Articles on this page are available in 1 other language: Spanish (29) (learn more)

Overview

Brief Summary

Description

Killer whales live in all the oceans between the Arctic and Antarctic ice packs. Given this enormous range and their predatory lifestyle, it is not surprising that they are adaptable, with excellent memory, intelligence, and a capacity for social complexity. They tend to live in pods of fewer than 10 animals, built around a stable core of 2-3 generations of related females - mothers, daughters, sisters, and aunts. This is shown by genetic studies of pods living in the same area. Adult females without calves, and adult males, may help care for and train younger whales to hunt, especially when a reproducing female is rearing more than one offspring. Cooperation extends to hunting, and these animals are known to attack and drown larger whales by swarming them from all sides. Orcas may even beach themselves temporarily to snatch seals, or knock them off ice floes by ramming the ice. Their prey includes larger marine mammals, fish, birds, and cephalopods.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis. Tenth Edition, Laurentii Salvii, Stockholm, 1:77, 824 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Orcas are the top predator in the sea and have an extremely broad diet, including fish, gulls, penguins, turtles, squid and marine mammals, even including large whales such as grey and blue whales (2). They spend their life in stable groups, called pods (2), which hunt co-operatively (6). Long-term studies off Canada have shown that orcas occur as 'transient', 'resident' or 'offshore' populations, which have different hunting styles and social organisation (4). Orcas are extremely active and acrobatic; they are one of the fastest animals in the sea and often breach (clear the water), lobtail (slap the tail flukes on the surface of the water), and spy-hop (bring the head out of the water) (4). Females become sexually mature in their teens and produce a single calf every three years until they reach around 40 years of age (6). After the gestation period of up to 17 months, calves are suckled for about a year (6). Killer whales live to between 50 and 100 years of age (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Orca

Although Orca's are known as fierce predators of the sea, it is also known that some Orca's are non mammal eating predators, and have also been seen swimming with dolphin packs.
Public Domain

 

Supplier: infortlaud1979

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The killer whale is the largest member of the dolphin family. Killer whales are recognized by their distinctive black, white and grey coloration and a white eye patch, or spot, located just above and behind the eye. Just behind the dorsal fin there is a grey saddle patch. The whale's belly, lower jaw and the underside of the tail flukes are white. The rest of the body is black. The wide, tall dorsal fin is curved backwards in females and juveniles and upright and triangular in adult males. The head is rounded, with a barely distinguishable beak. The pectoral flippers are paddle-shaped. In addition to sexual size dimorphism, male appendages, especially the dorsal fin, are disproportionately larger than in females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Conspicuous black and white colour. Black on top with a white belly and throat and patch behind the eyes. The distinctive, large dorsal fin can reach 1.8m in length in males and 0.9 m in females. Large, rounded paddle like flippers. The snout is blunt with a short, poorly defined beak. Males can be in excess of 9 m in length, 6 m for females.The orca is the largest species of dolphin. It is also referred to as the killer whale. It is a fast swimmer, reaching speeds in excess of 30 knots. It feeds on squid, octopus, fish, seals and other smaller dolphins and may eat seabirds and marine turtles occasionally. 

Orcinus orca is listed in the Red list of threatened animals (IUCN, 2003) as of Lower Risk (LR) but dependant on conservation effort. Orcinus orca is included within the grouped Species Action Plan "toothed whales (other than small dolphins)" under the UK Biodiversity Action Plan (Anon, 1999x). The killer whale is listed under Appendix II of the Bern convention. All species of cetaceans are given protection under the Wildlife & Countryside Act 1981 and the Wildlife (Northern Ireland) Order 1985 (Anon, 1999x). All cetacean species are listed on Annex IV (Animal and Plant Species of Community Interest in Need of Strict Protection) of the EC Habitats Directive (Anon, 1999x). All whales are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES Appendix I thus prohibiting their commercial trade (Anon, 1999x).

Whaling is illegal in UK waters (Fisheries Act 1981) but neighbouring countries maintain the right to hunt (Anon, 1999x). An 'Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas' (ASCOBANS), formulated in 1992, has now been signed by seven European countries, including the UK. Under the Agreement, provision is made for protection of specific areas, monitoring, research, information exchange, pollution control and heightening public awareness. Although aimed primarily at dolphins and porpoises, ASCOBANS includes all toothed whales except the sperm whale (Anon, 1999x). The killer whale is also listed on Appendix II of the Bonn Convention on the Conservation of Migratory species of Wild Animals (Anon, 1999x).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The orca, once also known as the killer whale, is in fact the largest of the dolphins (2). They are easily identified by the black and white colouration; the underside is white and there are white patches behind the eyes, and a greyish white area called a 'saddle-patch' behind the dorsal fin (2). The shape of the saddle is unique in each animal, and can help to identify individuals (4). The dorsal fin is also used to recognise individuals (4). Male orcas have the tallest dorsal fin known in the animal kingdom (4), measuring up to six feet high in mature males (2), it can be as tall as a man (4). Females have shorter, more curved dorsal fins (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The killer whale is the most cosmopolitan of all cetaceans and may be the second-most widely-ranging mammal species on the planet, after humans (Rice 1998). Killer whales can be seen in virtually any marine region, from the equator to polar waters. Although they are generally more common in nearshore areas and in higher-productivity areas and/or higher latitudes, there appear to be no hard and fast restrictions of water temperature or depth on their range. The distribution extends to many enclosed or partially-enclosed seas, such as the Mediterranean Sea, Sea of Okhotsk, Gulf of California, Gulf of Mexico, Red Sea, and Persian Gulf. However, there are only extralimital records from the Baltic Sea and no records from the Black Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Orcinus orca is found living in all oceans of the world. They have been spotted from as far north as the Artic Ocean near pack ice to as far south as the Antarctic Ocean. Although Orcinus orca seems to prefer colder waters, they have also been observed in tropical waters. There seems to be no or very little migration due to weather and water temperature, but killer whales will move to other areas when food becomes scarce.

Biogeographic Regions: arctic ocean ; indian ocean; atlantic ocean ; pacific ocean

Other Geographic Terms: cosmopolitan

  • Ford, J., G. Ellis, K. Balcomb. 2000. Killer Whales. University of Washington Press, unknown: 104.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica/Southern Ocean; East Pacific; Eastern Atlantic Ocean; Indo-West Pacific; Western Atlantic Ocean
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

cosmopolitan
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Antarctica, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, Gulf of St. Lawrence, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, St. Lawrence Estuary, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread in temperate and coastal waters up to the borders of the North and South Poles.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Throughout the world's oceans and seas, from high latitudes to the equator; most common in cooler coastal waters of both hemispheres, with the greatest abundance within 800 km from continental coasts.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Southern Resident DPS, which consists of whales from the J, K, and L pods, wherever they are found in the wild.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan; found in all oceans.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan; found in all oceans.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found in every ocean, the orca is one of the most widely distributed animals known (2). In the UK, it occurs most often around northern and western Scotland, and closer to shore between May and October (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Killer whales have streamlined, black and white bodies. They are black on the dorsal surface, white extends from the bottom of the chin to just beyond the anus on the ventral surface. There is also a white spot above the eye. In both sexes there is a "saddle spot" which is a grey spot behind the dorsal fin on the back. In calves, their black is somewhat grey up to a year old. Also, the white on the calf's underside has a yellow tint to it until they reach 1 year old. The average length for a male adult is 8 m, with the maximum length at 9.75 m. The average length in females is 7 m with a maximum length of 8.5 m. Newborn calves are from 2 to 2.4 m long and weigh about 136 kg at birth. The average weight for a male killer whale is 7200 kg. Female average body size and weight is slightly smaller than that of males. In males, the erect dorsal fin can reach up to 1.8 m high; in females and immature males this dorsal fin is only about 0.9 m high. This fin curves over either to the right or left side.

Average mass: 7200 kg.

Range length: 9.75 (high) m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average mass: 3.9875e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Male length: 10 m; Female length: 8.5 m; Males weight: up to 10,000 kg; Females weight: up to 7,500 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 9100 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 9.8 m (male maximum)
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 9.8 m (male maximum)
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females in body size, flipper size, and dorsal fin height.

Length:
Range: up to 9 m males; up to 7.7 m females

Weight:
Average: 5,568 kg males; 3,810 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Killer whales may occur in virtually any marine or estuarine habitat but are most common in areas of high marine productivity, particularly at higher latitudes and near shore (Dahlheim and Heyning 1999; Forney and Wade 2006). Sightings range from the surf zone to the open sea. Movements can be extensive. For instance, some killer whales have been documented to have moved between Alaska and central California, a distance of more than 2000 km. In the Antarctic, they readily enter areas of floe ice in search of prey (Pitman and Ensor 2003). Killer whales in some areas congregate seasonally in coastal channels to forage and occasionally enter river mouths.

Killer whales are known to feed on a wide array of prey, including most marine mammal species (except river dolphins and manatees), seabirds, sea turtles, many species of fish (including sharks and rays) and cephalopods (Dahlheim and Heyning 1999; Ford and Ellis 1999; Ford 2002). They have a diversity of foraging tactics, including intentional beaching to gain access to seals onshore. They are known to use cooperative techniques to herd fish and to attack large prey (Dahlheim and Heyning 1999; Baird 2000).

Although a generalist as a species, at least some subpopulations specialize on particular types of prey (Bigg et al. 1990; Baird 2000). Studies in coastal waters of the eastern North Pacific, from California to Alaska, have described three distinct ecotypes of killer whales, referred to as residents, transients, and offshores. Although distinguished by ecological differences, there are also differences in coloration, external morphology, behavior and acoustics. The three ecotypes maintain social isolation from each other despite overlapping ranges. The northeastern Pacific residents are salmon specialists and have a strong preference for one species, the chinook salmon (Ford and Ellis 2006). Transients in coastal waters of the northeastern Pacific appear to focus their foraging on pinnipeds and small cetaceans and occasionally take baleen whales. Killer whales in coastal Norway specialize on herring (Simila et al. 1996) and in the Strait of Gibraltar on bluefin tuna (Cañadas and de Stephanis 2006). Some killer whales in New Zealand may forage selectively on rays and other elasmobranchs (Visser 1999). In the Antarctic, the standard-type killer whales appear to specialize on minke whales, one smaller type eats mostly seals, and yet another small form appears to be a fish-eater (Pitman and Ensor 2003).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Killer whales live in aquatic marine habitats. They are found in all oceans of the world. Normally prefering depths of 20 to 60 m, killer whales also visit shallow waters along coastlines or dive to 300 m in search of food. Killer whales generally occupy the same home range year round.

Range depth: 20 to 300 m.

Average depth: 60 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Slijper, E. 1979. Whales. Ithaca, New York: Hutchinson and Co. ; Cornell University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

inshore and offshore
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1405 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1093 samples.

Environmental ranges
  Depth range (m): 0 - 2450
  Temperature range (°C): -1.693 - 29.197
  Nitrate (umol/L): 0.042 - 30.376
  Salinity (PPS): 27.525 - 36.842
  Oxygen (ml/l): 4.513 - 8.967
  Phosphate (umol/l): 0.053 - 2.135
  Silicate (umol/l): 0.787 - 83.019

Graphical representation

Depth range (m): 0 - 2450

Temperature range (°C): -1.693 - 29.197

Nitrate (umol/L): 0.042 - 30.376

Salinity (PPS): 27.525 - 36.842

Oxygen (ml/l): 4.513 - 8.967

Phosphate (umol/l): 0.053 - 2.135

Silicate (umol/l): 0.787 - 83.019
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The orca occurs in virtually every marine region, from polar waters to the equator.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Mainly in coastal waters, but may occur anywhere in all oceans and major seas at any time of year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Usually found in deep water, although it may enter shallow water to catch prey.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cold and warm marine waters worldwide.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cold and warm marine waters worldwide.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The orca inhabits both coastal and offshore waters (5). It has also been known to venture into estuaries (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Migratory in some regions, nonmigratory in other regions. Migrations apparently are related to movements of prey species.

The longest known movement involved three individuals photographed in Glacier Bay, Alaska, on 6 August 1989, and subsequently observed attacking gray whales in Monterey Bay, California, on 2 May 1992 (Goley and Straley 1994); whether this movement was transitory or migratory is unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Killer whales are exceptionally successful predators. Orcinus orca diet is difficult to study and is most frequently assessed through looking at stomach contents. They eat a wide variety of large prey including: seals, sea lions, smaller whales and dolphins, fish, sharks, squid, octopi, sea turtles, sea birds, sea otters, river otters, and other animals.  Killer whales eat on average 45 kg of food a day, but they can eat much more than that. They swallow small prey whole, but tend to tear up larger prey before consumption. Killer whales are social hunters, as are wolves and lions. They often hunt in packs and use coordinated social behavior and communication to hunt prey larger than themselves, such as larger whales.

Animal Foods: birds; mammals; reptiles; fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Opportunistic; diet differs seasonally and geographically. Eats marine mammals (seals, dolphins, occasionally baleen whales), birds, fishes, and squid. May hunt cooperatively. Off Washington, British Columbia, and Alaska, "transients" feed mainly on pinnipeds, "residents" feed primarily on salmon (Baird et al. 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Opportunistic; will feed on everything from fish, seabirds, and seals to other cetaceans.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Opportunistic; will feed on everything from fish, seabirds, and seals to other cetaceans.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Killer whales are top predators in most marine ecosystems and impact the populations of common prey, such as seals and sea lions in breeding areas. Killer whales are host to some endoparasites and ectoparasites. They are host to killer whale lice (Cyamus orcini), trematodes (Fasciola skiranini), cestodes (Trigonocotyle spasskyi), and nematodes (Anasakis simplex).

A disease that affects killer whales and is often studied is toxoplasmosis (Toxoplasma gondii). While this parasite is often benign, it can have serious and fatal effects.

Commensal/Parasitic Species:

  • killer whale lice (Cyamus orcini)
  • trematodes (Fasciola skirabini)
  • cestodes (Trigonocotyle fasciola)
  • nematodes (Anasakis simplex)

  • Chadwick, D. 2001. Evolution of Whales. National Geographic, Vol. 200 Issue 5: 64-78.
  • Murata, K., K. Mizuta, K. Imazu, F. Terasawa, M. Taki, T. Endoh. 2004. The Prevalence of Toxoplasma gondii Antibodies in Wild and Captive Cetaceans from Japan.. The Journal of Parasitology, 90: 896-898.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Killer whales have no natural predators, although young killer whales may be attacked by other killer whales or large sharks. They are at the top of the marine food chain. Humans sometimes prey on killer whales, but not in great numbers.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 81 to >300

Comments: No exact figures.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Travels in well-defined social groups (pods), usually of fewer than 40 (averaging less than 10); sometimes forms aggregations exceeding 100. Studies in Puget Sound indicate strong social bonds and stable group structure. Typical pod contains mature females and their young (1-3 juveniles per female) and variable proportions of of males and/or post-reproductive females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

There are 3 categories of vocalizations used by killer whales: whistles, discrete calls, and clicks. Vocalizations are used both for communication and navigation. They use discrete calls and whistles when communicating within and among pods. Each pod has their a discrete dialect that sounds slightly different from that of other pods. This dialect has been shown to stay the same in a pod for up to six generations. Clicks seem to be used only for echolocation. Killer whales do have good vision, but in dark water their vision is not helpful in catching prey or navigating. As in other toothed whales, killer whales use sonar to perceive their aquatic environment.

The whale's ears are very small openings behind the eyes, which have no outer flap. The killer whale hears the whistles and clicks through an auditory bulla (earbone complex) in its lower jaw. The sound waves enter through the jaw where they then enter into the earbone complex. In this auditory bulla, there are bones that are like the bones found in the human ear. They waves travel trough these bones, then enter into the brain via an auditory nerve.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic ; echolocation

  • Bower, B. 2000. Culture of the Sea. Science News, Vol. 158, Iss.18: 284-286.
  • Miller, P. 2006. Diversity in Soundpressure Levels and Estimated Active Space of Resident Killer Whale Vocalizations. Journal of Comparative physiology, 192: 449-459.
  • Deeke, V., J. Ford, P. Slater. 2005. The Vocal Behaviour of Mammal-Eating Killer Whales: Communicating with costly calls. Animal Behaviour, 69/2: 385-405.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Killer whales are highly social animals that occur primarily in relatively stable social groups that often range in size from 2 to 15 animals. Larger groups (rarely as large as several hundred individuals) occasionally form, but are usually considered temporary groupings of smaller social units that probably congregate near seasonal concentrations of prey, for social interaction, or mating. Single whales, usually adult males, also occur in many populations. The diets of orcas vary from one region to another. They feed on Fishes, squids, seals, sea lions, walruses, sea turtles, otters, penguins, cetaceans (both mysticete and odontocete).

Sexual maturity of female killer whales is achieved when the whales reach lengths of approximately 15-18 feet (4.6 m-5.4 m), depending on geographic region. The gestation period for killer whales varies from 15-18 months, and birth may take place in any month. Calves are nursed for at least 1 year, and may be weaned between 1 and 2 years of age. The birth rate for killer whales is not well understood, but, in some populations, is estimated as every 5 years for an average period of 25 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day and night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Killer whale mortality rate varies with the age of the animal. Neonatal mortality is very high, in captivity neonatal mortality is between 37% and 50%. The reason for these high mortality rates is unknown, but predation is not considered a primary threat during this time. After six months, mortality rates steadily decline as killer whales learn how to protect and nourish themselves. Mortality rates are said to be the lowest around 12 to 13 years in males and 20 years in females.  The average lifespan for a female in the wild is around 63 years, with a maximum of 80 to 90 years. Male life expectancy is a bit shorter, with the average lifespan being around 36 years, with a maximum of 50 to 60 years.

Range lifespan

Status: wild:
90 (females) 60 (males) (high) years.

Typical lifespan

Status: wild:
63 (females) 36 (males) (high) years.

  • de Magalhaes, J., J. Costa, O. Toussaint. 2005. "HAGR: Human Ageing Genomic Resources" (On-line). Accessed December 01, 2008 at http://genomics.senescence.info/species/entry.php?species=Orcinus_orca.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 90 years (wild) Observations: Reproductive senescence has been reported in this species and no female over the age of 48 has been observed to give birth. Maximum longevity in the wild has been estimated to be around 90 years and the MRDT was calculated to be about 14 for females (Foote 2008). Anecdotal evidence, which could be true, suggests these animals may live up to 100 years. In captivity, one wild born animal was still alive at about 37 years of age (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Killer whales are polygynandrous; both males and females have multiple mates throughout a season or a lifetime.

Mating System: polygynandrous (promiscuous) ; cooperative breeder

While killer whales are difficult to study in the wild some of their reproductive habits have been recorded and studied in captive whales. Killer whales can reproduce whenever females enter estrus, which can occur mutiple times a year. However, most breeding happens in the summer, and killer whales are typically born in the fall. Females reach sexual maturity between 6 and 10 years of age. Males reach sexual maturity between 10 and 13 years old. Female killer whales begin to mate between 14 and 15 years of age. The youngest female whale on record to give birth was 11 years old. Females have a calf every 6 to 10 years and they stop breeding around the age of 40. The result is 4 to 6 offspring over a 25 year span.

Gestation takes about 14 months, although a gestation length in captivity was recorded at 539 days. Killer whales have a single calf at a time, twins have only been recorded once. Newborn calves nurse for about a year before weaning. Some studies show that almost half of all newborn calves die before their first birthday.

Breeding interval: Females breed every 3 to 10 years.

Breeding season: Breeding can occur at any time of the year, most often in the summer.

Range number of offspring: 1 (low) .

Average number of offspring: 1.

Range gestation period: 12 to 18 months.

Average birth mass: 181 kg.

Range weaning age: 12 to 24 months.

Range age at sexual or reproductive maturity (female): 6 to 10 years.

Range age at sexual or reproductive maturity (male): 10 to 13 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 180000 g.

Average number of offspring: 1.

Killer whale females invest a lot of energy in raising their offspring. They carry the calf for almost a year and a half, then give birth and nurse for another 12 months. During that time, mothers teach their calves to hunt and include their offspring in the social network of their pods. Because these animals are not monogamous, it is assumed that the fathers exhibit no parental involvement after mating. When a killer whale calf is born into a pod, it relies on its mother for nutrition and support. Calves remain in their natal pod after independence.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • Slijper, E. 1979. Whales. Ithaca, New York: Hutchinson and Co. ; Cornell University Press.
  • Payne, R. 1995. Among Whales. New York, New York 10020: Charles Scribner's Sons.
  • Robeck, T., K. Steinman, S. Gearhart, J. Reidarson, S. Monfort. 2004. Reproductive Physiology and Development of Artificial Insemination Technology in Killer Whales. Biology of Reproduction, Vol. 71 no. 2: 650-660.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating occurs late fall to midwinter in the northeastern Atlantic. Gestation lasts about 17 months (IUCN 1991). Litter size is 1. Calf may be dependent for at least 2 years, closely associated with mother for much of juvenile period. Calving interval has been estimated at 3-8 years (higher estimates may be more typical). Sexually mature at 10-18 years. Females become reproductively senescent at 35-45 years. Estimated maximum age 80-90 years in females, 50-60 years in males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating times vary worldwide. Gestation period is approximately 17 months. Calves may nurse for up to 15 months.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating times vary worldwide. Gestation period is approximately 17 months. Calves may nurse for up to 15 months.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Evolution

Recent genetic evidence suggests that there may in fact be three different species instead of a single Orcinus orca. These three species correspond to ecotypes, which had already been recognized as having differences in size and color pattern, behavior, prey preference, and social organization. Researchers sequenced mitochondrial genomes of 143 orcas and three outgroup species (false killer whale, long-finned pilot whale and short-finned pilot whale). They found 66 orca hapolotypes which clustered geographically and by ecotype. They estimate that the clades diverged between 150,000 and 700,000 years ago, with two Pacific clades splitting first and then an Atlantic clade more recently.
  • Mitochondrial DNA Points to Multiple Killer Whale Species. GenomeWeb Daily News. 23 April 2010. http://www.genomeweb.com/node/939227
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Cyndy Parr

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Orcinus orca

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 66 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2900-10|GU187202|Orcinus orca| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGCACCCTGTATTTACTATTTGGCGCCTGAGCGGGAATAGTAGGTACTGGTCTA---AGCTTATTGATTCGTGCTGAATTAGGTCAACCTGGTACACTTATTGGAGAC---GACCAGCTTTATAATGTTCTAGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTCATACCTATCATAATTGGAGGTTTTGGAAACTGATTAGTTCCCTTAATA---ATTGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTTCCCCCTTCCTTCCTACTATTAATAGCGTCTTCGATAGTTGAAGCTGGCGCAGGTACAGGCTGAACTGTATATCCTCCCTTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACTATTTTCTCCCTACATTTAGCCGGCGTATCTTCAATCCTTGGGGCTATTAACTTCATTACAACTATTATTAATATAAAACCACCCGCTATGACTCAATACCAAACACCTCTCTTCGTCTGATCAGTCCTTGTTACAGCAACCTTACTTTTACTATCACTACCTGTCTTAGCAGCC---GGAATTACTATACTATTGACTGATCGAAATCTAAACACAACCTTTTTCGACCCGGCAGGAGGAGGGGATCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCACCCCGAAGTATACATCTTAATTCTACCAGGTTTTGGAATAATCTCACACATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCTATAATTTCTATTGGTTTCCTGGGCTTCATCGTATGAGCTCACCATATGTTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Orcinus orca

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 66
Species: 66
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Contributor/s

Justification
This taxonomic unit is treated as one species even though there is evidence that it may be a complex of two or more species. If it is so designated, the category of this taxon may change. If taxonomic designations change, then it is suspected that some new species may warrant listing under higher categories of risk. Because additional data should resolve this taxonomic uncertainty, the current species is listed as DD. The combination of potential declines driven by depletion of prey resources and the effects of pollutants is believed sufficient that a 30% global reduction over three generations (77 years; Taylor et al. 2007) cannot be ruled out for some “groups” that may be designated as species.

History
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

According to the IUCN red list there is insufficient data about killer whale populations to assess their status. The data on the endangered species act list states that killer whales are endangered. They are on Appendix II of the CITES site, which means they are not threatened by extinction, but conservation efforts must be employed to help keep them from moving closer to extinction. Killer whales have not been as directly impacted by human exploitation as other whale species. They are occasionally hunted but management of harvests seems to have been effective.

US Federal List: endangered

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Cosmopolitan in oceans; abundance and trends are not well known.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 02/16/2006
Lead Region:   National Marine Fisheries Service (Region 11) 
Where Listed: Southern Resident DPS


Population detail:

Population location: Southern Resident DPS
Listing status: E

For most current information and documents related to the conservation status and management of Orcinus orca , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There is no longer a fishery devoted solely to Killer whales, but they are still hunted commercially in some areas. Listed in CITES Appendix II. Protected since 1980 by IWC moratorium against factory ship whaling.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

There is no longer a fishery devoted solely to Killer whales, but they are still hunted commercially in some areas. Listed in CITES Appendix II. Protected since 1980 by IWC moratorium against factory ship whaling.
  • IUCN Red Book
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive; eastern North Atlantic populations and eastern North Pacific populations of orca are listed under Appendix II of the Bonn Convention (also known as the Convention on Migratory Species, or CMS) and Appendix II of the Bern Convention (7). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. In the UK all cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Although killer whales occur worldwide, densities increase by 1-2 orders of magnitude between the tropics and the highest-sampled latitudes in the Arctic and Antarctic (Forney and Wade 2006). Killer whales tend to be more common along continental margins; however, there is some variation in this general pattern that appears linked to ocean productivity. Killer whales appear to be less common in western boundary currents, such as the Gulf Stream or the Kuroshio than in more productive eastern boundary currents, such as the California Current. Known areas of locally higher density often coincide with greater oceanographic productivity (e.g. off Argentina).

Killer whale populations have been relatively well-studied in the North Pacific. In the eastern tropical Pacific, a line-transect survey resulted in an estimate of 8,500 (CV=37%) (Wade and Gerrodette 1993). A catalogue of 86 individuals exists for waters around the Baja Peninsula, Mexico (Guerrero-Ruiz et al. 1998). In waters of Hawaii, a line-transect survey estimated 430 (CV=72%) (Barlow 2003). The southern resident subpopulation that inhabits the inland waters of Washington and southern British Columbia recently numbered 90 whales; it is apparently depleted and considered to be endangered (Ford et al. 2000; K. Balcomb pers. comm., Krahn et al. 2004). The northern resident subpopulation of British Columbia recently numbered 216 (Ford et al. 2000; Angliss and Outlaw 2005). The west coast transient subpopulation catalogue included 314 individual whales (Ford and Ellis 1999; Angliss and Outlaw 2005). A photographic catalogue of offshore type killer whales identified 211 individuals from British Columbia to California (Ford et al. 2000; Black et al. 1997), but this is likely an underestimate of the subpopulation size. A line-transect survey extending out to 300nm offshore resulted in an estimate of 466 (CV=35%) in California and 898 (CV=35%) in Washington and Oregon (Barlow 2003); these estimates likely include whales from the aforementioned west coast transient, southern resident, northern resident, and offshore subpopulations. A line-transect survey from the Aleutian Islands to the Gulf of Alaska resulted in an estimate of abundance for transient killer whales of 251 (CV=51%) (Zerbini et al. 2006), while the AT1 transient subpopulation (which inhabits Prince William Sound and waters of the Seward Peninsula, Alaska) numbers only 11 animals (Matkin et al. 1999; Angliss and Outlaw 2005). A Gulf of Alaska resident killer whale catalogue includes 507 individuals (Matkin et al. 1999) while a line-transect survey from the Aleutian Islands to the Gulf of Alaska resulted in an estimate of 991 (CV=51%) (Zerbini et al. 2006). Line-transect surveys suggest there are at least hundreds of killer whales in the western North Pacific, including waters around Japan (Miyashita 1993). Preliminary studies suggest as many as 700-800 killer whales may be in Russian waters of the Pacific, but an abundance estimate has yet to be calculated (Miranova et al. 2002).

Line-transect surveys have resulted in estimates of abundance in several regions in the North Atlantic, including an estimate of 133 (CV=49%) in the northern Gulf of Mexico (Waring et al. 2006), 3,100 (CV=63%) in Norwegian waters (Øien 1990), and 6,618 (CV=32%) in Iceland and Faroes Islands waters (Gunnlaugsson and Sigurjónsson 1990; Sigurjónsson et al. 1989).

Several analyses of line-transect surveys have yielded abundance estimates for killer whales around Antarctica (Ohsumi 1981; Hammond 1984; Kasamatsu and Joyce 1995); however, some of the estimates have been considered biased by methodology and survey coverage (Branch and Butterworth 2001). More recent analyses that account for some of these biases resulted in an estimate of about 25,000 for waters south of 60ºS (Branch and Butterworth 2001); however, there are still uncertainties related to coverage of areas in the pack ice, so true abundance could be higher. Densities are known to vary locally within Antarctic waters, ranging from very abundant to uncommon (Secchi et al. 2002; Pitman and Ensor 2003), and it has been recognized that killer whale densities are higher closer to the ice edge, where the smaller-type killer whales can occur in large aggregations of tens to hundreds of animals (Berzin and Vladimirov 1983; Pitman and Ensor 2003). Photo-identification studies have found 25-30 whales around Marion Island (Keith et al. 2001). In other parts of the southern Hemisphere, an estimate of 119 (CV=20%) has been made in New Zealand waters (Visser 2000), and 30 have been identified off Argentina (Lopez and Lopez 1985; Iñíguez 2001).

Although the available data are far from complete, abundance estimates for the areas that have been sampled provide a minimum worldwide abundance estimate of about 50,000 killer whales. It is likely that the total abundance is higher, because estimates are not available for many high-latitude areas of the northern hemisphere and for large areas of the South Pacific, South Atlantic, and Indian Ocean. However, this population abundance refers to several forms of killer whales that may be recognized as different species or subspecies in the future (Reeves et al. 2004).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Killer whales have been exploited at low levels in several regions world-wide (Jefferson et al. 1993). Norwegian whalers in the eastern North Atlantic took an average of 56 whales per year from 1938 to 1981. The Japanese took an average of 43 whales per year along their coastal waters from 1946 to 1981. The Soviets, whaling primarily in the Antarctic, took an average of 26 animals annually from 1935 to 1979 and then took 916 animals in the 1979/80 Antarctic season (Dahlheim and Heyning 1999; Reyes 1991). Killer whales are still taken in small numbers in coastal fisheries in Japan, Greenland, Indonesia, and the Caribbean islands (Reeves et al. 2003).

Fishermen in many areas see killer whales as competitors, and intentional shooting of whales is known to occur. This problem is especially serious in Alaska, where depredation of longline fisheries is extensive (Jefferson et al. 1993; Yano and Dahlheim 1995; Donohue et al. 2003). Depredation of long-line catches appears to be a recent and increasing phenomenon, and now occurs in many regions (e.g., Aleutian Islands Alaska, South Georgia, Crozet Island, and several other southern ocean island areas, Australia, and other locations in the south Pacific).

During the period 1976-1988, 59 whales were captured alive off Iceland, of which 8 were released, 3 died and 48 (an average 3.7 per year) were exported to aquaria (Reyes 1991). Live-captures of several killer whales have also taken place in Japanese waters (Reyes 1991). Bycatch in trawl and driftnet fishing operations occur, but are considered rare (Dahlheim and Heyning 1999).

Persistent bio-accumulating contaminants have recently been found to present a serious potential risk to some killer whale subpopulations. Ross et al. (2000) report that total PCB concentrations were very high in three killer whales subpopulations (2 resident and 1 transient) frequenting the coastal waters of British Columbia, Canada. Transient killer whales were particularly contaminated due to their high trophic position in the marine ecosystem. PCB levels in most killer whales sampled were greater than levels established at which adverse effects occur in harbor seals, suggesting that the majority of free-ranging killer whales in this region are at risk of toxic effects. The southern resident and transient killer whales of British Columbia and Washington can be considered among the most contaminated cetaceans in the world (Ross et al. 2000).

Habitat disturbance may be a matter for concern in areas inhabited by killer whales and supporting whale-watching industries (Reyes 1991). Moving boats can disrupt activities such as foraging and resting, and underwater boat noise could affect social and echolocation signals of the whales or otherwise interfere with foraging (Erbe 2002; Williams et al. 2002). For example, close approaches by whale-watching vessels have been shown to result in avoidance responses by resident killer whales in British Columbia, which may result in energetic costs for whales frequently subjected to whale watching activity (Williams et al. 2002, 2006). Fast-moving boats in the proximity of killer whales also present a risk of collision or injury from propellers. Visser (1999) reports on propeller scars observed on killer whales in New Zealand and their possible causes of mortality.

Large-scale catastrophic oil spills have the potential to cause significant mortality of killer whales. The Exxon Valdez oil spill in Alaska was strongly correlated with the subsequent loss of several whales from a pod that had been seen swimming through light oil slicks early in the spill (Dahlheim and Matkin 1994). Oil spills may also have an indirect effect by reducing prey abundance.

There have been large-scale reductions in predatory fish populations (Myers and Worm 2003; Baum et al. 2003) and over-fishing and collapse of several important “prey” fish stocks world-wide (Jackson et al. 2001). There have also been dramatic declines in marine mammal populations throughout the world. The effects of such reductions in prey populations (both fish and marine mammal) and subsequent ecosystem changes on world-wide populations of killer whales are unknown but could result in population declines.

Due to their dietary specialization, some populations of killer whales could be especially vulnerable to a reduction of their food supply. In British Columbia and Washington State, many salmon stocks have significantly declined as a result of over-fishing, habitat degradation and reduced ocean survival. This is likely to affect fish-eating resident killer whale populations in that region (Ford et al. 2005). Mammal-hunting killer whales in British Columbia likely experienced periods of reduced prey availability due to depletion of pinniped populations prior to 1970 (Ford and Ellis 1999). The depletion of the Mediterranean bluefin tuna stock is considered a source of concern for the survival of the Gibraltar killer whales (Cañadas and de Stephanis 2006).

Predicted impacts of global climate change on the marine environment may negatively affect certain killer whale subpopulations more than others through changes in prey availability (see e.g. Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: C : Not very threatened throughout its range, communities often provide natural resources that when exploited alter the composition and structure over the short-term, or communities are self-protecting because they are unsuitable for other uses

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The orca is threatened by hunting, prey depletion, and exposure to human activities such as disturbance from boats including whale-watching crafts, particularly when they venture closer to shore (3). As it is the top predator it is particularly vulnerable to contaminants, which build up in the tissues of prey species and subsequently affect the predator (6). Furthermore, the captivity industry has posed a threat, taking live individuals for the aquarium trade (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is in Appendix II of CITES and Appendices I and II of CMS. The eastern North Atlantic as well as the eastern North Pacific subpopulations are included in Appendix II of CMS.

Further studies on subpopulation structure, abundance and life history are needed for most regions. Regional subpopulations of killer whales can be small and highly specialized, and therefore vulnerable to over-exploitation and habitat deterioration. Several small subpopulations have already been recognized as having a high risk of extinction. Many similar small subpopulations may exist worldwide but have not yet been fully identified and described. There are likely several subpopulations that qualify for a threatened category, and steps should proceed to assess their status.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biological Research Needs: Worldwide taxonomic review to determine subspecific status.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Few to several (1-12) occurrences appropriately protected and managed

Comments: Populations occur in "protected" waters of Washington, British Columbia, and Alaska; also protected by the Marine Mammals Protection Act. See IUCN (1991) for a brief discussion of international and national protection regulations.

Needs: Worldwide ban on hunting.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The orca is a UK Biodiversity Action Plan priority species (3). It is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (3). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by seven European countries, including the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Orcinus orca on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Killer whales are hunted and used for a number of things. In various parts of the world, they are used for oil and meat. Meat is sold for human consumption or used for fertilizer or bait.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Current primary use: public display in marine aquaria, where generally long-lived and popular. Taken in local cetacean fisheries in various parts of the range; used for human food, animal food, and as source of oil (IUCN 1991). In some areas, regarded by fishermen as a nuisance due to destruction of fishes and fishing gear (see examples in IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Killer whale

The killer whale (Orcinus orca), commonly referred to as the orca whale or orca, and less commonly as the blackfish, is a toothed whale belonging to the oceanic dolphin family. Killer whales are found in all oceans, from the frigid Arctic and Antarctic regions to tropical seas. Killer whales as a species have a diverse diet, although individual populations often specialize in particular types of prey. Some feed exclusively on fish, while others hunt marine mammals such as sea lions, seals, walruses and even large whales. Killer whales are regarded as apex predators, lacking natural predators.

Killer whales are highly social; some populations are composed of matrilineal family groups which are the most stable of any animal species.[5] Their sophisticated hunting techniques and vocal behaviors, which are often specific to a particular group and passed across generations, have been described as manifestations of culture.[6]

The IUCN currently assesses the orca's conservation status as data deficient because of the likelihood that two or more killer whale types are separate species. Some local populations are considered threatened or endangered due to prey depletion, habitat loss, pollution (by PCBs), capture for marine mammal parks, and conflicts with fisheries. In late 2005, the "southern resident" population of killer whales that inhabits British Columbia and Washington state waters were placed on the U.S. Endangered Species list.

Wild killer whales are not considered a threat to humans,[7] although there have been cases of captives killing or injuring their handlers at marine theme parks. Killer whales feature strongly in the mythologies of indigenous cultures, with their reputation ranging from being the souls of humans to merciless killers.

Contents

Taxonomy and evolution

Orcinus citoniensis fossil, an extinct species of the same genus, Museo Capellini di Bologna

Orcinus orca is the only recognized extant species in the genus Orcinus, one of many animal species originally described by Linnaeus in 1758 in Systema Naturae.[8] Konrad Gessner wrote the first scientific description of a killer whale in his "Fish book" of 1558, based on examination of a dead stranded animal in the Bay of Greifswald that had attracted a great deal of local interest.[9]

The killer whale is one of 35 species in the oceanic dolphin family, which first appeared about 11 million years ago. The killer whale lineage probably branched off shortly thereafter.[7] Although it has morphological similarities with the pygmy killer whale, the false killer whale and the pilot whales, a study of cytochrome b gene sequences by Richard LeDuc indicated that its closest extant relatives are the snubfin dolphins of the genus Orcaella.[10]

Common names

English-speaking scientists most often use the term killer whale,[11] although the term orca is increasingly used. Killer whale advocates point out that it has a long heritage. Indeed, the genus name Orcinus means "of the kingdom of the dead",[11] or "belonging to Orcus."[12] Ancient Romans originally applied orca (plural orcae) to these animals, possibly borrowing it from the Greek ὄρυξ, which referred (among other things) to a whale species. Since the 1960s, orca has steadily grown in popularity; both names are now used. The term orca is preferred by some to avoid the negative connotations of "killer",[13] and because, being part of the family Delphinidae, the species is more closely related to other dolphins than to whales.[14]

They are sometimes referred to as blackfish, a name used for some whale species as well. Grampus is a former name for the species, but is now seldom used. This meaning of grampus should not be confused with the Grampus genus, whose only member is Risso's Dolphin.[15]

Types

Some examples of variations in killer whales

There are three to five types of killer whales that may be distinct enough to be considered different races,[16] subspecies, or possibly even species.[17] The IUCN reported in 2008, "The taxonomy of this genus is clearly in need of review, and it is likely that O. orca will be split into a number of different species or at least subspecies over the next few years."[2] In the 1970s and 1980s, research off the west coast of Canada and the United States identified the following three types:

  • Resident: These are the most commonly sighted of the three populations in the coastal waters of the northeast Pacific. Residents' diet consists primarily of fish and sometimes squid, and they live in complex and cohesive family groups called pods.[18] Female residents characteristically have a rounded dorsal fin tip that terminates in a sharp corner.[19] They visit the same areas consistently. British Columbia and Washington resident populations are amongst the most-intensively studied marine mammals. Researchers have identified and named over 300 killer whales over the past 30 years.[20]
  • Transient: The diet of these whales consists almost exclusively of marine mammals; they do not eat fish.[19] Transients generally travel in small groups, usually of two to six animals, and have less persistent family bonds than residents. Transients vocalize in less variable and less complex dialects. Female transients are characterized by more triangular and pointed dorsal fins than those of residents.[19] The gray or white area around the dorsal fin, known as the "saddle patch", often contains some black colouring in residents. However, the saddle patches of transients are solid and uniformly gray.[19] Transients roam widely along the coast; some individuals have been sighted in both southern Alaska and California.[21]
  • Offshore: A third population of killer whales in the northeast Pacific was discovered in 1988, when a humpback whale researcher observed them in open water. As their name suggests, they travel far from shore and feed primarily on schooling fish.[22] However, because of the large, scarred and nicked dorsal fins resembling those of mammal-hunting transients, they may also eat mammals and sharks. They have mostly been encountered off the west coast of Vancouver Island and near the Queen Charlotte Islands. Offshores typically congregate in groups of 20–75, with occasional sightings of larger groups of up to 200.[23] Currently, little is known about their habits, but they are genetically distinct from residents and transients. Offshores appear to be smaller than the others, and females are characterized by dorsal fin tips that are continuously rounded.[19]
Killer whale mother and calf extending their bodies above the water surface, from pectoral fins forward, with ice-pack in background
Type C killer whales in the Ross Sea. The eye patch slants forward.

Transients and residents live in the same areas, but avoid each other.[24] The name "transient" originated from the belief that these killer whales were outcasts from larger resident pods. Researchers later discovered transients are not born into resident pods or vice-versa. The evolutionary split between the two groups is believed to have begun two million years ago.[25] Genetic data indicates that the types have not interbred for up to 10,000 years.[26]

Other populations have not been as well studied, although specialized fish-eating and mammal-eating killer whales have been distinguished elsewhere.[27] Separate populations of fish-eating and mammal-eating killer whales have been identified around the United Kingdom.[28][29] Fish-eating killer whales in Alaska and Norway have resident-like social structures, while mammal-eating killer whales in Argentina and the Crozet Islands behave more like transients.[30]

Three types have been documented in the Antarctic. Two dwarf species, named Orcinus nanus and Orcinus glacialis, were described during the 1980s by Soviet researchers, but most cetacean researchers are skeptical about their status, and it is difficult to link these directly to the types described below.[17]

  • Type A looks like a "typical" killer whale, a large, black and white form with a medium-sized white eye patch, living in open water and feeding mostly on minke whales.[17]
  • Type B is smaller than Type A. It has a large white eye patch. Most of the dark parts of its body are medium gray instead of black, although it has a dark gray patch called a "dorsal cape"[31] stretching back from its forehead to just behind its dorsal fin. The white areas are stained slightly yellow. It feeds mostly on seals.[17]
  • Type C is the smallest type and lives in larger groups than the others. Its eye patch is distinctively slanted forwards, rather than parallel to the body axis. Like Type B, it is primarily white and medium gray, with a dark gray dorsal cape and yellow-tinged patches. Its only observed prey is the Antarctic Cod.[17]
  • Type D was identified based on photographs of a 1955 mass stranding in New Zealand and six at-sea sightings since 2004. Immediately recognizable by its extremely small white eye patch, shorter than usual dorsal fin, and bulbous head (similar to a pilot whale). Its geographic range appears to be circumglobal in subantarctic waters between latitudes 40°S and 60°S. And although nothing is known about the Type D diet, it is suspected to include fish because groups have been photographed around longline vessels where they reportedly depredate Patagonian toothfish (Dissostichus eleginoides).[32][33]

Types B and C live close to the ice pack, and diatoms in these waters may be responsible for the yellowish coloring of both types.[17][34] Mitochondrial DNA sequences support the theory that these are separate species that have recently diverged.[35] More recently, complete mitochondrial sequencing indicates that the two Antarctic groups that eat seals and fish should be recognized as distinct species, as should the North Pacific transients, leaving the others as subspecies pending additional data.[36]

Research is ongoing into the genetic relationships among killer whale types, and whether the types that have been identified represent deep evolutionary trends. For example, it was long thought that mammal-eating killer whales were likely to be closely related to other mammal-eating killer whales from different regions, but genetic testing refuted this hypothesis.[37]

Description

Diagram showing a killer whale and scuba diver from the side. The whale is about four times longer than the person, who is roughly as long as the whale's dorsal fin.
Size comparison to an average human.
Killer whale with only top of back and dorsal fin visible above water surface. The dorsal fin curves backward at the tip.
The dorsal fin and saddle patch of a resident killer whale in the northeastern Pacific Ocean. It may be either an adult female, or a juvenile of either sex.

Killer whales distinctively bear a black back, white chest and sides, and a white patch above and behind the eye. Calves are born with a yellowish or orange tint, which fades to white. Killer whales have a heavy and robust body[38] with a large dorsal fin up to 2 metres (6.6 ft) tall. Behind the fin, they have a dark grey "saddle patch" across the back. Antarctic killer whales may have pale grey to nearly white backs. Adult killer whales are very distinctive and are not usually confused with any other sea creature.[39] When seen from a distance, juveniles can be confused with other cetacean species such as the false killer whale or Risso's dolphin.[40] The killer whale's teeth are very strong and covered in enamel. Its jaws are a powerful gripping apparatus, as the upper teeth fall into the gaps between the lower teeth when the mouth is closed. The front teeth are inclined slightly forward and outward, thus allowing the killer whale to withstand powerful jerking movements from its prey while the middle and back teeth hold it firmly in place.[41]

Killer whales are the largest extant members of the dolphin family. Males typically range from 6 to 8 metres (20–26 ft) long and weigh in excess of 6 tonnes (5.9 long tons; 6.6 short tons).[42] Females are smaller , generally ranging from 5 to 7 metres (16–23 ft) and weighing about 3 to 4 tonnes (3.0 to 3.9 long tons; 3.3 to 4.4 short tons).[42] The largest male killer whale on record was 9.8 metres (32 ft), weighing over 10 tonnes (9.8 long tons; 11 short tons), while the largest female was 8.5 metres (28 ft), weighing 7.5 tonnes (7.4 long tons; 8.3 short tons).[43] Calves at birth weigh about 180 kilograms (400 lb) and are about 2.4 metres (7.9 ft) long.[44][45] The killer whale's large size and strength make it among the fastest marine mammals, able to reach speeds in excess of 30 knots (56 km/h).[46] The skeleton of the killer whale is of the typical delphinid structure but is more robust in all respects.[47] The killer whale's integument, unlike that of most other dolphin species, is characterised by a well-developed dermal layer with a dense network of fascicles of collagen fibers.[48]

Killer whale pectoral fins are large and rounded, resembling paddles. Males have significantly larger pectoral fins than females. At about 1.8 metres (5.9 ft) the male's dorsal fin is more than twice the size of the female's and is more of a triangular shape—a tall, elongated isosceles triangle—whereas hers is shorter and more curved.[49] Males and females also have different patterns of black and white skin in the genital area.[50] Sexual dimorphism is also apparent in the skull; adult males have a longer lower jaw than females, and have a larger occipital crest.[48]

Individual killer whales can often be identified from the dorsal fin and saddle patch. Variations such as nicks, scratches, and tears on the dorsal fin and the pattern of white or grey in the saddle patch are unique. Published directories contain identifying photographs and names for hundreds of North Pacific animals. Photo identification has enabled the local population of killer whales to be counted each year rather than estimated and has enabled great insight into lifecycles and social structures.[51]

White killer whales occur sporadically among normal killer whales, but are rare. They have been spotted in the northern Bering Sea and around St. Lawrence Island, and near the Russian coast.[52][23] In February 2008, a white killer whale was photographed 2 miles (3.2 km) off Kanaga Volcano in the Aleutian Islands.[52][23]

Killer whales have good eyesight above and below the water, excellent hearing, and a good sense of touch. They have exceptionally sophisticated echolocation abilities, detecting the location and characteristics of prey and other objects in their environment by emitting clicks and listening for echoes.[53]

Life cycle

Back and dorsal fin of killer whale projecting above the sea surface, including the grey saddle patch and part of the white eye patch. The dorsal fin rises steeply to a rounded point.
An adult male killer whale with its characteristic tall dorsal fin swims in the waters near Tysfjord, Norway

Female killer whales mature at around age 15. They then have periods of polyestrous cycling with non-cycling periods of between 3 and 16 months. Gestation varies from 15 to 18 months. Mothers calve, with usually a single offspring, about once every 5 years. In resident pods, birth occurs at any time of year, although winter is the most popular. Mortality is extremely high during the first six to seven months of life, when 37–50% of all calves die.[54] Weaning begins at about 12 months and completes by the age of two. According to observations in several regions, all male and female killer whale pod members participate in the care of the young.[55] Killer Whales and Pilot whales are the only non-human species in which the females go through menopause and live for decades after they have finished breeding.[56] Killer whales are unique among cetaceans, as their heads become shorter as they age.[48]

Females breed until age 40, meaning that on average they raise five offspring. The lifespan of wild females averages 50 years, with a maximum of 80–90 years.[57] Males sexually mature at the age of 15 but do not typically reproduce until age 21. Wild males live around 29 years on average, with a maximum of 50–60 years.[57] One male, known as Old Tom, was reportedly spotted every winter between the 1840s and 1930 off New South Wales, Australia. This would have made him up to 90 years old. Examination of his teeth indicated he died around age 35,[58] but this method of age determination is now believed to be inaccurate for older animals.[59] One male known to researchers in the Pacific Northwest (identified as J1) was estimated to have been 59 years old when he died in 2010.[60] Captive killer whale lifespans are typically significantly shorter, usually less than 25 years; however, numerous individuals are alive in their thirties, and a few have reached their 40s. In many instances, the lifespans of killer whales depend on the will of the animal.[61][62]

Range and habitat

A killer whale bursts forward out of the water. Its head is just starting to point downward, and is about a body width above the surface.
To travel quickly, killer whales leap out of the water when swimming—a behaviour known as porpoising

Killer whales are found in all oceans and most seas. Due to their enormous range, numbers and density, distributional estimates are difficult to compare,[63] but they clearly prefer higher latitudes and coastal areas over pelagic environments.[64]

Systematic surveys indicate the highest densities of killer whales (>0.40 individuals per 100 km²) in the northeast Atlantic around the Norwegian coast, in the north Pacific along the Aleutian Islands, the Gulf of Alaska and in the Southern Ocean off much of the coast of Antarctica.[63] They are considered "common" (0.20–0.40 individuals per 100 km²) in the eastern Pacific along the coasts of British Columbia, Washington and Oregon, in the North Atlantic Ocean around Iceland and the Faroe Islands. High densities have also been reported but not quantified in the western North Pacific around the Sea of Japan, Sea of Okhotsk, Kuril Islands, Kamchatka and the Commander Islands and in the southern hemisphere off the coasts of South Australia, Patagonia, off the coast of southern Brazil and the tip of southern Africa. They are reported as seasonally common in the Canadian Arctic, including Baffin Bay between Greenland and Nunavut, and around Tasmania and Macquarie Island.[63] Information for offshore regions and tropical waters is more scarce, but widespread, if not frequent, sightings indicate that the killer whale can survive in most water temperatures. There have been sightings, for example, in the Mediterranean, the Arabian Sea, the Gulf of Mexico and the Indian Ocean around the Seychelles.[63]

Probably the largest population lives in Antarctic waters, where they range up to the edge of the pack ice and are believed to venture into the denser pack ice, finding open leads much like beluga whales in the Arctic. In contrast, killer whales are seasonal summer visitors to Arctic waters, where they do not approach the ice pack. With the rapid Arctic sea ice decline in the Hudson Strait, their range now extends deep into the northwest Atlantic.[65]

Migration patterns are poorly understood. Each summer, the same individuals appear off the coasts of British Columbia and Washington State. Despite decades of research, where these animals go for the rest of the year remains unknown. Transient pods have been sighted from southern Alaska to central California.[66] Resident killer whales sometimes travel as much as 160 kilometres (100 mi) in a day, but may be seen in a general area for a month or more. Resident killer whale pod ranges vary from 320 to 1,300 kilometres (200 to 810 mi).

Occasionally, killer whales swim into freshwater rivers. They have been documented 100 miles (160 km) up the Columbia River in the United States.[67][68] They have also been found in the Fraser River in Canada and the Horikawa River in Japan.[67]

Population

Worldwide population estimates are uncertain, but recent consensus suggest an absolute minimum of 50,000.[2][23] Local estimates include roughly 25,000 in the Antarctic, 8,500 in the tropical Pacific, 2,250–2,700 off the cooler northeast Pacific and 500–1,500 off Norway.[69] Japan's Fisheries Agency estimated there were 2,321 killer whales in the seas around Japan.[70][71]

Feeding

Skeleton suspended on metal framework, which incorporates an outline of the soft tissue along a median cross-section of the animal. The jaws host many sharp teeth, and pectoral fin bones are attached to the lower ribs. The backbone stretches away out of frame; no hind limb bones can be seen. The outline includes an upright dorsal fin and rounded forehead.
A killer whale skeleton

Killer whales hunt varied prey; however, different populations/species tend to specialize and some can have a dramatic impact on certain preyed species.[72] For example, some populations in the Norwegian and Greenland sea specialize in herring and follow that fish's autumnal migration to the Norwegian coast. Other populations prey on seals. Salmon account for 96% of northeast Pacific residents' diet. 65% of them are large, fatty Chinook.[73] Chum salmon are also eaten, but smaller sockeye and pink salmon are not a significant food item.[74] Depletion of specific prey species in an area is therefore cause for concern for local populations, despite the high diversity of prey. On average, a killer whale eats 227 kilograms (500 lb) each day.[75]

Because some killer whales prey on large whales and sharks, they are considered to be apex predators. They are sometimes called the wolves of the sea, because they hunt in groups like wolf packs.[76]

Fish, reptiles and invertebrates

Fish-eating killer whales prey on around 30 species of fish, particularly salmon, herring, and tuna. In New Zealand, rays are killer whales' most frequent prey,[77] and they have also been observed hunting sharks (particularly makos, threshers and smooth hammerheads). Squid and sea turtles are also taken.[78]

A group of killer whales have surfaced. Four dorsal fins are visible, three of which curve backward at the tip.
Resident (fish-eating) killer whales. The curved dorsal fins are typical of resident females.

While salmon are usually hunted by an individual or a small group of individuals, herring are often caught using carousel feeding: the killer whales force the herring into a tight ball by releasing bursts of bubbles or flashing their white undersides. They then slap the ball with their tail flukes, either stunning or killing up to 10–15 at a time. The herring are then eaten one at a time. Carousel feeding has only been documented in the Norwegian killer whale population and with some oceanic dolphin species.[79]

Killer whales can induce tonic immobility in sharks and rays by holding them upside down, rendering them helpless and incapable of injuring the whale. Some sharks suffocate within about 15 minutes while the whale holds them still, because these sharks need to move to breathe. In one incident filmed near the Farallon Islands in October 1997, a female killed a 3–4-metre (9.8–13 ft) long great white shark,[80] apparently after swimming with it upside-down in her mouth and inducing tonic immobility in it. She and another pod member ate the shark's liver and allowed the rest of the carcass to sink.[81]

In July 1992, two killer whales attacked, killed and fed on an 8-metre (26 ft) long whale shark, Rhincodon typus, in the waters off Bahia de los Angeles in Baja California.[82]

Mammal prey

A pod of at least a dozen sea lions, swimming underwater.
California sea lions are common prey for mammal-eating killer whales on the west coast of North America.

Killer whales are very sophisticated and effective predators. Thirty-two cetacean species have been recorded as killer whale prey, from examining either stomach contents, scarring on the prey's body, or feeding activity. Groups even attack larger cetaceans such as minke whales, gray whales, and rarely sperm whales or blue whales.[27][83][84][85]

Hunting large whales usually takes several hours. Killer whales generally choose to attack young or weak animals instead. However, a group of five or more may attack a healthy adult. When hunting a young whale, a group chases it and its mother until they wear out. Eventually they separate the pair and surround the calf, preventing it from surfacing to breathe, drowning it. Pods of female sperm whales sometimes protect themselves by forming a protective circle around their calves with their flukes facing outwards, using them to repel the attackers.[86] Rarely, large killer whale pods can overwhelm even adult female sperm whales. Adult bull sperm whales, which are large, powerful and aggressive when threatened, and fully grown adult blue whales, who are possibly too large to overwhelm, are not believed to be predated by killer whales.[87]

Other marine mammal prey species include nearly 20 species of seal, sea lion and fur seal. Walruses and sea otters are less frequently taken. Often, to avoid injury, killer whales disable their prey before killing and eating it. This may involve throwing it in the air, slapping it with their tails, ramming it, or breaching and landing on it.[88] Sea lions are killed by head-butting or after a stunning blow from a tail fluke. In the Aleutian Islands, a decline in sea otter populations in the 1990s was controversially attributed by some scientists to killer whale predation, although there is no direct evidence of this.[89] The decline of sea otters followed a decline in harbour seal and Steller sea lion populations, the killer whale's preferred prey,[Note 1][91] which in turn may be substitutes for their original prey, now decimated by industrial whaling.[92][93][94]

In steeply banked beaches off Península Valdés, Argentina, and the Crozet Islands, killer whales feed on South American sea lions and southern elephant seals in shallow water, even beaching temporarily to grab prey before wriggling back to the sea. Beaching, usually fatal to cetaceans, is not an instinctive behavior, and can require years of practice for the young.[95]

Three killer whales swim along beside a large iceberg. Over 15 penguins stand on the berg; most of them are on the edge nearest the whales, and are looking towards them.
Killer whales swim by an iceberg with Adélie penguins in the Ross Sea, Antarctica. The Drygalski Ice Tongue is in the background.

"Wave-hunting" killer whales spy-hop to locate Weddell seals, crabeater seals and leopard seals resting on ice floes and then swim in groups to create waves that wash over the floe. This washes the seal into the water where other killer whales lie in wait.[96][97]

Killer whales have also been observed preying on terrestrial mammals, such as deer and moose swimming between islands off the northwest coast of North America.[90] Killer whale cannibalism has also been reported based on analysis of stomach contents, but this is likely to be the result of scavenging remains dumped by whalers.[98] One killer whale was also attacked by its companions after being shot.[27] Although resident killer whales have never been observed to eat other marine mammals, they occasionally harass and kill porpoises and seals for no apparent reason.[99]

Birds

Killer whales in many areas prey on several bird species, including penguins, cormorants and gulls.[100] A captive killer whale at MarineLand discovered that it could regurgitate fish onto the surface, attracting sea gulls, and then eat the birds. Four other killer whales then learned to copy the behavior.[101]

Behavior

The front half of a killer whale projects vertically out of the water, in a hole surrounded by the ice pack. The water surface is disturbed only by relatively small ripples.
Killer whales often raise their bodies out of the water in a behaviour called spyhopping.

Day-to-day killer whale behavior generally consists of foraging, travelling, resting and socializing. Killer whales are frequently active at the surface, engaging in acrobatic behaviors such as breaching, spyhopping, and tail-slapping. These activities may have a variety of purposes, such as courtship, communication, dislodging parasites, or play. Spyhopping, a behaviour in which a whale holds its head above water, helps the animal view its surroundings.[102]

Resident killer whales swim with porpoises, other dolphins, seals, and sea lions, which are common prey for transient killer whales.

Social structure

Killer whales are notable for their complex societies. Only elephants and higher primates, such as humans, live in comparably complex social structures.[55] Due to orcas' complex social bonds and society, many marine experts have concerns about how humane it is to keep these animals in captive situations.[103] Resident killer whales in the eastern North Pacific have a particularly complex and stable social grouping system. Unlike any other mammal species whose social structure is known, residents live with their mothers for their entire lives. These societies are based on matrilines consisting of the matriarch and her descendants who form part of the line, as do their descendants. The average size of a matriline is 5.5 animals.[104]

Because females can reach age 90, as many as four generations travel together. These matrilineal groups are highly stable. Individuals separate for only a few hours at a time, to mate or forage. With one exception, the killer whale named Luna, no permanent separation of an individual from a resident matriline has been recorded.[104]

Closely related matrilines form loose aggregations called pods, usually consisting of one to four matrilines. Unlike matrilines, pods may separate for weeks or months at a time.[104] DNA testing indicates that resident males nearly always mate with females from other pods.[105]

A killer whale leaping out of the water is about to land on its back.
Killer whales, like this one spotted near Alaska, commonly breach, often lifting their entire bodies out of the water.

Clans are the next level of resident social structure, and are composed of pods with similar dialects and common but older maternal heritage. Clan ranges overlap, mingling pods from different clans.[104]

The final association layer, perhaps more arbitrarily defined than the familial groupings, is called the community and is defined as a set of clans that regularly commingle. Clans within a community do not share vocal patterns.[Note 2]

Transient pods are smaller than resident pods, typically consisting of an adult female and one or two of her offspring. Males typically maintain stronger relationships with their mothers than females. These bonds can extend well into adulthood. Unlike residents, extended or permanent separation of transient offspring from natal matrilines is common, with juveniles and adults of both sexes participating. Some males become "rovers" and do not form long-term associations, occasionally joining groups that contain reproductive females.[106] As in resident clans, transient community members share an acoustic repertoire, although regional differences in vocalizations have been noted.[107]

Vocalizations

Multimedia relating to the orca

Like all cetaceans, killer whales depend heavily on underwater sound for orientation, feeding, and communication. Killer whales produce three categories of sounds: clicks, whistles, and pulsed calls. Clicks are believed to be used primarily for navigation and discriminating prey and other objects in the surrounding environment, but are also commonly heard during social interactions.[23]

Northeast Pacific resident groups tend to be much more vocal than transient groups in the same waters.[108] Residents feed primarily on Chinook and chum salmon, species that are insensitive to killer whale calls (inferred from the audiogram of Atlantic salmon). In contrast, the marine mammal prey of transients hear well underwater at the frequencies used in killer whale calls.

Transients are typically silent probably to avoid alerting their mammalian prey.[108] They sometimes use a single click (called a cryptic click) rather than the long train of clicks observed in other populations. Residents are only silent when resting.

All members of a resident pod use similar calls, known collectively as a dialect. Dialects are composed of specific numbers and types of discrete, repetitive calls. They are complex and stable over time. Call patterns and structure are distinctive within matrilines. Newborns produce calls similar to their mothers, but have a more limited repertoire.[107] Individuals likely learn their dialect through contact with their mother and other pod members.[109] For instance, family-specific calls have been observed more frequently in the days following a calf's birth, which may help the calf learn them.[110] Dialects are probably an important means of maintaining group identity and cohesiveness. Similarity in dialects likely reflects the degree of relatedness between pods, with variation building over time.[111]

Researchers have not determined whether calls have particular meanings or are associated with specific types of activity. Resident dialects contain 7–17 (mean = 11) distinctive call types. Transient dialects are much different, having only 4–6 discrete calls, none of which they share with residents. All members of the North American west coast transient community express the same basic dialect, although minor regional variation in call types is evident. Preliminary research indicates that offshore killer whales have group-specific dialects that are unlike those of residents and transients.[111]

Intelligence

Killer whales have the second-heaviest brains among marine mammals[112] (after Sperm whales, which have the largest brain of any animal). They can be trained in captivity and are often described as intelligent,[113][114] although defining and measuring "intelligence" is difficult in a species whose environment and behavioral strategies are very different from those of humans.[114]

A killer whale plays with a ball of ice, soon after a researcher had thrown a snowball at the whale.

Killer whales imitate others, and seem to deliberately teach skills to their kin. This is most strikingly seen when killer whales deliberately beach themselves to catch seals. Off Península Valdés, adults sometimes pull seals off the shoreline and then release them again near juvenile whales, allowing the younger whales to practice the difficult capture technique on the now-weakened prey. Off the Crozet Islands, mothers push their calves onto the beach, waiting to pull the youngster back if needed.[88][115]

People who have interacted closely with killer whales offer numerous anecdotes demonstrating the whales' curiosity, playfulness, and ability to solve problems. For example, Alaskan killer whales have not only learned how to steal fish from longlines, but have overcome a variety of techniques designed to stop them, such as the use of unbaited lines as decoys.[116] Once, fishermen placed their boats several miles apart, taking turns retrieving small amounts of their catch, in the hope that the whales would not have enough time to move between boats to steal fish as it was being retrieved. A researcher described what happened next:

"It worked really well for a while. Then the whales split into two groups. It didn't even take them an hour to figure it out. They were so thrilled when they figured out what was going on, that we were playing games. They were breaching by the boats."
—Craig Matkin[116]

In other anecdotes, researchers describe incidents in which wild killer whales playfully tease humans by repeatedly moving objects that the humans are trying to reach,[117][dead link] or suddenly start to toss around a chunk of ice after a human throws a snowball.[118]

The killer whale's use of dialects and the passing of other learned behaviours from generation to generation have been described as a form of culture.[119]

"The complex and stable vocal and behavioural cultures of sympatric groups of killer whales (Orcinus orca) appear to have no parallel outside humans and represent an independent evolution of cultural faculties."[6]

Conservation

Killer whale forges through small ice floes. Its back is dark from the head to just behind the dorsal fin, where there is a light grey saddle patch. Behind this, and on its lower side, its skin is an intermediate shade.
The Type C killer whale has two-toned gray colouring, including a dark "dorsal cape," in body areas where most killer whales have solid black colouring. Research is ongoing into whether one or more killer whale types is a distinct species in need of protection.

In 2008, the IUCN changed its assessment of the killer whale's conservation status from conservation dependent to data deficient, recognizing that one or more killer whale types may actually be separate, endangered species.[2] Depletion of prey species, pollution, large-scale oil spills, and habitat disturbance caused by noise and conflicts with boats are currently the most significant worldwide threats.[2]

Like other animals at the highest trophic levels, the killer whale is particularly at risk of poisoning from accumulation of toxins, including polychlorinated biphenyls (PCBs).[120] European Harbour seals have problems in reproductive and immune functions associated with high levels of PCBs and related contaminants, and a survey off the Washington coast found that PCB levels in killer whales were higher than levels that had caused health problems in harbour seals.[120] Blubber samples in the Norwegian Arctic show higher levels of PCBs, pesticides and brominated flame-retardants than in polar bears. When food is scarce, killer whales metabolize blubber for energy, which increases pollutant concentrations.

In the Pacific Northwest, wild salmon stocks, a main resident food source, have declined dramatically in recent years.[2] On the west coast of Alaska and the Aleutian Islands, seal and sea lion populations have also substantially declined.[121]

Two killer whales, one large and one small, swim close together. Their dorsal fins curve backward.
An adult female and her calf

In 2005, the United States government listed the southern resident community as an endangered population under the Endangered Species Act.[23] The southern resident community comprises three pods which live mostly in the Georgia and Haro Straits and Puget Sound in British Columbia and Washington. They do not breed outside of their community, which was once estimated at around 200 animals and later shrank to around 90.[122] In October 2008, the annual survey revealed that seven were missing and presumed dead, reducing the count to 83.[123] This is potentially the largest decline in the population in the past ten years. These deaths can be attributed to declines in chinook salmon.[123]

A scientist by the name of Ken Balcomb has extensively studied killer whales since 1976. Balcomb is the research biologist responsible for discovering that U.S Navy sonar may harm killer whales. He studied killer whales from the Center for Whale Research which is located in Friday Harbor, Washington.[124] He was also able to study killer whales from "his home porch perched above Puget Sound, where the animals hunt and play in summer months."[124] In May 2003, Balcomb (along with other whale watchers near the Puget Sound coastline) noticed uncharacteristic behavior displayed by the killer whales. The whales seemed "agitated and were moving haphazardly, attempting to lift their heads free of the water" to escape the sound of the sonars.[124] "Balcomb confirmed at the time that strange underwater pinging noises detected with underwater microphones were sonar. The sound originated from a U.S. Navy frigate 12 miles (19 kilometers) distant, Balcomb said."[124] The impact of sonar waves on killer whales is potentially life threatening. Three years prior to Balcomb's discovery, research in the Bahamas showed that 14 beaked whales washed up on the shore. These whales were beached on the exact day that U.S Navy destroyers were activated into sonar exercise.[124] Out of the 14 whales beached, six of them died. These six dead whales were studied and CAT scans of the two of the whale heads showed hemorrhaging around the brain and the ears, which is consistent with decompression sickness.[124]

Another conservation concern was made public in September 2008 when Ottawa decided that it was not necessary to enforce further protections (including the Species at Risk Act in place to protect endangered animals along their habitats) for killer whales aside from the laws already in place. In response, to this decision a total of Six environmental groups sued the federal government in Vancouver, Canada claiming that killer whales were facing many threats on the British Columbia Coast and the federal government did nothing to protect the killer whales from these threats.[125] A legal and scientific non-profit organization called Ecojustice led the lawsuit and represented : the David Suzuki Foundation, Environmental Defence, Greenpeace Canada, International Fund for Animal Welfare, the Raincoast Conservation Foundation, and the Wilderness Committee.[125] Many scientists involved in this lawsuit including Bill Wareham, a marine scientist with the David Suzuki Foundation, noted increased boat traffic, water toxic wastes, and low salmon population as major threats putting approximately 87 killer whales[125] on the British Columbia Coast in danger.

A Killer whale with a tall, sharply pointed dorsal fin. Its saddle and eye patches are dark grey.
The last known AT1 pod offspring, AT3, swimming in Resurrection Bay

Noise from shipping, drilling, and other human activities is a significant concern in some key killer whale habitats, including Johnstone Strait and Haro Strait.[126] In the mid-1990s, loud underwater noises from salmon farms were used to deter seals. Killer whales also avoided the surrounding waters.[127] High-intensity sonar used by the Navy disturbs killer whales along with other marine mammals.[128] Killer whales are popular with whale watchers, which may stress the whales and alter their behavior, particularly if boats approach too closely or block their line of travel.[129]

The Exxon Valdez oil spill adversely affected killer whales in Prince William Sound and Alaska's Kenai Fjords region. Eleven members (about half) of one resident pod disappeared in the following year. The spill damaged salmon and other prey populations, which in turn damaged local killer whales. By 2009, scientists estimated the AT1 transient population (considered part of a larger population of 346 transients), numbered only 7 individuals and had not reproduced since the spill. This population is expected to die out.[130][131]

Relationship with humans

Indigenous cultures

Jade carving of a killer whale with exaggerated fins and bared teeth. Its body and fins are engraved with nested ovals and other patterns.
Haida sculpture by Bill Reid

The indigenous peoples of the Pacific Northwest Coast feature killer whales throughout their history, art, spirituality and religion. The Haida regarded killer whales as the most powerful animals in the ocean, and their mythology tells of killer whales living in houses and towns under the sea. According to these myths, killer whales took on human form when submerged, and humans who drowned went to live with them.[132] For the Kwakwaka'wakw, the killer whale was regarded as the ruler of the undersea world, with sea lions for slaves and dolphins for warriors.[132] In Kwakwaka'wakw and Nuu-chah-nulth mythology, killer whales may embody the souls of deceased chiefs.[132] The Tlingit of southeastern Alaska regarded the killer whale as custodian of the sea and a benefactor of humans.[133]

The Maritime Archaic people of Newfoundland also had great respect for killer whales, as evidenced by stone carvings found in a 4,000-year-old burial site at the Port au Choix National Historic Site.[134][135]

In the tales and beliefs of the Siberian Yupik people, killer whales are said to appear as wolves in winter, and wolves as killer whales in summer.[136][137][138][139] Killer whales are believed to assist their hunters in driving walrus.[140] Reverence is expressed in several forms: the boat represents the animal, and a wooden carving hung from the hunter's belt.[138] Small sacrifices such as tobacco are strewn into the sea for them.[140] Killer whales were believed to have helped the hunters even when in wolf guise, by forcing reindeer to allow themselves to be killed.[139]

"Killer" stereotype

In Western cultures, killer whales were historically feared as dangerous, savage predators.[141] The first written description of a killer whale was given by Pliny the Elder in circa AD 70, who wrote, "Orcas (the appearance of which no image can express, other than an enormous mass of savage flesh with teeth) are the enemy of [other whales]... they charge and pierce them like warships ramming."[142]

Killer whale silhouette, with two projections above shown above the blowhole.
Male killer whale depicted in St Mary's in Greifswald, Germany, 1545[9]

There have been very few confirmed attacks on humans by wild killer whales, none of which has been fatal.[143] In one instance, killer whales tried to tip ice floes on which a dog team and photographer of the Terra Nova Expedition was standing.[144] There is speculation that the sled dogs' barking may have sounded enough like seal calls to trigger the killer whale's hunting curiosity. In the 1970s, a surfer in California was bitten, and in 2005 a boy in Alaska who was splashing in a region frequented by harbor seals was bumped by a killer whale that apparently misidentified him as prey.[145] Unlike wild killer whales, captive killer whales are reported to have made nearly two dozen attacks on humans since the 1970s, some of which have been fatal.[146][147]

Competition with fishermen also led to killer whales being regarded as pests. In the waters of the Pacific Northwest and Iceland, the shooting of killer whales was accepted and even encouraged by governments.[141] As an indication of the intensity of shooting that occurred until fairly recently, about 25% of the killer whales captured in Puget Sound for aquaria through 1970 bore bullet scars.[148] The U.S. Navy claimed to have deliberately killed hundreds of killer whales in Icelandic waters in 1956.[149][150]

Modern Western attitudes

Western attitudes towards killer whales have changed dramatically in recent decades. In the mid 1960s and early 1970s, killer whales came to much greater public and scientific awareness, starting with the first live-capture and display of a killer whale known as Moby Doll, a resident that had been harpooned off Saturna Island in 1964.[141] So little was known at the time that it was nearly two months before the whale's keepers discovered what food (fish) it was willing to eat. To the surprise of those who saw him, Moby Doll was a docile, non-aggressive whale that made no attempts to attack humans.[151]

Killer whale wrapped in white cloth on a boat, surrounded by four people. A board braces its dorsal fin.
In 2002, the orphan Springer was successfully returned to her family.

Between 1964 and 1976, 50 killer whales from the Pacific Northwest were captured for display in aquaria, and public interest in the animals grew. Millions of people became interested in killer whales after viewing them in captivity. In the 1970s, research pioneered by Michael Bigg led to the discovery of the species' complex social structure, its use of vocal communication, and its extraordinarily stable mother-offspring bonds. Through photo-identification techniques, individuals were named and tracked over decades.[152]

Bigg's techniques also revealed that the Pacific Northwest population was small—in the low hundreds rather than the thousands that had been previously assumed.[141] The Southern Resident community alone had lost 48 of its members to captivity; by 1976, only 80 remained.[153] In the Pacific Northwest, the species that had unthinkingly been targeted became a cultural icon within a few decades.[122]

The public's growing appreciation also led to growing opposition to whale–keeping in aquaria. Only one whale has been taken in North American waters since 1976. In recent years, the extent of the public's interest in killer whales has manifested itself in several high-profile efforts surrounding individuals. Following the success of the 1993 film Free Willy, the movie's captive star Keiko was returned to the coast of his native Iceland. The director of the International Marine Mammal Project for the Earth Island Institute , David Phillips, led the efforts to return Keikoto the Iceland waters.[154] In 2002, the orphan Springer was discovered in Puget Sound, Washington. She became the first whale to be successfully reintegrated into a wild pod after human intervention, crystallizing decades of research into the vocal behavior and social structure of the region's killer whales.[125] The saving of Springer raised hopes that another young killer whale named Luna who had become separated from his pod could be returned to it. However, his case was marked by controversy about whether and how to intervene, and in 2006 Luna was killed by a boat propeller.[155]

Whaling

A killer whale swims alongside a whaling boat, with a smaller whale in between. Two men are standing, the harpooner in the bow and another manning the aft rudder, while four oarsmen are seated.
The killer whale named Old Tom swims alongside a whaling boat, flanking a whale calf. The boat is being towed by a harpooned whale (not visible here), near Eden, Australia.

The first records of commercial hunting of killer whales date to the 18th century in Japan. During the 19th and early 20th centuries, the global whaling industry caught immense numbers of baleen and sperm whales, but largely ignored killer whales because of their limited amounts of recoverable oil, their smaller populations, and the difficulty of taking them.[105] Once the stocks of larger species were depleted, killer whales were targeted by commercial whalers in the mid-20th century. Between 1954 and 1997, Japan took 1,178 killer whales and Norway took 987.[156] Over 3,000 killer whales were taken by Soviet whalers,[157] including an Antarctic catch of 916 in 1979–80 alone, prompting the International Whaling Commission to recommend a ban on commercial hunting of the species pending further research.[156] Today, no country carries out a substantial hunt, although Indonesia and Greenland permit small subsistence hunts.

Killer whales have helped humans hunting other whales.[158] One well-known example was in Eden, Australia, including the male known as Old Tom. Whalers more often considered them a nuisance, however, as they would gather to scavenge meat from the whalers' catch.[158] Some populations, such as in Alaska's Prince William Sound, may have been reduced significantly by whalers shooting them in retaliation.[16]

Captivity

A killer whale rises vertically above the pool surface, except its tail, with a trainer standing on its nose.
Lolita, at the Miami Seaquarium, is one of the oldest whales in captivity.

The killer whale's intelligence, trainability, striking appearance, playfulness in captivity and sheer size have made it a popular exhibit at aquariums and aquatic theme parks.[159] From 1976 to 1997, 55 whales were taken from the wild in Iceland, 19 from Japan, and three from Argentina. These figures exclude animals that died during capture.[159] Live captures fell dramatically in the 1990s, and by 1999, about 40% of the 48 animals on display in the world were captive–born.[159]

Organizations such as the World Society for the Protection of Animals and the Whale and Dolphin Conservation Society campaign against the practice of keeping them in captivity. In captivity they often develop pathologies, such as the dorsal fin collapse seen in 60–90% of captive males. Captives have vastly reduced life expectancies, on average only living into their 20s.[Note 3] In the wild, females who survive infancy live 50 years on average, and up to 70–80 years in rare cases. Wild males who survive infancy live 30 years on average, and up to 50–60 years.[160] Captivity usually bears little resemblance to wild habitat, and captive whales' social groups are foreign to those found in the wild. Critics claim that captive life is stressful due to these factors and the requirement to perform circus tricks that are not part of wild killer whale behavior.[161] Wild killer whales travel up to 160 kilometres (100 mi) each day, and critics say that the animals are too big and intelligent to be suitable for captivity.[113]

In a 2011 CNN Justice news article Bill Mears and Tom Cohen wrote about a lawsuit that PETA (People for the Ethical Treatment of Animals) pursued against SeaWorld. PETA filed a "20-page complaint asks the U.S. District Court in Southern California to declare that the five whales – Tilikum, Katina, Corky, Kasatka, and Ulises – are being held in slavery or involuntary servitude in violation of the 13th Amendment."[162] PETA claims that the 13th amendment technically does not state that it solely applies to non-human animals.[162] Ric O'Barry and two former SeaWorld trainers supported PETA in moving forward with this lawsuit.[162] Legal cases in State and federal courts dealing with animal cruelty tend to be based on human actions solely because animals cannot actually be prosecuted or actively participate as plaintiffs and defendants on trial.

In 1970 a killer whale, later named Lolita, was captured from the Puget Sound waters and since then has been performing at Miami Seaqurium for more than 40 years. During these four decades celebrities, children, and a Washington state governor have campaigned to free Lolita.[163] One of the Lolita supporters is Howard Garret. Howard Garret is a co-founder of the non-profit Orca Network located on Whidbey Island, Wash.[163] Garret believes that Lolita has a strong memory of her life and her family in her former natural habitat. The Miami Seaquarium argues that Lolita's interaction and dependence on her human caregivers supersedes her natural survival instincts, thus she would not survive on her own in the wild.[163] They also argue that human and boat activity, as well as pollution are serious threats to killer whales. In December of 2011 supporters offered $1 million dollars[163] to have Lolita freed from the Miami Seaquarium. After campaign and financial efforts to free Lolita were denied by the Miami Seaquarium activists are suing the federal government in federal court in Seattle with the argument that Lolita should have been protected when other Southern region orcas were listed as endangered species in 2005.[163] The Endangered Species Act (ESA) deems it illegal to "harass, harm, pursue, shoot, wound, kill, trap, capture, or collect" to any species put on the list.[164] The Miami Sequarium did not wish to comment on the lawsuit, instead the Miami Seaquarium released a statement highlighting Lolita's life in captivity as active, healthy, and well cared for.[163] One plaintiff in the lawsuit named Carter Dillard, chief counsel for the Animal Legal Defense Fund, suggested that Lolita be moved to a larger "sea pen" home where Lolita would be able to swim farther distances and interact with other killer whales.[164]

In February 2010, a 40-year-old SeaWorld Trainer named Dawn Brancheau was killed by a 12,300-lb male[154] killer whale named Tillikum. The fatal event occurred after a show called "Dine with Shamu" at SeaWorld's Shamu Stadium in Orlando, Florida. The Orange County sheriff's spokesman Jim Solomons stated that Brancheau slipped and fell into the 35-foot-deep tank, where one of the killer whales fatally injured her.[165] However, other witnesses maintain that Dawn Brancheau was violently grabbed and attacked by the killer whale. Lori Miller, who attended the show at SeaWorld prior to the death of the trainer, spoke on "Larry King Live" saying the trainers had a hard time getting the killer whales to perform.[165] Captives occasionally act aggressively towards themselves, their tankmates, or humans, which critics say is a result of stress.[146] A spokesperson for PETA commented on this incident and referred to it as "a tragedy that didn't have to happen."[165] Before Brancheau's death two other trainers were involved in incidents with killer whales at SeaWorld. In 1999, a 27-year-old man sneaked into the park after closing, and his body was later discovered floating on his back in Tillikum's tank.[165] Another SeaWorld trainer was seriously injured during a show at the Shamu Stadium after being grabbed by a killer whale and held underwater in 2006.[165]

See also

Notes

  1. ^ According to Baird,[90] killer whales prefer harbour seals to sea lions and porpoises in some areas.
  2. ^ In the northeast Pacific, three communities of fish-eating killer whales have been identified: the southern community (1 clan, 3 pods, 90 killer whales as of 2006), the northern community (3 clans, 16 pods, 214 killer whales as of 2000), and the south Alaskan community (2 clans, 11 pods, 211 killer whales as of 2000).
  3. ^ Although there are examples of killer whales living longer, including several over 30 years old, and two captive orcas (Corky II and Lolita) are in their mid-40s.

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300074. 
  2. ^ a b c d e f Taylor, B. L., Baird, R., Barlow, J., Dawson, S. M., Ford, J., Mead, J. G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R. L. (2008). 'Orcinus orca'. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 2009-01-01.
  3. ^ "Orcinus Fitzinger, 1860". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180468. Retrieved 9 March 2011. 
  4. ^ "Orcinus orca (Linnaeus, 1758)". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180469. Retrieved 9 March 2011. 
  5. ^ Ford, Ellis & Balcomb 2000, p. 12
  6. ^ a b Rendell, Luke, and Hal Whitehead (2001). "Culture in whales and dolphins". Behavioral and Brain Sciences 24 (2): 309–324. doi:10.1017/S0140525X0100396X. PMID 11530544. http://whitelab.biology.dal.ca/lr/bbs.htm. Retrieved 2010-03-07. 
  7. ^ a b Carwardine 2001, p. 19
  8. ^ (Latin) Linnaeus, C. (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I (10th ed.). Holmiae. (Laurentii Salvii). p. 824. http://www.biodiversitylibrary.org/item/10277#3. 
  9. ^ a b Zum Wal in der Marienkirche (in German). St. Mary's Church, Greifswald. Retrieved 2010-02-16
  10. ^ LeDuc, R. G.; Perrin, W. F.; Dizon, A. E. (1999). "Phylogenetic relationships among the delphinid cetaceans based on full cytochrome b sequences". Marine Mammal Science 15 (3): 619–648. doi:10.1111/j.1748-7692.1999.tb00833.x. http://onlinelibrary.wiley.com/doi/10.1111/j.1748-7692.1999.tb00833.x/abstract. 
  11. ^ a b Ford, Ellis & Balcomb 2000, p. 69
  12. ^ Killer Whales. Scientific Classification, Seaworld.org, 23 September 2010, Retrieved 2010-09-09.
  13. ^ Olsen, Ken. Orcas on the Edge – Killer: It's a Name, Not an Accusation. National Wildlife Federation. 10 January 2006. Retrieved 2010-01-26.
  14. ^ Best, P.B. 2007 Whales and Dolphins of the Southern African Subregion ISBN 978-0-521-89710-5
  15. ^ Leatherwood, Stephen and Larry J. Hobbs (1988). Whales, dolphins, and porpoises of the eastern North Pacific and adjacent Arctic waters: a guide to their identification, p. 118. Courier Dover Publications. ISBN 0-486-25651-0 Retrieved 2010-01-28.
  16. ^ a b (Baird 1999). Status of Killer Whales in Canada. Contract report to the Committee on the Status of Endangered Wildlife in Canada, Ottawa, ON, Canada. Also published as Status of Killer Whales, Orcinus orca, in Canada The Canadian Field-Naturalist 115 (4) (2001), 676–701. Retrieved 2010-01-26.
  17. ^ a b c d e f Pitman, Robert L. and Ensor, Paul (2003). "Three forms of killer whales (Orcinus orca) in Antarctic waters". Journal of Cetacean Research and Management 5 (2): 131–139. http://swfsc.noaa.gov/uploadedFiles/Divisions/PRD/Programs/Ecology/PitmanandEnsor2003JCRM.pdf. 
  18. ^ Berta, Annalisa; Sumich, James L.; Kovacs, Kit M. (2006). Marine mammals: evolutionary biology. Academic Press. p. 387. ISBN 978-0-12-088552-7. 
  19. ^ a b c d e Carwardine 2001, pp. 40–47
  20. ^ Ford, Ellis & Balcomb 2000, p. 23
  21. ^ NMFS 2005, p. 24
  22. ^ Ford, Ellis & Balcomb 2000, p. 21
  23. ^ a b c d e f Rare White Killer Whale Spotted in Alaskan Waters From NOAA Ship Oscar Dyson, news release, National Oceanic and Atmospheric Administration, 6 March 2008. Retrieved 2010-03-20
  24. ^ NMFS 2005, p. 23
  25. ^ Heimlich & Boran 2001, p. 22
  26. ^ Chadwick, Douglas H. (April 2005). "Investigating A Killer". National Geographic. 
  27. ^ a b c Jefferson, T. A.,; Stacey, P. J.; Baird, R. W. (1991). "A review of killer whale interactions with other marine mammals: predation to co-existence" (PDF). Mammal Reviews 21 (4): 151–180. doi:10.1111/j.1365-2907.1991.tb00291.x. http://swfsc.noaa.gov/uploadedFiles/Divisions/PRD/Publications/Jeffersonetal.1991(8).pdf. 
  28. ^ Bourton, Jody. Two killer whale types found in UK waters, Earth News, BBC, 5 January 2010. Retrieved 2010-02-23.
  29. ^ Foote, Andrew D.; Newton, Jason; Piertney, Stuart B.; Willerslev, Eske; Gilbert, M. Thomas P. (2009). "Ecological, morphological and genetic divergence of sympatric North Atlantic killer whale populations". Molecular Ecology 18 (24): 5207. doi:10.1111/j.1365-294X.2009.04407.x. PMID 20050301. http://www.orcanetwork.org/nathist/NoAtlantictypes.pdf. 
  30. ^ Ford, Ellis & Balcomb 2000, p. 27
  31. ^ Evans, W. E.; Yablokov, A. V. and Bowles, A. E. (1982). Geographic Variation in the Color Pattern of Killer Whales (Orcinus orca), Reports of the International Whaling Commission 32: 687–694. Retrieved 2010-02-16.
  32. ^ Pitman, Robert L.; Durban, John W.; Greenfelder, Michael; Guinet, Christophe; Jorgensen, Morton; Olson, Paula A.; Plana, Jordi; Tixier, Paul et al (2010). "Observations of a distinctive morphotype of killer whale (Orcinus orca), type D, from subantarctic waters". Polar Biology 34 (2): 303–306. doi:10.1007/s00300-010-0871-3. 
  33. ^ Rejcek, Peter. "The Antarctic Sun: News about Antarctica – Killer News". Antarcticsun.usap.gov. http://antarcticsun.usap.gov/science/contenthandler.cfm?id=2117. Retrieved 2011-02-16. 
  34. ^ Gorter, Uko. Newsletter of the Puget Sound Chapter of the American Cetacean Society, Spring 2004. Retrieved 2010-02-16.
  35. ^ Pitman, Robert L.; Robertson, Kelly M.; Leduc, Richard G. (2008). "Mitochondrial sequence divergence among Antarctic killer whale ecotypes is consistent with multiple species". Biology Letters 4 (4): 426. doi:10.1098/rsbl.2008.0168. PMC 2610147. PMID 18524738. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=2610147. 
  36. ^ Morin, Phillip A; Archer, Frederick; Foote, Andrew D; Vilstrup, Julia; Allen, Eric E; Wade, Paul; Durban, John; Parsons, Kim et al (2010). "Complete mitochondrial genome phylogeographic analysis of killer whales (Orcinus orca) indicates multiple species". Genome Research 20 (7): 908. doi:10.1101/gr.102954.109. 
  37. ^ Schrope, Mark (2007). "Food chains: Killer in the kelp". Nature 445 (7129): 703–705. doi:10.1038/445703a. PMID 17301765. 
  38. ^ Poncelet, Eric. Killer whale biology: Morphology. Retrieved 2010-02-16
  39. ^ Carwardine 2001, p. 20
  40. ^ "Wild Whales". Vancouver Aquarium. http://wildwhales.org/other-species/. Retrieved 2012-03-23. 
  41. ^ Heptner et al. 1996, p. 683
  42. ^ a b Baird 2002
  43. ^ "Killer Whales: Physical Characteristics". Seaworld.org. http://www.seaworld.org/infobooks/KillerWhale/physchkw.html. Retrieved 2009-12-30. 
  44. ^ Olsen, K. (2006). National Wildlife 44 (6) (October/November), 22–30
  45. ^ Stewart, D. (2001). National Wildlife 39 (1) (December/January), 54–59
  46. ^ Killer whale. Cetacean Research & Rescue Unit. Retrieved 2010-02-18
  47. ^ Heyning, J. E.; Dahlheim, M. E. (1988) Orcinus orca. Mammalian Species 304:1–9
  48. ^ a b c Heptner et al. 1996, p. 681
  49. ^ Orca (Killer whale). American Cetacean Society. Retrieved 2009-01-02
  50. ^ Ford, Ellis & Balcomb 2000, p. 45
  51. ^ Obee & Ellis 1992, pp. 1–27
  52. ^ a b Mary Pemberton. Rare white killer whale spotted in Alaska, MSNBC, 7 March 2008
  53. ^ Carwardine 2001, pp. 30–32
  54. ^ NMFS 2005, p. 35
  55. ^ a b Heimlich & Boran 2001, p. 35
  56. ^ What do Whales and Females have in Common?, Australian Geographic, 30 June 2010
  57. ^ a b Carwardine 2001, p. 26
  58. ^ Mitchell, E. and Baker, A. N. (1980). Age of reputedly old Killer Whale, Orcinus orca, 'Old Tom' from Eden, Twofold Bay, Australia, in: W. F. Perrin and A. C. Myrick Jr (eds.): Age determination of toothed whales and sirenians, pp. 143–154 Rep. Int. Whal. Commn (Special Issue 3), cited in Know the Killer Whale, The Dolphin's Encyclopaedia. Retrieved 2010-01-27
  59. ^ Olesiuk, Peter F.; Ellis, Graeme M. and Ford, John K. B. (2005). Life History and Population Dynamics of Northern Resident Killer Whales (Orcinus orca) in British Columbia, Research Document 2005/045, Canadian Science Advisory Secretariat, Fisheries and Oceans Canada. p. 33. Retrieved 2010-01-27
  60. ^ How Southern Resident Killer Whales are Identified, Center for Whale Research. Retrieved 2012-03-23
  61. ^ Hoyt, Erich; Howard E. Garrett; Naomi A. Rose (1995). "Observations of disparity between educational material related to killer whales (Orcinus orca) disseminated by public display institutions and the scientific literature" (PDF). http://www.orcanetwork.org/nathist/biennial.pdf. Retrieved 2010-02-16. 
  62. ^ Williams, Vanessa (2001). Captive Orcas 'Dying to Entertain You'. Whale and Dolphin Conservation Society. Retrieved 2010-02-16
  63. ^ a b c d Forney, K.A.; Wade, P. (2007). "Worldwide distribution and abundance of killer whales". In Brownell, James A.; DeMaster, Douglas P.; Doak, Daniel F. et al. Whales, whaling and ocean ecosystems. Berkeley: University of California Press. pp. 145–162. ISBN 978-0-520-24884-7. http://iwcoffice.org/_documents/sci_com/SC59docs/SC-59-ForInformation38.pdf. 
  64. ^ Carwardine 2001, p. 21
  65. ^ Kwan, Jennifer. Canada Finds Killer Whales Drawn to Warmer Arctic, Reuters, 22 January 2007. Retrieved 2010-01-26
  66. ^ NOAA 2005, pp. 24–29
  67. ^ a b Baird 2002, p. 10
  68. ^ Southern Resident Killer Whale Research – October 2003, Northwest Fisheries Science Center. Updated 2007-02-14. Retrieved 2010-01-26
  69. ^ NMFS 2005, p. 46
  70. ^ Ecology of Japanese Coastal Orcas, sha-chi.jp. Retrieved 2010-02-17
  71. ^ Ten Years after Taiji Orca Capture, 28 January 2007. Iruka (dolphin) and Kujira (whale) Action Network (IKAN): Iruma, Saitama Prefecture, Japan. Retrieved 2010-02-17
  72. ^ Morell, Virginia (2011). "Killer Whales Earn Their Name". Science 331 (6015): 274–276. doi:10.1126/science.331.6015.274. PMID 21252323. 
  73. ^ NMFS 2005, p. 18
  74. ^ Ford & Ellis 2006
  75. ^ Hughes, Catherine D.. "National Geographic creature feature". http://kids.nationalgeographic.com/kids/animals/creaturefeature/orca/. Retrieved 2007-07-25. 
  76. ^ "Orcinus orcaOrca (Killer Whale)". Marinebio.org. http://marinebio.org/species.asp?id=84. Retrieved 2007-06-26. 
  77. ^ Visser, Ingrid N. (2001). Mysteries of the Orca (PDF), Forest and Bird 301 (August), 22–26. Retrieved 2010-01-04. Archived October 17, 2007 at the Wayback Machine
  78. ^ NMFS 2005, p. 17
  79. ^ Similä, T. and Ugarte, F. (1993). "Surface and underwater observations of cooperatively feeding killer whales". Can. J. Zool. 71 (8): 1494–1499. doi:10.1139/z93-210. http://rparticle.web-p.cisti.nrc.ca/rparticle/AbstractTemplateServlet?calyLang=eng&journal=cjz&volume=71&year=1993&issue=8&msno=z93-210. Retrieved 2010-02-26. 
  80. ^ Heithaus, Michael (2001). "Predator–prey and competitive interactions between sharks (order Selachii) and dolphins (suborder Odontoceti): a review". Journal of Zoology (London: Cambridge University Press) 253: 53–68. doi:10.1017/S0952836901000061. http://www.science.fau.edu/sharklab/courses/elasmobiology/readings/heithaus.pdf. Retrieved 2010-02-26. 
  81. ^ "Wild: The Whale That Ate Jaws." National Geographic Channel. 25 November \2011. Retrieved 2010-01-03
  82. ^ O'Sullivan, J. B.; T., Mitchell (2000). "American Elasmobranch Society 16th Annual Meeting, 14–20 June 2000". La Paz, B.C.S., México. http://www.flmnh.ufl.edu/fish/meetings/abst2000c.htm. Retrieved 2010-02-18. 
  83. ^ Visser, Ingrid N (2010). "First Record of Predation on False Killer Whales (Pseudorca crassidens) by Killer Whales (Orcinus orca)". Aquatic Mammals: 195–204. doi:10.1578/AM.36.2.2010.195. 
  84. ^ Ford, J. K. B. and Reeves R. R. (2008). "Fight or flight: antipredator strategies of baleen whales". Mammal Review 38: 50–86. doi:10.1111/j.1365-2907.2008.00118.x. 
  85. ^ Santos, Marcos Cesar de Oliveira, and Netto, Denis Ferreira (2005). "Killer whale (Orcinus orca) predation on a franciscana dolphin (Pontoporia blainvillei) in Brazilian waters". Lajam 4 (1): 69–72. doi:10.5597/lajam00072. 
  86. ^ Pitman, Robert L. et al. (2001). "Killer Whale Predation on Sperm Whales: Observations and Implications". Marine Mammal Science 17 (3): 494–507. doi:10.1111/j.1748-7692.2001.tb01000.x. http://swfsc.noaa.gov/uploadedFiles/Divisions/PRD/Programs/Photogrammetry/2001_Pitman%20et%20al_MMS_OorcAttackPmac.pdf. 
  87. ^ Estes, et al (2007). Whales, Whaling, and Ocean Ecosystems. ISBN 978-0-520-24884-7. 
  88. ^ a b Heimlich & Boran 2001, p. 45
  89. ^ Pinell, Nadine, et al. "Transient Killer Whales – Culprits in the Decline of Sea Otters in Western Alaska?" B.C. Cetacean Sightings Network, 1 June 2004. Retrieved 2010-03-13
  90. ^ a b Baird 2002, p. 23
  91. ^ Killer Whales Develop a Taste For Sea Otters Ned Rozell, Article #1418, Alaska Science Forum, December 10, 1998. Retrieved 2010-02-26
  92. ^ Springer, A. M. (2003). "Sequential megafaunal collapse in the North Pacific Ocean: An ongoing legacy of industrial whaling?". Proceedings of the National Academy of Sciences 100 (21): 12223. doi:10.1073/pnas.1635156100. 
  93. ^ Demaster, D; Trites, A; Clapham, P; Mizroch, S; Wade, P; Small, R; Hoef, J (2006). "The sequential megafaunal collapse hypothesis: Testing with existing data". Progress in Oceanography. doi:10.1016/j.pocean.2006.02.007. 
  94. ^ Estes, J. A.; Doak, D. F.; Springer, A. M.; Williams, T. M. (2009). "Causes and consequences of marine mammal population declines in southwest Alaska: a food-web perspective". Philosophical Transactions of the Royal Society B: Biological Sciences 364 (1524): 1647. doi:10.1098/rstb.2008.0231. 
  95. ^ Carwardine 2001, p. 29
  96. ^ Visser, Ingrid N.; Smith, Thomas G.; Bullock, Ian D.; Green, Geoffrey D.; Carlsson, Olle G. L.; Imberti, Santiago (2008). "Antarctic peninsula killer whales (Orcinus orca) hunt seals and a penguin on floating ice". Marine Mammal Science 24: 225. doi:10.1111/j.1748-7692.2007.00163.x. http://www.grupofalco.com.ar/pedefes/Visser%20et%20al%202008.%20Antarctic%20killer%20whales%20on%20ice%20-%20Marine%20Mammals%20Science.pdf. 
  97. ^ BBC Nature – Killer whales make waves to hunt seals. Bbc.co.uk (2011-10-18). Retrieved on 2012-04-04.
  98. ^ Baird 2002, p. 124
  99. ^ Ford, Ellis & Balcomb 2000, p. 19
  100. ^ Baird 2002, p. 14
  101. ^ "Whale uses fish as bait to catch seagulls then shares strategy with fellow orcas". Associated Press. 2005-09-07. http://news.mongabay.com/2005/0907-ap.html. Retrieved 2010-02-18. 
  102. ^ Carwardine 2001, p. 64
  103. ^ "Keep Whales Wild". Keep Whales Wild. 2011-01-14. http://www.keepwhaleswild.org/. Retrieved 2011-02-16. 
  104. ^ a b c d NMFS 2005, p. 12
  105. ^ a b NMFS 2005, p. 39
  106. ^ NMFS 2005, p. 13
  107. ^ a b NMFS 2005, p. 14
  108. ^ a b NMFS 2005, p. 20
  109. ^ Filatova, Olga A.; Fedutin, Ivan D.; Burdin, Alexandr M. and Hoyt, Erich (2007). "The structure of the discrete call repertoire of killer whales Orcinus orca from Southeast Kamchatka". Bioacoustics 16: 261–280. http://russianorca.com/Doc/Science/structure_repert.pdf. 
  110. ^ Weiß, Brigitte M.; Ladich, Friedrich; Spong, Paul; Symonds, Helena (2006). "Vocal behaviour of resident killer whale matrilines with newborn calves: The role of family signatures". The Journal of the Acoustical Society of America 119 (1): 627. doi:10.1121/1.2130934. PMID 16454316. http://web.archive.org/web/20110527060306/http://www.coloradocollege.edu/dept/ev/Research/Faculty/OVALItems/pdf_Papers/SpongCalvesPaper.pdf. 
  111. ^ a b NMFS 2005, pp. 15–16
  112. ^ Spear, Kevin. Killer whales: How smart are they? Orlando Sentinel, 7 March 2010. Retrieved 2010-03-07
  113. ^ a b Associated Press. Whale Attack Renews Captive Animal Debate CBS News, 1 March 2010. Retrieved 2010-03-07
  114. ^ a b Carwardine 2001, p. 67
  115. ^ Baird 2002, pp. 61–62
  116. ^ a b Obee & Ellis 1992, p. 42
  117. ^ "Killer whale games". Blackfish Sounder 13: 5. 2005. http://www.killerwhale.org/BFS/BFS_13.pdf. Retrieved 2007-11-04. 
  118. ^ Pitman, Robert L. Scientist Has 'Snowball Fight' With a Killer Whale. Live Science, 6 February 2009. Retrieved 2010-03-07
  119. ^ Marino, Lori; et al. (2007). "Cetaceans Have Complex Brains for Complex Cognition". PLoS Biology 5 (e139): e139. doi:10.1371/journal.pbio.0050139. PMC 1868071. PMID 17503965. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1868071. 
  120. ^ a b Ford, Ellis & Balcomb 2000, p. 99
  121. ^ Ford, Ellis & Balcomb 2000, p. 98
  122. ^ a b M. L. Lyke, Granny's Struggle: When Granny is gone, will her story be the last chapter?, Seattle Post Intelligencer, 14 October 2006
  123. ^ a b Le Phuong. Researchers: 7 Orcas Missing from Puget Sound, Associated Press. USA Today, 25 October 2008
  124. ^ a b c d e f Pickrell, John (March 2004). "U.S Navy Sonar May Harm Killer Whales, Expert Says.". National Geographic News. http://news.nationalgeographic.com/news/2004/03/0331_040331_whalesincrisis.html. Retrieved 19 March 2012. 
  125. ^ a b c d "Ottawa Sued over Lack of Legislation to Protect B.C. Killers Whales". CBC News. 09 October 2008. http://www.cbc.ca/news/canada/british-columbia/story/2008/10/08/bc-killer-whale-lawsuit.html. Retrieved 19 March 2012. 
  126. ^ Ford, Ellis & Balcomb 2000, p. 100
  127. ^ Research on Orcas, Raincoast Research Society. Retrieved 2010-02-18
  128. ^ McClure, Robert (2003-10-02). "State expert urges Navy to stop sonar tests". Seattle Post Intelligencer. http://www.seattlepi.com/local/article/State-expert-urges-Navy-to-stop-sonar-tests-1125871.php. Retrieved 2007-06-25. 
  129. ^ Williams, Rob (2002). "Behavioural responses of male killer whales to a 'leapfrogging' vessel" (PDF). Journal of Cetacean Resource Management 4 (3): 305–310. http://www.nwfsc.noaa.gov/research/divisions/cbd/marine_mammal/kwworkshops/boatpubs/leapfrogging_williamsetal.pdf. 
  130. ^ "Unique Killer-Whale Pod Doomed by Exxon Valdez | Wired Science". Wired.com. http://www.wired.com/wiredscience/2009/03/valdezwhales/. Retrieved 2009-12-31. 
  131. ^ "Marine Ecology Progress Series 356:269" (PDF). http://www.whalesalaska.org/docs/m356p269.pdf. Retrieved 2009-12-31. 
  132. ^ a b c Francis & Hewlett 2007, pp. 115–120
  133. ^ Ford, Ellis & Balcomb 2000, p. 11
  134. ^ Rollmann, Hans (1999). Religion in Newfoundland and Labrador, Newfoundland and Labrador Heritage, Memorial University of Newfoundland. Retrieved 2010-01-26
  135. ^ Tuck, James A. (1971). "An Archaic Cemetery at Port Au Choix, Newfoundland". American Antiquity 36 (3): 343–358. doi:10.2307/277719. JSTOR 277719. 
  136. ^ The orphan boy with his sister, p. 156 in Rubcova, E. S. (1954). Materials on the Language and Folklore of the Eskimoes, Vol. I, Chaplino Dialect. Leningrad: Academy of Sciences of the USSR. Original data: Е.С. Рубцова: Материалы по языку и фольклору эскимосов (чаплинский диалект). Академия Наук СССР. Москва-Ленинград, 1954
  137. ^ Menovshchikov, G. A. (1962). Grammar of the language of Asian Eskimos. Vol. I., pp. 439, 441. Moscow and Leningrad: Academy of Sciences of the USSR. Original data: Г. А. Меновщиков: Грамматиκа языка азиатских эскимосов. Часть первая. Академия Наук СССР. Москва-Ленинград, 1962
  138. ^ a b Духовная культура (Spiritual culture), subsection of Support for Siberian Indigenous Peoples Rights (Поддержка прав коренных народов Сибири) — see the section on Eskimos
  139. ^ a b Vajda, Edward J. "Siberian Yupik (Eskimo)". East Asian Studies. http://pandora.cii.wwu.edu/vajda/ea210/aleut.htm. 
  140. ^ a b (Russian) Ковалева, Ирина & Богословская, Людмила (2002-12-03). Животные и отражение их прихода к человеку в самых разных текстах. Эхо Москвы. Арсенал.  A radio interview with Russian scientists about man and animal, examples taken especially from Asian Eskimos
  141. ^ a b c d Obee & Ellis 1992, pp. Chapter 1
  142. ^ Gaius Plinius Secundus. Historia Naturalis 9.5.12 (Latin), in Bill Thayer's LacusCurtius: Into the Roman World. (See also an English translation by John Bostock and Henry Thomas Riley, 1855.) Retrieved 2010-02-19.
  143. ^ "Orca shares the waves with local surfer". 3 News. 12 September 2008. http://www.3news.co.nz/Orca-shares-the-waves-with-local-surfer/tabid/423/articleID/71245/Default.aspx. Retrieved 13 October 2011. 
  144. ^ Cherry-Garrard, Apsley (2004). The Worst Journey in the World:Antarctic 1910–1913. Globe Pequot. p. 92. ISBN 1-59228-212-1. 
  145. ^ The Associated Press. "Boy survives bump from killer whale." The Seattle Times, 18 August 2005. Retrieved 2010-01-03
  146. ^ a b "ABC News: Killer Whale Attacks SeaWorld Trainer". ABC News. 30 November 2006. http://abcnews.go.com/GMA/story?id=2690153. Retrieved 2010-01-03. 
  147. ^ SeaWorld trainer killed by killer whale, CNN, 25 February 2010, Retrieved 2010-09-09
  148. ^ NMFS 2005, p. 41
  149. ^ Killer Whales Destroyed: VP-7 Accomplishes Special Task, Naval Aviation News, December, 1956, p. 19. Reproduced at Longevity and Causes of Death, SeaWorld/Busch Gardens ANIMALS. Retrieved 2010-01-11
  150. ^ "Naval War Declared Against Killer Whales". The Science News-Letter 69 (24): 374. 1956. JSTOR 3936619. 
  151. ^ Francis & Hewlett 2007, pp. 58–59
  152. ^ Baird 2002, pp. 73–80
  153. ^ Heimlich & Boran 2001, p. 11
  154. ^ a b Wood, Daniel (24 February 2010). "Death of Sea World trainer: Do 'killer whales' belong in theme parks?". The Christian Science Monitor. http://www.csmonitor.com/USA/2010/0224/Death-of-Sea-World-trainer-Do-killer-whales-belong-in-theme-parks. Retrieved 19 March 2012. 
  155. ^ McClure, Robert (11 March 2006). "Luna the orca killed by tugboat". Seattle Post-Intelligencer (Seattle, Washington: Hearst Corporation). http://www.seattlepi.com/local/article/Luna-the-orca-killed-by-tugboat-1198168.php. Retrieved 2009-04-08. 
  156. ^ a b Obee & Ellis 1992, p. 34
  157. ^ Killer Whale, Bergen Museum. Retrieved 2010-01-26
  158. ^ a b Reeves, Randall; Whitehead, Hal (2005). "Killer whales and whaling: the scavenging hypothesis". Biology Letters 1 (4): 415. doi:10.1098/rsbl.2005.0348. PMC 1626385. PMID 17148221. http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1626385. 
  159. ^ a b c NMFS 2005, pp. 43–44
  160. ^ "Orcas". Humane Society of the United States. http://www.hsus.org/marine_mammals/a_closer_look_at_marine_mammals/orcas.html. Retrieved 2010-01-09. [dead link]
  161. ^ "Orcas in captivity". Whale and Dolphin Conservation Society. http://www.wdcs.org/submissions_bin/cap-orc-glo-000016.pdf. Retrieved 2010-01-26. 
  162. ^ a b c Mears, Cohen, Bill, Tom (26 October 2011). "PETA Lawsuit Alleges SeaWorld Enslaves Killer Whales". CNN. http://articles.cnn.com/2011-10-26/justice/justice_killer-whale-lawsuit_1_killer-whales-orcinus-sea-world-trainers?_s=PM:JUSTICE. Retrieved 19 March 2012. 
  163. ^ a b c d e f Vallbona, Nuri (December 2 2011). "Whale Activists Sue to Free Lolita from Captivity". MSNBC US News. http://usnews.msnbc.msn.com/_news/2011/12/02/9169352-whale-activists-sue-to-free-lolita-from-captivity. Retrieved 19 March 2012. 
  164. ^ a b Welch, Craig (01 December 2011). "Captive orca could test Endangered Species Act". The Seattle Times. http://seattletimes.nwsource.com/html/localnews/2016910986_orcasuit02m.html. Retrieved 19 March 2012. 
  165. ^ a b c d e "SeaWorld trainer killed by killer whale". CNN U.S. 24 February 2010. http://articles.cnn.com/2010-02-24/us/killer.whale.trainer.death_1_killer-whale-trainer-seaworld-employees?_s=PM:US. Retrieved 19 March 2012. 
Bibliography

Further reading

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Dwarf killer whale

The Dwarf killer whale is a type of killer whale found in Antarctic waters believed by some scientists to be a distinct species from the larger killer whales found throughout the world's oceans. Primarily eating fish rather than mammals, this ecotype averages less than 6 metres in length.

Robert L. Pitman describes using aerial photogrammetry to determine the size of numerous Type C killer whales, supporting earlier Soviet research which suggested that one or possibly two distinct species of killer whale exist in the Southern Ocean.[1][2]

References

  1. ^ Pitman, Robert L. et al. A Dwarf Form of Killer Whale in Antarctica Journal of Mammalogy 88(1):43-48, 2007, CryptoMundo.com
  2. ^ Pitman, Robert L. and Ensor, Paul. "Three forms of killer whales (Orcinus orca) in Antarctic waters" Journal of Cetacean Resource Management 5(2):131–139, 2003
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Lolita (orca)

Lolita performing at Miami Seaquarium

Lolita is an orca housed at the Miami Seaquarium.

Over 40 years old (estimated birth, 1966 or 1967), Lolita is a large female orca measuring 20 feet in length and weighing approximately 7,000 pounds[1].

References

Lolita (Tokitae), the Killer Whale
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two forms of the killer whale occur in the coastal waters of North America from Washington to Alaska. The two groups, generally refered to as "transient" and "resident," differ in foraging behavior, habitat use, group dynamics, dorsal fin shape, pigmentation patterns, and mtDNA; apparently there is little or no gene flow between the two groups (see references in Baird et al. 1992). A third group consists of "offshore" killer whales.

Orcinus nanus and O. glacialis were described from antarctic waters in the early 1980s but, because of weak supporting evidence, these nominal species have not been accepted as valid by most authorities (O. nanus is a nomen nudum). Mead and Brownell (in Wilson and Reeder 1993, 2005) and Jones et al. (1992) regarded Orcinus as monotypic.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!