Articles on this page are available in 1 other language: Spanish (28) (learn more)

Overview

Brief Summary

Description

"The short-finned pilot whale is one of two species of the genus Globicephala living in North American waters, mostly in tropical to temperate waters of the continental shelf. ""Globicephala"" translates directly to the most prominent characteristic of the genus, its round head. Short-finned pilot whales travel in coordinated pods of about 25 individuals. These may be groups of closely related females of all ages and their offspring, plus one or a few adult males. In tropical waters, pods may join together to form large herds, and are sometimes seen ""logging,"" a behavior in which they all face the same direction and bob like floating logs. Presumably they are resting.  Males reach reproductive age at 13 and females at about 8 years. The average life span is about 45 years for males and 55 years for females. One unexplained phenomenon is that groups of these whales sometimes come ashore, strand, and die. Such strandings are relatively common on beaches in the Carolinas, Florida, and the Gulf of Mexico"

Links:
Mammal Species of the World
  • Original description: Gray, J. E., 1846.  On the cetaceous animals. Pp. 13-53, in The zoology of the voyage of H.M.S. Erebus and Terror, under the command of Capt. Sir J. C. Ross, R. N., F. R. S., during the years 1839 to 1843 (Sir J. Richardson and J. E. Gray, eds.) [1844-1875], 1:33.  E. W. Janson, London, 2 vols.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Short-finned Pilot Whales are found in warm temperate to tropical waters of the world, generally in deep offshore areas (Reilly and Shane 1986, Olson and Reilly 2002). They do not usually range north of 50°N or south of 40°S. There is some distributional overlap with their long-finned relatives (G. melas is the only other species currently recognized), which appear to prefer cold temperate waters of the North Atlantic, Southern Hemisphere, and previously the western North Pacific. Only Short-finned Pilot Whales are currently thought to inhabit the North Pacific, although distribution and taxonomy of pilot whales in this area are still largely unresolved (Kasuya 1992). The two geographic forms of Short-Finned Pilot Whale off Japan have different, but partially-overlapping, distributions. The range includes the Sea of Japan. This species is not thought to inhabit the Mediterranean Sea, but it does occur in the southern Red Sea (Olson 2009). There are no confirmed accounts of Globicephala in the Persian Gulf, which is generally shallow with high salinity and turbidity (Boer et al. 2003, Preen 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The Pacific, or short-finned, pilot whale lives throughout the tropical and warm temperate waters of several oceans and associated seas and bays.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Comores, Eritrea, European waters (ERMS scope), Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Cosmopolitan in tropical, subtropical, and warm temperate waters; in North America, north mainly to the mid-Atlantic states and central California (sometimes to Alaska). Generally regarded as abundant within the range (IUCN 1991). See IUCN (1991) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Pilot whales are jet black with a white patch on their chin, which may extend dorsally to the anus. They have a large, blubous head, with no beak and a slightly prominent upper lip. There are 7-9 large, conical teeth in each side of the uper and lower jaws. The flippers are short (about 1/5 of body length) and sickle-shaped. The dorsal fin is located further forward on the body than on any other cetacean. There is a median notch on the tail flukes. Sexual dimorphism occurs, with males reaching 5.9 m in length and 3000 kg and females growing to 4 m and 1200 kg.

Range mass: 1200 to 3000 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 600 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Average: 5.5 m
Range: 7 m males; 4.3 m females

Weight:
Range: up to 3,000 kg males; up to 1,500 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Globicephala macrorhynchus Gray, 1846
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skull
Collector(s): C. Scammon
Locality: Locality Unknown, "Coast Of Lower California In Latitude 31 Degrees, Land 10 Miles Distant.", California, United States, North America, North Pacific Ocean
  • Type: Cope, E. D. 1869. Proc. Acad. Nat. Sci. Philadelphia. 1869: 21.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
These animals are found in deep waters, typically in highest densities over the outer continental shelf or continental slope. They occur in tropical to cool temperate waters. In 1982–83, a strong El Niño event brought about major ecosystem changes off the southern California coast. Pilot whales avoided the area (presumably due to the absence of spawning squid) for much of the next 10 years.

This species feeds on vertically migrating prey, with deep dives at dusk and dawn following vertically migrating prey and near-surface foraging at night (Baird et al. 2003).

Although they also take fish, pilot whales are thought to be primarily adapted to feeding on squid. One of the main forms taken off the California coast is the Market Squid (Loligo sp.). Short-finned Pilot Whales show the tooth reduction typical of other squid-eating cetaceans.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pilot whales are known to migrate from cold to warm waters.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

warm temperate to tropical, oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 435 specimens in 1 taxon.
Water temperature and chemistry ranges based on 376 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 12.570 - 28.782
  Nitrate (umol/L): 0.035 - 8.292
  Salinity (PPS): 31.668 - 36.629
  Oxygen (ml/l): 4.409 - 6.246
  Phosphate (umol/l): 0.052 - 1.086
  Silicate (umol/l): 0.803 - 12.244

Graphical representation

Temperature range (°C): 12.570 - 28.782

Nitrate (umol/L): 0.035 - 8.292

Salinity (PPS): 31.668 - 36.629

Oxygen (ml/l): 4.409 - 6.246

Phosphate (umol/l): 0.052 - 1.086

Silicate (umol/l): 0.803 - 12.244
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Usually offshore, but moves inshore when squid are spawning (e.g., in spring off southern California) (Leatherwood and Reeves 1983). Exhibits a relatively high degree of site fidelity, at least seasonally (see Stacey and Baird 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Makes seasonal offshore-inshore migrations (inshore mainly in spring off southern California) (Leatherwood and Reeves 1983). See also Stacey and Baird (1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Pilot whales ingest about 45 kg of food per day. The main component of diet is squid, although small fish are also eaten.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Recorded stomach contents include squid (Loligo opalescens) (Seagars and Henderson 1985).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

10,000 to >1,000,000 individuals

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Commonly in groups of a few to several hundred (average around 20-25); often with dolphins (especially bottlenose). Mass standings sometimes occur.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Sex: male

Status: wild:
46.0 years.

Average lifespan

Sex: female

Status: wild:
63.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 63 years (wild) Observations: The MRDT was calculated to be about 20 for females and the IMR 0.017 (Foote 2008). It has been speculated that females stop reproducing after about the age of 40.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Pilot whales are polygynous and, in breeding groups, there is a ratio of about 8 breeding females to 1 breeding male.

Mating System: polygynous

Females reach sexual maturity at 7-12 years, males at 15-22 years. The breeding season is spread across the year, gestation lasts 11-13 months, and one calf is born. Weaning occurs at an average of 2 years, although has been known to extend to 6 or even 10 years (these longer periods are found in older mothers). Calves are born at a 7 year interval, and a maximum of 4-5 calves are born in the mother's lifetime. Female reproduction slows after about age 28 years and stops after age 40 years.

Breeding interval: Calves are born at a 7 year interval, and a maximum of 4-5 calves are born in the mother's lifetime.

Breeding season: The breeding season is spread across the year.

Average number of offspring: 1.

Range gestation period: 11 to 13 months.

Average weaning age: 24 months.

Range age at sexual or reproductive maturity (female): 7 to 12 years.

Range age at sexual or reproductive maturity (male): 15 to 22 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 60000 g.

Average number of offspring: 1.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding/parturition apparently vary geographically (see IUCN 1991). Gestation lasts about 15 months; young take solid food beginning at 6 months but may continue to nurse for two to several years; females probably stay in their mother's group for life; sexually mature at average age of about 9 (females) to 15 (males) years; females may stop breeding in their 30s; may live several decades (see Stacey and Baird 1993 for further details).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Skin resists microorganisms: pilot whale
 

The skin of pilot whales resists microorganisms thanks to microscopic pores and nanoridges, surrounded by a secreted enzymatic gel which denatures proteins and carbohydrates.

       
  "On the skin surface of delphinids small biofoulers are challenged to high shear water flow and liquid–vapor interfaces of air-bubbles during jumping. This state of self-cleaning is supported by the even, nano-rough gel-coated epidermal surface of the skin. The present study focussed on the intercellular evolution of gel formation and the chemical composition of the gel smoothing the skin surface of the pilot whale, Globicephala melas…In the superficial layer of the epidermis, the stratum corneum, intercellular material was shown…to assemble from smaller into larger covalently cross-linked aggregates during the transit of the corneocytes towards the skin surface. XPS measurements showed that the surface of the skin and the intercellular gel included approximately the same amounts of polar groups (especially, free amines and amides) and non-polar groups, corresponding to the presence of lipid droplets dispersed within the jelly material. It was concluded from the results that the gel-coat of the skin surface is a chemically heterogeneous skin product. The advantages of chemically heterogeneous patches contributing to the ablation of traces of the biofouling process are discussed." (Baum et al. 2003:181)
  Learn more about this functional adaptation.
  • Baum C; Simon F; Meyer W; Fleischer L-G; Siebers D; Kacza J; Seeger J. 2003. Surface properties of the skin of the pilot whale Globicephala melas. Biofouling. 19(Supplement): 181-186.
  • Baum C; Meyer W; Stelzer R; Fleischer L-G; Siebers. 2002. Average nanorough skin surface of the pilot whale (Globicephala melas, Delphinidae): considerations on the self-cleaning abilities based on nanoroughness. Marine Biology. 140(3): 653-657.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Globicephala macrorhynchus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2958-10|HM060333|Globicephala macrorhynchus| AACCGATGACTATTCTCTACCAATCACAAGGATATTGGTACCCTGTACTTACTATTTGGCGCTTGAGCAGGAATAGTGGGTACTGGCCTA---AGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGTACACTCATCGGAGAT---GACCAGCTTTACAATGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATGGTTATACCTATCATAATCGGGGGCTTTGGAAACTGATTAGTTCCCTTAATA---ATTGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTGATAGCATCTTCAATAGTTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACCATTTTCTCCCTACATTTAGCCGGTGTATCTTCAATCCTCGGAGCTATTAACTTTATTACAACTATTATTAATATAAAACCACCCGCTATAACCCTATACCAAACACCCCTCTTCGTCTGATCAGTCCTAGTCACAGCAATCTTACTTTTACTATCATTACCTGTCTTAGCAGCC---GGAATTACTATACTATTAACTGATCGAAATCTAAACACAACCTTTTTTGACCCGGCAGGAGGAGGAGACCCAATCTTGTATCAACACCTGTTCTGATTTTTTGGTCATCCCGAGGTATATATTCTAATTCTGCCCGGCTTTGGAATAGTTTCACATATCGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGATATATAGGGATAGTATGAGCTATAGTTTCTATTGGTTTCCTAGGTTTCATTGTATGAGCTCATCATATGTTTACAGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Globicephala macrorhynchus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P. & Perrin , W.

Contributor/s

Justification
The Short-finned Pilot Whales are treated as one species even though there is evidence that it may be a complex of two or more species. If it is so designated, the classification may change. If taxonomic designations change, then it is suspected that some new species may warrant listing under higher categories of risk. Because additional data should resolve this taxonomic uncertainty, the current species is listed as Data Deficient. Primary threats that could cause widespread declines include entanglement in fisheries and noise. Hunting is localized and has not had a high impact on the status of the species globally. However, if this does represent a species complex, then these as yet unnamed taxonomic units could be at risk levels warranting threatened category listing. The combination of possible declines driven by these factors is believed sufficient that a 30% global reduction over three generations (71 years; Taylor et al. 2007) cannot be ruled out.

History
  • 2008
    Data Deficient
    (IUCN 2008)
  • 1996
    Lower Risk/conservation dependent
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Pilot whales are conservation dependent, and may be functionally extict in areas such as Newfoundland, but there are still sufficient numbers to support healthy populations of this species.

CITES: appendix ii

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large range; no serious threats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Estimates of abundance exist for several areas. The northern form off Japan has a subpopulation estimated at 4,000–5,000, and the southern form has an estimated subpopulation of about 14,000 in coastal waters (Miyashita 1993). Dolar et al. (2006) estimated abundances in the Philippines: eastern Sulu Sea - 7,492 (CV = 29%); Tañon Strait - 179 (CV = 96%). There are an estimated 589,000 (CV=26%) Short-finned Pilot Whales in the eastern tropical Pacific (Gerrodette and Forcada 2002), and an estimated 304 (CV=102%) in waters off the North American west coast (Barlow 2003). In Hawaiian waters, there are estimated to be 8,846 (CV=49%) (Barlow 2006). The Gulf of Mexico contains at least 2,388 (CV=48%) animals (Mullin and Fulling 2004), and 31,139 (CV=27%) pilot whales of both species are estimated to occur in the western North Atlantic (Waring et al. 2006).

Trend data are not available throughout the range of the species; however, abundance estimates of short-finned pilot whales in the eastern tropical Pacific significantly increased from 1986–1990 to 1998–2000 (Gerrodette and Forcada 2002). There is no information on global trends in the abundance of this species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The Short-finned Pilot Whale has been exploited for centuries in the western North Pacific. The largest catches have recently occurred off Japan, where small coastal whaling stations and drive fisheries take a few hundred annually. In recent years, the southern form continues to sustain a higher kill than the northern form and is considered depleted The current annual national quota is 50. In 1982, the drive fishery at Taiji expanded and harpooning of the northern form was resumed off Sanriku and Hokkaido. Between 1982 and 1985, 1,755 whales of the southern form were killed, and 519 of the northern form were taken during this same period. The current annual national quota is 450. From 1985 to 1989, Japan took a total of 2,326 short-finned pilot whales. The drive fisheries in Japan, as well as the Japanese harpoon fishery continue today. In 1997, Japan recorded a catch of 347 Short-finned Pilot Whales (Olson and Reilly 2002).

A small, intermittently active fishery takes around 220 pilot whales per year at St. Vincent, and there are reports of a small fishery at St. Lucia (Bernard and Reilly 1999). Reliable catch data are not available for these Caribbean hunts. The species is also hunted in Indonesia and Sri Lanka, also with no regular reporting of catch levels.

Dolar et al. (1994) reported on directed fisheries for marine mammals in central and southern Visayas, northern Mindanao and Palawan, Philippines. Hunters at four of the seven investigated fishing villages took cetaceans for bait or human consumption, including short-finned pilot whales. These are taken by hand harpoons or, increasingly, by togglehead harpoon shafts shot from modified, rubber-powered spear guns. Around 800 cetaceans are taken annually by hunters at the sites investigated, mostly during the inter-monsoon period of February–May. Dolphin meat is consumed or sold in local markets and some dolphin skulls are cleaned and sold as curios. Although takes and possession were banned in December 1992, the ban did not stop dolphin and whale hunting, but it seems to have decreased the sale of dolphin meat openly in the market.

In U.S. Atlantic waters, pilot whales have been taken in a variety of fisheries (Olson and Reilly 2002). Based on preliminary data, the squid round-haul fishery in southern California waters is estimated to have taken 30 Short-finned Pilot Whales in one year. In the California drift gill net fishery between 1993 and 1995, the mean annual take of Short-finned Pilot Whales was 20 (Bernard and Reilly 1999). About 4 individuals/year are killed in the Hawaii-based long-line fishery (Forney and Kobayashi 2005). Such interactions have also been recorded in the western tropical Indian Ocean (Indian Ocean Tuna Commission, unpublished data). On the other side of the Pacific Ocean, an estimated 350 - 750 G. macrorhynchus die annually in passive nets and traps set in a Japanese fishery (Bernard and Reilly 1999) and an unknown number are taken incidentally by the large-mesh pelagic driftnets off eastern Taiwan. The most common human-related cause of death observed in waters off Puerto Rico and the US and British Virgin Islands were entanglement and accidental captures, followed by gunshots and spear wounds (Mignucci et al. 1999).

This species, like beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006). While conclusive evidence of cause and effect are often lacking, mass stranding events have been spatially and temporally associated with high levels of anthropogenic sound for Short-finned Pilot Whales (Hohn et al. 2006). Around Taiwan and adjacent areas, a series of unusual strandings of short-finned pilot whales coincided with large-scale military exercises in 2004 but whether these strandings were related to the exercises is unknown (Wang and Yang 2006).

Predicted impacts of global climate change on the marine environment may affect short-finned pilot whales, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: Population off northern Japan is considered to be at risk (see Stacey and Baird 1993) due to relatively high harvest rates (IUCN 1991). More information is needed on population status and impact of harvest in the Caribbean region (IUCN 1991). Vulnerable to incidental mortality in squid driftnet fishery (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed on Appendix II of CITES. Research is needed to determine the impact of potential threats on this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

None known.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Before international whaling laws were enacted, pilot whales were heavily hunted in the Faroe Islands and Japan for meat and oil. Kills of over 10,000 a year were reported by Japan, and over 100,000 in 300 years (1584-1883) in the Faroe Islands.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Harvested for food and oil by hand-harpoon in certain areas of the West Indies (several hundred per year) (see IUCN 1991 for details). Harvested sporatically in Japan and Okinawa; in Japan, annual catch in recent years has been several hundred (IUCN 1991). Has been commonly displayed in some marine aquaria.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Short-finned pilot whale

The Short-finned Pilot Whale (Globicephala macrorhynchus) is one of the two species of cetacean in the genus Globicephala. It is part of the oceanic dolphin family (Delphinidae), though its behaviour is closer to that of the larger whales.

Short-finned Pilot Whales can be confused with their relatives the long-finned pilot whales, but there are various differences. As their names indicate, their flippers are shorter than those of the Long-finned Pilot Whale, with a gentler curve on the edge. They have fewer teeth than the Long-finned Pilot Whale, with 14 to 18 on each jaw. Short-finned pilot whales are black or dark grey with a grey or white cape. They have grey or almost white patches on their bellies and throats and a grey or white stripe which goes diagonally upwards from behind each eye.

Adult males may have a number of scars on their bodies. Their heads are bulbous and this can become more defined in older males. Their dorsal fins vary in shape depending on how old the whale is and whether it is male or female. They have flukes with sharply pointed tips, a distinct notch in the middle and concave edges. They tend to be quite slender when they are young, becoming more stocky as they get older.

Contents

Physical Characteristics at a Glance

Field ID: Stocky body, bulbous forehead, no prominent beak, long flippers sharply pointed at the tip, black or dark grey color, fin set forward on body, fluke raised before deep dive, may float motionless at the surface, frequently seen in very large groups, prefers deep water, may be approached.

Length (metres): Adults are 3.5 - 6.5 metres in length. When they are born short-finned pilot whales are about 1.4-1.9 metres long.

Weight: At birth, Short-finned Pilot Whales weigh about 60kg (135lb). A fully grown adult will weigh between 1 and 4 tons.

Diet: Fish, Squid, Octopus

Behaviour

Short-finned Pilot Whales are very sociable and are rarely seen alone. They are found in groups of ten to thirty, though some pods are as large as sixty. They are sometimes seen logging and will allow boats to get quite close. They rarely breach, but may be seen lobtailing (slapping their flukes on the water surface) and spyhopping (poking their heads above the surface). Before diving, they arch their tails and raise them above the surface. When coming to the surface to breathe, adults tend to show only the top of their head, whereas calves will throw their entire head out of the water. Adults occasionally porpoise (lift most of the body out of the water) when swimming particularly quickly.

They are known as the 'Cheetahs of the Deep' for the high speed pursuits of squids at depths of hundreds of metres.

Conservation

The Short-finned Pilot Whale is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS) and the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS). The species is further included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU) and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU)

Cuisine

Japanese meal with short finned pilot whale meat; includes skewer of fried whale meat (left) and bowl with grilled meat over rice, topped with pickled ginger (right).

In a very few areas of Japan, mainly along the central Pacific coast, pilot whales are commercially hunted and the meat is available for human consumption. In certain restaurants or izakayas, pilot whale steaks are marinated, cut into small chunks, and grilled.[3] The meat is high in protein and low in fat (a whale's fat is contained in the layer of blubber beneath the skin).[3][4][5] When grilled, the meat is slightly flaky and quite flavorful, somewhat gamey, though similar to a quality cut of beef but with distinct yet subtle undertones recalling its marine origin..[3][4]

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300051. 
  2. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2011). "Globicephala macrorhynchus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/9249. Retrieved 18 January 2012. 
  3. ^ a b c "No Matter How You Slice It, Whale Tastes Unique", Planet Ark (Reuters), 2002, http://www.planetark.org/dailynewsstory.cfm/newsid/16090/story.htm, retrieved 14 January 2011 
  4. ^ a b Browne, Anthony (9 September 2001), "Stop Blubbering: Whales are supposed to be protected but that doesn't stop the Japanese killing and eating hundreds of them every year. But does the West's moral outrage over the pursuit of our gentle leviathans amount to anything more than hypocrisy and cultural bullying?", The Observer, http://www.guardian.co.uk/lifeandstyle/2001/sep/09/foodanddrink.features4, retrieved 14 June 2011 
  5. ^ Buncombe, Andrew (2005), "The Whaling Debate: Arctic Lament", Ezilon, http://www.ezilon.com/information/article_11436.shtml, retrieved 14 January 2011 
  • WDCS (Danish)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Two populations off Japan appear to be genetically distinct from each other; there is some evidence that northern and southern "forms" occur in the eastern Pacific (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!