e Ridgway, S. and Harrison, R. (1981). Handbook of Marine Mammals (6 ed.). San Diego: Academic Press Limited. p. 486. ISBN 978-0-12-588506-5. 
  34. ^ a b c d e "Beluga Whales – Physical Characteristics". Sea World.org. Retrieved 30 July 2010. 
  35. ^ a b c d e Paine, S. (1995). The World of the Arctic Whales. San Francisco: Sierra Club. ISBN 0-87156-957-4. 
  36. ^ Sergeant, D. E. and Brodie, P. F. (1969). "Body Size in White Whales, Delphinapterus leucas". Journal Fisheries Research Board of Canada 26 (10): 2561–2580. doi:10.1139/f69-251. 
  37. ^ United Nations Environment Programme – Conservation of Migratory Species of Wild Animals (2006). Review of small cetaceans: distribution, behaviour, migration and threats: 177 (Marine mammal action plan/regional seas reports and studies). UNEP/CMS. p. 356. ISBN 3-937429-02-6. 
  38. ^ a b "Delphinapterus leucas – Morphology, Physical Description". Encyclopaedia of Life. Retrieved 3 August 2010. 
  39. ^ a b c d Friedman W. R. (June 2006). "Environmental Adaptations of the Beluga Whale (Delphinapterus leucas)". Cognitive Science 143. 
  40. ^ a b St. Aubin, D. J., Smith, T. G. and Geraci, J. R. (1990). "Seasonal Epidermal Molt in Beluga Whales, Delphinapterus leucas". Canadian Journal of Zoology 68 (2): 339–367. doi:10.1139/z90-051. 
  41. ^ a b c d Haley, Delphine (1986). Marine Mammals of Eastern North Pacific and Arctic Waters (2 ed.). Seattle: Pacific Search Press. ISBN 0-931397-14-6. [page needed]
  42. ^ a b c d e f "Beluga Whales – Communication and Echolocation". Sea World.org. Retrieved 30 July 2010. 
  43. ^ Turl, C.W (1990). T.G. Smith, D.J. St. Aubin, and J.R. Geraci., ed. "Echolocation abilities of the beluga, Delphinapterus leucas: a review and comparison with the bottlenose dolphin, Tursiops truncatus". Can. Bull. Fish. Aquat. Sci 224: 119–128. 
  44. ^ Litchfield, Carter; Ackman, R. G.; Sipos, J. C.; Eaton, C. A. (1971). "Isovaleroyl triglycerides from the blubber and melon oils of the beluga whale (Delphinapterus leucas)". Lipids 6 (9): 674–81. doi:10.1007/BF02531529. PMID 5141491. 
  45. ^ a b Bonner, W.N. Whales. Poole, England: Abe Books. pp. 17, 23–24. ISBN 0713708875. 
  46. ^ a b c d e f Nowak, Ronald M. (1991). Walker's Mammals of the World 2 (5 ed.). Baltimore: The Johns Hopkins University Press. ISBN 0-8018-5789-9. [page needed]
  47. ^ The National Oceanic and Atmospheric Administration's National Marine Fisheries Service – Alaska Regional Office. "Beluga Whales". Retrieved 3 August 2010. 
  48. ^ Enchanted Learning. "Blowhole". Retrieved 6 August 2010. 
  49. ^ a b Aubin DJST – University of Guelph (Canada) (1989). "Thyroid function and epidermal growth in beluga whales, Delphinapterus leucas". Diss Abst Int Pt B Sci and Eng 50 (1). 
  50. ^ Mikaelian, I.; Labelle, P.; Kopal, M.; De Guise, S.; Martineau, D. (2003). "Adenomatous Hyperplasia of the Thyroid Gland in Beluga Whales (Delphinapterus leucas) from the St. Lawrence Estuary and Hudson Bay, Quebec, Canada". Veterinary Pathology 40 (6): 698–703. doi:10.1354/vp.40-6-698. PMID 14608025. 
  51. ^ Kasting NW, Adderley SAL, Safford T and Hewlett KG (1989). "Thermoregulation in beluga (Delphinapterus leucas) and killer (Orcinus orca) whales". Physiological zoology 62 (3): 687–701. JSTOR 30157921. 
  52. ^ a b Belkovitch, V. M.; Shekotov, M. N. (1993). The Belukha Whale: Natural Behavior and Bioacoustics. Woods Hole, MA: Woods Hole Oceanographic Inst. 
  53. ^ RR Fay (1988). Hearing in Vertebrates: a Psychophysics Databook. Winnetka IL: Hill-Fay Associates. p. 621. ISBN 978-0-9618559-0-1. 
  54. ^ Olson, Harry F (1967). Music, Physics and Engineering. Dover Journals. p. 249. ISBN 0-486-21769-8. 
  55. ^ a b Sea World.org. "Beluga Whales – Senses". Retrieved 30 July 2010. 
  56. ^ a b c d Herman, Louis (1988). Cetacean Behavior: Mechanisms and Functions. Nueva York: John Wiley and Sons. p. 480. ISBN 978-0-89464-272-2. 
  57. ^ a b c d Katona, Steven K., Valerie Rough and David T. Richardson (1993). Field Guide to Whales, Porpoises, and Seals from Cape Cod to Newfoundland (4 ed.). Smithsonian Institution Press. p. 336. ISBN 1-56098-333-7. 
  58. ^ Illustrated Encyclopaedia of North American Mammals: A Comprehensive Guide to Mammals of North America. MobileReference. 2009. ISBN 9781605012797. 
  59. ^ Slijper, E. J. (1979). Whales (2 ed.). Ithaca, Nueva York: Cornell University Press. p. 511. ISBN 0-8014-1161-0. 
  60. ^ Jefferson TA, Leatherwood S, Webber MA (1993). FAO Species identification guide. Marine mammals of the world. UNEP / FAO, Rome. p. 320. 
  61. ^ a b c d MacDonald, David (1993). The Encyclopaedia of Mammals. Nueva York: Facts on File, Inc. p. 895. ISBN 0-87196-871-1. 
  62. ^ Sjare, Becky L. and Thomas G. Smith (1986). "The Relationship Between Behavioral Activity and Underwater Vocalizations of the White Whale, Delphinapterus leucas". Canadian Journal of Zoology 64 (12): 2824–2831. doi:10.1139/z86-406. 
  63. ^ a b Sea World.org. "Beluga Whales – Behavior". Retrieved 30 July 2010. 
  64. ^ Georgia Aquarium. "Beluga Whale". Archived from the original on 2 October 2008. Retrieved 12 October 2008. 
  65. ^ Alaska Geographic Society (1979). Alaska Whales and Whaling. Edmonds, Washington: Alaska Northwest Publishing Co. 
  66. ^ Smith, T. G. and G. A. Sleno (1986). "Do White Whales, Delphinapterus leucas, Carry Surrogates in Response to Early Loss of Their Young". Canadian Journal of Zoology 64 (7): 1581–1582. doi:10.1139/z86-237. 
  67. ^ Fish, FE (1998). "Comparative kinematics and hydrodynamics of odontocete cetaceans: Morphological and ecological correlates with swimming performance". The Journal of Experimental Biology 201 (Pt 20): 2867–2877. PMID 9739069. 
  68. ^ "Georgia Aquarium – Beluga Whale". Archived from the original on 2 October 2008. Retrieved 12 October 2008. 
  69. ^ Sea World.org. "Beluga Whales – Adaptations for an Aquatic Environment". Retrieved 30 July 2010. 
  70. ^ Ridgway, Sam H.; Carder, Donald A.; Kamolnick, Tricia; Smith, Robert R.; Schlundt, Carolyn E.; Elsberry, Wesley R. (2001). "Hearing and whistling in the deep sea: Depth influences whistle spectra but does not attenuate hearing by white whales (Delphinapterus leucas) (Odontoceti, Cetacea)". The Journal of Experimental Biology 204 (Pt 22): 3829–41. PMID 11807101. 
  71. ^ a b c d Heide-Jørgensen, M. P.; Richard, P. R.; Rosing-Asvid, A. (March 1998). "Dive Patterns of Belugas (Delphinapterus lencas) in Waters near Eastern Devon Island". Arctic 51 (1): 17–26. doi:10.14430/arctic1041. JSTOR 40511799. 
  72. ^ "Delphinapterus leucas: Beluga Whale". Marine Bio. Retrieved 26 August 2008. 
  73. ^ a b c Ridgway, Sam H (1972). Mammals of the Sea. Biology and Medicine. Springfield, Illinois: Charles C. Thomas. p. 812. ISBN 0-398-02389-1. 
  74. ^ Ridgway, S. H. et. al; Bowers; Miller; Schultz; Jacobs; Dooley (1984). "Diving and Blood Oxygen in the White Whale". Canadian Journal of Zoology 6 (11): 2349–2351. doi:10.1139/z84-344. 
  75. ^ Noren, S.R.; Williams, T.M. (2000). "Body size and skeletal muscle myoglobin of cetaceans: Adaptations for maximizing dive duration". Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 126 (2): 181–91. doi:10.1016/S1095-6433(00)00182-3. PMID 10936758. 
  76. ^ Dueck L. (2014). "3.2 Habits – 3.2.1 Diving Characteristics and Sightability Estimates of Eastern Arctic Bowhead Whales Based on Satellite-Linked Telemetry". The Fisheries and Oceans Canada. Retrieved 2015-01-30. 
  77. ^ Loseto LL, Stern GA, Connelly TL, Deibel D, Gemmill B, Prokopowicz A, Fortier L, Ferguson SH; Stern; Connelly; Deibel; Gemmill; Prokopowicz; Fortier; Ferguson (2009). "Summer diet of beluga whales inferred by fatty acid analysis of the eastern Beaufort Sea food web". J Exp Mar Biol Ecol 374 (1): 12–18. doi:10.1016/j.jembe.2009.03.015. 
  78. ^ Heide-Jorgensen, M.P., Teilmann, J (1994). "Growth, reproduction, age structure and feeding habits of white whales (Delphinapterus leucas) in West Greenland waters". Meddr Gronland, Biosci. 39: 195–212. 
  79. ^ Frost, K.J. and Lowry, L.F (1981). "Trophic importance of some marine gadids in Northern Alaska and their body-otolith size relationships". Fish Bull. 79: 187–192. 
  80. ^ a b Lentifer, J (1988). Selected Marine Mammals of Alaska: Species Accounts with Research and Management Recommendations. Marine Mammals Commission. ASIN B000102908. [page needed]
  81. ^ Perez, Michael A – NOAA (1990). NOAA Technical Memorandum NMFS F/NWC-186. Review of Marine Mammal Population and Prey Information for Bering Sea Ecosystem Studies. NOAA. 
  82. ^ Sea World.org. "Beluga Whales – Diet and Eating Habits". Archived from the original on 12 July 2010. Retrieved 30 July 2010. 
  83. ^ Katona, Steven K., Valerie Rough and David T. Richardson. (1983). A Field Guide to the Whales, Porpoises and Seals of the Gulf of Maine and Eastern Canada. New York: Charles Scribner's Sons. p. 255. ISBN 0-684-17902-4. 
  84. ^ Lentifer, Jack W. (1988). Selected Marine Mammals of Alaska: Species Accounts with Research and Management Recommendations. Washington, D.C.: Marine Mammals Commission. ASIN B000102908. OCLC 18060784. [page needed]
  85. ^ a b Suydam, Robert Scott (2009). "Age, growth, reproduction, and movements of beluga whales (Delphinapterus leucas) from the eastern Chukchi Sea". University of Washington. Retrieved 4 August 2008. 
  86. ^ Robeck, Todd R.; Monfort, Steven L.; Calle, Paul P.; Dunn, J. Lawrence; Jensen, Eric; Boehm, Jeffrey R.; Young, Skip; Clark, Steven T. (2005). "Reproduction, Growth and Development in Captive Beluga (Delphinapterus leucas)". Zoo Biology 24 (1): 29–49. doi:10.1002/zoo.20037. 
  87. ^ Cosens, S. & Dueck, L. (June 1990). "Spring Sightings of Narwhal and Beluga Calves in Lancaster Sound, N.W.T". Arctic 31 (2): 1–2. 
  88. ^ Animal Diversity Web – Museum of Zoology, University of Michigan. "Delphinapterus leucas". Retrieved 30 July 2010. 
  89. ^ Sea World.org. "Beluga Whales – Birth and Care of the Young". Retrieved 30 July 2010. 
  90. ^ a b Sea World Education Department (1993). Toothed Whales. San Diego: Sea World Education Department Publication. 
  91. ^ Leung, Elaine S.; Vergara, Valeria; Barrett-Lennard, Lance G. (2010). "Allonursing in captive belugas (Delphinapterus leucas)". Zoo Biology 29 (5): 633–7. doi:10.1002/zoo.20295. PMID 20127963. 
  92. ^ Au, W. W. L.; Carder, D. A.; Penner, R. H.; Scronce, B. L. (1985). "Demonstration of adaptation in beluga whale echolocation signals". The Journal of the Acoustical Society of America 77 (2): 726–30. doi:10.1121/1.392341. PMID 3973242.  edit
  93. ^ "The Canaries of the Sea, granted a pardon, this time…". ePluribus Media. Retrieved 7 August 2010. 
  94. ^ Bonner, W (1989). Whales of the World. New York: Facts on File Journals. p. 191. ISBN 9780816052165. 
  95. ^ a b c Rice DW (1998). Wartzok D, ed. Marine mammals of the world: systematics and distribution (4 ed.). Lawrence, KS. USA: Society for Marine Mammalogy, Special Journal. p. 231. ISBN 1-891276-03-4. 
  96. ^ Fisheries and Oceans Canada. http://www.nfl.dfo-mpo.gc.ca/e0008989
  97. ^ Artyukhin Yu.B. and V.N. Burkanov (1999). Sea birds and mammals of the Russian Far East: a Field Guide, Moscow: АSТ Publishing – 215 p. (Russian)
  98. ^ a b c Suydam RS, Lowry LF, Frost KJ, O' Corry-Crowe GM, Pikok D JR; Lowry; Frost; O'Corry-Crowe; Pikok (2001). "Satellite Tracking of Eastern Chukchi Sea Beluga Whales into the Arctic Ocean". Arctic 54 (3): 237–243. doi:10.14430/arctic784. 
  99. ^ Barber DG, Saczuk E, Richard PR; Saczuk; Richard (2001). "Examination of Beluga-Habitat Relationships through the Use of Telemetry and a Geographic Information System". Arctic 54 (3): 305–316. doi:10.14430/arctic790. 
  100. ^ "Whale Carcass in Alaska River Mystifies Experts". Los Angeles Times. 16 June 2006. Retrieved 3 August 2010. 
  101. ^ Gewalt W (1994). "Wale und Delphine 1 -Delphinapterus leucas – Weißwal oder Beluga". Handbuch der Säugetiere Europas. Meeressäuger. Teil IA (in German). Aula-Verlag, Wies-baden. pp. 185–208. ISBN 3-89104-560-3. 
  102. ^ "Beluga’s body in river baffles scientists". South Bend Tribune. Retrieved 10 September 2012. 
  103. ^ "Beluga Whale". Alaskan Naure. 
  104. ^ Heide Jørgensen MP and Reeves RR (1996). "Evidence of a decline in beluga, Delphinapterus leucas, abundance off West Greenland. ICES". J Mar Sci 53 1: 61–72. 
  105. ^ Irish Whale and Dolphin Group. beluga whale. Retrieved 02 June 2014
  106. ^ BBC News. (21 February 2012) Beluga whale sightings in SNH marine renewables report. Retrieved 02 June 2014
  107. ^ Wildlife Extra. Dolphin and whale watching in the Scotland. Retrieved 02 June 2014
  108. ^ Hebridean Whale and Dolphin Trust. Beluga Whale. Retrieved 02 June 2014
  109. ^ Sato, H.; Ichimura, M. (2011). "The Sighting Record of Beluga (White Whale) Delphinapterus leucas in Shiretoko–Nemuro Strait Water, Eastern Hokkaido, Japan. Sea Life Watch in Shibetsu". Bulletin of the Shiretoko Museum 32: 45–52. 
  110. ^ Sato H., Sea Life Watch in Nemuro Strait, Eastern Hokkaido. feit.jp
  111. ^ Uni, Y (2006). "Whales, Dolphins and Porpoises off Shiretoko" (PDF). Bulletin of the Shiretoko Museum 27: 37–46. 
  112. ^ Tianzao. 2010. クジラとイルカに出会える街・室蘭. Retrieved 02 June 2014
  113. ^ Volcano-bay Marine-animals Waching Association of Muroran Renaissance
  114. ^ Mukai. T., KK-ELM. retrieced on 02 June 2014
  115. ^ Sasamori K., Muroran Dolphin and Whale Watching. Retrieved 02 June 2014
  116. ^ Imai Y., 野生のシロイルカ/ベルーガ in 日本 Beluga, the White Whale observations in Japanese waters.. YouTube. Retrieved 02 June 2014
  117. ^ a b c d e Reyes JC (1991). The conservation of small cetaceans: a review. Report prepared for the Secretariat of the Convention on the Conservation of Migratory Species of Wild Animals. UNEP/CMS Secretariat, Bonn. 
  118. ^ Hobbs RC, Laidre KL, Vos DJ, Mahoney BA, Eagleton M (2005). "Movements and Area Use of Belugas, Delphinapterus leucas, in a Subarctic Alaskan Estuary". Arctic 58: 331–340. 
  119. ^ Rugh DJ, Mahoney BA, Smith BK (2004). "Aerial Surveys of Beluga Whales in Cook Inlet, Alaska, Between June 2001 and June 2002". NOAA Technical Memorandum NMFS AFSC. no. 145. p. 20. Retrieved 7 August 2010. 
  120. ^ Goetz, Kimberly T.; Rugh, David J.; Read, Andrew J. and Hobbs, Roderick C. "Habitat use in a marine ecosystem: beluga whales Delphinapterus leucas in Cook Inlet, Alaska". National Marine Mammal Laboratory, Alaska Fisheries Science Center, NMFS, NOAA, Washington, USA. 
  121. ^ Loseto, L.L.; Richard, P.; Stern, G.A.; Orr, J.; Ferguson, S.H. (1 December 2006). "Segregation of Beaufort Sea beluga whales during the open-water season". Canadian Journal of Zoology 84 (12): 1743–1751(9). doi:10.1139/Z06-160. 
  122. ^ a b c d e Ellis, Richard (1991). Men and Whales (1st ed.). The Lyons Press. p. 560. ISBN 978-1-55821-696-9. 
  123. ^ a b c Dionne, Suzan and Gourbilière, Claire – Encyclopaedia of French Cultural Heritage in North America (2007). "St. Lawrence Beluga". Retrieved 1 September 2010. 
  124. ^ Reeves, R. R. and Mitchell, E. (1984). "Catch history and initial population of white whales (Delphinapterus leucas) in the river and gulf of St. Lawrence, eastern Canada". Canadian Field-Naturalist (111): 63–121. 
  125. ^ a b c Dold, Catherine (July–August 1993). "The Great White Whales". Wildlife Conservation: 45–53. ISSN 1048-4949. 
  126. ^ Nowak, Ronald M. (1999). Walker's Mammals of the World (6 ed.). Baltimore: The Johns Hopkins University Press. ISBN 978-0-8018-5789-8. [page needed]
  127. ^ Tyrrell, Martina (2007). "Sentient Beings and Wildlife Resources: Inuit, Beluga Whales and Management Regimes in the Canadian Arctic". Human Ecology 35 (5): 575–86. doi:10.1007/s10745-006-9105-2. 
  128. ^ Hernández, Clara (17 November 2006). "Un grupo de cazadores matará en Canadá a cerca de 80 belugas que han quedado atrapadas por el hielo" (in Spanish). 20 minutos.es – Internacional. 
  129. ^ Freeman, Milton M. R. "Polar Bear Predation on Beluga in the Canadian Arctic". McMaster University, Hamilton, Ontario. Retrieved 12 August 2010. 
  130. ^ a b Shelden KEW, Rugh DJ, Mahoney BA, Dahlheim ME; Rugh; Mahoney; Dahlheim (2003). "Killer whale predation on belugas in Cook Inlet, Alaska: Implications for a depleted population". Mar. Mamm. Sci 19 (3): 529–544. doi:10.1111/j.1748-7692.2003.tb01319.x. 
  131. ^ Lowry LF, Nelson RR, Frost KJ (1987). "Observations of killer whales, Orcinus orca , in western Alaska: Sightings, strandings, and predation on other marine mammals". Ont. Field-Nat 101 (1): 6–12. 
  132. ^ a b Beland, Pierre (1996). Beluga: A Farewell to Whales (1 ed.). The Lyons Press. p. 224. ISBN 1-55821-398-8. 
  133. ^ "Marine Pollution: Causes and Effects". Bamfield Marine Sciences Centre Public Education Program. 
  134. ^ Metcalfe, C; Metcalfe, T; Ray, S; Paterson, G; Koenig, B (1999). "Polychlorinated biphenyls and organochlorine compounds in brain, liver and muscle of beluga whales (Delphinapterus leucas) from the Arctic and St. Lawrence estuary". Marine Environmental Research 47 (1): 1–15. doi:10.1016/S0141-1136(98)00107-X. 
  135. ^ a b Smith, T. G., D. J. St. Aubin, and J. R. Geraci (1990). Advances in Research on the Beluga Whale, Delphinapterus leucas. Ottawa: Department of Fisheries and Oceans. ISBN 0660138174. 
  136. ^ Hansen, Carstenthye; Nielsen, Christianovergaard; Dietz, Rune; Hansen, Martinmunk (1990). "Zinc, cadmium, mercury and selenium in minke whales, belugas and narwhals from West Greenland". Polar Biology 10 (7): 529–39. doi:10.1007/BF00233702. 
  137. ^ a b c Martineau, D.; Lemberger, K.; Dallaire, A.; Labelle, P.; Lipscomb, T. P.; Michel, P.; Mikaelian, I. (2002). "Cancer in Wildlife, a Case Study: Beluga from the St. Lawrence Estuary, Québec, Canada". Environmental Health Perspectives 110 (3): 285–92. doi:10.1289/ehp.02110285. PMC 1240769. PMID 11882480.  edit
  138. ^ Guise, S. D.; Lagace, A.; Beland, P. (1994). "Tumors in St. Lawrence Beluga Whales (Delphinapterus leucas)". Veterinary Pathology 31 (4): 444–9. doi:10.1177/030098589403100406. PMID 7941233.  edit
  139. ^ Caron LMJ, Sergeant DE (1988). "Yearly variation in the frequency of passage of beluga whales (Delphinapterus leucas) at the mouth of the Saguenay River, Quebec, over the past decade". Can Nat 115 (2): 111–116. 
  140. ^ Lesage, Veronique; Barrette, Cyrille; Kingsley, Michael C. S.; Sjare, Becky (January 1999). "The Effect of Vessel Noise on the Vocal Behavior of Belugas in the St. Lawrence River Estuary, Canada". Marine Mammal Science 15 (1): 65–84. doi:10.1111/j.1748-7692.1999.tb00782.x. 
  141. ^ Finley KJ, Miller GW, Davis RA, Greene CR (1990). "Reactions of belugas, Delphinapterus leucas , and narwhals, Monodon monoceros, to ice-breaking ships in the Canadian High Arctic. In "Advances in research on the beluga whale, Delphinapterus leucas"". Can Bull Fish Aquat Sci 224: 97–117. 
  142. ^ Sea World.org (2002). "Beluga Whales – Longevity and Causes of Death". Retrieved 30 July 2010. 
  143. ^ a b Dierauf, L. & Gulland, F. (2001). CRC Handbook of Marine Mammal Medicine:Health, Disease, and Rehabilitation. CRC Press. pp. 26, 303, 359. ISBN 0-8493-0839-9. 
  144. ^ Calle, Paul P.; Kenny, David E.; Cook, Robert A. (1993). "Successful treatment of suspected erysipelas septicemia in a beluga whale (Delphinapterus leucas)". Zoo Biology 12 (5): 483–90. doi:10.1002/zoo.1430120510. 
  145. ^ Dierauf, L.; Gulland, F. (2001). CRC Handbook of Marine Mammal Medicine. CRC Press. pp. 316–7. ISBN 0-8493-0839-9. 
  146. ^ Wazura, K. W.; Strong, J. T.; Glenn, C. L.; Bush, Albert O. (1986). "Helminths of the Beluga Whale (Delphinapterus leucas) from the Mackenzie River Delta, Northwest Territories". Journal of Wildlife Diseases 22 (3): 440–2. doi:10.7589/0090-3558-22.3.440. PMID 3735598. 
  147. ^ "The Whales, New York Tribune, August 9, 1861". New York Tribune. 9 August 1861. Retrieved 5 December 2011. 
  148. ^ a b c d e "Beluga Whales in Captivity" (PDF). Special Report on Captivity 2006. Canadian Marine Environment Protection Society. 2006. Retrieved 26 December 2014. 
  149. ^ a b "Beluga Whales". Mystic Aquarium. Retrieved 21 November 2014. 
  150. ^ "Species of the Month, Juno". Mystic Aquarium. Retrieved 21 November 2014. 
  151. ^ "Beluga Whales Training". GeorgiaAquarium. 2008-03-04. Retrieved 21 November 2014. 
  152. ^ "We played music for belugas". SMAD-Sea Mammals Are Delightful. 2014-11-12. Retrieved 21 November 2014. 
  153. ^ "Mariachi Band Serenades Beluga Whale". The Huffington Post. 2011-08-03. Retrieved 21 November 2014. 
  154. ^ "Beluga (Delphinapterus leucas)Facts – Distribution – In the Zoo". WAZA : World Association of Zoos and Aquariums. Retrieved 5 December 2011. 
  155. ^ "Nanuq". Cetacousin. Retrieved 9 September 2012. 
  156. ^ "Beluga Whale Calf Born at Shedd Aquarium". Association of Zoos and Aquariums. Retrieved 9 September 2012. 
  157. ^ "Male Beluga Whale Arrives at Mystic Aquarium". Mystic Aquarium. Retrieved 9 September 2012. 
  158. ^ Inmaculada Sanz (3 November 2006). "Nace la primera cría de ballena beluga en cautividad en Europa" (in Spanish). Noticias 20minutos. 
  159. ^ Noticias 20minutos Valencia (27 November 2006). "Muere la ballena beluga que nació hace 25 días en el Oceanográfico de Valencia" (in Spanish). 
  160. ^ a b "The Story of Navy Dolphins". PBS. Retrieved 12 October 2008. 
  161. ^ Lepisto, Christine (2 August 2009). "Beluga Whale Saves Diver". Retrieved 31 August 2010. 
  162. ^ "Wal Rettet Ertrinkende Taucherin!". Retrieved 27 September 2009. 
  163. ^ a b UCLA Department of Chemistry and Biochemistry. "Beluga Whale Watching". Retrieved 11 February 2010. 
  164. ^ Blane, JM. Jackson, R; Jaakson (1994). "The impact of ecotourism boats on the St. Lawrence beluga whales". Environmental Conservation 21 (3): 267–269. doi:10.1017/S0376892900033282. 
  165. ^ National Oceanic and Atmospheric Administration, NOAA (January 2004). "Marine Wildlife Viewing Guidelines". Retrieved 6 August 2010. 
  166. ^ Shpatak A. (2012). "Japan Sea. Rudnaya Bay. Polar White Whale.". The 35PHOTO.ru. Retrieved 2015-01-19. 
  167. ^ "Study: Male beluga whale mimics human speech". 23 October 2012. 
  168. ^ "The Story of One Whale Who Tried to Bridge the Linguistic Divide Between Animals and Humans". Smithsonian Magazine. June 2014. 
  169. ^ "Endangered and Threatened Species; Endangered Status for the Cook Inlet Beluga Whale". National Oceanic and Atmospheric Administration. 22 October 2008. Retrieved 26 August 2009. 
  170. ^ Herbert, H. Josef (17 October 2008). "Government declares beluga whale endangered". Associated Press. Retrieved 17 October 2008. 
  171. ^ Angliss and Outlaw 2007.
  172. ^ a b National Oceanic and Atmospheric Administration, NOAA (January 2004). "MMPA – The Marine Mammal Protection Act of 1972 as Amended (2007)". Retrieved 6 August 2010. 
  173. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5 March 2009.
  174. ^ "Official CITES website". Convention on International Trade in Endangered Species of Wild Fauna and Flora. Archived from the original on 9 December 2009. Retrieved 20 December 2009. 
  175. ^ Shih, Xenia. "In-depth: Belugas – Beluga Whales Under Threat". Jean-Michael Cousteau – Ocean Adventures. 
  176. ^ St. Lawrence Action Plan – Official Page. "St. Lawrence Action Plan For a Sustainable Development". Retrieved 6 August 2010. 
  177. ^ The Internet Movie Database. "Pour la suite du monde". Retrieved 7 August 2010. 
  178. ^ Callahan, Mike; Owens, Mike; Edwards, David and Eyries, Patrice (2005). "White Whale Album Discography". 
  179. ^ National Institutes of Health, Department of Health & Human Services. "Baby beluga". Retrieved 12 February 2010. 
  180. ^ Motor Scooter Guide (2010). "Yamaha Beluga (Riva 80/CV80)". Retrieved 8 August 2010. 
  181. ^ "Project 1710 Mackerel Beluga class". Federation of American Scientists. Retrieved 11 February 2010. 
  182. ^ "Airbus beluga service". airbus.com. 
  183. ^ Skysails. "Skysails turn wind into profit". Retrieved 12 February 2010. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Brennin et al. (1997) examined mtDNA variation in North American populations and detected two distinct groups, one occurring primarily from the St. Lawrence estuary and eastern Hudson Bay and the other primarily in western Hudson Bay, southern Baffin Island, western Greenland, the Canadian High Arctic, and the eastern Beaufort Sea

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!