Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Biology

Harbour porpoises live either solitarily or in groups, normally of three to five individuals, although sometimes more. Normally individual porpoises or couples (mother and calf) are observed and high numbers can be seen during migrations. Like dolphins, the harbour porpoise orientates itself by means of echo-sounding or ‘sonar’. It has a particular way of swimming with a ‘rolling’ movement (imagine a turning wheel); part of the back, including the dorsal fin surfaces briefly before re-entering the water giving the appearance of a rotating motion. This movement will normally be repeated three to four times, prior to a long dive. 

 The diet of an adult harbour porpoise is made up of various pelagic and demersal fish, as well as invertebrates. In the Southern North Sea, it consists mainly of small benthic fish, herring, cephalopod, whiting and cod. A daily meal would normally consist of about 5 kilos fish (around 10% of the body

Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Taxonomy

Morphology
Phocoena phocoena, the harbour porpoise
  • is a stocky, rotund animal with a broad-based, low, triangular dorsal fin and small, oval pectoral flippers.
  • has a short-beaked head with a dark line that runs from the back of the mouth to the leading edge of the dorsal fin.
  • has a comparatively thick layer of blubber which varies in thickness over the body. Blubber thickness can also be affected by nutritional status.
  • are very dark grey to black on their back, becoming speckled/intermediate on their sides and white on their underside.
  • has straight mouth-line slopes upwards towards the eye (Jefferson et al, 2008).
  • tail flukes are defined by a deep median notch, have concave trailing edges and rounded tips (Watson, 1981).
  • has 19-28 teeth in each tooth row (Jefferson et al, 2008). Each tooth has a cylindrical ‘neck’, flattened into a spatulate form at the tip.
  • tongue has finger-like extensions around its edge known as marginal lingual papillae. These are age-related structures helping to seal the mouth during suckling and then aiding the eating of solid food whilst excluding seawater following weaning (Natural History Museum, 2002).


Phylogeny
Four subspecies are recognized (IUCN, 2009):
  • Phocoena. p. phocoena in the North Atlantic
  • Phocoena. p. vomerina, in the eastern North Pacific
  • Phocoena. p. relicta in the Black Sea (Reeves and Notarbartolo di Sciara 2006)
  • An un-named subspecies in the western North Pacific (Rice, 1998)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Large numbers of harbor porpoises are caught in fishing nets, because the porpoises feed on schooling fish such as herring and mackerel, in relatively shallow coastal waters. They are also affected by increasing pollution in coastal waters, and are considered vulnerable or threatened in many parts of their range. They are social, and feed in groups, working their way northward to spend the summer in cooler waters and back south as far as Los Angeles, in the Pacific, and the Carolinas or even Florida, in the Atlantic, for the winter. These small, stocky animals breed when they are 3-5 years old. Females nurse their calves for about 9 months. The stomachs of 4-5 month old juveniles killed in gillnets contained both milk and solid food, which indicates that they were beginning to feed themselves.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:77, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

A social species, the harbour porpoise travels in groups numbering between two to five individuals (2), but larger groups may form during migration (4). It feeds on a variety of fish, including herring, mackerel and anchovy (2), a variety of invertebrates are also taken (4). It is known that echolocation is used in the detection and capture of prey, but this is not yet fully understood. Sight and passive listening (for the sounds made by prey) are also important during hunting (7). Mating occurs in summer, and gestation (pregnancy) takes 11 months (4). The calf is suckled for up to eight months and sexual maturity is reached at about four years of age (4). The harbour porpoise has possibly the shortest life-span of any cetacean; they rarely live for more than 12 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Size
Harbour porpoises species vary in size across a geographical range, with males generally being slightly smaller than females of the same age.Adult length averages 1.4 metres with a maximum of 1.8 metres. Adult weight averages about 41kg. Calves are about 75cm long at birth, with an average weight of 5kg (Watson, 1981).

Life expectancy
Maximum longevity is reported as 24 years in the United Kingdom (Lockyer, 1995b), but most do not live beyond 10 years (Jefferson et al, 2008).

Reproduction
The species matures very quickly, with females being able to reproduce at around 14 months old, and males at around 3 years (Watson, 1981).Reproduction is extremely seasonal in all populations of harbour porpoises, with ovulation and conception occurring in spring or summer (Read, 1999).Gestation is 10-11 months, calves are nursed for around 8-12 months and females may become pregnant again the following season (Watson, 1981; Jefferson et al, 2008).

Predation
White sharks and killer whales are the two major predators of harbour porpoises (Read, 1998).In some areas, harbour porpoises have been taken heavily by humans, with their meat being used for human and animal consumption, and their oil for lamps and lubricants (Nowak, 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

Phocoena phocoena the harbour porpoise is found in cool temperate to sub-polar waters in the northern hemisphere. There are an estimated 700,000 harbour porpoises globally, therefore the species is not currently a major conservation concern.Porpoises are difficult to approach and follow, generally avoiding boats and other human activity. Though fast swimmers, they are not acrobatic, rarely breaching or leaping. They make brief dives, usually lasting for less than five minutes. They will often lie motionless at the surface on calm days, either resting or scanning the water below (Watson and Gaskin, 1983). Dive depths in excess of 200 metres have been recorded (Westgate et al, 1995).Hunting and exploitation by humans, exposure to environmental contaminants and incidental capture in fishing nets are the main threats to the harbour porpoise (Jefferson et al, 2008).The Natural History Museum, London, is part of a government-funded collaborative UK research group gathering data on strandings. These data help inform conservation policy makers at both UK and EU level (NHM strandings website, UKCSIP website). They are the most frequently stranded of all cetacean species in UK waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Phocoena phocoena is a small cetacean with a blunt short beaked head. It exhibits counter-shading with the animal being generally dark grey on the back and white on the belly. A short, wide-based, triangular dorsal fin, with small bumps on the leading edge is situated midway along the back. The flippers are dark, small and rounded at the tips. The straight mouth line is dark and slopes upwards towards the eye.Phocoenids appear to live in smaller groups and have a simpler social structure than most delphinids. Most harbour porpoise are found in small groups consisting of less than 8 individuals but occasionally form large, loose groups of 50 to several hundred for feeding and migration. 

The harbour porpoise is listed on Appendix II of CITES and Appendix II of the Bern Convention and Annexes II and IV of the EC Habitats Directive. It is also on Appendix 2 of the Bonn Convention (Anon, 1999z). All species of cetaceans are given protection under the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Order 1985 (Anon, 1999z). All cetacean species are listed on Annex IV (Animal and Plant Species of Community Interest in Need of Strict Protection) of the EC Habitats Directive (Anon, 1999x). All whales are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES Appendix I thus prohibiting their commercial trade (Anon, 1999x). Whaling is illegal in UK waters (Fisheries Act 1981), but neighbouring countries maintain the right to hunt (Anon, 1999x). An 'Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas' (ASCOBANS), formulated in 1992, has now been signed by seven European countries, including the UK. Under the Agreement, provision is made for protection of specific areas, monitoring, research, information exchange, pollution control and heightening public awareness. Although aimed primarily at dolphins and porpoises, ASCOBANS includes all toothed whales except the sperm whale (Anon, 1999x).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The harbour porpoise is the most commonly seen porpoise (2), and is the most widely distributed of all cetaceans (whales and dolphins) in northern Europe (4). It is easily recognised as it has a low triangular dorsal fin and lacks a beak (2). It is small in comparison to other porpoises, has a plump body with a dark grey to bluish coloured back, a pale belly and a rounded head (5). At birth, young harbour porpoises are dull in colour and typically have 'birth lines', which look like folds in the skin, and persist for the first few hours after birth (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Distribution

Arctic Ocean, Azores Exclusive Economic Zone, Baltic sea, Belgian Exclusive Economic Zone, Black Sea, Blankenberge, Bredene, Bretagne, De Haan, De Panne, Den Helder, Elbe, European waters (ERMS scope), Goote Bank, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of St. Lawrence, Irish Exclusive economic Zone, Kara Sea, Knokke, Koksijde, Mediterranean Sea, Middelkerke, Nieuwpoort, North Atlantic, North Pacific, North Sea, North West Atlantic, Oostende, Polish Exclusive Economic Zone, Schelde estuary, Senegalese Exclusive Economic Zone, Southern Bight, St. Lawrence Estuary, United Kingdom Exclusive Economic Zone, Wenduine, Westende, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

In the Baltic Sea area the historic range apparently included all of the Kattegat/Skagerrak area, the Gulfs of Riga, Finland, and Bothnia, and much of the Baltic Sea proper. However, in the latter half of the 1900s, the range was reduced considerably, and currently porpoises are considered to be virtually absent in the north-eastern Baltic (Koschinski 2002).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Harbour porpoises are found in cold temperate to sub-polar waters of the Northern Hemisphere (Gaskin 1992, Read 1999). They are usually found in continental shelf waters, although they occasionally travel over deeper offshore waters. In the North Pacific, they range from central California and northern Honshu to the southern Beaufort and Chukchi Seas (including the Bering and Okhotsk Seas, and Sea of Japan). In the North Atlantic, they are found from the southeastern United States to southern Baffin Island (they apparently do not enter Hudson Bay) in the west, and from Senegal to Novaya Zemlya in the east. They also occur around southeast and western Greenland, Iceland, and the Faroe Islands, and this is the only cetacean species that currently regularly occupies the Baltic Sea. The species occurs in the Black Sea, Marmara Sea, and Sea of Azov, but with the exception of the adjacent northern Aegean Sea, they do not regularly occur in the Mediterranean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found in coastal regions of the North Atlantic, Arctic, and North Pacific Oceans; also the Mediterranean and Black Sea regions. They are found in bays, estuaries, river mouths, and sometimes ascend further up rivers.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); arctic ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: holarctic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Temperate and ice-free boreal zone of northern hemisphere; summer visitor to the productive fringes of the Arctic Ocean (Gaskin 1992; Suydam and George, 1992, Can. Field-Nat. 106:489-492); isolated population in the Black Sea; south to Senegal in the eastern Atlantic. Has disappeared from parts of the Baltic Sea, the southern North Sea, and portions of the central California coast (see Read et al. 1993). See also IUCN (1991) for distribution information.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northern Hemisphere in the North Atlantic and Pacific Oceans.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in sub-Arctic and cool temperate waters of the North Atlantic and North Pacific (5), the harbour porpoise is typically a species of coastal areas, although it also occurs over most of the European continental shelf (4). In the UK, seasonal concentrations occur between July and October off western and south-western Ireland, west Wales, the west of Scotland, around Shetland and Orkney as well as around north-east Scotland (4). This species used to occur in the south coast of England and southern parts of the North Sea, but it is now rare in these waters (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Phocoena phocoena, also known as the "Common" or "Harbor" Porpoise, is a small cetacean that is 1.5 to 2 meters long and weighs from 45 - 65 kilograms. The female of the species is usually slightly larger than the male. The color of the animal varies from individual to individual, but the most common coloration pattern is a dark dorsal surface that shifts to a lighter colored hue ventrally. Although the dark color is usually black or deep gray, albinos have been reported in which the dark segments are completely or partially white. The flippers, dorsal fin, and tail are all dark in color, and there is a black stripe that runs from the edge of the mouth or eye to the flipper on either side. There is no noticeable forehead or beak on this species, and the snout is short, giving the head a somewhat cone-like shape. P. phocoena has two pectoral flippers, a single dorsal fin, and a tail with two partially separated flukes. All of these appendages are short and not very sharp, with the dorsal fin being triangular shaped and usually around 15 - 20 cm tall. There is a noticeable keel located near the all dark tail flukes, with the tail itself spanning anywhere from 30-65 cm. Inside the slightly upturned mouth there are rows of 16-28 spade-shaped teeth. There is no variance in the shape or type of teeth in P. phocoena.

Range mass: 45 to 60 kg.

Range length: 1.5 to 2 m.

Sexual Dimorphism: female larger

Average basal metabolic rate: 107.675 W.

  • The Porpoise Page, 1998. "Harbor Porpoise" (On-line). The Porpoise Page. Accessed 11/03/04 at http://www.theporpoisepage.com/harbor.php.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size in North America

Sexual Dimorphism: Females are 10%-20% larger than males.

Length:
Average: 1.6 m
Range: "1.5-1.9 m "

Weight:
Average: 50 kg
Range: 45-90 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 1800 cm

Weight: 54000 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: Maximum female 1.89 m, male maximum 1.78 m.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Morphology

The head is blunt. Depending on the light, the back may appear black, grey or brown). The flanks are grey and the underside is white. The pectoral fins are black. A dark line runs from the corner of the mouth to the flipper. The more or less triangular small dorsal fin is positioned in the centre of the back. The upper back and dorsal fin are the only features one normally gets to see of a swimming harbour porpoise. The chief characteristics are its small size, the blunt head and the small triangular dorsal fin.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Morphology

Distinguishing characteristics: Dives without lifting tail. Blow not readily visible. Triangular dorsal fin. Spoon-shaped teeth. Blunt snout. Colour is grey above with white belly.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The Baltic Sea is a semi-enclosed, relatively shallow shelf sea with some deeper basins of more than 200 m depth. There is a gradient in salinity with declining salinity towards east and north. Winter sea-ice normally covers the northern and eastern parts of the Baltic Sea.

In the Baltic Sea and vicinity, herring, sprat, and cod are the main prey items, and many prey species are benthic or demersal (Read 1999, Boerjesson et al. 2003).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Throughout its range, P. phocoena is largely limited to continental shelf waters. They frequent relatively shallow bays, estuaries, and tidal channels less than about 200 m in depth. Carretta et al. (2001) found that the main distribution of porpoises in northern California was in waters of less than 60 m. Dives to at least 220 m have been recorded via telemetry (Bjørge and Tolley 2002, Otani et al. 1998).

Harbour porpoises eat a wide variety of fish and cephalopods, and the main prey items vary regionally (see Smith and Gaskin 1974; Recchia and Read 1989, Fontaine et al. 1994, Gonzales et al. 1994, Aarefjord et al. 1995, Gannon et al. 1998, Read, 1999, Børjesson et al. 2003, Santos et al. 2004, Reeves and Notarbartolo di Sciara 2006). Although small schooling fish (e.g. herring) are important, demersal foraging is characteristic in many areas.

The ecology of Black Sea harbour porpoises may be unusual reflecting the high degree of geographic isolation of their habitat. Low water salinity, seasonal fluctuations of water temperatures and large amounts of anoxic waters below 100-250 m (Reeves and Notarbartolo di Sciara 2006).

Surveys in 1994 and 2005 in the North Sea and adjacent waters have shown a major shift in distribution from northern to southern areas (Hammond et al. 2002, Hammond pers. comm.), a change that is reflect by increased in shore-based sightings (Camphuysen 2004, Thomsen et al. 2006).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Found in both salt and fresh water areas, Phocoena phocoena require a shallow coastal body of water. In the Western Atlantic, they also move far out to sea near the end of summer and reappear in spring. Other regional populations move south or farther away from shore to avoid ice buildups.

Habitat Regions: temperate ; polar ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

cool temperate and subpolar, mostly in shallow water
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

inshore and offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 18628 specimens in 1 taxon.
Water temperature and chemistry ranges based on 6226 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.232 - 27.476
  Nitrate (umol/L): 0.209 - 16.868
  Salinity (PPS): 7.159 - 36.318
  Oxygen (ml/l): 4.672 - 8.091
  Phosphate (umol/l): 0.092 - 1.734
  Silicate (umol/l): 0.987 - 35.231

Graphical representation

Temperature range (°C): 1.232 - 27.476

Nitrate (umol/L): 0.209 - 16.868

Salinity (PPS): 7.159 - 36.318

Oxygen (ml/l): 4.672 - 8.091

Phosphate (umol/l): 0.092 - 1.734

Silicate (umol/l): 0.987 - 35.231
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Coastal waters and adjacent offshore shallows; also inhabits inshore areas such as bays, channels, and rivers. Mothers and young tend to move into sheltered coves and similar sites soon after parturition.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 It can be found in cool temperate and subpolar waters. Usually found in near shore waters, but occasionally over deeper waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cold temperate and subarctic marine waters. Coastal areas; including bays, estuaries, offshore shallows, tidal rivers and channels.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Favours shallow, cold coastal waters (4). Most sightings have been made within ten kilometres of the land. It frequents relatively shallow bays, estuaries, and tidal channels under about 200 kilometres in depth, and will swim a considerable distance up river (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May make seasonal inshore (summer) - offshore (winter) or north (summer) - south (winter) migrations, though movements often are related to movements of prey species (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Diet consists mainly of smooth, non-spiny fish, and cephalopods. Herring, pollack, hake, sardines, and cod are commonly eaten. Other sea creatures such as squid and shrimp are also consumed. P. phocoena produces click-like sounds similar to those used by other cetaceans as a means of echolocation in order to locate food.(Johnston(1999), Nowak(1999))

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats various fishes, squid, and crustaceans. In summer in the Bay of Fundy, adults fed mainly on clupeid and gadid fishes while euphausiids were the most common prey of calves (Can. J. Zool. 70:1629).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthic fish, some pelagic fish species, and some benthic invertebrates.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Comments: Total population for the Gulf of Maine/Bay of Fundy was estimated at 37,500 in 1991, 67,500 in 1992, and 74,000 in 1995 (NMFS 1999). In the 1980s, population from California to Washington was estimated at about 50,000 (Barlow 1987, cited by IUCN 1991). See IUCN (1991) for population estimates for other parts of the range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Social; travels in groups of 2-10, sometimes up to 50 individuals; may segregate by sex and/or age.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution ecology

Distribution
Harbour porpoises are found in cool temperate to sub-polar waters of the northern hemisphere, usually near shore and in shallow water (Jefferson et al, 2008).In the North Pacific, they range from southern California and northern Honshu, Japan, to the southern Beaufort and Chukchi seas (Jefferson et al, 1993).In the North Atlantic, they are found from the southeastern United States to southern Baffin Island in the west, and Senegal, West Africa to Novaya Zemlya in the east (Jefferson et al, 1993).Harbour porpoises do not regularly occur throughout most of the Mediterranean except in the northern Aegean Sea, and represent the only cetacean species regularly found in the Baltic Sea (Jefferson et al, 2008). It is the smallest and most numerous small cetacean found in north-western European continental shelf waters (Reid et al, 2003). It is limited to the continental shelf by its demersal foraging behaviour and diving capacity (Gaskin et al, 1993) and by the presence of concentrated aggregations of prey.Porpoises are extremely mobile, can cover large distances in relatively short periods of time and in some areas, may utilize home ranges that encompass tens of thousands of square kilometres (Read and Westergate, 1997).

Population Biology
In the North Atlantic Ocean (including the Black and Azov seas), fourteen populations are recognized. In the North Pacific, at least ten different stocks occur (Jefferson et al, 2008).

Abundance
Current estimates suggest that the global abundance of the harbour porpoise is around 700,000 animals, with evidence of declining populations in the Baltic and Black Seas (IUCN, 2009).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

Harbour porpoises usually occur in small groups of less than 8-10 individuals, although larger groups of up to several hundred have been recorded (Jefferson et al, 1993; Hoek, 1992). Larger group aggregation may be associated with migration or feeding behaviour (Jefferson et al, 1993). They are rarely found in close association with other cetacean species (Read, A.J., 1999).Porpoises are difficult to approach and follow, generally avoiding boats and other human activity. Though fast swimmers, they are not acrobatic, rarely breaching or leaping. They make brief dives, usually lasting for less than five minutes. They will often lie motionless at the surface on calm days, either resting or scanning the water below (Watson and Gaskin, 1983). Dive depths in excess of 200 metres have been recorded (Westgate et al, 1995).

Feeding
Harbour porpoises feed on a wide variety of fish and cephalopods. Many prey species are benthic or demersal (Jefferson et al, 2008). Prey species vary by location, with small, schooling clupeoid and gadid fishes forming a major part of their diet (Read, A.J., 1999). Harbour porpoises forage independently and seldom use co-operative strategies for concentrating or obtaining prey (Würsig, 1986).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
13.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.4 years (captivity) Observations: These animals rarely live more than 13 years in the wild (Ronald Nowak 1999). One captive specimen was still alive at 20.4 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

It is not clearly known how extensive the mating season is in P. phocoena, but it seems that mating mainly occurs from June to September with births occurring from May to August. It is commonly noted that gestation lasts 11 months with nursing following for another 7 or 8 months. A female will give birth to one calf per year, with the birth size of the calf being 6-8kg and 70-100cm long. Sexual maturity is reached by the fifth year, if not before, and the life span of P. phocoena is believed to be anywhere from 6 to 20 years. (Johnston(1999), Nowak(1999))

Breeding interval: A female will give birth to one calf per year

Breeding season: Mating mainly occurs from June to September

Average number of offspring: 1.

Average gestation period: 11 months.

Range weaning age: 7 to 8 months.

Range age at sexual or reproductive maturity (female): 5 (high) years.

Range age at sexual or reproductive maturity (male): 5 (high) years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 7000 g.

Average gestation period: 320 days.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds in summer. Following a gestation of 10-11 months, a single calf is born between May and early August. Females breed each year. Young weaned in 8 months. In Bay of Fundy, sexually mature in 3-4 years (5-6 years in north Sea). Few live beyond 7-8 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating season takes place from June to August, and gestation lasts for 10-11 months. Calves average 75 cm in length at birth. Calves nurse for about 8 months.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Blubber structure stores and releases energy: porpoise
 

Blubber between the porpoise's dorsal fin and tail flukes decreases amount of metabolic energy needed to swim because it is crosshatched with elastic fibers.

     
  "This study investigated the functional morphology of the blubber that forms the caudal keels of the harbor porpoise (Phocoena phocoena). Blubber is a pliant biocomposite formed by adipocytes and structural fibers composed of collagen and elastic fibers. Caudal keels are dorsally and ventrally placed triangular wedges of blubber that define the hydrodynamic profile of the porpoise tail-stock. Mechanical tests on carcasses demonstrate that when keels are bent, they strain nonuniformly along their lengths, with highest strains just caudal to the dorsal fin and lowest at the insertion of the flukes. Therefore, caudal keels undergo nonuniform longitudinal deformation while maintaining a stable, triangular cross-sectional shape. Polarizing and transmitted light microscopy techniques were used to investigate blubber's 3D fiber architecture along the length of the dorsal keel. The triangular cross-sectional shape of the keel appears to be maintained by structural fibers oriented to act as tensile stays. The construction of the blubber composite is regionally specific: structural fiber densities and diameters are higher in the relatively stiff caudal region of the keel than in the more deformable cranial keel region. The orientations of structural fibers also change along the length of the keel. Cranially, no fibers are oriented along the long axis, whereas a novel population of longitudinally oriented fibers reinforces the keel at the insertion of the flukes. Thus, differences in the distribution and orientation of structural fibers contribute to the regionally specific mechanical properties of the dorsal keel." (Hamilton et al. 2004: 105)
  Learn more about this functional adaptation.
  • Hamilton, J. L.; Dillaman, R. M.; McLellan, W. A.; Pabst, D. A. 2004. Structural Fiber Reinforcement of Keel Blubber in Harbor Porpoise (Phocoena phocoena). Journal of Morphology. 261: 105-117.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phocoena phocoena

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0131-06|AJ554063|Phocoena phocoena| AACCGATGACTATTCTCTACCAACCACAAAGACATTGGTACTCTATACCTACTATTTGGCGCCTGGGCAGGAATAGTAGGTACAGGCCTA---AGCTTATTAATCCGCGCTGAATTAGGTCAACCTGGCTCACTTATCGGAGAT---GACCAAATCTATAATGTACTAGTAACAGCTCACGCTTTCGTGATAATCTTCTTTATAGTAATGCCCATTATAATCGGGGGATTTGGGAACTGACTAGTTCCTTTGATA---ATCGGAGCTCCTGATATAGCATTCCCTCGTCTAAACAACATGAGCTTCTGACTACTTCCTCCCTCTTTCCTATTACTAATAGCATCCTCCGTAGTTGAAGCTGGCGCAGGCACAGGCTGAACCGTATATCCCCCTCTAGCAGGGAATCTAGCACACGCAGGAGCCTCAGTGGATCTC---ACCATCTTCTCCCTACATCTAGCCGGAGTATCTTCAATCCTTGGGGCTATTAACTTCATCACAACTATCATTAACATAAAACCACCTGCTATAACCCAGTACCAAACACCCCTTTTCGTGTGATCAGTCCTAGTTACGGCAGTATTACTCTTATTATCATTACCTGTCCTAGCAGCC---GGTATTACTATACTACTGACCGACCGAAATCTAAATACAACTTTCTTTGACCCTGCAGGAGGGGGCGATCCTGTCCTATATCAACACTTATTCTGGTTTTTTGGCCACCCTGAAGTGTATATTCTAATTCTACCCGGTTTCGGAATAATCTCGCACATCGTAACATACTATTCAGGAAAAAAA---GAGCCTTTTGGGTATATAGGGATGGTATGAGCTATGGTCTCTATCGGTTTCCTAGGTTTTATCGTGTGGGCCCATCACATATTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phocoena phocoena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 30
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Contributor/s

Justification
The current information on abundance provides evidence for a population size of fewer than 250 mature animals in the Baltic Sea subpopulation. A continued decline in mature animals can be inferred based on the current information on bycatches. All individuals in the Baltic Sea population belong to one subpopulation.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D. (Cetacean Red List Authority)

Justification
Although the species is known to be harvested in two areas and regional declines are described, it is widespread and abundant. In some of the major habitats for harbour porpoises (the shelf waters of the USA and Europe) conservation measures are implemented.

History
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although fishing of P. phocoena is now illegal in most areas, the species is still in danger. Deliberate and accidental deaths still occur because modern fishing nets are almost undetectable to porpoises. Since these nets are commonly used in nearshore areas, in the natural range of P. phocoena, they probably kill large numbers of porpoises. Various measures are being taken in the United States and other nations in an attempt to limit deaths of this kind. In addition to deaths related to fishing, porpoises also suffer from chemical and noise pollution. (Dollinger(1988), Johnston(1999), McWilliam(1999), Nowak(1999))

CITES: appendix ii

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status
The IUCN Red List (2009) has the harbour porpoise listed as LC (least concern).The species is currently listed as CITES Appendix II.

Threats
Hunting and exploitation by humans, exposure to environmental contaminants and incidental capture in fishing nets are the main threats to the harbour porpoise (Jefferson et al, 2008).The European Union (EU) has adopted regulations to reduce the incidental catch of small cetaceans in nets in EU waters (IUCN, 2009). Regulations include restricting Baltic Sea drift net fisheries, mandatory use of acoustic deterrent devices in some EU gillnet fisheries in the North and Baltic Seas, and the use of onboard observers on vessels of over 15m in length (IUCN, 2009).The Natural History Museum, London, is part of a government-funded collaborative UK research group gathering data on strandings. These data help inform conservation policy makers at both UK and EU level (NHM strandings website, UKCSIP website). They are the most frequently stranded of all cetacean species in UK waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Natural History Museum, London

Supplier: Natural History Museum

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There is some serious concern over this species and incidental catch and entanglement in gill nets and other fishing gear. The Harbor Porpoise is hunted commercially by 1 country still, and this fishery is relatively small. This species is listed in CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Vulnerable.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) under the IUCN Red List (1). Listed on Annexes II and IV of the EC Habitats Directive, Appendix II of the Bern Convention, and North, Baltic and Black Sea and western North Atlantic populations are listed under Appendix II of the Bonn Convention (the Convention on Migratory Species). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited, the species is also listed on Appendix II of CITES. Covered by the terms of the Agreement on the Conservation of Small Cetaceans of the Baltic and North Seas (ASCOBANS). In the UK all cetaceans are fully protected under Schedule 5 the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

The abundance of the Baltic Sea stock has been estimated at 599 (CV=57%; 95% confidence interval = 200-3,300) (Hiby and Lovell 1996), of which about 50% or 300 would likely be mature (Taylor et al. 2007). Using a precautionary approach (Wade 1998), a minimum abundance estimate of mature animals would be the lower 20th percentile of the abundance estimate of mature individuals, equal to 192. Scheidat et al. (2004) reported that on the Oderbank east of Rügen, Baltic harbour porpoise densities between May and August 2002 were high relative to nearby Mecklenburg and Kiel Bights. There is evidence that porpoises in the Kattegat –Skagerrak area migrate to the North Sea (Teilmann et al. 2004).

Although there are no reliable estimates of pre-exploitation subpopulation size, harbour porpoises were once numerous in the Baltic proper (Kinze 1995).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In the North Atlantic Ocean (including the Black and Azov seas), fourteen population units have been proposed (Donovan and Bjørge 1995), and in the North Pacific, several population units have been identified based on genetic studies (Chivers et al. 2002).

There are no synoptic surveys covering the entire range within ocean basins, but abundance has been estimated for selected portions of the range. Abundance estimates have been summarized by Read 1999 (but see updates in Angliss and Outlaw 2005, Carretta et al. 2006, Waring et al. 2006). About 73,000 animals have been estimated to occur along the west coast of the USA (including 1,656 [CV=0.39] in the Morro Bay population, 1,613 [CV=0.42] in the Monterey Bay population, 8,521 [CV=0.38] from San Francisco to the Russian River, 17,763 [CV=0.39] in northern California and southern Oregon, 39,586 [CV=0.38] in Oregon and Washington, and 3,509 [CV=0.40] in Washington inland waters). In Alaska abundance is estimated at about 89,000 (including 10,947 [CV=0.24] in southeast Alaska, 30,506 [CV=0.21] in the Gulf of Alaska, and 47,356 [CV=0.22] in the Bering Sea) (see summary in Angliss and Outlaw 2005). In the western Atlantic, there are an estimated 75,438 [CV=0.42] in the Gulf of Maine/Upper Bay of Fundy to the entrance of the Gulf of St. Lawrence, and 27,000 for the Gulf of St. Lawrence (Waring et al. 2007). Abundance has been estimated at 27,000 in Iceland (Stenson 2003) and 11,000 [CV=0.44] off North Norway - Barents Sea (Bjørge and Øien 1995). In the waters of the European Atlantic, abundance in 2005 was estimated at 385,600 [CV=0.20] (P.S. Hammond pers. comm.), of which about 335,000 [CV=0.21] were estimated in the North Sea and adjacent waters, where abundance was estimated at 341,000 [CV=0.14] in 1994 (Hammond et al. 2002). The abundance in the Baltic Sea is estimated at 599 (CV = 0.57) (Hiby and Lovell 1996). Line transect surveys have been conducted recently (since 2001) to estimate harbour porpoise abundance in different portions of the Black Sea. These suggest that total population size in the region may be at least several thousand and perhaps as much as 10,000-12,000 (Reeves and Notarbartolo di Sciara 2006).

Taken together, these numbers indicate that the global abundance of the harbour porpoise is at least about 700,000 individuals.

There is evidence of decline in abundance in some areas, e.g. in the Black Sea (Reeves and Notarbartolo di Sciara 2006), in the Baltic Sea (see account for that subpopulation), and in inland waterways of Washington State, USA (Osmek et al. 1996).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

Historically, large commercial catches occurred when porpoises migrated through the Danish Straits, mainly during winter and spring months. Annual catch levels averaged about 1,000 porpoises during most of the nineteenth century, increasing to 2,000 at the end of the century with a subsequent declining trend during the twentieth century until catches increased again in the 1940s. According to Kinze (1995), historical directed catches in the Baltic proper might have been higher than the catches in the Danish Straits.

Today, the most significant threat is incidental catches in fishing nets, primarily various types of gillnets (including both set gillnets and driftnets; Berggren 1994, Koschinski 2002). In addition to gillnets, harbor porpoises are also taken in smaller numbers in trawls (Berggren 1994). The current bycatch, known to be at least seven porpoises per year, is thought to be unsustainable, and Baltic porpoises may become extinct in the near future unless actions are taken to prevent future anthropogenic mortality (ASCOBANS 2000). Skóra and Kuklik (2003) recorded information on 62 observations of harbour porpoises in Polish waters during 1990-1999. Of these, 45 (75.6%) were reported bycaught in fishing gear, 10 observed at sea and 7 found dead on the shore. The bycatches occurred mostly in driftnets set for salmonids and bottom-set gillnets set for cod.

The annual bycatch in German Baltic fisheries is assumed to be between 3-5 porpoises (ICES 2005). Eight porpoises in Poland and two in Latvia were reported bycaught in 2003-2004 (ICES 2005). In Finland two porpoises were reported bycaught in the period 1986-1999. No bycatches were reported from Finland after 1999 (ICES 2003).

Pollution is of particular concern in the Baltic Sea where toxic compounds (in particular PCBs) have been described as the likely source for reduced fertility and population decline in Baltic Sea pinnipeds (Helle et al. 1976, Helle 1980, Bergman and Olsson 1986, Bergman 1999). Porpoises from the Baltic Sea have up to 254% higher mean levels of PCBs than corresponding samples from the Kattegat and Skagerrak (Berggren et al. 1999, Bruhn et al. 1999), and currently, a number of lesions and pathological changes are reported from the Baltic Sea porpoises (Siebert et al. 1999, Clausen and Andersen 1988), including pneumonia, liver fibrosis, arthrosis, abscesses in muscles, lungs and other organs, skin lesions and heavy attacks from parasites (Siebert et al. 1999, Clausen and Andersen 1988). Therefore, pollution cannot be excluded as a contributing factor in the past decline in abundance in the Baltic Sea. However, a recent decline of PCB concentration in Baltic Sea biota has been observed (Bignert et al. 2003).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The harbour porpoise has been hunted in many areas of its range, e.g. in Puget Sound, the Bay of Fundy, Gulf of St. Lawrence, Labrador, Newfoundland, Greenland, Iceland, Black Sea, and the Danish Belt Seas. Many of these fisheries are now closed, but hunting of harbour porpoises still occurs in Greenland. In Greenland more than 700 per year were taken in 1990-1993 (Teilmann and Dietz 1995). In 2003 the reported catch had increased to 2,320 (NAMMCO 2005). Assessments of population impacts of these takes are not available.

In the Black Sea, large directed takes occurred during 1976-1983. Within that period, the total number of harbour porpoises killed was at least 163,000-211,000. Commercial hunting of Black Sea cetaceans, including harbour porpoises, was banned in 1966 in the former USSR (present Georgia, Russia and Ukraine), Bulgaria and Romania, and in 1983 in Turkey. Illegal direct killing of unknown numbers continued in some parts of the Black Sea until 1991 (Reeves and Notarbartolo di Sciara 2006).

Today, the most significant threat in most areas is incidental catches in fishing gear, primarily gill nets. Incidental mortality in fishing gear is likely to occur throughout the range of the species, but substantial incidental takes have been documented (summarized in Donovan and Bjørge 1995) for the Gulf of Maine (1,200-2,900/year), Bay of Fundy (80-400/year), West Greenland (1,400/year), North Sea (4,600/year) Celtic Shelf (1,500/year), and also off central California during the 1980s and 1990s (tens to hundreds per year; Barlow and Hanan 1995). More recent monitoring programs of Danish set-net fisheries in the North Sea revealed an average of 5,591 porpoises taken annually in the period 1987-2001 (Vinther and Larsen 2002). However, most North Sea gillnet fisheries were not monitored for marine mammal bycatch (ICES 2002).

In the Black Sea incidental mortality in bottom-set gillnets is estimated to have been in the thousands annually through the 1980s (e.g., Birkun 2002a). Almost all (>99%) of the porpoises are caught in bottom-set gillnets. The scale of this mortality almost certainly increased in recent times owing to the rapid expansion of illegal, unreported and unregulated fishing in the Black Sea.

Other types of threats include chemical pollution, vessel traffic, noise, and depletion of prey by overfishing. Due to its near shore distribution, harbour porpoises are exposed to coastal sources of pollution throughout most of its range. Chemical pollution (PCBs) has been described as having adverse effects (see Baltic subpopulation account).

An explosion at a gas-drilling platform in the Azov Sea in August 1982 resulted in the deaths of over 2,000 porpoises (Birkun 2002b).

Severe habitat degradation and prey depletion caused by intensive fishing in the Black Sea, together with explosive growth of populations of invasive species are considered important threats for local harbour porpoises (Reeves and Notarbartolo di Sciara 2006). Reduced prey availability coincided with two mass mortality events (in 1989 and 1990) that affected all three Black Sea cetacean species, but primarily harbour porpoises (Birkun 2002c). Severe pulmonary nematodosis, caused by Halocercus spp. and complicated by bacterial super-infection, was recognized as a primary cause of the deaths, which were mainly of young animals.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Mortality due to entanglement and entrapment in commercial fishing gear may contribute to depletion of local populations in western Greenland, Gulf of St. Lawrence, Newfoundland, Bay of Fundy, and Gulf of Maine (Read and Gaskin 1988, Read et al. 1993, Caswell et al. 1998, NMFS 1999), as well as in other parts of the world (IUCN 1991). The average annual mortality estimate for 1992-1997 for U.S. Atlantic fisheries was 1,749 individuals (NMFS 1999). Bycatch in the Bay of Fundy in Canada was estimated at approximately 100-425 porpoises per year in the early 1990s (Trippel et al. 1996). Bycatch reduction efforts are in operation, and NMFS (1999) regarded these as sufficient to reduce the bycatch to sustainable levels. Habitat modification and environmental contaminants do not appear to be a significant threat in the Gulf of Maine/Bay of Fundy (NMFS 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Since the 1940s, there is evidence of a decline in the numbers of this species in UK waters (3). The main threats are thought to include entanglement in fishing nets, chemical and noise pollution, hunting, boat traffic, and lack of food (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

The species is listed in Appendix II of CITES.

The European Union adopted a Council Regulation 812/2004 entering into force in July 2004. This regulation is aimed at reducing the incidental catch of small cetaceans in fisheries in European Union waters. The regulation includes measures restricting Baltic Sea drift net fisheries, providing for mandatory use of acoustic deterrent devices (pingers) in some EU gillnet fisheries in the BalticSeas, and the use of onboard observers on vessels of over 15 m in length. Immediate actions to reduce the magnitude of bycatches are necessary. A review of the progress of implementing the regulation was scheduled for 2007.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

In the North Sea incidental takes have been determined to be above the advised maximum level of removals. The European Union adopted a regulation aimed at reducing the incidental catch of small cetaceans in fisheries in European Union waters. The regulation includes measures restricting Baltic Sea drift net fisheries, providing for mandatory use of acoustic deterrent devices (pingers) in some EU gillnet fisheries in the North and Baltic Seas, and the use of onboard observers on vessels of over 15 m in length. A review of the progress of implementing resolution is scheduled for 2007.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Harbor porpoises in the Gulf of Maine and Bay of Fundy appear to comprise a relatively discrete population unit that can be managed as a separate stock (NMFS 1999).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Needs: Protection from excessive mortality in commercial fisheries is an important consideration (IUCN 1991, NMFS 1999); regulate and monitor fisheries to maintain bycatch at sustainable levels. January 1994). A variety of local stocks should be protected, since there seems to be relatively little gene flow among populations (Gao and Gaskin 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, the harbour porpoise is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (3). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by seven European countries, including the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (7). Increased awareness of this species may help to secure its future (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Taken heavily in various areas, the meat is used for human and animal consumption, and its oil is used in lamps and as a lubricant.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: See IUCN (1991) for information on historical and present harvest; Greenland is the only country presently reporting large direct catches; use is mainly for human consumption; there is no longer a major commerical harvest, though resumption of commercial harvest may occur in Turkey (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Subpopulation Baltic Sea harbour porpoise : Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Harbour porpoise

The harbour porpoise (Phocoena phocoena) is one of six species of porpoise. It is one of the smallest marine mammals. As its name implies, it stays close to coastal areas or river estuaries, and as such, is the most familiar porpoise to whale watchers. This porpoise often ventures up rivers, and has been seen hundreds of miles from the sea. The harbour porpoise may be polytypic, with geographically distinct populations representing distinct races: P. p. phocoena in the North Atlantic and West Africa, P. p. relicta in the Black Sea and Sea of Azov, an unnamed population in the northwest Pacific and P. p. vomerina in the northeast Pacific.[3]

Contents

Etymology

The English word porpoise comes from the French pourpois (old French porpais, 12th cent.), which is from Medieval Latin porcopiscus, which is a compound of porcus (pig) and piscus (fish). The old word is probably a loan-translation of a Germanic word, cf. Danish marsvin and Dutch mereswijn (sea swine). Classical Latin had a similar name, porculus marinus (used by Pliny[citation needed]), and the notion behind the name is probably a fancied resemblance of the snout to that of a pig or the sound of a porpoise breathing resembling a pig snort. The species is sometimes known as the common porpoise in texts originating in the United Kingdom, though this usage appears to be dying out[citation needed]. It is also called a "puffer" or "puffer pig" by fishermen in New England and eastern Canada.[4] The species' taxonomic name, Phocaena phocaena, is the Latinized form of the Greek φώκαινα, phōkaina, "big seal", as described by Aristotle; this from φώκη, phōkē, "seal".

Physical description

Harbour porpoise skeleton on display

The harbour porpoise is a little smaller than the other porpoises, at about 67–85 cm (26–33 in) long at birth, weighing 6.4-10 kg. Adults of both sexes grow to 1.4 m to 1.9 m (4.6-6.2 ft). The females are heavier, with a maximum weight of around 76 kg (167 pounds) compared with the males' 61 kg (134 pounds). The body is robust, and the animal is at its maximum girth just in front of its triangular dorsal fin. The beak is poorly demarcated. The flippers, dorsal fin, tail fin and back are a dark grey. The sides are a slightly speckled, lighter grey. The underside is much whiter, though there are usually grey stripes running along the throat from the underside of the body.

Populations and distribution

A harbour porpoise off Denmark

The harbour porpoise species is widespread in cooler coastal waters of the North Atlantic, North Pacific and the Black Sea.[5] The populations in these regions are not continuous[4] and are classified as separate subspecies with P. p. phocoena in the North Atlantic and West Africa, P. p. relicta in the Black Sea and Sea of Azov, an unnamed population in the northwest Pacific and P. p. vomerina in the northeast Pacific.[3][5] Recent genetic evidence suggests the harbour porpoise population structure may be more complex, and they should be reclassified.[6]

In the Atlantic, harbour porpoises may be present in a curved band of water running from the coast of West Africa to the coasts of Spain, France, the United Kingdom, Ireland, Scandinavia, Iceland, Greenland, Nova Scotia and Newfoundland and the eastern seaboard of the United States.[4][5] There is a similarly-shaped band in the Pacific Ocean running from Sea of Japan, Vladivostok, the Bering Strait, Alaska and California.[4][5] The harbour porpoise has a global population of 700,000.[5] Areas with sizable numbers include the North Sea, where porpoises number at about 350,000;[7] and well as the Gulf of Maine/Bay of Fundy area, the US west coast and Alaska.[8]

Natural history

A harbour porpoise in captivity in Denmark, trained to jump out of the water.

Ecology

Harbour porpoises prefer temperate and subarctic waters.[4] They inhabit in fjords, bays, estuaries and harbours, hence the name.[4] They feed mostly on small pelagic schooling fish, particularly herring, capelin, and sprat.[5] They will, however, eat squid and crustaceans in certain places.[5] This species tends to feed close to the sea bottom, atleast for waters less than 200 m deep.[5] However, when hunting spat, porpoise may stay closer to the surface.[5] When in deeper waters, porpoises may forage for mid-water fish, such as pearlsides.[5] Harbour porpoises tend to be solitary foragers, but they do sometimes hunt in packs and herd fish together.[5] Young porpoises need to consume about 7% to 8% of their body weight each day to survive, which is approximately 15 pounds or 7 kilograms of fish. Significant predators of harbour porpoises include white sharks and killer whales (orcas). Researchers at the University of Aberdeen in Scotland have also discovered that the local bottlenose dolphins attack and kill harbour porpoises without eating them due to competition for a decreasing food supply.[9]

A harbour porpoise off Denmark

Behaviour and reproduction

Some studies suggest porpoises are relatively sedentary and usually don't leave a certain area for long.[5] Nevertheless, they have been recorded to move from onshore to offshore waters along coast.[5] Dives of 220m by harbour porpoises have been recorded.[5] Dives can last five minutes dives but typically last one minute.[10]

The social life of harbour porpoises is not well understood. They are generally seen as a solitary species.[4] Most of the time, porpoise are either alone or in groups of no more than five animals.[4] Porpoises mate promiscuously.[5] Males produce large amounts of sperm, perhaps for sperm competition.[5] Females, become sexual mature at by their third or fourth year and can calve each year for several consecutive years, being pregnant and lactating at the same time. The gestation of the porpoise is typically 10–11 months.[4] Most births occur in late spring and summer.[5] Calves are weaned after 8–12 months.[4]

Conservation

Harbour porpoises were traditionally hunted for food, as well as for their blubber, which was used for lighting fuel. The drive hunt in the Little Belt strait, Denmark, is the best known example. Thousands of porpoises were caught there until the end of the 19th century and again in smaller scale during the world wars.[11] Currently, however, this species is not subject to commercial hunting, but it is hunted for food and sold locally in Greenland. In prehistoric times, this animal was hunted by the Alby People of the east coast of Oland, Sweden.

The Harbour porpoise populations of the North Sea, Baltic Sea, western North Atlantic, Black Sea and North West Africa are listed on Appendix II[12] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). This listing means that these populations have an unfavourable conservation status or would benefit significantly from international co-operation organised by tailored agreements.

In addition, the Harbour porpoise is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS), the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS) and the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU).

Currently, the total population is in the hundreds of thousands and the harbour porpoise is not under threat of extinction. There are, however, a number of threats that impact population distribution and numbers.

Interactions with fisheries

The main threat to porpoises is static fishing techniques such as gill and tangle nets. Bycatch in bottom-set gill nets is considered the main anthropogenic mortality factor for harbour porpoises worldwide. Bycatch is reported from the Black Sea, the Baltic Sea, the North Sea and the east coast of the United States and Canada. Bottom-set gill nets are anchored to the sea floor and are up to 12.5 miles (20 km) in length. It is unknown why porpoises become entangled in gill nets, since several studies indicate they are able to detect these nets using their echolocation.[13][14] Porpoise-scaring devices, so-called pingers, have been developed to keep porpoises out of nets and numerous studies have demonstrated they are very effective at reducing entanglement.[15][16] However, concern has been raised over the noise pollution created by the pingers and whether their efficiency will diminish over time due to porpoises habituating to the sounds.[17]

Dead porpoise ashore

Mortality resulting from trawling bycatch seems to be less of an issue, probably because porpoises are not inclined to feed inside trawls, as dolphins are known to do.

Climate change

An increase in the temperature of the sea water is likely to affect the distribution of porpoises and their prey, but has not been shown to occur. Reduced stocks of sand eel along the east coast of Scotland seems to have been the main reason for the malnutrition in porpoises in the area.

Overfishing

Overfishing may reduce preferred prey availability for porpoises. Overfishing resulting in the collapse of herring in the North Sea caused porpoises to hunt for other prey species. Reduction of prey may result from climate change, or overfishing, or both.

Noise pollution

Noise from ship traffic and oil platforms is thought to affect the distribution of toothed whales, like the harbour porpoise, that use echolocation for communication and prey detection. The construction of thousands of offshore wind turbines,planned in different areas of North Sea, is known to cause displacement of porpoises from the construction site,[18] particularly if steel monopile foundations are installed by percussive piling, where reactions can occur at distances of more than 20 km.[19] Noise levels from operating wind turbines are low and unlikely to affect porpoises, even at close range.[20][21]

Pollution

Marine top predators like porpoises and seals accumulate pollutants such as heavy metals, PCBs and pesticides in their fat tissue. Porpoises have a coastal distribution that potentially brings them close to sources of pollution. Porpoises may not experience any toxic effects until they draw on their fat reserves, such as in periods of food shortage, migration or reproduction.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300116. 
  2. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Phocoena phocoena. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b Shirihai, Hadoram and Jarrett, Brett (2006). Whales, Dolphins and Seals - A Field Guide to the Marine Mammals of the World. A&C Black Publishers. ISBN 0-7136-7037-1. 
  4. ^ a b c d e f g h i j Randall R. Reeves, Brent S. Stewart, Phillip J. Clapham and James A. Powell (2002). National Audubon Society Guide to Marine Mammals of the World. Alfred A. Knopf, Inc. ISBN 0375411410. 
  5. ^ a b c d e f g h i j k l m n o p q Arne Bjorge, Krystal. A Tolley, "Harbor porpoise Phocoena phocoena" pgs. 530-532 of Encyclopedia of Marine Mammals (edited by William F. Perrin, Bernd Wursig, and J. G.M. Thewissen). Academic Press; 2nd edition. 2008.
  6. ^ Harbour porpoises (Phocoena phocoena) in the North Atlantic: Distribution and genetic population structure. NAMMCO Sci. Pub 5: 11-29.
  7. ^ Hammond, P. S., et al. (2002). "Abundance of harbour porpoise and other cetaceans in the North Sea and adjacent waters," Journal of Applied Ecology 39: 361-376.
  8. ^ A Bjorge and GP Donovan (eds.) (1995). Biology of Phocoenids. AN INTERNATIONAL WHALING COMMISSION SPECIAL. Issue 16.
  9. ^ Read, Andrew (1999). Porpoises. Stillwater, MN, USA: Voyageur Press. ISBN 0-89658-420-8. 
  10. ^ Westgate AJ, Read AJ, Berggren P, Koopman HN, Gaskin DE (1995). Diving behaviour of harbour porpoises, Phocoena phocoena. Can. J. Fish Aquat. Sci. 52, 1064-1073.
  11. ^ Aage Petersen (1969). Porpoises and porpoise hunters. Middelfart, Denmark (in Danish).
  12. ^ "Appendix II" of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  13. ^ R. Kastelein, W. W. L. Au, and D. de Haan (2000). Detection distances of bottom-set gill nets by harbour porpoises (Phocoena phocoena) and bottlenose dolphins (Tursiops truncatus). Mar.Environm.Res. 49:359-375.
  14. ^ A. Villadsgaard, M. Wahlberg, and J. Tougaard (2007). Echolocation signals of free-ranging harbour porpoises, Phocoena phocoena. J.Exp.Biol. 210 (1):56-64.
  15. ^ S. D. Kraus, A. J. Read, A. Solow, K. Baldwin, T. Spradlin, E. Anderson, and J. Williamson (1997). Acoustic alarms reduce porpoise mortality. Nature 388:525
  16. ^ Larsen, F (1999). The effect of acoustic alarms on the by-catch of harbour porpoises in the Danish North Sea gill net fishery. Paper SC/51/SM41 presented to the IWC Scientific Committee
  17. ^ T. M. Cox, A. J. Read, A. Solow, and N. Tregenza (2001). Will harbour porpoises (Phocoena phocoena) habituate to pingers? J.Cetacean.Res.Manage. 3 (1):81-86
  18. ^ J. Carstensen, O. D. Henriksen, and J. Teilmann (2006). Impacts on harbour porpoises from offshore wind farm construction: Acoustic monitoring of echolocation activity using porpoise detectors (T-PODs). Mar.Ecol.Prog.Ser. 321:295-308
  19. ^ J. Tougaard, J. Carstensen, J. Teilmann, H. Skov, and P. Rasmussen (2009). Pile driving zone of responsiveness extends beyond 20 km for harbour porpoises (Phocoena phocoena, (L.)). J.Acoust.Soc.Am. 126 (1):11-14
  20. ^ P. T. Madsen, M. Wahlberg, J. Tougaard, K. Lucke, and P. L. Tyack (2006). Wind turbine underwater noise and marine mammals: Implications of current knowledge and data needs. Mar.Ecol.Prog.Ser. 309:279-295.
  21. ^ J. Tougaard, O. D. Henriksen, and L. A. Miller (2009). Underwater noise from three offshore wind turbines: estimation of impact zones for harbor porpoises and harbor seals. J.Acoust.Soc.Am. 125 (6):3766-3773

Bibliography

Further reading

  • Friel, D. and Sleeman, D.P. 2010. A neonate harbour porpoise (Phocoena phocoena (L.)) with damaged skin. Ir Nat. J. 31: 55.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Various data indicate that four distinct populations exist in the western North Atlantic Ocean: Gulf of Maine/Bay of Fundy; Gulf of St. Lawrence; Newfoundland; and Greenland (NMFS 1999). Patterns of morphological variation in metric skull characters suggest that gene flow among populations is restricted to some degree even among closely adjacent geographical units (Gao and Gaskin 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!