Articles on this page are available in 1 other language: Spanish (29) (learn more)

Overview

Brief Summary

Description

For reasons unknown, the false killer whale is among the most common cetaceans involved in mass strandings. The sheer size of these episodes is hard to absorb - 835 animals were beached in the largest documented case. They are found in tropical and temperate waters worldwide, swimming with as many as ten other species of cetaceans. They feed primarily on fish and squid and have been seen sharing food in the wild, an unusual occurrence in mammals. In captivity, they have hybridized with bottlenose dolphins and given birth to viable offspring. The false killer whale is the second largest of the dolphins, measuring 3.3 - 6 m in length and weighing up to 1,360 kg; in the family Delphinidae, only killer whales are larger.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Owen, R.A., 1846.  A history of British fossil mammals and birds, p. 516.  London, 560 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The false killer whale's apparently playful nature and fast, acrobatic swimming mean that individuals are frequently encountered skilfully surfing the bow waves of sea vessels, porpoising or leaping clear of the water surface (6) (7). This rapid locomotion also makes the false killer whale a highly-efficient predator, and it feeds on an array of different prey items, which, depending on its location, may include: salmon, squid, tuna and mahi mahi (5). Groups of false killer whales have also been observed feeding on smaller dolphins and even attacking humpback and sperm whales (4) (5). A highly social species, the false killer whale usually forms groups, or pods, of between 10 and 50 individuals of mixed sex and age, but these may occasionally merge into superpods of over 800 animals (6). Pods appear to communicate extensively by producing an incredibly diverse array of clicks and whistles (2). Sound is also employed by the animals in the form of echolocation, which is used to sense their environment and locate prey (4). Breeding is believed to occur throughout the year, but may peak at different times depending on the location (2). After a gestation period of about 15.5 months, the calves are born measuring up to two metres in length and for the first 18 to 24 months are fed on milk (2). The females reach sexual maturity at 8 to 11 years and are estimated live for up to 62 years (4), while the males may only reach maturity at 16 to 18 years (2) and live for around 57 years (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

False killer whales are large members of the dolphin family. They have a small conical head without a beak. Their dorsal fin is tall and their flippers (pectoral fins) have a distinctive hump or bulge in the middle of the front edge. False killer whales have dark coloration except for some lighter patches near the throat and middle chest. Their body shape is more slender than other large delphinids.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Pseudorca crassidens is a toothed whale and can be recognised as such by the single blowhole and the presence of teeth. It is a member of the dolphin family with a characteristic prominent median notch in the flukes, a smooth crease-less throat and sharply pointed teeth. The false killer whale reaches up to 6 m in length. It has moderately long and slender, bent flippers and small tail flukes. The dorsal fin is tall, large and located on the middle of the back. The head is smoothly sloping without a snout. It is entirely black in colour.False killer whales are usually found in pairs or in groups up to several hundred individuals. Their surface behaviour is typical of dolphins with acrobatic leaps and bow-riding are not uncommon. Dive duration is unknown (Kinze, 2002).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Despite its name, the false killer whale is not a close relative of the killer whale (Orcinus orca), and, in fact, any resemblance between the two species is relatively superficial (2) (4) (5). The false killer whale's body is long and slender, with a tall, backwardly curving dorsal fin and uniquely shaped flippers that possess a large bulge at the midpoint reminiscent of an elbow (6) (7). The head tapers into a long, rounded snout, which overhangs the lower jaw and is marked with a crease running above the mouthline (7). The jaws are armed with 8 to 11 pairs of formidable-looking, large, conical teeth, from which the species derives its Latin name crassidens, meaning “thick-tooth” (7). The colouration is almost uniformly black, with the exception of faint grey marks on the heads of some individuals and a whitish chest patch located between the flippers (4) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

False killer whales are found in tropical to warm temperate zones, generally in relatively deep, offshore waters of all three major oceans. They do not generally range into latitudes higher than 50° in either hemisphere. However, some animals occasionally move into higher latitude waters. They are found in many semi-enclosed seas and bays (including the Sea of Japan, Bohai/Yellow Sea, Red Sea, and Persian Gulf), but they only occasionally occur in the Mediterranean Sea (Leatherwood et al. 1989). There are a few records for the Baltic Sea, which are considered extralimital. There are also records of false killer whales being found far into large rivers in China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Pseudorca crassidens is found throughout the Atlantic, Pacific, and Indian Oceans. It is nearly cosmopolitan, occurring at latitudes as far north as 50 degrees north and as far south as 52 degrees south.

This species has been observed as far south as New Zealand, Peru, Argentina, South Africa, and the north Indian Ocean. They also range from Australia, the Indo-Malayan Archipelago, Philippines, and north to the Yellow Sea. They have been observed in the Sea of Japan, coastal British Columbia, coastal Maryland (USA), the Bay of Biscay, and have been discovered in the Red and Mediterranean Seas. Many pods live near the Gulf of Mexico and surrounding the Hawaiian Islands.

Biogeographic Regions: indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

circumtropical to warm temperate
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Maryland to South America
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Comores, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Red Sea and Mediterranean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Widely distributed, though apparently nowhere abundant, in tropical, subtropical, and warm temperate waters throughout the world. In North America, usually not north of Maryland and southern California, but occasionally strays into northern temperate waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The false killer whale is incredibly widespread, with populations found in all the world's major oceans, from northern locations such as the waters around Japan and British Columbia, south to New Zealand and Argentina (1) (5). Although normally found in tropical to warm temperate waters, individuals have been seen in cool waters as far afield as Norway and Alaska (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

False killer whales are black or dark gray with a white blaze on their ventral side. Some have a paler gray coloring on their head and sides. Their heads are rounded and often described as blunt and conical with a melon-shaped forehead. Their bodies are elongated. The dorsal fin is sickle-shaped and protrudes from the middle of their back, the pectoral flippers are pointed. They have a slight overbite--the upper jaw extends beyond the lower jaw. This gives them a slight beaked look to their rostrum. No subspecies have been described.

Adult males range from 3.7 to 6.1 m in length, while adult females range from 3.5 to 5 m. Adults may weigh 917 to 1842 kg. Newborns range from 1.5 to 1.9 m in length and weigh about 80 kg. The dorsal fin can grow to be 18 to 40 cm high. This species has a more slender build compared to other dolphins and they have tapering heads and flippers. Their flippers average about one-tenth of the head and body length and have a distinct hump on the leading margin of the fin. There is a definite median notch on their flukes and they are very thin with pointed tips. False killer whales also have 8 to 11 teeth on each side of their jaw.

The skulls of females range in length from 55 to 59 cm, while males are 58 to 65 cm. They have 47 to 52 vertebrae: 7 cervical, 10 thoracic, 11 lumbar, and 20 to 23 caudal vertebrae. They have 10 pairs of ribs. Their manus consists of 6 carpals, 5 metacarpals, and 14 phalanges.

This species is often mistaken for bottlenose dolphins (Tursiops truncatus), short-finned pilot whales (Globicephala macrorhynchus), or long-finned pilot whales (Globicephala melas) as they inhabit the same regions. To distinguish these species, bottlenose dolphins have beaks, and pilot whales are larger with obvious dorsal fin differences.

Range mass: 916.26 to 1841.59 kg.

Range length: 3.5 to 6.1 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; sexes shaped differently

  • Liebig, P., K. Flessa, T. Taylor. 2007. Taphonomic Variation Despite Catastrophic Mortality: Analysis of a Mass Stranding of False Killer Whales(Pseudorca crassidens), Gulf of California, Mexico. Palaios, Volume 22, Issue 4: 384-391.
  • Minasian, S., K. Balcomb, III, L. Foster. 1984. The World's Whales. New York and London: W.W. Norton & Company.
  • Convention of Migratory Species. Review on Small Cetaceans: Distribution, Behaviour, Migration and Threats. None. Germany: Boris Michael Culik, Marco Barbieri. 2005. Accessed September 20, 2007 at http://www.cms.int/reports/small_cetaceans/data/P_crassidens/p_crassidens.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Male length: up to 6.1 m; Female length: up to 4.9 m; Weight: up to 1,360 kg.

 

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 550 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are larger than females.

Length:
Range: 3.7-6 m males; 3.3-5.1 m females

Weight:
Average: 1,360 kg (maximum)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Pseudorca crassidens (Owen, 1846)
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Partial Skull
Collector(s): Collector Unknown
Locality: Paita, Off Paita, Piura, Peru, South America, South Pacific Ocean
  • Type: Cope, E. D. 1886. Proc. Acad. Nat. Sci. Philadelphia. 18: 296.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
False killer whales occur in tropical and temperate waters worldwide (Stacey et al. 1994; Odell and McClune 1999), generally in relatively deep, offshore waters. However, some animals may move into shallow and higher latitude waters, on occasion (including some semi-enclosed seas such as the Red Sea and the Mediterranean). The species seems to prefer warmer water temperatures. Off Hawaii, this species is found in both shallow (less than 200 m) and deep water (greater than 2000 m) habitats (Baird et al. 2008).

Although false killer whales eat primarily fish and cephalopods, they also have been known to attack small cetaceans, humpback whales, and sperm whales. They eat some large species of fish, such as mahi-mahi (also called dorado or dolphinfish), tunas (Alonso et al. 1999) and sailfish. In Hawaiian waters observational studies suggest that large game fish (mahi-mahi, tunas, billfish) may form the majority of their diet (Baird et al. 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

False killer whales are common in tropical or temperate seas. They visit coastal waters but prefer to remain in deeper waters. They are known to dive as deep as 2000 meters.

Range depth: 0 to 2000 m.

Average depth: 500 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 134 specimens in 1 taxon.
Water temperature and chemistry ranges based on 116 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 1.915 - 29.248
  Nitrate (umol/L): 0.048 - 23.409
  Salinity (PPS): 32.029 - 37.045
  Oxygen (ml/l): 4.476 - 7.572
  Phosphate (umol/l): 0.070 - 1.578
  Silicate (umol/l): 0.777 - 18.227

Graphical representation

Temperature range (°C): 1.915 - 29.248

Nitrate (umol/L): 0.048 - 23.409

Salinity (PPS): 32.029 - 37.045

Oxygen (ml/l): 4.476 - 7.572

Phosphate (umol/l): 0.070 - 1.578

Silicate (umol/l): 0.777 - 18.227
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

They prefer tropical to temperate waters that are deeper than 1000 m.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Primarily pelagic; usually not near land except around oceanic islands and coast with deep water nearby (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 The false killer whale is an offshore species although little is known about their prefered bathymetry.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Although the false killer whale is most commonly found in open ocean waters, it also frequents the coastal areas around oceanic islands such as Hawaii, and may enter semi-enclosed seas such as the Mediterranean (5) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

May make seasonal migrations into northern Pacific waters during spring-summer warming (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

False killer whales are carnivores, eating primarily fish and squid. They mainly eat squid (Loligo) but also opportunistically take fish and occasional marine mammals, such as seals (Phocidae) or sea lions (Otariidae). Some of the fish they eat include salmon (Oncorhynchus), squid (Loligo, Berryteuthis magister, or Gonatopsis borealis), sciaenid and carangid fishes, bonito (Sarda lineolata), mahi mahi (Coryphaena hippurus), yellowfin tuna (Thunnus albacares), yellowtail (Pseudosciana manchurica), and perch (Lates calcarifer). On one occasion researchers found the remains of a humpback whale Megaptera noveangliae in the stomach of a false killer whale.

This species moves quickly in order to catch fish. They have been observed catching a fish in their mouth while completely breaching the waters' surface. They have also been seen shaking their prey until the head and entrails are shaken off. They then peel the fish using their teeth and discard all the skin before eating the remains. Some mothers will hold a fish in the mouth and allow their calf to feed on the fish. This food manipulation is rare in cetaceans.

Animal Foods: mammals; fish; mollusks; other marine invertebrates

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mainly squid and large fishes (Stacey et al. 1994), including some obtained from fishing lines. May attack dolphins released from purse seines in eastern tropical Pacific (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

False killer whales are predators of fish and squid (Uroteuthis duvauceli), and they also eat smaller delphinids and pinnipeds (e.g., seals [Phocidae], and sea lions [Otariidae]).

One protozoan that is found in false killer whales are the parasites Bolbosoma capitatum. They are also carriers of two types of whale lice: Lsocyamus delphini and Cyamus antarcticensis.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Due to their harmful effects on fisheries, humans kill false killer whales. In some regions in the eastern tropical Pacific, they are hunted for meat.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Global Abundance

Unknown

Comments: Nowhere abundant.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Gregarious, often in herds of >100 individuals; mean group size off Japan was 55; group size from 14 mass strandings (not uncommon) averaged 180 (50-835). Herds usually include both sexes and all age classes (or minus males in the late maturing stage) and appear to be socially cohesive. Often associates with other cetaceans (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Pseudorca crassidens use echolocation primarily in the frequency range of 20 yo 60 kHz. They also use higher frequencies of 100 to 130 kHz.  False killer whales, like other toothed whales also use other sounds, such as whistles, squeals, or less distinct pulsating sounds. It has been noted that whenever researchers get close to a group of false killer whales, they have been able to detect the whales' piercing whistles from about 200 meters away. James Porter notes, "The noises were astonishingly diverse, much more varied than the sounds of human speech, both in pitch and intensity. Each whale seemed to be making different sounds. The cacophony gave the impression that whatever they were 'saying', they were not all 'saying' the same thing at the same time (Watson 1981)."

Communication Channels: tactile ; acoustic

Perception Channels: visual ; acoustic ; ultrasound ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

These whales are gregarious and form strong social bonds. They are usually found in groups of ten to twenty that belong to much larger groups of up to 40 individuals. They are known to "strand" in large groups as well. False killer whales are also found with other cetaceans, most notably bottlenose dolphins. To increase success of finding prey, these whales travel in a broad band that can be up to several miles wide. They feed during the day and at night on fishes and cephalopods, and they are known to attack smaller dolphins that are involved in the tuna purse-seine fishery.

False killer whales' breeding season lasts several months. Gestation periods range from 14 to 16 months and lactation occurs for one and a half to two years. False killer whales have low reproduction rates with calving intervals of approximately seven years. Maturity occurs at around 12 years of age and maximum longevity is 63 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Researchers estimate that males live an average of 57.5 years and females live an average of 62.5 years in the wild. No known age-dependent mortality rate has been discovered. Because few false killer whales are kept in captivity, captive lifespans are unknown.

Average lifespan

Status: wild:
60 years.

Average lifespan

Status: wild:
22.0 years.

  • Stacey, P., S. Leatherwood, R. Baird. 1994. Pseudorca crassidens. Mammalian Species, 456: 1-6.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 62.5 years (captivity) Observations: One captive specimen was still alive at 33.6 years of age (Richard Weigl 2005). Females are estimated to live over 62 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Although false killer whales breed year-round, their breeding peaks in late winter to early spring. Studies suggest they are polygynandrous.

Mating System: polygynandrous (promiscuous)

False killer whales will only have one calf per pregnancy and she carries that calf for 11 to 15.5 months. The calf stays with the mother for 18 to 24 months. Between 18 and 24 months old, the calf is gradually weaned. Sexual maturity occurs in females between 8 and 11 years of age and in males at 8 to 10 years.

In this species and a few others in the family Didelphinidae, if the female doesn't conceive after the first ovulation, she will keep ovulating until she does conceive. After giving birth, the female will not breed again for an average of 6.9 years.

Breeding interval: Females give birth every 6.9 years, on average.

Breeding season: Breeding occurs year-round, but peaks December to January and again in March.

Range number of offspring: 1 (high) .

Average number of offspring: 1.

Range gestation period: 11 to 15.5 months.

Range weaning age: 18 to 24 months.

Range age at sexual or reproductive maturity (female): 8 to 11 years.

Range age at sexual or reproductive maturity (male): 8 to 10 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); induced ovulation ; viviparous

Average number of offspring: 1.

After false killer whales calves are born, they are cared for and nursed by their mother for up to 24 months. Young are capable of swimming on their own shortly after birth. Young are likely to remain in the same social group with their mother beyond weaning.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Protracted breeding season, reportedly with no fixed breeding or calving season, though a peak in calving in March was found off Japan. Gestation lasts about 15-16 months. Lactation lasts apparently about 18 months. Sexually mature at about 3.2-3.8 m (Leatherwood and Reeves 1983), probably at a minimum age of 8 years (IUCN 1991, Stacey et al. 1994). Off Japan, the average interval between births has been estimated at about 7 years, with females over 45 years old post-reproductive (see Stacey et al. 1994). May live several decades.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pseudorca crassidens

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA2959-10|HM060332|Pseudorca crassidens| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTGTATTTACTATTTGGTGCCTGAGCAGGAATAGTGGGTACTGGCCTA---AGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGTACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATCGGAGGCTTTGGAAACTGATTAGTTCCCTTGATA---ATTGGAGCCCCTGACATAGCATTCCCCCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTGCTACTGATAGCATCTTCAATAGTTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACTATTTTCTCCCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATTACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACACCTCTCTTCGTCTGATCAGTTTTGGTCACAGCAATCTTACTTTTACTATCATTACCTGTCTTAGCAGCC---GGAATTACTATACTACTAACTGACCGAAATCTAAACACAACTTTTTTTGACCCGGCAGGAGGAGGGGACCCAGTCTTATATCAACACTTGTTCTGATTTTTTGGTCATCCCGAAGTATACATTTTAATTCTACCCGGCTTTGGAATAGTTTCACATATCGTTACTTATTATTCAGGGAAAAAA---GAGCCTTTTGGGTATATAGGAATAGTATGAGCTATAGTTTCTATTGGCTTCCTAGGTTTCATTGTATGAGCTCACCATATATTTACAGTTGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pseudorca crassidens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 1
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Justification
Global trend or abundance data for this species are unavailable. Threats that could cause widespread declines include high levels of anthropogenic sound, especially military sonar and seismic surveys, and bycatch. Bycatch is particularly worrisome because of known unsustainable levels where fisheries are monitored in Hawaii and the presence of similar fisheries throughout the range of the species. The relative rarity of this species implied from the existing records makes it potentially vulnerable to low-level threats. The combination of possible declines driven by vulnerability to high-level anthropogenic sound sources and bycatch is believed sufficient that a 30% global reduction over three generations cannot be ruled out (criterion A).

History
  • 1996
    Lower Risk/least concern
    (Baillie and Groombridge 1996)
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Although false killer whales are hunted by humans and there are annual mass strandings, populations are considered stable. There are only a few countries that hunt them for food or remove them as threats to the fisheries industry.

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: data deficient

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Data Deficient.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Widespread in oceans, not significantly threatened.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Studies on population structure in this species indicate both broad-scale (between-ocean) limits on gene flow (e.g., Kitchener et al. 1990), and limited gene flow on smaller (within-ocean) scales (Chivers et al. 2007). Abundance has been estimated for the coastal waters of China and Japan (16,000, CV=26%; Miyashita 1993), the northern Gulf of Mexico (1,038, CV = 71%; Mullin and Fulling 2004), and the U.S. EEZ of Hawaii (268, CV=108%; Barlow 2006). Abundance in the eastern tropical Pacific has been estimated as 39,800, CV=64%; Wade and Gerrodette 1993). There is no information on global trends in abundance.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Although there is considerable controversy regarding the absolute level of declines, there is good evidence of large-scale reductions in many predatory fish populations (e.g., Baum et al. 2003, 2005; Sibert et al. 2006; Polacheck 2006) and over-fishing and collapse of several important “prey” fish stocks world-wide (e.g., Jackson et al. 2001). The effects of such fish population reductions and subsequent ecosystem changes on world-wide populations of false killer whales are unknown but could result in population declines.

False killer whales are occasionally taken in Japan for food and in St. Vincent in the Caribbean for meat and cooking oil (Jefferson et al. 1993; Odell and McClune, 1999). Considerable numbers of false killer whales may have also been killed in a past drive fishery in the Penghu Islands of Taiwan. Their interactions with fisheries, particularly their tendency to remove desired target species from longlines and sport fishing gear, have made them the targets of culling efforts. Around Iki Island, Japan, over 900 false killer whales were killed in drive fisheries from 1965 to 1980 in an attempt to reduce interactions with the yellowtail fishery (Jefferson et al. 1993; Odell and McClune, 1999). They continue to be taken opportunistically in Japanese harpoon and drive fisheries (Kishiro and Kasuya 1993). They are also hunted at least opportunistically in Indonesia, Taiwan and the West Indies. Some of the animals caught in the Japanese and Taiwanese drive fisheries have been kept alive and sold to oceanaria (Reeves et al. 2003).

Incidental takes of small numbers of false killer whales in gill nets has occurred off northern Australia, the Andaman Islands, the southern coasts of Brazil and in tuna purse seines in the eastern tropical Pacific. Dolphin entrapment in tuna purse seine nets may be providing artificial feeding opportunities for Pseudorca on other marine mammals (Odell and McClune, 1999). Although there have not been any records of false killer whale being killed in the large-mesh pelagic driftnets off eastern Taiwan, some are likely to be caught. Yang et al. (1999) reported on by-catch rates in Chinese coastal fisheries (trawl, gill and stow net), which may number in the hundreds per year for P. crassidens alone. False killer whales are occasionally hooked in longline fisheries, presumably as they are removing fish from the hooks. Death has been observed as a result of some hookings (Forney 2006). Many of the other hookings are inside the mouth or gullet and are likely to result in the subsequent death of the animals (Forney and Kobayashi 2005). Other types of non-lethal injuries may also occur (Baird and Gorgone 2005). Such longline fisheries are found throughout the central and western tropical Pacific, and similar interactions with false killer whales occur in other regions (e.g. Mediterranean, Bearzi 2002). Observer programs to monitor bycatch are limited.

Evidence from stranded individuals of several similar species indicates that they have swallowed discarded plastic items, which may eventually lead to death (e.g. Scott et al. 2001); this species may also be at risk

This species, like beaked whales, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

Predicted impacts of global climate change on the marine environment may affect false killer whales, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: D : Unthreatened throughout its range, communities may be threatened in minor portions of the range or degree of variation falls within natural variation

Comments: No known major threats, though some mortality occurs as a result of direct and indirect taking associated with various fisheries (IUCN 1991). Culls have occurred in Japan in efforts to reduce perceived damage to fisheries (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The population status of the false killer whale is poorly known; despite this species' vast range, it does not appear to be particularly abundant at any location. As a result, the false killer whale may be severely affected by relatively low-grade threats. At the current time, the main threat to this species is the worldwide decline in the predatory fish species that constitute a major part of its diet. False killer whales are also frequently caught as bycatch by the commercial fishing industries of many different nations, for example, hundreds are caught each year in the trawl nets used in Chinese coastal fisheries. The false killer whale is also notorious for stealing bait from longlines, which has led to retaliatory cullings, despite the fact that many of the animals are lost due to becoming caught on the hooks and drowned (1). Huge numbers of false killer whales, in one case over 800, are often involved in beach strandings (6). While there is no clear explanation for this phenomenon, it may be linked to the use of navy sonar and seismic exploration, which has been frequently implicated in causing strandings in other cetacean species such as beaked whales (1) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES

This is a relatively poorly-known species which, although mostly observed over deep water, is known to strand from many coasts. Abundance estimates as well as by-catch data do not exist for most areas, nor are there detailed accounts on migratory behaviour. Clearly, more research is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Before a conservation plan for the false killer whale can be developed, it is imperative that more information about its population status and migratory movements be gathered. Until this happens, the impact of the threats faced by this species will remain unclear (1). Even with evidence to support the decline of this species, it may prove difficult to safeguard the false killer whale from military exercises and the use of sonar, as the development of protective legislation has become a contentious issue (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These whales will eat fish off of fishing lines and out of nets of commercial fishing operations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the eastern tropical Pacific, Pseudorca crassidens is taken for food and also to limit their consumption of tuna Osteoglossiformes and inhibit their competition with commercial fisheries.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Has been successfully maintained in several marine aquaria. Sometimes taken for human food and oil in mass shore drives in Japan and in small cetacean fisheries in Taiwan and the Caribbean (Leatherwood and Reeves 1983, Stacy et al. 1994). Sometimes regarded as pest by fishermen who perceive these whales as a competitor for fishes. Sometimes takes fishes hooked on fishing lines; sometimes causes significant impact on tuna long-line fishery in the tropical Pacific (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

False killer whale

The false killer whale (Pseudorca crassidens) is a cetacean, and the third largest member of the oceanic dolphin family (Delphinidae). It lives in temperate and tropical waters throughout the world. As its name implies, the false killer whale shares characteristics, such as appearance, with the more widely known Orca (killer whale). Like the orca, the false killer whale attacks and kills other cetaceans. However, the two dolphin species are not closely related.

The false killer whale has not been extensively studied in the wild; much of the data about it has been derived by examining stranded animals.

The species is the only member of the Pseudorca genus.

Contents

Population and distribution

The false killer whale appears to have a widespread, if small, presence in temperate and tropical oceanic waters. They have been sighted in fairly shallow waters such as the Mediterranean Sea and Red Sea as well as the Atlantic Ocean (from Scotland to Argentina), the Indian Ocean (in coastal regions and around the Lakshwadweep islands) and the Pacific Ocean (from the Sea of Japan to New Zealand and the tropical area of the eastern side), and also in Hawaii. The eastern tropical Pacific is estimated to have in excess of 40,000 individuals and is probably the largest population.[citation needed]

A false killer whale and a bottlenose dolphin mated in captivity and produced a fertile calf.[3] The hybrid offspring has been called a "wholphin".

Description

The skull of a false killer whale.
Photo of one large and one small animal soaring into the air
False killer whale and bottlenose dolphin at the Enoshima Aquarium, Japan

The false killer whale is black with a grey throat and neck. It has a slender body with an elongated tapered head and 44 teeth. The dorsal fin is sickle-shaped and its flippers are narrow, short and pointed. The average size is around 4.9 m (16 ft). Females can reach a maximum known size 5.1 m (17 ft) in length and weigh 1,200 kg (2,600 lb), while the largest males can reach 6.1 m (20 ft) and weigh as much as 2,200 kg (4,900 lb).[4][5][6]

Human interaction

The false killer whale has not been hunted extensively, for example in the West Indies and Indonesia. In Japan, a large number are killed every year during the annual slaughter in Taiji.

Several public aquaria, including Seaworld Orlando, display false killer whales.

Recent evidence indicates that the local population of false killer whales in Hawaii has declined dramatically over the last 20 years. Five years of aerial surveys undertaken from 1993 through 2004 showed a steep decline in sighting rates. Group sizes of the largest groups documented in surveys were almost four times larger than the entire current population estimate.[7]

Beachings

On 2 June 2005 up to 140 (estimates vary) false killer whales were beached at Geographe Bay, Western Australia.[8] The main pod, which had been split into four separate strandings along the length of the coast, was successfully moved back to sea with only one death after the intervention of 1,500 volunteers coordinated by the Department of Conservation and Land Management.

Just prior to sunrise on 30 May 2009, a pod of 55 false killer whales was discovered beached on a sandy beach at Kommetjie in South Africa (latitude 34° 8'3.98"S, longitude 18°19'58.22"E).[9] By 9 a.m. 50 or more volunteers had already arrived to help move the whales into the ocean. Many more volunteers came throughout the day to offer their services. Late morning a decision by the authorities asked all volunteers to stabilize the false killers whales on the beach. No further attempt was made to take the whales into the open sea. At approximately 4 p.m. after considerable debate by all the authorities present, the decision was made to initiate euthanasia by shooting the whales; approximately 44 whales were killed.

Conservation

The false killer whale is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS) and the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS). The species is further included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU) and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU)

See also

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300078. 
  2. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Pseudorca crassidens. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ "Whale-dolphin hybrid has baby wholphin". MSNBC. April 15, 2005. http://www.msnbc.msn.com/id/7508288/. Retrieved 2009-11-12. 
  4. ^ [1] (2011).
  5. ^ [2] (2011).
  6. ^ [3] (2011).
  7. ^ "Hawai‘i's false killer whales". Cascadia Research.
  8. ^ "Scores of whales stranded in western Australia A pod of up to 80 whales has become stranded on a beach in Western Australia, the second mass beaching in the country in three weeks.". The Daily Telegraph (London). 2009-03-23. http://www.telegraph.co.uk/news/worldnews/australiaandthepacific/australia/5035021/Scores-of-whales-stranded-in-western-Australia.html. Retrieved 2010-05-02. 
  9. ^ Pitney, Nico (2009-05-30). "Whales Killed At Kommetjie In South Africa (VIDEO)". Huffingtonpost.com. http://www.huffingtonpost.com/2009/05/30/55-whales-beached-at-komm_n_209413.html. Retrieved 2011-12-07. 

Further reading

  • Heptner, V. G.; Nasimovich, A. A; Bannikov, Andrei Grigorevich; Hoffmann, Robert S, Mammals of the Soviet Union, Volume II, part 3 (1996). Washington, D.C. : Smithsonian Institution Libraries and National Science Foundation
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!