Articles on this page are available in 1 other language: Spanish (16) (learn more)

Overview

Brief Summary

Description

"Dall’s porpoises are highly acrobatic and are often seen swimming at high speed, darting to and fro, riding the bow waves of boats and engaging in slow rolls at the surface. Because they are black and white, boaters sometimes misidentify them as killer whales. They are small cetaceans, with robust bodies and small heads, flukes, and flippers. Reproductively, they differ from many cetaceans by breeding annually, calving in June or July and mating soon thereafter. This means females are nursing young while pregnant with next year’s offspring. A calf often stays with its mother until the next one is born. Females favor certain areas of the ocean for calving; at calving time, most males, juveniles, and females without offspring stay farther south. Dall's porpoises have very tiny teeth: each tooth is about the size of a grain of rice. They feed on a great variety of prey, from squid to deepwater fish to small schooling fish, which they swallow whole."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: True, F.W., 1885.  On a new species of porpoise, Phocaena dalli, from alaska, 8:95.  Proceedings of theU.S. National Museum, 8:95-98.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Dall's porpoises are found only in the northern North Pacific Ocean and adjacent seas (Bering and Okhotsk seas, and Sea of Japan). They inhabit deep waters between about 30°N and 62°N (Jefferson 1988; Houck and Jefferson 1999), but may occasionally occur as far south as about 28°N off the coast of Baja California (Mexico), during unusually cold-water periods.

The dalli-type occurs throughout of the species’ range, from the west coast of North America to Japan.

The truei-type, identified by a broad lateral white patch, inhabits the western north Pacific, and migrates between wintering grounds off the Pacific coast of northern Japan and summer breeding grounds in the central Okhotsk Sea, and constitutes one population (IWC 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Dall's porpoises, Phocoenoides dalli, are cool water porpoises inhabiting the North Pacific Ocean and adjacent seas. The central Bering Sea marks the northern boundary of their range and, although they prefer colder water, Dall's porpoises are found in the warmer waters of Baja California on the east to southern Japan on the west. They are frequently observed in these lower latitudes during the winter months. There are potentially two subspecies of Dall's porpoises, although they may simply be color morphs, P. dalli dalli and P. dalli truei. Phocoenoides dalli truei is abundant only off the Pacific coast of northern Japan.

Biogeographic Regions: pacific ocean (Native )

  • Klinowska, M. 1991. Dolphins, Porpoises and Whales of the World. Gland, Switzerland: IUCN.
  • Reeves, R., S. Leatherwood. 1994. Dolphins, Porpoises and Whales. Gland, Switzerland: IUCN.
  • Genther, K. 2000. "Dall's porpoise (Phocoenoides dalli): The difference between the subspecies" (On-line). Accessed March 08, 2004 at http://www.fish.washington.edu/AcademicSite/cap/projects/guenther/.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: North Pacific: infrequent north of 62 degrees North in Bering Sea; in west, north of Choshi and east-central Honshu, Japan, and in the Sea of Japan and southern Okhotsk Sea; in east, north from about 28 degrees north (usually north of 32 degrees North). TRUEI morph is most abundant off the Pacific coast of northern Japan and off the Kuril Islands.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Dall's porpoises are the largest of the phocoenids. They typically reach a length of 1.8 to 2.0 meters, rarely more than 2.2 meters. At birth, the length is between 0.85 and 1.0 meters. Weight in adults varies from 130 to 220 kilograms. The body is stocky and more powerful than other members of Phocoenidae. The head is small and lacks a beak although there is a sloping forehead. The flippers are small, pointed, and located near the head. The dorsal fin is triangular in shape with a hooked tip.

There are three color patterns observed in the Dall's porpoises. The first is a uniform black or white throughout the entire body. The second pattern consists of intermixed stripes of black and white running along the length of the body. Finally, there is the most common color pattern observed, that of P. dalli dalli. This is defined as having a dorsal area uniformly black with a white ventral side. The white ventral patch begins far behind the flippers. The dorsal fin, flippers, and fluke are black with some white at the tips. The color pattern of P. dalli truei is different only in the distribution of the white ventral patch. The white patch begins ahead of the flippers rather than far behind them, and P. dalli truei is often longer and slimmer than P. dalli dalli.

Range mass: 130 to 220 kg.

Range length: 2.2 (high) m.

Average length: 1.8-2.0 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 2200 cm

Weight: 220000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: up to 2.2 m males; up to 2.1 m females

Weight:
Range: up to 210 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits mainly offshore deep waters colder than 18°C (Miyashita and Kasuya 1988), but may also occur in narrow channels and fjords in the western North Pacific (Jefferson 1988; Rice 1998).

Sex-biased dispersal is known to occur in this species, and this may have relevance in assessing the impact of takes on regional populations (Escorza Trevino and Dizon 2000).

Dall's porpoises are apparently opportunistic feeders, taking a wide range of surface and midwater fish and squid, especially soft-bodied species like lanternfish (myctophids) and gonatid squid. Occasional krill, decapods, and shrimps found in porpoise stomachs are not considered normal prey (Houck and Jefferson 1999; Jefferson 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Generally the colder waters of the North Pacific are home to Dall's porpoises. They are observed inshore and offshore. They are a deep water species, so when they approach the coast they usually follow canyons or deep channels. They are also commonly observed in sounds and inland passages where these meet the open sea.

Habitat Regions: temperate ; polar ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

in deep waters, warm temperate to subarctic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4703 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1700 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 3.149 - 16.669
  Nitrate (umol/L): 0.142 - 16.473
  Salinity (PPS): 30.381 - 33.496
  Oxygen (ml/l): 5.634 - 7.757
  Phosphate (umol/l): 0.330 - 1.734
  Silicate (umol/l): 1.436 - 35.231

Graphical representation

Temperature range (°C): 3.149 - 16.669

Nitrate (umol/L): 0.142 - 16.473

Salinity (PPS): 30.381 - 33.496

Oxygen (ml/l): 5.634 - 7.757

Phosphate (umol/l): 0.330 - 1.734

Silicate (umol/l): 1.436 - 35.231
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Sounds, inland passages, nearshore regions (usually in deep water), and the open sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Details of migrations are poorly known. Year-round resident thoughout much of range, but generally moves north for summer, south for winter. Migrations into Bering Sea may occur spring though fall. Inshore movements may augment populations off California in winter and spring (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Dall's porpoises apparently feed at night and depend to some degree on the deep scattering layer, that is the fauna which travels upwards each night from the deeper parts of the ocean's water column. Food species as determined from stomach contents include squid and other cephalopods, lanternfish, Pacific hake, jack mackerel, herring, sardines, and crustaceans. Dall's porpoises are thought to be capable of deep diving because mesopelagic, bathypelagic, and deep-water benthic species are represented in the diet.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats squid, crustaceans, and various fishes (saury, hake, herring, jack mackeral, and mesopelagic, bathypelagic, and deep-water benthic species) (Leatherwood and Reeves 1983). Feeds mainly on epi- and meso-pelagic squids and small schooling fishes (Jefferson 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Dall's porpoises are important predators of fish and cephalopods in the ecosystems in which they live.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Killer whales and sharks are believed to be the primary natural predators of Dall's porpoises. They largely escape predation through their large body size, agility in the water, and their habit of traveling in groups. Their coloration may make them difficult to see in the water as well.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Phocoenoides dalli preys on:
Actinopterygii
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population estimates range from several hundred thousand to over 2 million, but these figures indicate only the general order of magnitude of the population (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually travels in groups of 10-20 (also reported as 2-12), though aggregations of at least 200 (or thousands) have been reported. Frequently in association with Pacific white-sided dolphins or pilot whales (Leatherwood and Reeves 1983, Jefferson 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

As in most phocoenids, Dall's porpoises use a form of echolocation to navigate, capture prey, and perhaps to communicate with conspecifics. They also use a variety of audible clicks and whistles. They may also use touch for social communication.

Communication Channels: tactile ; acoustic

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Feeding apparently mainly nocturnal (Jefferson 1988).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of a Dall's Porpoise is 16-17 years.

Average lifespan

Status: wild:
16-17 years.

Average lifespan

Status: wild:
22.0 years.

Average lifespan

Status: wild:
17.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22 years (wild) Observations: Average longevity is around 16-17 years (Margaret Klinowska 1991). Maximum longevity is probably underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Little is known about mating in cetaceans, especially in species which occur primarily offshore. Mating systems in Dall's porpoises are unknown.

Little is known about the reproductive biology of Dall's porpoises. Two calving periods have been reported for portions of the eastern North Pacific, one in winter, from February through March, and the other in summer, from July through August. Some segregation of animals seems to occur with juveniles found closer to shore and larger adults well offshore. In offshore areas, females in late pregnancy or lactation seem to be distributed in northern areas, and southern areas are mainly occupied by males and females not accompanied with calves. This seems to indicate that not all females become pregnant every year. Females usually reach sexual maturity between the age of 3 to 6 years, whereas males reach sexual maturity between the ages of 5 to 8 years. Gestation is believed to last about 11 months, and lactation periods are usually about 2 years.

Phocoenoides dalli dalli appear to have three major breeding grounds. Two occur in the North Pacific north of 45 degree latitude, and another breeding site occurs in the central Bering Sea. Phocoenoides dalli truei may breed off the northern coast of Japan.

Breeding interval: Individual females probably do not breed every year. Breeding intervals may be as long as 3 to 4 years because of the length of dependence of calves.

Breeding season: Mating is likely to occur after the calving seasons each year which occur in winter, from February to March, and in summer, from July to August.

Average gestation period: 11 months.

Average weaning age: 24 months.

Range age at sexual or reproductive maturity (female): 3 to 6 years.

Range age at sexual or reproductive maturity (male): 5 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average gestation period: 347 days.

Average number of offspring: 1.

Females feed and care for their offspring for extended periods of time. It is likely that some form of extended learning occurs during this period as well. Male parents do not contribute parental care.

Parental Investment: no parental involvement; precocial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Klinowska, M. 1991. Dolphins, Porpoises and Whales of the World. Gland, Switzerland: IUCN.
  • Reeves, R., S. Leatherwood. 1994. Dolphins, Porpoises and Whales. Gland, Switzerland: IUCN.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Single calf is born mainly late June-September, though births may occur year-round in the eastern North Pacific. Gestation estimates: 7-9 months, 11.4 months. Calves nurse for a few months. Not all adult females become pregnant every year; nonbreeders may segregate from breeders. Males are sexually mature at 5-8 years, females at 3-7 years, depending on location. Most live less than 13 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phocoenoides dalli

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNTCTATATCTACTATTTGGTGCCTGGGCAGGAATAGTAGGTACCGGCCTAAGCTTATTAATCCGCGCTGAATTAGGTCAACCCGGCTCACTTATTGGAGATGACCAAATCTATAACGTATTAGTAACAGCTCACGCTTTCGTAATAATCTTCTTTATAGTGATACCCATTATAATTGGAGGATTTGGGAACTGACTAGTTCCCTTAATAATTGGAGCCCCTGATATGGCATTCCCTCGTCTAAACAACATGAGCTTCTGACTACTTCCTCCCTCTTTCCTATTACTAATAGCATCCTCCGTAGTTGAAGCCGGTGCAGGCACAGGCTGAACCGTATACCCCCCTCTAGCAGGGAACCTAGCACATGCAGGGGCCTCAGTGGATCTTACCATTTTCTCCCTACATCTAGCCGGAGTGTCTTCAATCCTTGGGGCTATTAATTTCATCACAACTATCATCAACATAAAACCACCTGCTATAACCCAATACCAAACACCTCTTTTCGTGTGATCAGTCCTAGTTACAGCGGTATTACTTTTATTATCACTACCTGTCCTAGCAGCCGGAATTACCATACTATTAACCGACCGAAATCTAAATACAACTTTCTTTGACCCTGCAGGAGGGGGCGATCCTGTCCTATATCAGCACTTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phocoenoides dalli

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Justification
The species is widespread and abundant, with current range-wide population estimates of more than one million animals. The species was killed in high-seas driftnet fisheries operations during the 1970s and 1980s, but these fisheries have now been banned, and by-catch levels were not considered sufficiently high to cause population declines. While incidental and directed takes in Japanese coastal waters as well as incidental takes in Russian waters are ongoing (with combined removals on the order of 20,000 annually), neither threat is likely to have caused a range-wide decline sufficient to warrant listing in a category of threat.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dall's porpoises are not directly exploited in the eastern Pacific, but serious conservation problems are centered in the western Pacific where, during the 1980's, Dall's porpoises were intensely hunted. Estimates suggested 40,367 Dall's porpoises were killed in 1989 from the Japanese hand-harpoon fishery alone. In recent years these numbers have declined because of the Japanese government's effort to regulate the hand-harpooning of these animals. In 1992 11,403 were killed. This species is often killed accidentally in the Japanese seas and off of North America by drift nets set for salmon. It has been estimated that up to 20,000 porpoises are entangled and drowned in these nets off of Japan and up to about 4,100 off of North America annually. Due to international negotiations between Japan and the United States, along with new fishing gear and techniques, the incidental take has been reduced drastically. However, the conservation of Dall's porpoises remains a major issue.

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Dall’s porpoises are common in many parts of the North Pacific, and density is high in many areas of the range. The total abundance of the species is probably over 1.2 million individuals (Buckland et al. 1993). In Alaska, the abundance is estimated at 83,400 (CV=10%) (Angliss and Outlaw 2005). Along the U.S. west coast, abundance estimates have ranged from about 35,000 to 134,000, averaging 86,000 animals (CV = 45%) between 1991 and 2005 (Barlow and Forney, in press). In the western North Pacific, the truei-type population migrating between the Pacific coasts of Japan and the central Okhotsk Sea is estimated at 217,000 (CV=0.23). The dalli-type population migrating between the Sea of Japan and the southern Okhotsk Sea is estimated at 226,000 (CV=0.15), and the dalli-type population summering in the northern Okhotsk Sea at 111,000 (CV=0.29) (IWC 1998). These estimates are subject to biases due to response to survey vessels.

The International Whaling Commission currently recognizes 11 populations of this species, based on differences in genetics, pollutant loads, parasite faunas, and distribution patterns of cow/calf pairs (IWC 2002). Three of them summer in the Okhotsk Sea, two in the Bering Sea, four in the North Pacific, and two off the US coast, but the wintering grounds are unknown for many of them. The populations cannot be reliably distinguished by their external appearance at sea except for the three summering in the Okhotsk Sea, which are distinguishable based on the pigmentation and location.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The largest threats to this species have been incidental takes by salmon and squid drift net fisheries and direct takes by hand harpoon fishery in Japanese coastal waters. The driftnet salmon fisheries began in 1952 and continued until a United Nation moratorium on all high-seas driftnet fisheries came into effect (Reeves et al. 2003). The large-mesh and squid driftnet fisheries operated throughout the central and western North Pacific between about 35˚N and 47˚N, increasing in effort during the 1970s and peaking during the 1980s prior to the moratorium. Bycatch estimates are only available for 1989-1990, when about 4,000 Dall's porpoise were estimated killed per year (Hobbs and Jones 1993). During the 1970s and 1980s, the combined high-seas driftnet fisheries likely killed tens of thousands of Dall's porpoise, but this level would not have been high enough to cause population declines (Hobbs and Jones 1993). The estimated annual take by Japanese salmon fisheries within the United States EEZ for the period 1981-1987 ranged from 741 (1987) to 4,187 (1982), with lower levels of additional takes in Bering Sea waters outside of the U.S. EEZ (IWC 1991; T. Jefferson pers. comm.).

Incidental catches on the order of thousands of porpoise per year are ongoing in several fisheries using gillnets in the Russian exclusive economic zone (Burkanov and Nikulin 2001). Small numbers of Dall's porpoises are also taken along the US West Coast in drift net and trawl fisheries (Carretta et al. 2006).

The Japanese hand harpoon fishery for Dall’s porpoise started in the 1910s (Ohsumi 1972; Sawadate 1983), made a great expansion around the World War II period (Wilke et al. 1953; Sawadate 1983), then remained lower at between 5,000 and 10,000 individuals until the 1970s (Kasuya 1982). Approximately 111,500 Dall’s porpoises were removed by hunting between 1986 and 1989 from two stocks centred in the Okhotsk Sea (IWC 1991). The Japanese government began to regulate the hand-harpoon hunt in 1989, and a catch quota was introduced in 1993. The fishery currently operates with a quota of 9,000 dalli-type Sea of Japan-southern Okhotsk Sea population and 8,700 truei-type Pacific coast-central Okhotsk Sea population (IWC 2002). The current level of reported takes are about 4% of the mean estimate of the size of the populations; however, these catch statistics might not be reliable (Kasuya 2007).

Environmental contaminants are also thought to be a threat, and high levels of organochlorines may reduce testosterone levels in males and affect calf viability, thereby influencing reproduction and survival (Subramanian et al. 1987, 1988).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Thousands were killed annually in the 1970s and 1980s in the Japanese salmon fishery. Unknown number are taken incidently in squid gillnet fisheries in the western North Pacific. During 1986-1989, in excess of 110,000 were taken directly in Japanese harpoon fishery (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

The long period since the last survey (over 15 years) warrants urgent reassessment of the status of the two subpopulations hunted by the Japanese hand harpoon fishery.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Dall's porpoises have no negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The only direct commercial harvest of Dall's porpoises is a traditional coastal harpoon fishery in Japan which accounts for annual harvests of about 6,000 animals to compensate for the shortage of whale meat. Dall's porpoises contribute to marine ecotourism through their gregariousness and their aquatic antics.

Positive Impacts: food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Through at least the late 1980s, tens of thousands were harpooned annually for human consumption in Japan (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Dall's porpoise

Dall's porpoise (Phocoenoides dalli) is a species of porpoise found only in the North Pacific. It came to worldwide attention in the 1970s when it was disclosed for the first time to the public that salmon fishing trawls were killing thousands of Dall's porpoises and other cetaceans each year by accidentally capturing them in their nets. Dall's porpoise is the only member of the genus Phocoenoides. It was named after American naturalist W. H. Dall.

Contents

Physical description [edit]

Dorsal view of a Dall's porpoise

The unique body shape of Dall's porpoise makes it easily distinguishable from other cetacean species. The animal has a very thick body and a small head. The colouration is rather like that of a killer whale; the main body of the porpoise is very dark grey to black creeper, with very demarcated white patches on the flank and belly. The dorsal fin is set just back from the middle of the back and sits up erect. The upper part of the dorsal fin has a white to light grey "frosting".

The fluke has a similar frosting. The adult fluke curves back towards the body of the animal, which is another distinguishing feature. It is larger than other porpoises, growing up to 2.3 m (7.5 ft) in length and weighing between 130 and 220 kg (290 and 490 lb).[3] There is also sexual dimorphism in the species, with males being larger, having a deeper caudal peduncle and a pronounced hump behind the anus.[3] Young Dall's have a greyish tint and dark-colored flukes.

Population and distribution [edit]

A Dall's porpoise on a calm day in the Shelikof Strait

Dall’s porpoise ranges through much of the North Pacific and nearby seas, such as the Bering and Okhotsk Seas and the Sea of Japan. The southernmost part of its range is southern Japan in the west and southern California in the east, while it is northernmost range is the central Bering Sea.[4] They do enter Scammon's Lagoon in Baja California, though, when the waters are unseasonably cold.[5] They also travel up to the Chukchi Sea, though very rarely.[4]

Dall’s porpoise prefers cold waters more than 180 metres (590 ft) deep .[3] It is found over the continental shelf adjacent to the slopes and oceanic waters.[6] While it mostly lives in offshore waters, it does occur in deep coastal waters on off North America.[4] There, it typically stays close to deep-water canyons.

Two consistent and well-defined colour morphs, the dalli-type and the truei-type, have been identified. The dalli-type is present throughout the porpoise’s range, while the truei-type lives mostly on the western Pacific and is rare in the east.[3] There is some question as to whether the morphs are merely colour patterns (the truei-type having a more extensive belly patch) or whether they are separate subspecies.[5].[7] They are believed to number around 104,000 off Japan, 554,000 in the Okhotsk Sea, 83,000 off Alaska and 100,000 off the continental US.[4]

Ecology and lifestyle [edit]

Dall's porpoise in Prince William Sound causing a "rooster tail"

Dall’s porpoises primarily eat small fishes(of numerous species) and cephalopods.[4] Schooling fish, such as herrings, anchovies, pilchards, mackerels, hake and sauries[3][4] are favored prey, as well as mesopelagic fish such as myctophids and deep sea smelts.[4] They may also consume krill, but these are probably not important in their diet.[4] Dall’s porpoise are also deep divers. They have been recorded to dive to 94m.[8] Dall’s porpoise are prey to killer whales and white sharks. They also are susceptible to certain parasites. The trematode fluke Nastitrema, an internal parasite, is known to cause death and stranding of the porpoises.[4] External parasites of the porpoise are whale lice.

A group of Dall's porpoises near Point Reyes

Dall's porpoises are highly active creatures. They will often zigzag around at great speed on or just below the water surface, creating a spray called a "rooster tail". They may appear and disappear quite suddenly. The fastest of all small cetaceans, Dall's porpoises can swim at up to 55 km/h, almost as fast as the killer whale. The porpoises will approach boats and will bow- and stern-ride, but may lose interest, unless the boat is travelling quickly. They will also "snout ride" on waves made by the heads of large whales.[4] They may also do more calm behaviors, such as subdued rolls at the surface.[4] They rarely leap from the water.[4]

Dall’s porpoises live in small, fluid groups of two to 12.[3] However they can gather in the hundreds when feeding.[3] They have a polygynous mating system in which males will guard females in estrus.[9] During the mating season, a male will select a fertile female and guard her to ensure that he will sire her calf.[9] While guarding, males may sacrifice opportunities to forage in deep dives.[9] Births usually take place in the summer.[4] Porpoise gestation lasts 10 to 11 months, and the lactation period lasts at least two months.[3] Depending on their condition, females can give birth up to every year.[3] Dall's porpoises live for up to 15 years.

Dall's porpoises at market in Japan

One study[10] determined through DNA sequencing that a fetus found in British Columbia was an intergeneric hybrid of a Dall's porpoise and a harbour porpoise. This hybrid may not be rare— it may describe the origins of some atypically coloured individuals that otherwise appear to be Dall's porpoises spotted off the coast of Vancouver Island.

Conservation status [edit]

Many Dall's porpoises are killed each year as by-catch in fishing nets.[citation needed] A serious cause of concern is the hunting of the species by harpoon by Japanese hunters[citation needed]. The number of porpoise caught each year rose dramatically following the moratorium on hunting larger cetaceans introduced in the mid-1980s. The greatest number were caught in 1988, when more than 40,000 were taken. International attention to the hunt through a 1990 International Whaling Commission (IWC) resolution resulted in a reduction in numbers caught; however, around 15,000 animals are still caught each year, making it the largest direct hunt of any cetacean species in the world. The hunt has been repeatedly criticized by the IWC and its Scientific Committee, most recently in 2008.[11] A quota of just over 16,000 individuals per year is now in effect. In addition, unknown numbers of animals are struck and lost or caught as by catch. Despite these threats, Dall's porpoise remains a fairly common species with productive populations.

Dall's porpoise is listed on Appendix II[12] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II[12] as it has an unfavorable conservation status or would benefit significantly from international co-operation organized by tailored agreements.

See also [edit]

References [edit]

  1. ^ Mead, J. G.; Brownell, R. L., Jr. (2005). "Order Cetacea". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 723–743. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Phocoenoides dalli. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 7 October 2008.Database entry includes a lengthy justification of why this species is of Least Concern
  3. ^ a b c d e f g h i Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  4. ^ a b c d e f g h i j k l m Thomas A. Jefferson. "Dall's porpoise Phocoenoides dalli" pp. 296-298 of Encyclopedia of Marine Mammals (edited by William F. Perrin, Bernd Wursig, and J. G.M. Thewissen), Academic Press; 2nd edition, (2008).
  5. ^ a b Morejohn, GV (1979). The natural history of Dall's porpoise in the North Pacific Ocean. In "Behavior of Marine Animals", Vol. 3, "Cetaceans" (Eds HE Winn and BL Olla) pp. 45-83. Plenum Press, New York
  6. ^ Hall, J. 1979. A survey of cetaceans of Prince William Sound and adjacent waters - their numbers and seasonal movements. Unpubl. rep. to Alaska Outer Continental Shelf Environmental Assessment Programs. NOAA OCSEAP Juneau Project Office, Juneau, AK. 37 pp.
  7. ^ S. Escorza-Treviño, L. A. Pastene and A. E. Dizon. (2004). "Molecular Analyses of the Truei and Dalli Morphotypes of Dall's Porpoise (Phocoenoides dalli)", Journal of Mammalogy, 85(2): 347-355.
  8. ^ Hanson, M.B., and R.W. Baird. 1998. "Dall’s porpoise reactions to tagging attempts using a remotely-deployed suction-cup attached tag". Marine Technology Society Journal 32(2):18-23.
  9. ^ a b c Willis P. M., Dill L. M. (2007). "Mate Guarding in Male Dall's Porpoises (Phocoenoides dalli)". Ethology 113(6): 587-597.
  10. ^ *An intergenetic breed in the family Phocoenoidae, Canadian Journal of Zoology, Baird, Willis, Guenther, Wilson and White 1998. Vol 76 pages 198-204.
  11. ^ "Report of the Sub-Committee on Small Cetaceans". 7.6: International Whaling Commission. June 2008. p. 10. Retrieved March 2010. 
  12. ^ a b "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The taxonomic status of the two morphologically distinct forms of Dall's porpoises, Phocoenoides dalli (dalli- and truei-type), has been uncertain. A neighbor-joining tree of mtDNA haplotypes presented by Escorza-Trevino et al. (2004) showed 2 distinctive clades, each containing individuals from both types. According to Escorza-Trevino et al., "This suggests that truei- and dalli-types are forms of the same species. However, at the population level, statistically significant genetic differentiation was found between truei-type and sympatric dalli-type populations. These results argue that differentiation between truei- and dalli-types is at the population level, much in the same way that dalli-type populations differ among each other."

Rice (1998) and Mead and Brownell (in Wilson and Reeder 2005) recognized dalli and truei as subspecies.

See Winans and Jones (1988) for information on genetic relationships among populations in the North Pacific and Bering Sea. Based on calving grounds, there may be at least six stocks of dalli-type and one stock of truei-type in the North Pacific (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!