Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

"Beluga are a Northern Hemisphere species, and have a thick layer of blubber that enables them to live in icy polar waters. They breed in the winter. The mother's pregnancy lasts about a year, and the calf nurses for two years on her rich milk. Beluga visit warm-water estuaries during the summer, possibly because warmth may accelerate the annual molting, or shedding, of their outer skin. After they molt, they are bright white. They are social animals who live in groups called ""pods,"" which may consist of several hundred individuals. Beluga make a variety of squeaks and chirps while traveling. Sailors who could hear them through the sides of their wooden ships called them ""sea canaries."" Polar bears and killer whales are known predators."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
Visit ARKive for more images of the beluga whale  More images, video and sound
  • Original description: Pallas, P.S., 1776.  Reise durch verschiedene Provinzen des Russischen Reichs, p. 85. St. Petersbourg, viii, Pt. 2, nxxvi.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Belugas are highly social animals, and in the summer months thousands of individuals can be seen gathered in estuaries; often females with calves will come together whilst males form large bachelor groups (3). Females are sexually mature at around five years of age, they give birth to a single calf after a gestation period that lasts just over a year (6). Mother and calf have an extremely strong bond, swimming very closely together, and the calf will continue to feed on its mothers milk until well into its second year (3). Belugas are able to dive to depths of over 1,000 metres but spend most of their time on the surface of the water swimming slowly. During winter months it may be necessary for individuals to create breathing holes in the ice, which they can do with their heavy head (7). The flippers are capable of a wide-range of movement and enable belugas to manoeuvre themselves effectively (3). In summer months, large numbers of belugas gather in estuaries in order to moult; they rub themselves on the gravel bed and shed the yellow, withered skin of the previous year to once again become gleaming white (3). Belugas feed on a wide variety of fish, bottom-dwelling invertebrates and worms; most of the prey is found on the seabed and it is thought that the highly flexible lips may be used to suck prey into the mouth (8). Sounds can be used to detect prey; the enlarged melon is an electro-receptor for sounds that are sent out from the nasal passages (3). These whales are thought to live for up to 50 years, killer whales and polar bears prey upon them, and belugas are particularly vulnerable if trapped by the ice (6) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The snow-white beluga whale is one of the most distinctive of all cetaceans (a group that includes, dolphins, whales and porpoises). The stocky body ends in a particularly small head, and adults develop their striking white colouring as they mature (2). Belugas lack a dorsal fin, their genus name 'Delphinapterus' means 'dolphin-without-a-wing' (3) (6), but there is a ridge of toughened skin along the back that tends to be more pronounced in mature males (6). Unlike most cetaceans, belugas have an extremely flexible neck and can turn their head almost 90 degrees to the side; their lips are also flexible, forming a variety of facial expressions (3). Belugas use a wide range of vocalisations such as clicks, grunts, squeals, screeches and whistles (6). These sounds can be heard through the hulls of ships and the beluga was nicknamed the 'sea canary' by early Arctic sailors (3). They have a very thick layer of blubber which may be up to 15 centimetres thick that provides insulation in the freezing arctic waters (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Beluga Whale: A gregarious white whale of Arctic coasts primarily inhabiting areas with sea ice
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Newborns dark gray, subadults light gray, adults white; No dorsal fin, but dorsal ridge; Head with prominent melon and short beak; Flexible neck allows them to turn their heads
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Arctic and sub-Arctic waters of North America and Eurasia. Southernmost regular range in the Western Hemisphere: St. Lawrence River estuary (isolated resident population), Gulf of Alaska, James Bay (Stewart and Stewart 1989). See Reeves and Mitchell (1989) for information on status in Ungava Bay and eastern Hudson Bay. See Richard (1993) for information on status in western and southern Hudson Bay. See Doidge and Finley (1993) for information on status of the Baffin Bay population. See also IUCN (1991) for further details regarding distribution.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

East Pacific; Eastern Atlantic Ocean, Europe and Northern Asia (excluding China); Indo-West Pacific; Western Atlantic Ocean
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Subarctic area
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Beluga whales are distributed in high latitudes of the Northern Hemisphere from the west coast of Greenland westwards to Svalbard (Stewart and Stewart 1989; O'Corry-Crowe 2002). Records from the Sea of Japan and Baltic Sea are considered extralimital, but resident populations occur in cold temperate latitudes in Cook Inlet (Alaska, US) and the St. Lawrence River system (Canada). Satellite telemetry, genetic studies, and organochlorine analyses show belugas have strong matrilineally driven seasonal site fidelity to fjords and estuaries for summering and they migrate to separate wintering grounds (O’Corry-Crowe et al. 1997, Richard et al. 2001, de March et al. 2002, Innes et al. 2002, O’Corry-Crowe et al. 2002, Palsbøll et al. 2002).

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Beluga whales inhabit the arctic and sub-arctic waters along the coast of Canada, Alaska, Greenland, Norway, and the Soviet Union. About 500 of them inhabit the waters of the St. Lawrence River.

Biogeographic Regions: arctic ocean (Native ); pacific ocean (Native )

  • Bonner, W. 1989. Whales of the World. New York: Facts on File Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Belugas are found in Arctic waters around northern Russia, North America, Greenland and the Norwegian archipelago of Svalbard (3). Most populations migrate north in the spring, then south in the autumn once the ice starts to form (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The beluga is also known as the white whale for its milky white skin. It is the only species of whale that is entirely white, although it is born gray and fades gradually with age. These whales lack a dorsal fin, but have a shallow ridge along their back. Their appendages are narrower and pointier than that of the narwhal. Belugas also have a melon-shaped head, which is the center for echolocation. They are 3 to 5 meters and length and weigh an average of 1.6 tons (3500lbs). Fifty percent of their weight is fat, a marked increase relative to other non-arctic whales, whose body is only twenty percent fat. The blubber is 10cm thick in belugas. Belugas are sexually dimorphic, with the males being slightly larger than the females. Females average 1,350 kg and males 1,500 kg in weight.

Average mass: "1,350-1,500" kg.

Range length: 300 to 460 cm.

Average length: 400 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 1.43e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 4300 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 3.4-4.9 m males; 3.3-4 m females

Weight:
Range: 800-1,500 kg males; 540-790 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Morphology

Distinguishing characteristics: Belugas are white-colored whales with a fusiform body shape and a large melon on the head. This melon is thought by some to focus echolocation tones, although this is in question. The melon can also be used as an indicator of health (poorly nourished belugas have low flat melons while well fed individuals have round melons) and of emotional state--agressive individuals raise their melons forward. There are no dorsal fins. Thirty-eight teeth are present. Males are larger than females.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Inhabits the open ocean as well as shallow coastal waters, rivers, estuaries; shallow waters such as estuaries of large rivers are used in summer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

inshore including estuaries and rivers in summer, sometimes offshore
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

mostly coastal, also in estuaries and rivers
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Belugas are relatively well-studied as a result of carcass sampling in association with hunting, along with a considerable amount of satellite-linked radio-tracking (Richard et al. 1998a,b; Richard et al. 2001; Lydersen et al. 2001; Heide-Jørgensen et al. 2003a; Hobbs et al. 2005).

Belugas occur seasonally (mainly in summer) in coastal waters as shallow as 1–3 m deep but also in deep offshore waters (800 m). They typically enter estuaries and sometimes move upstream into rivers; there are records of individuals or small groups ranging hundreds of kilometers from the sea. They occupy estuaries, continental shelf and slope waters, and deep ocean basins in conditions of open water, loose ice, and heavy pack ice. Belugas generally prefer to overwinter in shallow or coastal areas, usually with light or highly moveable ice cover (Barber et al. 2001, Richard et al. 2001, Suydam et al. 2001, Heide-Jørgensen et al. 2003a) and may occur as fully Arctic populations (Richard et al. 1998b, Richard et al. 2001, Suydam et al. 2001) or sub-Arctic populations (Hobbs et al. 2005).

Some Belugas undertake large-scale annual migrations between summering and wintering sites, while others remain in the same area year-round, shifting offshore only when excluded from coastal habitat by fast-ice formation (Hobbs et al. 2005). Large numbers of migratory Belugas occur along the northwestern and northern Alaskan coast, in the Canadian high Arctic, and in western Hudson Bay. At certain times of the year, those whales migrate thousands of kilometers, in some cases as far as 80oN into dense pack ice (Suydam et al. 2001) or thousands of kilometers into the North Water polynya or to the pack ice off West Greenland (Richard et al. 1998a,b; Richard et al. 2001; Heide-Jørgensen et al. 2003a). Non-migratory belugas that generally make seasonal shifts in distribution of less than a few hundred kilometers are found in Cook Inlet, Cumberland Sound, Svalbard, and the Gulf of St. Lawrence (Lydersen et al. 2001; Kingsley 2002; Hobbs et al. 2005).

While the general features of Beluga whale habitat can be described for the relatively well-studied populations, the importance of those features is not well understood (Laidre et al. in press). For example, the summer occupation of nearshore/estuarine waters has been ascribed alternatively to feeding (Seaman et al. 1982), to warm water providing a thermal advantage to neonates (Sergeant and Brodie 1969), and to the presence of fresh water and coarse substrates facilitating skin shedding during molt (St. Aubin et al. 1990, Frost et al. 1993). The relative importance of each of those factors likely varies based on the environmental conditions (e.g., water temperatures and prey availability) specific to each of the summering areas (Frost and Lowry 1990a). Similarly, it is unclear why belugas sometimes move into deep, ice-covered waters. One potential reason would be to avoid Killer Whale (Orcinus orca) predation (Frost et al. 1992). However, the movements into the ice appear excessive for what would be needed to avoid killer whales (Suydam et al. 2001) and actually could expose belugas to predation by Polar Bears (Ursus maritimus) (Lowry et al. 1987a) as well as increase the risk of entrapment in the ice. It is possible belugas move into ice-covered offshore regions for feeding, primarily on Arctic Cod (Boreogadus saida), but few data are available to test this hypothesis. Similarly, the associations of belugas with features such as the continental shelf break (Moore 2000) may be related to oceanographic processes that produce good feeding conditions (Laidre et al. in press).

Dives may last up to 25 min. and can reach depths of 800 m. The Beluga has a diverse diet, which varies greatly from area to area. Although various species of fish are considered to be the primary prey items (including salmon, herring, and Arctic Cod), Belugas also feed on a wide variety of molluscs (such as squid and octopus) and benthic crustaceans (shrimps and crabs). Polar Bears and Killer Whales are known predators of belugas throughout their Arctic range (Frost et al. 1992).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The habitat of beluga whales includes inlets, fjords, channels, bays, and the shallow waters of the artic seas that are warmed by continuous sunlight. They are also found at the mouths of river during summertime, where they feed, socialize, and deliver their offspring. These waters are usually 8 to 10 degrees celsius.

Range depth: 0 to 350 m.

Habitat Regions: saltwater or marine

Terrestrial Biomes: icecap

Aquatic Biomes: pelagic ; benthic ; coastal ; brackish water

Other Habitat Features: estuarine

  • Paine, S. 1995. The World of the Arctic Whales. San Francisco: Sierra Club.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.367 - 14.365
  Nitrate (umol/L): 1.715 - 3.963
  Salinity (PPS): 31.835 - 33.295
  Oxygen (ml/l): 6.009 - 7.040
  Phosphate (umol/l): 0.419 - 0.635
  Silicate (umol/l): 2.009 - 3.312

Graphical representation

Temperature range (°C): 7.367 - 14.365

Nitrate (umol/L): 1.715 - 3.963

Salinity (PPS): 31.835 - 33.295

Oxygen (ml/l): 6.009 - 7.040

Phosphate (umol/l): 0.419 - 0.635

Silicate (umol/l): 2.009 - 3.312
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Arctic and subarctic, often in or near sea ice or glacial ice; Coastal waters and estuaries, shelf break, and deep basins; Circumpolar but discontinuous distributionShelf & coastal, North Pacific to Chukchi & Beaufort Seas
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The beluga whale inhabits cold arctic waters, usually near to the ice edge (3). Summer is spent in shallow bays and estuaries, whereas in winter, the beluga whale occurs in areas of loose pack ice, where wind and ocean currents keeps cracks for breathing holes open (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Population that summers around Somerset Island in eastern Canadian high arctic migrates through Lancaster Sound and winters mainly in Baffin Bay and Davis Strait (Droidge and Finley 1992, 1993). heavy pack ice and landfast ice; in spring may follow ice edges closely, penetrate areas with ice cracks (Stewart and Stewart 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats various benthic and pelagic prey in shallow and coastal waters; most important prey varies, includes capelin, various cods, sand lance, char, herring, cisco, whitefish, smelt, burbot, salmon, sculpin, decapods, squid, octopus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Belugas feast on a variety of prey including smelt, flatfish, flounder, sculpins, salmon, and cod. They also feed on invertebrates such as crab, shrimp, clams, worms, octopus, squid, and other bottom dwelling creatures. Since they don’t have many big, sharp teeth to grab their prey, they use suction to trap it into their mouths. Consequently, everything must be eaten whole. Prey cannot be too large, therefore, or the beluga will choke on it.

Animal Foods: fish; mollusks; aquatic or marine worms; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wide range of prey including primarily fish, cephalopods, and crustaceans; Echolocate prey with sonar
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Belugas consume many fish, especially since they travel in herds of between one hundred and a thousand. This undoubtedly causes some regulation of fish populations. Belugas also seem to have a parasite called Pharurus pallasii, thought to infect the hearing organs. However, it is not known if this parasite is harmful to the beluga.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

The known predators of belugas are killer whales and polar bears. Polar bears will attack belugas in the same way they would attack a seal, which entails lying in wait at breathing holes. Killer whales come around August. Belugas can usually hear killer whales, so this makes it difficult for killer whales to attack them. Also, the conspicuous fin makes it almost impossible for a killer whale to maneuver in ice. Humans used to hunt belugas for their skin and oil, but that is not so common anymore.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Delphinapterus leucas is prey of:
Orcinus
Homo sapiens
Ursus maritimus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Delphinapterus leucas preys on:
benthonic invertebrates
Vertebrata
non-insect arthropods
Actinopterygii
aquatic or marine worms
Mollusca
Crustacea

Based on studies in:
Arctic (Marine)

This list may not be complete but is based on published studies.
  • M. J. Dunbar, Arctic and subarctic marine ecology: immediate problems, Arctic 7:213-228, from p. 223 (1954).
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Travels in small groups of 2-10, also forms summer congregations of hundreds or thousands. Mature males tend to travel together, as do females, calves, and immatures (Stewart and Stewart 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

large variety of fish, various crustaceans and other bottom living invertebrates
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Communication is achieved by using the melon for echolocation. Belugas have a high frequency level of communication. Their voices are so loud that they sound like birds, which is why they were once nicknamed “sea canaries”. They are considered to be among the most vocal species of cetaceans. They use their vocalizations for echolocation, mating, and communication. Their voices sound like chirps, whistles, and squawks. Belugas also use body language such as grinding their teeth or splashing around. Some communication undoubtedly occurs when babies are in contact with their mothers.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; acoustic ; echolocation ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Development

There is either thought to be spontaneous ovulation with an extremely long gestation period or delayed implantation with a shorter gestation period, but it is unknown. Their development is similar to that of most other mammals. (Lentifer 1988)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size at birth 1.5m (5 feet); Sexual maturity at 5-8 years; Females have calves every 2-3 years; Longevity over 35 years, possibly more then 50 years; Behavior; Vocal and gregarious
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Arctic Ocean Diversity

Source: Arctic Ocean Diversity

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The life span for females is thought to be about 32 years and that for males about 40 years. Predation and ice entrapment are common causes of premature death.

Range lifespan

Status: wild:
32 to 40 years.

Typical lifespan

Status: wild:
25 to 30 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 40 years (captivity) Observations: It is estimated that these animals may live up to 40 years in the wild (David Macdonald 1985). One wild born specimen was still alive in captivity at about 34 years of age (Richard Weigl 2005). Maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Mates generally in spring. Gestation lasts 14-15 months. Single young (rarely 2); births peak in late March in western Greenland, late June in western Hudson Bay and Bering Sea, July in the Gulf of St. Lawrence. Lactation lasts 20-24 months. Age of first pregnancy: 4-7 years (Stewart and Stewart 1989). Calving interval probably is 3 years for most adult females. Females live up to about 20 years, males to about 30 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The mating system of these whales has not been described.

Belugas tend to mate from late February to early April. The males chase down the females, making all sorts of noises. The male throws down his tail and bends violently, then he throws his head up and down as his melon vibrates to ward off any other males who might attempt to mate with this female.

The male and female swim in harmony and caress each other, until she swims underneath his belly. She puts her belly up against his and they continue to swim in harmony with each other. They mate only with absolute consent. (Paine, 1995)

Gestation lasts about fourteen months. However, it is a possibility that these creatures have delayed implantation. A calf is born during the summer months of May through July. The calf is very well developed and has a grayish coloration. The nursery pod stays around during the delivery and then all of them take off except a young teenage nursemaid. This usually happens near rivers because the water is ten degrees warmer there. This is important for the calf, which does not have as much blubber as a full grown adult. The baby stays in-between the two females as they swim pulling him with the current. The calf is totally dependent on the mother’s milk for a year, but lactation lasts 1.5 to 2 years.

It takes 4 to 7 years for females to sexually mature, and it takes 7 to 9 years for males. (Bonner, 1989)

Females reproduce every 2 to 3 years. Females stop reproducing in their early twenties. (Lentifer, 1989)

Breeding interval: Female belugas generally reproduce once every two to three years.

Breeding season: Breeding occurs from late February through early April.

Range number of offspring: 1 to 1.

Average gestation period: 14 months.

Range weaning age: 12 to 24 months.

Range time to independence: 12 to 24 months.

Range age at sexual or reproductive maturity (female): 4 to 7 years.

Range age at sexual or reproductive maturity (male): 7 to 9 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; delayed implantation

Average birth mass: 66000 g.

Average gestation period: 416 days.

Average number of offspring: 1.

Offspring are precocious, and able to swim along side their mothers from birth. The mother provides protection and guidance for the offspring, as well as milk. A female beluga can lactate for up to two years.

Parental Investment: precocial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Bonner, W. 1989. Whales of the World. New York: Facts on File Publications.
  • Lentifer, J. 1988. Selected Marine Mammals of Alaska: Species Accounts with Research and Management Recomendations. Washington, D.C.: Marine Mammals Commission.
  • Paine, S. 1995. The World of the Arctic Whales. San Francisco: Sierra Club.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Delphinapterus leucas

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTATATCTACTATTTGGTGCCTGAGCAGGAATAGTAGGCACCGGCCTAAGCTTGTTAATTCGTGCTGAATTAGGCCAACCTGGCTCACTTATTGGAGACGACCAAATTTATAACGTACTAGTAACAGCCCACGCCTTCGTGATAATCTTCTTTATAGTAATGCCTATTATAATTGGAGGGTTTGGAAACTGACTTGTCCCTTTAATAATCGGAGCCCCCGACATGGCTTTCCCTCGTCTAAATAACATAAGCTTTTGACTGCTTCCTCCTTCTTTCCTACTACTAATAGCATCCTCAATAGTTGAAGCCGGCGCAGGCACAGGCTGAACTGTGTACCCCCCTCTAGCAGGAAATCTAGCACATGCAGGAGCCTCAGTCGACCTTACTATTTTCTCTCTACATCTAGCCGGCGTATCTTCAATCCTCGGGGCTATCAACTTCATTACAACTATTATTAACATAAAACCACCCGCTATAACCCAATACCAAACACCTTTATTCGTATGATCAGTCTTAATTACAGCAGTCTTACTCCTATTATCACTACCTGTCCTAGCAGCCGGAATTACCATGCTACTAACTGATCGAAACCTAAACACAACCTTTTTCGACCCTGCAGGAGGAGGCGACCCAGTCCTATATCAACACCTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Delphinapterus leucas

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N3 - Vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Jefferson, T.A., Karkzmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R., Rojas-Bracho, L., Secchi, E., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J.

Contributor/s

Justification
At the global level the species does not qualify for a threatened status under any of the criteria although there is substantial uncertainty about numbers and trends for at least some large parts of the range, especially in the Russian Arctic. Given that uncertainty, and the fact that cessation of national and international, taxon-specific conservation programs that currently monitor and manage hunting could result in the Beluga’s qualifying for threatened status (under criterion A3) within five years, the species should be listed as Near Threatened. The Beluga whale is unquestionably a conservation-dependent species.

The species was assessed previously (1996) as Vulnerable (VU A1abd). The main reason for the change to Near Threatened is that the decline criterion for Vulnerable is not met for some of the largest subpopulations, and they have a disproportionate effect on the assessment of the species as a whole. Also, estimates of current population size for several of the larger stocks are substantially higher than previous estimates (due to better survey methods and not necessarily because of increases in numbers).

Across the global range of Belugas, subpopulations are subject to differing levels of threat and warrant individual assessment. Some subpopulations clearly qualify for threatened status and only one of these – the Cook Inlet subpopulation – has been assessed thus far (as CR) (Lowry et al. 2006). Those other potentially threatened subpopulations (e.g. West Greenland, eastern Hudson Bay, St. Lawrence River, Ungava Bay) that are well-defined and well-studied should be assessed separately as soon as feasible.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Currently, beluga populations have been estimated at 60,000 to a 100,000 so there is no need for conservation efforts, although it couldn’t hurt.

US Federal List: no special status

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1). Listed on Appendix II of CITES (4), and listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population consists of numerous subpopulations with varying degrees of differentiation (hereafter the terms subpopulation and stock are used interchangeably). The International Whaling Commission’s Scientific Committee (IWC 2000) organized information on belugas on the basis of 29 provisional management stocks. Some of the stock boundaries overlap spatially and seasonally, complicating assessment. Many of the subpopulations or stocks maintain distinct or contiguous geographical ranges during the summer months but mix during the spring and autumn migrations and share common wintering quarters. While good abundance estimates are available for some Beluga subpopulations/stocks, the sizes of others are virtually unknown. Total numbers worldwide are well above 150,000 animals, with many portions of the range unsurveyed. The following estimates for subpopulations/stocks or regions range from relatively precise abundance estimates to rough approximations of numbers in the late 1990s or early 2000s:

Alaska
Cook Inlet: The number of Beluga whales in Cook Inlet is estimated from counts by aerial observers and aerial video group counts (Hobbs et al. 2000b; Lowry et al. 2006). The most recent published estimate at the time of the present assessment (May 2008) was 302 (CV=0.16) in 2006 (Angliss and Outlaw 2007). In addition, the National Marine Fisheries Service had indicated via a web posting that the point estimate from the 2007 aerial survey was 375.

Bristol Bay: Most recently (1994), the number of Beluga whales in Bristol Bay was estimated at 1,555 (Lowry and Frost 1999). This estimate was based on a maximum count of 503 animals, which was corrected using radio-telemetry data for the proportion of animals that were diving (Lowry and Frost 1999) and for the proportion of newborns and yearlings not observed due to their small size and colouration. Surveys in 1999 and 2000 resulted in maximum counts of 690 and 531, which can be extrapolated to population estimates of 2,133 and 1,642, respectively (L. Lowry, University of Alaska Fairbanks pers. comm. to K. Laidre, 1/07).

Eastern Bering Sea: Aerial surveys of Norton Sound, the summering site for the eastern Bering Sea stock, were conducted in 2000. Preliminary analyses produced an uncorrected estimate of 5,868 animals; when corrected for animals not visible at the surface and for newborn and yearling animals not observed due to their small size and dark coloration, the estimated population size for Norton Sound is 18,142 (CV=0.24) (R. Hobbs, AFSC-NMML pers. comm. 01/07; Angliss and Outlaw 2005).

Eastern Chukchi Sea: Frost et al. (1993) estimated the minimum size of the eastern Chukchi stock of belugas at 1,200, based on counts of animals from aerial surveys conducted during 1989-91. The total corrected abundance estimate for the eastern Chukchi stock is 3,710.

Shared Alaska/Canada
Eastern Beaufort Sea/Beaufort Sea: The most recent aerial survey, conducted in July 1992, resulted in an uncorrected estimate of 19,629 (CV=0.229) (Harwood et al. 1996). The corrected population estimate was 39,258 animals (Angliss and Outlaw 2005).

Canada
Cumberland Sound: This stock numbers about 1,500 animals and is thought to have increased since the 1980s (COSEWIC 2004)

Ungava Bay: The Ungava Bay stock is too small to estimate. Hammill et al. (2004) recently estimated it at <50 animals; none were seen on a survey conducted in 2001.

West Hudson Bay: There are estimated to be more than 23,000 Belugas in western Hudson Bay and more than 1,300 along the southern Hudson Bay coast (Richard 1991).

East Hudson Bay: Belugas in Eastern Hudson Bay have declined from 4,200 (SE 300) in 1985 to 3,100 (SE 800) in 2004 (corrected estimates) (Hammill et al. 2005).

St Lawrence River: The St. Lawrence subpopulation is estimated to be in the order of 900–1,000 individuals. There is no evidence of a significant trend in abundance since 1988 (COSEWIC 2004).

Eastern High Arctic/Baffin Bay: A survey in 1996 estimated 21,213 Belugas (95% CI 10,985 to 32,619) in the waters surrounding Somerset Island: Barrow Strait, Peel Sound and Prince Regent Inlet (Innes et al. 2002). This estimate takes into account both whales missed by observers and those that might have been unavailable for detection due to diving behaviour. It includes whales that move to West Greenland during the winter.

Shared Canada/Greenland
West Greenland: Aerial surveys flown in late winter in West Greenland between 1981 and 1994 found that Beluga numbers had decreased by 62% during that period, probably because of over-harvesting (Heide-Jørgensen and Reeves 1996). Further surveys in 1998 and 1999 confirmed the decline and found 7,941 (95% CI: 3650-17278) belugas in West Greenland, including whales missed by the observers and whales that were submerged during the survey (Heide-Jørgensen and Acquarone 2002). Heide-Jørgensen et al. (2003) estimate that approximately 30% of the Eastern Canadian high Arctic/Baffin Bay beluga stock migrates to West Greenland for overwintering.

Svalbard
Belugas have never been surveyed around Svalbard. Pods numbering into the thousands are sighted irregularly around the archipelago, and pods ranging from a few to a few hundred individuals are seen regularly (Gjertz and Wiig 1994, Kovacs and Lydersen 2006).

Russia
Eastern and Central Russian Arctic: There are no rigorous abundance estimates for the Eastern and Central Russian Arctic (Boltunov and Belikov 2002). Rough estimates of a few thousand in Anadyr Gulf and a few thousand in the western Chukchi and eastern East Siberian Seas were summarized in a table compiled by the IWC Scientific Committee (IWC 2000). In addition to those animals, belugas from Alaskan stocks (e.g. eastern Bering Sea, eastern Chukchi Sea, and Beaufort Sea stocks) move into eastern Russian waters during the winter. The IWC table mentioned above (IWC, 2000) indicates a rough estimate of 18,000–20,000 in the Okhotsk Sea.

Western Russian Arctic: Belugas in the Western Russian Arctic occupy four major areas: (1) southern Barents and White seas, (2) southern Barents and Kara seas, (3) coastal waters of the Kara Sea, and (4) western portion of the Laptev Sea. They may share wintering grounds to some extent. Surveys have not yet been conducted in the Barents and Kara seas and the number of Belugas inhabiting these regions is unknown. The White Sea hosts a resident population of belugas numbering about 1,000 over-wintering individuals. In summer, this number is augmented by animals from the Barents Sea.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Population decline in Gulf of St. Lawrence (from 5000 to 500) and elsewhere is attributed to loss of suitable habitat, pollution, and especially historic over-exploitation (Stewart and Stewart 1989, IUCN 1991, Dold 1993). This population shows a high rate of intestinal cancer, possibly related to water pollution (Farnsworth, NY Times, 22 August 1995). Lungworms may be an important cause of morbidity and mortality of young in the St. Lawrence estuary (Measures et al. 1995). The Southeast Baffin Island population is thought to be declining as a result of excessive harvest (Richard 1991). There is also concern that excessive harvest, especially in western Greenland, may be threatening the Baffin Bay population that summers around Somerset Island (Droidge and Finley 1992, 1993). Potentially threatened also by development of hydrocarbon resources and increased disturbance from ship traffic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Hunting for human consumption is the biggest known threat to belugas across certain portions of their range. The most immediate concerns relate to continuing harvests from small and depleted subpopulations (IWC 2000). The strong philopatry of belugas, which causes them to return to the same estuaries year after year, makes them highly vulnerable to overexploitation. This behavioural trait is undoubtedly the most important natural factor that has led to the extirpation of Belugas from some parts of their range by a combination of commercial and subsistence hunting (e.g. in southwestern Greenland and some river mouths in Ungava Bay, Canada).

Known or potential threats include a variety of human activities in addition to hunting: oil and gas development, expansion of fisheries (with possible implications for bycatch and resource depletion), hydroelectric development (in Hudson Bay), and industrial and urban pollution. Climate change will likely increase the scale and distribution of these activities. Hydroelectric development may affect belugas because of their dependence on estuarine conditions. Areas such as the McKenzie Delta and West Greenland are subject to oil exploration, which often includes seismic surveys, offshore drilling, and artificial island construction. These activities are undertaken in the summer months in the same areas occupied by belugas at this time of year. In a study of responses of belugas to ice-breaking ships, the Belugas typically moved rapidly along ice edges away from approaching ships and showed strong avoidance reactions to approaching ships at distances of 35–50 km (Finley et al. 1990).

Climate change is another potential threat. Belugas may experience climate-induced geographic shifts or altered reproductive success due to persistent changes in extent of sea ice (Tynan and DeMaster, 1997, Laidre et al in press). Belugas are also susceptible to savssats or ice entrapments when sea ice conditions change rapidly.

Threats from contaminants are of concern in some areas. Studies of the small, geographically isolated subpopulation in the St. Lawrence River have found that concentrations of both total PCBs and chlorinated PCB congeners are much higher in these belugas than in Arctic belugas. Some scientists believe that the increased occurrence of opportunistic bacterial infections, parasitic infestation, gastric ulcers and other disorders in St. Lawrence belugas is evidence of a link between immune system dysfunction and PCB exposure (Martineau et al., 1994).

To summarize, in some parts of the species’ range, particularly in Canada and Greenland, intensive hunting represents an ongoing major threat, and in a few instances this is compounded by the less direct and less easily quantified threats (realized and potential) of disturbance by vessel traffic (e.g. St. Lawrence estuary, river mouths in eastern Hudson Bay), habitat modification (e.g. large hydroelectric dams in rivers flowing into Hudson Bay and James Bay), contaminants (e.g. St. Lawrence estuary), climate change (including secondary effects from opening of Arctic and sub-Arctic waters to year-round ship traffic, oil an gas development, commercial fishing), and possibly incidental catch in fisheries (e.g. St. Lawrence estuary).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In some parts of the Beluga Whale’s range, particularly in Canada and Greenland, intensive hunting represents an ongoing threat to Belugas. In a few instances this is compounded by the less direct and less easily quantified threats of disturbance by vessel traffic (e.g., St. Lawrence estuary, river mouths in eastern Hudson Bay), habitat modification (e.g., large hydroelectric dams in rivers flowing into Hudson Bay and James Bay), contaminants (e.g., St. Lawrence estuary), and possibly incidental catch in fisheries (wherever entangling gear overlaps the animals’ range) (IUCN 2009).

Global climate change may also have serious negative impacts on Beluga Whales. The most serious impacts of climate change on Belugas may not come directly from the effects of weather conditions, but rather indirectly from the role that regional warming and reduced sea ice play in changing human activities. Extensive ice cover and extreme winter conditions (including both darkness and cold) have always limited human activities in the Arctic, and many regions have remained inaccessible to ships and other vessels. As Arctic ice cover declines and the passages between northern landmasses become more navigable, humans will gain easier access to formerly pristine areas that have long served as refuges for Belugas (IUCN 2009).

The number of vessels sailing through the Arctic for gas and oil exploration/extraction, commercial shipping (for both transportation and tourism), and fishing has already increased. Further reductions in sea ice are likely to accelerate this trend in coming decades. With the increase in ship traffic, ship strikes are likely to become an increasingly significant cause of Beluga injury and death. Belugas detect and respond to the presence of icebreaking ships over great distances (up to 50 km). Industrial noise (e.g., from ships, seismic surveys, and offshore drilling), likely disrupts Beluga behaviour and may impair the ability of Belugas to communicate, forage efficiently and generally sense their environment. Noise-producing activities are already ongoing or planned in many areas used by large populations of Belugas, including the Beaufort and Chukchi seas, West Greenland, and Hudson Bay (IUCN 2009).

Pollution may become an increasingly significant problem for Belugas with increasing industrialization and urbanization of the Arctic. Many toxic contaminants become concentrated as they move up the food chain. Because Belugas and other cetaceans are at or near the top of the food chain and have long life spans, they accumulate relatively high concentrations of certain toxins in their blubber and other organs. These may contribute to a range of health problems in the animals themselves and are also of concern to the people who hunt Belugas for food (IUCN 2009).


Loss of sea ice and increased ocean temperatures will affect the distribution, composition, and productivity of prey communities and in turn influence the ability of Belugas to find and catch suitable prey. Given the great uncertainties about how Arctic and sub-Arctic ecosystems function and about how they will be affected by climate change, it is difficult to confidently predict impacts of climate change on Beluga prey populations (IUCN 2009).


As weather patterns become more unpredictable and extreme due to climate change, it is possible that Belugas and other Arctic whales will become more susceptible to ice entrapment. Such events have always occurred and are assumed to contribute to natural mortality in most Beluga populations. However, it is feared that the frequency and scale of the mortality from ice entrapment will increase as the climate changes (IUCN 2009).

As Arctic waters become warmer and patterns of circulation, salinity, and nutrient input change, species that previously were not present in the Arctic will be able to move farther north and remain there for longer. This could have two major types of effects on Belugas. First, species such as Minke and Humpback whales as well as seals and other predators may directly compete with Belugas for food resources. Second, species such as Killer Whales may have more opportunities to prey on Belugas. Both of these factors could negatively affect Beluga populations (IUCN 2009).

One population (or "distinct population segment" in the curious language of the U.S. Endangered Species Act), the Cook Inlet Beluga Whale of Cook Inlet in southeastern Alaska, was listed as endangered by the U.S. National Oceanic and Atmospheric Administration (NOAA) in October of 2008. In December of 2009, NOAA proposed designating more than a third of Cook Inlet as critical habitat for the remaining ~300 Cook Inlet Beluga Whales.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Shapiro, Leo

Source: EOL Rapid Response Team

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Belugas have traditionally been hunted for their blubber for many centuries, but only with the advent of commercial whaling did the harvest become too large to sustain (6) (9). These whales are particularly vulnerable, due to their high fidelity for certain migratory routes (3). Perhaps the most pertinent threat to the beluga today, is habitat deterioration in the form of the industrial development and pollution of coastal habitats with which they are particularly associated (3). Some populations are declining principally as a result of pollution; belugas in the St Lawrence River Estuary, for example, accumulate so many toxins that deformed calves are prevalent and dead individuals are treated as toxic waste (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Although the Beluga was hunted intensively on a commercial basis in many parts of its range during the 20th century, the only known direct removals at present are for food (subsistence use) and the aquarium trade (there is a limited live-capture fishery in Russia). A regional management body, the Joint Committee on Narwhal and Beluga/North Atlantic Marine Mammal Commission (JCNB/NAMMCO), exists in Canada and Greenland with the expectation that it will ensure the conservation of Belugas. This body sets or recommends catch limits for Beluga populations within member countries. Catch levels from subpopulations range anywhere from <10 to a few hundred animals per year. Removals from some subpopulations/stocks are considered sustainable, however, there is concern and evidence that removals from other subpopulations/stocks are not (e.g. Eastern Hudson Bay and West Greenland) (Alvarez and Heide-Jørgensen 2004, COSEWIC 2004, NAMMCO/JCNB 2005).

It is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Today the widespread hunting of beluga whales is prohibited under the International Moratorium on Commercial Whaling (11); however, small quotas are permitted to local people who depend upon the harvest (6). The Alaska and Inuvialuit Beluga Whale Committee was established in 1988 and encourages dialogue between native hunters, conservationists and government representatives as well as carrying out stock and hunting assessment of the Alaskan and Canadian populations of belugas (12). Some protection from industrial development is being provided at locations where these whales commonly occur but careful monitoring of existing stocks will be needed to secure the future of this attractive cetacean (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Long subjected to subsistence harvest, and formerly to commercial harvest, throughout range (IUCN 1991). Currently harvested by subsistence hunters (e.g., Alaskan natives and Canadian Inuit, and Greenland natives). Displayed in some marine aquaria.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Belugas hinder fishermen from getting any fish. Much of the hunting of belugas has died down since the seventies.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Belugas were once hunted for food and other items such as oil. These provided humans with a profit. Now, because of their large social groupings, they provide ecotourists with entertainment.

Positive Impacts: food ; ecotourism ; research and education; produces fertilizer

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

subpopulation Cook Inlet beluga whale : Critically Endangered (CR)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Category

Near Threatened (NT)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Beluga whale

Beluga whale!<-- This template has to be "warmed up" before it can be used, for some reason -->

The beluga or white whale, Delphinapterus leucas, is an Arctic and sub-Arctic species of cetacean. It is one of two members of the family Monodontidae, along with the narwhal. This marine mammal is commonly referred to simply as the beluga or sea canary due to its high-pitched twitter.[3] It is up to 5 meters (16 ft) in length and an unmistakable all-white color with a distinctive protuberance on the head. From a conservation perspective, the beluga is considered "near threatened" by the International Union for Conservation of Nature; however the subpopulation from the Cook Inlet in Alaska is considered critically endangered and is under the protection of the United States' Endangered Species Act.[2][4] Of seven Canadian beluga populations, two are listed as endangered, inhabiting eastern Hudson Bay, and Ungava Bay.

Contents

Taxonomy

In 1776 Peter Simon Pallas first described the beluga.[1] It is a member of the Monodontidae family, which is in turn part of the toothed whale suborder.[1] The Irrawaddy dolphin was once placed in the same family; however, recent genetic evidence suggests otherwise.[5] The narwhal is the only other species within the Monodontidae family besides the beluga.[6]

The Red List of Threatened Species gives both beluga and white whale as common names, though the former is now more popular. The English name comes from the Russian белуга (beluga) or белуха (belukha), which derives from the word белый (belyy), meaning "white". It is sometimes referred to by scientists as the belukha whale in order to avoid confusion with the beluga sturgeon.

The whale is also colloquially known as the Sea Canary on account of its high-pitched squeaks, squeals, clucks and whistles. A Japanese researcher says he taught a beluga to "talk" by using these sounds to identify three different objects, offering hope that humans may one day be able to communicate effectively with sea mammals.[7]

Description

Photo of beluga at water surface with back flexed, with both head and tail raised
A beluga in the shallow waters of the Vancouver Aquarium

Male belugas are larger than females. Males can reach 5.5 metres (18 ft) long, while females grow to 4.1 metres (13 ft).[8] Males weigh between 1,100 and 1,600 kilograms (2,400 and 3,500 lb) while females weigh between 700 and 1,200 kilograms (1,500 and 2,600 lb).[9] This is larger than most dolphins, but is smaller than most other toothed whales.[citation needed]

The adult beluga is rarely mistaken for another species, because it is completely white or whitish-gray in color. Calves, however, are usually gray.[8] Its head is unlike that of any other cetacean. Like most toothed whales it has a melon—an oily, fatty tissue lump found at the center of the forehead. The beluga's melon is extremely bulbous and even malleable.[6] The beluga is able to change the shape of its head by blowing air around its sinuses. Unlike many dolphins and whales, the vertebrae in the neck are not fused together, allowing the animal to turn its head laterally. The rostrum has about 8 to 10 teeth on each side of the jaw and a total of 34 to 40 teeth.

Belugas have a dorsal ridge, rather than a dorsal fin.[8] The absence of the dorsal fin is reflected in the genus name of the species—apterus the Greek word for "wingless." The evolutionary preference for a dorsal ridge rather than a fin is believed to be an adaptation to under-ice conditions, or possibly as a way of preserving heat.[6] As in other cetaceans, the thyroid gland is relatively large compared to terrestrial mammals (proportionally three times as large as a horse's thyroid) and may help to sustain higher metabolism during the summer estuarine occupations.

Its body is round, particularly when well-fed, and tapers less smoothly to the head than the tail. The sudden tapering to the base of its neck gives it the appearance of shoulders, unique among cetaceans. The tail fin grows and becomes increasingly and ornately curved as the animal ages. The flippers are broad and short—making them almost square-shaped.

Range and habitat

Photo of whale at surface with bump behind head
Beluga at the mouth of Churchill River into Hudson Bay, Canada

The beluga inhabits a discontinuous circumpolar distribution in Arctic and sub-Arctic waters ranging from 50° N to 80° N, particularly along the coasts of Alaska, Canada, Greenland, and Russia. The southernmost extent of their range includes isolated populations in the St. Lawrence River estuary and the Saguenay fjord, around the village of Tadoussac, Quebec, in the Atlantic and the Amur River delta, the Shantar Islands and the waters surrounding Sakhalin Island in the Sea of Okhotsk.[10]

In the spring, the beluga moves to its summer grounds: bays, estuaries and other shallow inlets. These summer sites are discontinuous. A mother usually returns to the same site year after year. As its summer homes clog with ice during autumn, the beluga moves away for winter. Most travel in the direction of the advancing icepack and stay close its edge for the winter months. Others stay under the icepack—surviving by finding ice leads and polynyas (patches of open water in the ice) in which they can surface to breathe. Beluga may also find air pockets trapped under the ice. The beluga's ability to find the thin slivers of open water within a dense ice pack that may cover more than 96% of the surface mystifies scientists. Its echo-location capabilities are highly adapted to the sub-ice sea's peculiar acoustics and it has been suggested that belugas can sense open water through echo-location.

In 1849, while constructing the first railroad between Rutland and Burlington in Vermont, workers unearthed the bones of a mysterious animal in the town of Charlotte. Buried nearly 10 feet (3.0 m) below the surface in a thick blue clay, these bones were unlike those of any animal previously discovered in Vermont. Experts identified the bones as those of a beluga. Because Charlotte is over 150 miles (241 km) from the nearest ocean, early naturalists were at a loss to explain the bones of a marine mammal buried beneath the fields of rural Vermont. Today, the Charlotte whale aids in the study of the geology and the history of the Champlain Basin,[11] and this fossil is now the official Vermont State Fossil (making Vermont the only state whose official fossil is that of a still extant animal).

On June 9, 2006, a young beluga carcass was found in the Tanana River near Fairbanks in central Alaska, nearly 1,700 kilometers (1,056 mi) from the nearest ocean habitat. Belugas sometimes follow migrating fish, leading Alaska state biologist Tom Seaton to speculate that it had followed migrating salmon up the river at some point in the prior fall.

Life history

Overhead photo of five belugas swimming at surface with four splash areas behind them
Pod of belugas swimming

Belugas are highly sociable. Groups of males may number in the hundreds, while mothers with calves generally mix in slightly smaller groups. When pods aggregate in estuaries, they may number in the thousands. This can represent a significant proportion of the entire population and is when they are most vulnerable to hunting.

Pods tend to be unstable, meaning that they tend to move from pod to pod. Radio tracking has shown that belugas can start out in a pod and within a few days be hundreds of miles away from that pod. Mothers and calves form the beluga's closest social relationship. Nursing times of two years have been observed and lactational anestrus may not occur. Calves often return to the same estuary as their mother in the summer, meeting her sometimes even after becoming fully mature.

Belugas can be playful—they may spit at humans or other whales. It is not unusual for an aquarium handler to be drenched by one of his charges. Some researchers believe that spitting originated with blowing sand away from crustaceans at the sea bottom.

Unlike most whales, it is capable of swimming backwards.[12]

Males reach sexual maturity between four and seven years, while females mature at between six and nine years. The beluga can live more than 50 years.[8]

Reproduction

Underwater photo of calf swimming slightly below and behind mother
Female and calf

Female belugas typically give birth to one calf every three years.[8] Most mating occurs between February and May, but some mating occurs at other times of year.[6][8] It is questionable whether the beluga has delayed implantation.[6] Gestation last 12 to 14.5 months.[8]

Calves are born over a protracted period that varies by location. In the Canadian Arctic, calves are born between March and September, while in Hudson Bay the peak calving period is in late June and in Cumberland Sound most calves are born from late July to early August.[13]

Newborns are about 1.5 metres (4.9 ft) long, weigh about 80 kilograms (180 lb), and are grey in color. The calves remain dependent on their mothers for at least two years.

Ecology

Feeding

The beluga is a slow swimmer that feeds mainly on fish. It also eats cephalopods (squid and octopus) and crustaceans (crab and shrimp). Foraging on the seabed typically takes place at depths of up to 1,000 feet (300 m) but they can dive at least twice this depth. A typical feeding dive lasts 3–5 minutes, but belugas submerge for up to 20 minutes at a time.[14]

Predation

Polar bears take particular advantage of situations when belugas become trapped by ice and are thus unable to reach the ocean. The bears swipe at the belugas and drag them onto the ice. The orca is its other significant natural predator.[9]

Relation to humans

Belugas were among the first whale species in captivity. The first beluga was shown at Barnum's Museum in New York City in 1861. Today it remains one of the few whale species kept at aquaria and sea life parks across North America, Europe, and Asia. Its popularity there with visitors reflects its attractive color, and its range of facial expressions. While most cetacean "smiles" are fixed, the extra movement afforded by the beluga's unfused cervical vertebrae allows a greater range of apparent expression. Most belugas found in aquariums are caught in the wild, though captive breeding programs enjoy some success.

Both the United States Navy and the Russian Navy have used belugas in anti-mining operations in Arctic waters.[15] In one instance, a captive beluga helped bring a distressed diver who was performing a stunt in his pool up to the surface, possibly saving the diver's life.[16] Another time, a captive beluga brought a cramp-paralized diver from the bottom of the pool up to the surface by holding her foot in its mouth, certainly saving the female diver's life.[17]

Population and threats

Photo of white whale with head placed on poolside with human arm reaching to front of whale's mouth
A beluga whale in an aquarium with a trainer

The global population of belugas today stands at about 100,000. Although this number is much greater than that of many other cetaceans, it is much smaller than pre-hunting populations. There are estimated to be 40,000 individuals in the Beaufort Sea, 25,045 in Hudson Bay, 18,500 in the Bering Sea, and 28,008 in the Canadian Low Arctic. The population in the St. Lawrence estuary is estimated to be around 1,000.[18] It is considered an excellent sentinel species (indicator of environment health and changes). This is because it is long-lived, on top of the food web, bearing large amounts of fat and blubber, relatively well-studied for a cetacean, and still somewhat common.

Because the beluga congregates in river estuaries, pollution is proving to be a significant health danger. Incidents of cancer have been reported to be rising as a result of St. Lawrence River pollution. Local beluga carcasses contain so many contaminants that they are treated as toxic waste.[citation needed] Reproductive pathology has been discovered here, possibly caused by organochlorines. Levels between 240 ppm and 800 ppm of PCBs have been found, with males typically having higher levels.[19] The long-term effects of this pollution on the affected populations is not known.

Underwater photo of whale with top of head above surface
A beluga resurfaces

Indirect human disturbance may also be a threat. While some populations tolerate small boats, others actively try to avoid ships. Whale-watching has become a booming activity in the St. Lawrence and Churchill River areas.

Because of its predictable migration pattern and high concentrations, the beluga has been hunted by indigenous Arctic peoples for centuries. In many areas, hunting continues, and is believed to be sustainable. However, in other areas, such as the Cook Inlet, Ungava Bay, and off western Greenland, previous commercial operations left the populations in great peril. Indigenous whaling continues in these areas, and some populations continue to decline. These areas are the subject of intensive dialogue between Inuit communities and national governments aiming to create a sustainable hunt.

Pathogens

Papillomaviruses have been found in the gastric compartments of belugas in the St. Lawerence River. Herpesvirus as well has been detected on occasion in belugas. Encephalitis has sometimes been observed and the protozoa Sarcocystis can infect the animals. Ciliates have been observed to colonize the blowhole yet may not be pathogenic or especially harmful.[20]

Erysipelothrix rhusiopathiae bacilli, likely from contaminated fish in the diet, can endanger captive belugas, causing anorexia, dermal plaques, and lesions. This may lead to death if not diagnosed early and treated with antibiotics.[21]

Conservation status

Photo of stamp showing two adult and one juvenile, swimming
Pictured on Faroe Islands stamp

As of 2008, the beluga is listed as "near threatened" by the IUCN. This is due to uncertainty about the number of belugas over parts of its range (especially the Russian Arctic) and the expectation that if current conservation efforts cease, especially hunting management, the beluga population is likely to qualify for "threatened" status within five years. Prior to 2008, the beluga was listed as "vulnerable", a higher level of concern. IUCN cited the stability of the largest subpopulations and improved census methods that indicate a larger population than previously estimated.[2]

To prevent hunting, belugas are protected under the International Moratorium on Commercial Whaling; however, small amounts of beluga whaling are still allowed. Since it is very difficult to know the exact population of belugas because their habitats include inland waters away from the ocean, it is easy for them to come in contact with oil and gas development centers. To prevent whales from coming in contact with industrial waste, the Alaskan and Canadian governments are relocating sites where whales and waste come in contact.

To prevent captive whales from dying, researchers from the Vancouver Aquarium Marine Science Centre are finding ways to prevent fungi from entering the habitats and to constantly check their health. Healthy captive belugas are important because they are one of the only whales found in many marine aquariums. The high numbers of captives adds to the threat to the beluga population, while their carcasses contribute to scientific research.

Subpopulations are subject to differing levels of threat and warrant individual assessment. The Cook Inlet subpopulation is listed as "Critically Endangered" by the IUCN as of 2006.[22] The Cook Inlet beluga population is listed as Endangered under the Endangered Species Act as of October 2008.[4][23][24] This was due to overharvesting of belugas prior to 1998. The population has failed to recover even though the reported harvest has been small. The most recent published estimate as of May 2008 was 302 (CV=0.16) in 2006.[25] In addition, the National Marine Fisheries Service indicated that the 2007 aerial survey's point estimate was 375.

Evolution

Skeleton of D. leucas

The beluga's earliest known ancestor is the prehistoric Denebola brachycephala from the late Miocene period. A single fossil from the Baja California peninsula, indicates that the family once inhabited warmer waters. The fossil record also indicates that in comparatively recent times the beluga's range varied with that of the polar ice packs—expanding during ice ages and contracting when the ice retreats.

See also

References

  1. ^ a b c Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300105. 
  2. ^ a b c Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Reeves, R.R., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K. (2008). Delphinapterus leucas. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2008-10-07.
  3. ^ Harris, Patricia; Lyon, David; (April 8, 2007) Boston Globe Enter close quarters: colonial to nuclear subs. Section: Travel; Page 8M.
  4. ^ a b Rosen, Yereth (October 17, 2008). "Beluga whales in Alaska listed as endangered". Reuters. http://www.reuters.com/article/domesticNews/idUSTRE49G6JD20081017. Retrieved 2008-10-17. 
  5. ^ Arnold, P. (2002). "Irrawaddy Dolphin Orcaella brevirostris". In Perrin, W., Würsig B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 652. ISBN 0-12-551340-2. 
  6. ^ a b c d e O'Corry-Crowe, G. (2002). "Beluga Whale Delphinapterus leucas". In Perrin, W., Würsig B. and Thewissen, J.. Encyclopedia of Marine Mammals. Academic Press. p. 94–99. ISBN 0-12-551340-2. 
  7. ^ "Japanese whale whisperer teaches beluga to talk". www.meeja.com.au. 2008-09-16. http://www.meeja.com.au/index.php?display_article_id=221. Retrieved 2008-09-16. 
  8. ^ a b c d e f g Shirihai, H. & Jarrett, B. (2006). Whales, Dolphins and Other Marine Mammals of the World. Princeton: Princeton Univ. Press. p. 97–100. ISBN 0-69112757-3. 
  9. ^ a b Reeves, R., Stewart, B., Clapham, P. & Powell, J. (2003). Guide to Marine Mammals of the World. New York: A.A. Knopf. p. 318–321. ISBN 0-375-41141-0. 
  10. ^ Artyukhin Yu.B. and V.N. Burkanov (1999). Sea birds and mammals of the Russian Far East: a Field Guide, Мoscow: АSТ Publishing – 215 p. (Russian)
  11. ^ http://www.uvm.edu/whale/
  12. ^ "Georgia Aquarium – Beluga Whale". http://www.georgiaaquarium.org/exploreTheAquarium/webcam-beluga.aspx. Retrieved 2008-10-12. 
  13. ^ Cosens, S. & Dueck, L. (June 1990). "Spring Sightings of Narwhal and Beluga Calves in Lancaster Sound, N.W.T". Arctic 31 (2): 1–2. http://pubs.aina.ucalgary.ca/arctic/Arctic43-2-127.pdf. 
  14. ^ "Delphinapterus leucas: Beluga Whale". Marine Bio. http://www.marinebio.org/species.asp?id=159. Retrieved 2008-08-26. 
  15. ^ "The Story of Navy Dolphins". PBS. http://www.pbs.org/wgbh/pages/frontline/shows/whales/etc/navycron.html. Retrieved 2008-10-12. 
  16. ^ "Wal Rettet Ertrinkende Taucherin!". http://www.blick.ch/news/ausland/wal-rettet-ertrinkende-taucherin-124805. Retrieved 2009-09-27. 
  17. ^ Christine Lepisto (02 August 2009). "Beluga Whale Saves Diver". http://www.treehugger.com/files/2009/08/amazing-beluga-whale-rescues-diver.php. Retrieved 2010-08-31. 
  18. ^ Portrait of endangered beluga whales in Quebec
  19. ^ J Great Lakes Res.,19 & Arch. Environ. Contam. Toxicol.,16 & Sci. Total Environ.,154
  20. ^ Dierauf, L. & Gulland, F. (2001). CRC Handbook of Marine Mammal Medicine. CRC Press. p. 26, 303, 359. ISBN 0849308399. 
  21. ^ Dierauf, L. & Gulland, F. (2001). CRC Handbook of Marine Mammal Medicine. CRC Press. p. 316–317. ISBN 0849308399. 
  22. ^ "The IUCN Red List of Threatened Species". International Union for Conservation of Nature and Natural Resources. http://www.iucnredlist.org/apps/redlist/details/6335/0/full. Retrieved 2008-10-17. 
  23. ^ "Endangered and Threatened Species; Endangered Status for the Cook Inlet Beluga Whale". National Oceanic and Atmospheric Administration. 2008-10-22. http://www.nmfs.noaa.gov/pr/pdfs/fr/fr73-62919.pdf. Retrieved 2009-08-26. 
  24. ^ Herbert, H. Josef (October 17, 2008). "Government declares beluga whale endangered". Associated Press. http://ap.google.com/article/ALeqM5gJx0IzvRt6GWrUBb90Foe4URCGagD93SD0DO0. Retrieved 2008-10-17. 
  25. ^ Angliss and Outlaw 2007.

Further reading

  • Outridge, P. M., K. A. Hobson, R. McNeely, and A. Dyke. 2002. "A Comparison of Modern and Preindustrial Levels of Mercury in the Teeth of Beluga in the Mackenzie Delta, Northwest Territories, and Walrus at Igloolik, Nunavut, Canada". Arctic. 55: 123–132.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Brennin et al. (1997) examined mtDNA variation in North American populations and detected two distinct groups, one occurring primarily from the St. Lawrence estuary and eastern Hudson Bay and the other primarily in western Hudson Bay, southern Baffin Island, western Greenland, the Canadian High Arctic, and the eastern Beaufort Sea

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!