Articles on this page are available in 1 other language: Spanish (30) (learn more)

Overview

Brief Summary

Description

"Much of what we know about Risso's dolphin, also called grampus, comes from studying stranded animals. They inhabit deep tropical and warm-temperate waters worldwide, usually where the water is deeper than 180 m, making them hard to study. The remains found in stomachs show they prey upon squid exclusively. Scars are often found on their skin, which may be the results of wounds produced by squid beaks and tentacles. Some researchers believe these marks may also reflect the highly physical ways these dolphins interact - by slapping, splashing, and leaping on one another. Risso's dolphin is highly social. Hundreds of them have been seen swimming on the surface, leaping clear of the water, and ""bow-riding"" on waves, sometimes with Pacific white-sided dolphins and northern right whale dolphins."

Links:
Mammal Species of the World
  • Original description: Cuvier G., 1812.  in Nouvelles annales du Muséum d?histoire naturelle, Paris, Tome 19, p. 13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Risso's dolphin feeds largely on squid, although other cephalopods are also taken, as well as fish and crustaceans (2). Like most dolphins, this species is a highly social animal, typically occurring in groups of between 3 to 50 individuals (2), and may mix with different species of cetaceans (whales and dolphins) (8). When groups are hunting they spread out into a long line (5). This species tends to ride alongside or in the wake of boats, and young individuals often breach (clear the water), slap their flippers on the surface of the water or 'spyhop' (lift their heads clear of the water) (5). A number of sounds are produced, including characteristic 'signature whistles' (6), many of these vocalisations are important in detecting prey through echolocation (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Risso's dolphin is the fifth largest of the delphinids. Its anterior body is extremely robust, tapering to a relatively narrow tail stock and its dorsal fin is one of the tallest in proportion to body length of any cetacean, exceeded only by that of the adult male killer whale (Orcinus orca). The bulbous head has a distinct vertical crease or cleft along the anterior surface of the melon. Color patterns change dramatically with age. Infants are dorsally grey to brown, then darken to nearly black and lighten while maturing (the dorsal fin remaining dark). In ageing animals, the majority of the dorsal and lateral surfaces become covered with distinctive linear scars. Older animals can appear completely white on the dorsal surface.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 Grampus griseus has a robust body up to 4 meters in length and weighs up to 600 kg. Males of the species are larger than females. Colouration varies individually and with age. Generally adults are medium to dark grey on the back, paler on the flanks with a marked border and a white anchor shaped patch on the belly. Dorsal fin, flippers and flukes are dark grey. This species has a large blunt head, no beak and a characteristic crease on its forehead from the blowhole to the upper 'lip'. The mouth line is straight and slants upwards slightly. There are 3-7 pairs of strong oval teeth at the tip of the lower jaw and, only occasionally are there one or two vestigial teeth on the upper jaw. Grampus griseus has a tall dorsal fin up to 60 cm high with a pointed or rounded tip. Its flippers are also pointed and up to 60 cm long. The pointed tail flukes have an expanse of up to 76 cm.Grampus griseus is one of the largest members of the Delphinidae family. 'Grampus' meaning 'grand fish', and 'griseus' referring to its grey colouration. At birth this species has a muted anchor shaped patch on its belly, and is uniformly gray becoming lighter with age. This is due to the extensive teeth scarring caused by Grampus griseus during play, aggression and sexual behaviour, as well as confrontations with cephalopod species (to a lesser degree) (Carwardine, 2000). The white colouration in older species may confuse it with Beluga whales (Delphinapterus leucas), however Risso's tall dorsal fin is the main distinguishing feature (Martin, 1990; Carwardine, 2000). Gestation is 13-14 months, and sexual maturity around 3-4 years for both sexes. Calves can be up to 1.7 meters long and weight approximately 20 kg. Grampus griseus dives for 1-2 minutes but can stay submerged for up to 30 minutes. It also takes a dozen breaths every 15-20 seconds, and seldom bow-rides. Full breaching occurs in the young and half breaching in adults (Carwardine, 2000). This species occurs in groups of about 12, and can aggregate into large of herds, up to 4000 individuals has been recorded. This species feeds on pelagic fish and cephalopods, favouring squid. Hybrids of Grampus griseus and Bottlenose dolphin, Tursiops truncatus, have also been reported in the wild (Kinze, 2002). 

This species is subject to by-catch, and is included in the UK Biodiversity Action Plan list of species of conservation concern (Biodiversity Steering Group, 1995). All species of cetaceans are given protection under the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Order 1985. All cetacean species are listed on Annex A of EU Council Regulation 338/97 and therefore treated by the EU as if they are on CITES Appendix I therefore prohibiting their commercial trade. Risso's dolphin is also listed on Annex IV of the EC Habitats Directive, which prohibits all killing, capture, disturbance, sale, exchange or keeping of the animials. The directive requires that all accidental killing and capture be monitored by all member states. Also this species is listed under Appendix II of the Bonn Convention (North and Baltic Sea populations), and Appendix II of the Bern Convention. The Bonn Convention is the parent Convention to the 'Agreement on the Conservation of Small Cetaceans in the Baltic and the North Seas' (ASCOBANS) formulated in 1992. The UK is one of seven European countries which have signed the agreement which includes the protection of specific areas, monitoring, research, information exchange, pollution control and heightened public awareness. Measures included are specifically aimed at protecting dolphins and porpoises in the North Baltic Seas (Anon, 1999e).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Risso's dolphin is a large, stocky species with a blunt head (2). They are easily recognised as they are heavily scared and become whiter with age as the number of scars increases (2). Calves are born with grey skin that turns chocolate brown as they age (5), eventually they take on the adult colouring of a grey back and white underside with darker flippers and tail (5). The scars are thought to be caused by the teeth of other Risso's dolphins, due to playing or fighting, however it is also thought that some of the scars are the result of squid bites (2). The tall, centrally positioned sickle-shaped dorsal fin is even taller and more erect in adult males than in females (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This is a widely-distributed species, inhabiting primarily deep waters of the continental slope and outer shelf (especially with steep bottom topography), from the tropics through the temperate regions in both hemispheres (Kruse et al. 1999). It also occurs in some oceanic areas, beyond the continental slope, such as in the eastern tropical Pacific. It is found from Newfoundland, Norway, the Kamchatka Peninsula, and Gulf of Alaska in the north to the tips of South America and South Africa, southern Australia, and southern New Zealand in the south. Its range includes many semi-enclosed bodies of water, such as the Gulf of Mexico, Gulf of California, Red Sea, Persian Gulf, Sea of Japan, and Mediterranean Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Grampus griseus has an extensive distribution. The species can be found in temperate, subtropical and tropical waters of oceans worldwide.

Biogeographic Regions: indian ocean; atlantic ocean ; pacific ocean ; mediterranean sea

Other Geographic Terms: cosmopolitan

  • 2010. "NOAA fisheries" (On-line). Office of Protected Resources. Accessed March 12, 2011 at http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/rissosdolphin.htm.
  • Amano, M., N. Miyazaki. 2004. Composition of a school of Risso's dolphins, Grampus griseus. Marine and Freshwater Biology, Zoology, 20/1: 152-160.
  • Nuno, J. 2008. Field Notes on the Risso's Dolphin (Grampus Griseus) Distribution, Social Ecology, Behaious, and Occurence in the Azores. Aquatic Mammals, 34/4: 426.
  • Pawloski, J., P. Nachtigall, W. Au, J. Philips, H. Roitblat. 2003. Echolocation in Risso's dolphin, Grampus griseus. The Journal of the Acoustical Society of America, 113/1: 605-616.
  • Stewart, B., P. Clapham, J. Powell, R. Reeves. 2002. National Audobon's Guide to Marine Mammals of the World. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

in all oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Georges Bank, on the continental shelf and shelf edge waters
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Comores, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Irish Exclusive economic Zone, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portugese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, Spanish Exclusive Economic Zone, Subantarctic Waters, Tanzania, United Kingdom Exclusive Economic Zone, World Oceans
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Mediterranean and Red Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Tropical and temperate waters worldwide.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Transient

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Not uncommon worldwide in tropical, subtropical, and warm temperate oceans. In the North Atlantic: Newfoundland to Lesser Antilles in the west, Sweden to the Mediterranean in the east. South to Argentina and South Africa in the south Atlantic. In the Pacific Ocean: Alaska and the Kuiles south to central Chile, Australia, and New Zealand. Occurs also in the Indian Ocean and Red Sea. May wander into cooler waters in summer. See Leatherwood et al. (1980) for information on distribution in the eastern Pacific Ocean.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Widely distributed, inhabiting tropical and warm temperate waters of both hemispheres (6). In UK waters the main concentration is around the Hebrides, but the species also occurs around the Northern Isles and in the Irish Sea. It is also quite common in south-east and western Ireland (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Risso's dolphins have blunt, squarish heads and lack the beak typical of other delphinids. The dorsal fin is tall and falcate, and their flippers are long, pointed, and recurved. The anterior part of the body is very robust, tapering to a narrow tailstock. Adults range from 2.6 to 4 m in length, with an average body mass around 400 kg. The sexes are similar in size. Newborns range from 1.1 to 1.5 m in length and average 20 kg at birth. Along the body axis on the melon (i.e., beak, eyes, blowhole) there is a slight concave groove which is a unique characteristic of this species. Sexual dimorphism has not been reported in this species.

The youngest calves range in colour from iridescent gunmetal grey to fawn-brown dorsally and are creamy-white ventrally. Pale ochre-yellow highlights accentuate the muzzle. A white anchor-shape patch between the flippers resembles the chest chevron seen on pilot whales but is typically brighter and more extensive. Calves become silver-grey, then darken to nearly black, retaining the ventral patches of white. As animals age further, their heads, abdomens, and flanks lighten. (Nishiwaki 1972, Kruse et al. 1999, MMSC 1996,

This species displays highly variable coloration. The youngest calves range in colour from iridescent gunmetal grey to fawn-brown dorsally and are creamy-white ventrally. Pale ochre-yellow highlights accentuate the muzzle. A white anchor-shape patch between the flippers resembles the chest chevron seen on pilot whales but is typically brighter and more extensive. Calves become silver-grey, then darken to nearly black, retaining the ventral patches of white. In older animals, lip colour frequently contrasts with the surrounding background. Coloration fades with age, and some adults appear almost completely white due to the linear scarring that accumulates on individuals over time. These distinctive scars accumulate primarily on the animals' dorsal and lateral surfaces and have been hypothesized to result from the combined effects of lack of repigmentation of damaged tissue and a slower healing process than that observed in animals such as bottlenose dolphins. Scarification can be caused by other Risso's dolphins, predators (e.g., cookie cutter sharks), prey, or by parasites like sea lamprey. Intraspecific, tooth rake, scars tend to be long and parallel and may act as an indicator of male fitness during aggressive social interactions.

Risso's dolphins lack teeth in their upper jaws, but have 2 to 7 pairs of sharp peg-like teeth in their lower jaw, which are specialized for capturing prey, fighting predators, and competing with conspecific for mates and resources. Evolutionary retention of these teeth may be partly due to their significance in male-male interactions.

Risso's dolphins may be confused with bottlenose dolphins, false killer whales, and killer whales due to the shape and size of their dorsal fin. However, their blunt heads and extensive scarring make them unmistakable.

Range mass: 300 to 500 kg.

Range length: 2.6 to 5 m.

Average length: 2.8 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Hartman, K., F. Visser, A. Hendriks. 2008. Social structure of Risso's dolphin (Grampus Griseus) at the Azores: a stratified community based on highly associated social units. Canadian Journal of Zoology, 86/4: 294-306.
  • Jefferson, T., S. Leatherwood, M. Webber. 1993. Marine Mammals of the World. Rome: United Nations Environment Programme. Accessed March 31, 2011 at http://books.google.com/books?id=W4Cbz0WphN0C&printsec=frontcover&cd=1&source=gbs_ViewAPI#v=onepage&q&f=false.
  • MacLeod, C. 1998. Intraspcific scarring in odontocete cetaceans: and indicator of male 'quality' in agressive social interactions?. Journal of Zoology, 244: 71-77.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Head-body length: 2.6 – 4 m; Weight: 300 – 500 kg.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 400 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 2.8-3.8 m

Weight:
Average: 500 kg
Range: 400-600 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Grampus griseus (Cuvier, 1812)
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Partial Skull
Collector(s): C. Scammon
Locality: Monterey, California, United States, North America, North Pacific Ocean
  • Type: Dall. 1873. Proc. Calif. Acad. Sci. 5: 13.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Risso’s dolphins inhabit deep oceanic and continental slope waters, generally 400-1,000 m deep (Baird 2002; Jefferson et al. 1993), mostly occurring seaward of the continental slope. They frequent subsurface seamounts and escarpments, where they are thought to feed on vertically migrant and mesopelagic cephalopods. In Monterey Bay, California, Risso's dolphins are concentrated over areas with steep bottom topography (Kruse 1989). Currents and upwelling causing local increases in marine productivity may enhance feeding opportunities, resulting in the patchy distribution and local abundance of this species worldwide (Kruse et al. 1999). Davis et al. (1998) and Baumgartner (1997) reported that in the Gulf of Mexico, Risso's dolphins were mostly found over deeper bottom depths, concentrating along the upper continental slope, which may reflect squid distribution. Most records of Grampus griseus in Britain and Ireland are within 11 km of the coast. In certain areas, such as in the southwest English Channel, Risso’s dolphins are known to occur seasonally in shallow coastal waters to feed on cuttlefishes Sepia officinalis (Kiszka et al., 2004).

Long-term changes in the occurrence of Risso’s dolphins in some areas (e.g., off Catalina Island and in central California) have been linked to oceanographic conditions and movements of spawning squid (Kruse et al. 1999). Risso's dolphins feed on crustaceans and cephalopods, but seem to prefer squid. Squid bites may be the cause of at least some of the scars found on the bodies of these animals. In the few areas where feeding habits have been studied, they appear to feed mainly at night.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Risso's dolphins are pelagic, but prefer habitat on steep slopes, ranging from 400 to 1,200 meters. They are often seen near the edges of continental shelves, or near bathymetric features such as seamounts and submarine canyons. They are most commonly found in waters ranging in temperature from 59 to 68 degrees F, but will inhabit waters cold as 50 degrees F.

Risso’s dolphins are present year round throughout most of their geographic range. Residents of the northern-most parts of their range migrate seasonally between summering and wintering grounds For example, populations off the coast of northern Scotland during the summer, migrate to the Mediterranean during the winter, and populations off the coast of California during the summer, migrate to Mexican waters during winter.

Range depth: 400 to 1,200 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; benthic ; coastal

  • Culik, B. 2010. "Grampus griseus" (On-line). CMS (Convention on Migratory Speices). Accessed April 16, 2011 at http://www.cms.int/reports/small_cetaceans/data/g_griseus/g_griseus.htm.
  • Leatherwood, S., W. Perrin, V. Kirby, C. Hubb, M. Dahlheim. 1980. Distribution and movements of Risso's dolphin, Grampus griseus, in the eastern north Pacific. Fishery Bulletin, 77/4: 951-963.
  • Taylor, B., R. Baird, J. Barlow, S. Dawson, J. Ford, J. Mead, G. Notarbartolo di Sciara, P. Wade, R. Pitman. 2010. "Grampus griseus" (On-line).
    The IUCN Red List of Threatened Species
    . Accessed May 31, 2011 at http://www.iucnredlist.org/apps/redlist/details/9461/0.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

temperate to tropical, oceanic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3009 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2342 samples.

Environmental ranges
  Depth range (m): 0 - 2200
  Temperature range (°C): 3.515 - 29.261
  Nitrate (umol/L): 0.037 - 28.479
  Salinity (PPS): 30.381 - 37.318
  Oxygen (ml/l): 3.182 - 7.195
  Phosphate (umol/l): 0.055 - 1.881
  Silicate (umol/l): 0.746 - 26.702

Graphical representation

Depth range (m): 0 - 2200

Temperature range (°C): 3.515 - 29.261

Nitrate (umol/L): 0.037 - 28.479

Salinity (PPS): 30.381 - 37.318

Oxygen (ml/l): 3.182 - 7.195

Phosphate (umol/l): 0.055 - 1.881

Silicate (umol/l): 0.746 - 26.702
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Risso's dolphins are pelagic, mostly occurring seaward of the continental slope.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Comments: Pelagic waters; generally in water >180 m deep (>1000 m deep according to IUCN 1991). In the northern Gulf of Mexico, occurs mainly in steep sections of the upper continental slope, where water depth is 350-975 m and gradient is greater than 24 m per 1.1 km (Baumgartner 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Grampus griseus is a deep water species sighted close to shore where the continental shelf is narrow and around oceanic islands. It prefers tropical and warm temperate water migrating north in the summer months.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Shows a preference for deep, warm temperate and tropical waters in offshore areas (6). Risso's are fairly abundant, with wide distribution. They prefer deep off shore waters, but can be seen close to shore around oceanic islands. In Britain and Ireland most records are within 11 km of the coast (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Risso's dolphins are known to prey on a mix of neritic, oceanic, and occasionally bottom dwelling organisms.  Their diet consists of fish, krill, crustaceans, and cephalopods. Their most important prey item is the greater argonaut, which is also known as the paper nautilus. They often follow prey into shallow waters along the continental shelf, and prefer to feed between 600 and 800 m below the surface of the sea.

Animal Foods: fish; mollusks; aquatic crustaceans

Primary Diet: carnivore (Molluscivore )

  • Raga, J., M. Raduan, C. Blanco. 2006. Diet of Risso's dolphin (Grampus Griseus) in the western Mediterranean Sea. Scientia Marina, 70/3: 407-411.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Diet mainly squid, occasionally small fishes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Risso's dolphins consume large amounts of fish, krill, crustaceans, and cephalopods and likely have a significant influence on the abundance of these animals. Risso's dolphins are one of many hosts for sea lamprey, which is common in shoreline habitat throughout north Atlantic.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is no information available regarding predators specific to Risso's dolphin.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Usually occurs in groups; off California, groups averaged usually between 30-50, sometimes over 200; in the eastern tropical Pacific, groups averaged 15-26; in the northeastern Atlantic and Mediterranean, average group size was 6-7, with maximum of 20-30 (Leatherwood et al. 1980, IUCN 1991). Commonly associates with pilot whales.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Risso’s dolphins use echolocation to locate, identify, and determine the distance of various objects in their environment. One of the most well-known sounds of delphinids are clicks. The clicks of Risso's dolphins have a peak frequency of 65 kHz, 3-dB bandwidths of 72 kHz, and durations of 40 to 100 Ms, all of which are consistent with other delphinids. Risso’s dolphins are also able to emit sonar clicks in the water while the majority of their forehead is above water, a characteristic unique to this species. In addition to broadband clicks, Risso's dolphins make a number of different vocalizations, including barks, buzzes, grunts, chirps, whistles, and simultaneous whistle and pulse sounds. Whistle and burst-pulse vocalizations have not been reported in other cetaceans and are thought to be unique to this species.

Communication Channels: visual ; acoustic

Perception Channels: visual ; acoustic ; echolocation

  • Corkeron, P., S. Van Parijs. 2001. Vocalizations of eatern Austailian Risso's dolphins, Grampus griseus. Canadian Journal of Zoology, 79/1: 160-164.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Risso's dolphins feed primarily on squid and are also known to feed on a variety of fish. Risso's dolphins are a gregarious species that form groups of between 3-30 individuals on average; however they have been known to form massive schools of thousands of dolphins. They are an agile species that perform leaps and fluke and flipper slapping.

Risso's dolphins are thought to reach sexual maturity when they reach between 2.6-2.8 m in length in both sexes. Little is known about the reproductive habits of this species. One young born at any time of year after gestation of 13-14 months. The lifespan is estimated at 20-40 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Active day/night.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

On average Risso's dolphins live at least 30 years.

Average lifespan

Status: wild:
30 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 42.5 years (captivity) Observations: One captive specimen lived for 42.5 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

There is no information regard the mating system of Grampus griseus. However, other Cetaceans tend to be either polygynous and polyandrous.

There is little information available regarding reproductive behavior in Grampus griseus. Most females are sexually mature by 8 to 10 years old, however, size is often a better indicator of sexual maturity than age in marine cetaceans. Most males reach sexually maturity at a length of 2.6 to 2.8 m. Gestation lasts 13 to 14 months, and average mass of newborns calves is 20 kg. Weaning is complete by 12 to 18 months after parturition. Breeding and calving occur year-round, but peak during summer and winter in the north Atlantic and eastern Pacific, respectively.

Breeding season: Grampus griseus breeds year round, but peaks seasonally depending on hemisphere.

Range gestation period: 13 to 14 months.

Average birth mass: 20 kg.

Range weaning age: 12 to 18 months.

Range age at sexual or reproductive maturity (female): 8 to 10 years.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average number of offspring: 1.

Female Risso's dolphins are the primary care givers to calves, and paternal care, which is rare in other cetaceans, has not been documented in this species. Newborns are precocial and begin swimming immediately after birth. Mother-calf pods form, and young usually do not leave the group until a few years before sexual maturity. Alloparental care has been recorded amongst females. Often, while a calve's mother is foraging for food, another female provides care.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); post-independence association with parents

  • 2010. "NOAA fisheries" (On-line). Office of Protected Resources. Accessed March 12, 2011 at http://www.nmfs.noaa.gov/pr/species/mammals/cetaceans/rissosdolphin.htm.
  • Hartman, K., F. Visser, A. Hendriks. 2008. Social structure of Risso's dolphin (Grampus Griseus) at the Azores: a stratified community based on highly associated social units. Canadian Journal of Zoology, 86/4: 294-306.
  • Nuno, J. 2008. Field Notes on the Risso's Dolphin (Grampus Griseus) Distribution, Social Ecology, Behaious, and Occurence in the Azores. Aquatic Mammals, 34/4: 426.
  • Stewart, B., P. Clapham, J. Powell, R. Reeves. 2002. National Audobon's Guide to Marine Mammals of the World. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Grampus griseus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2450-09|EU557095|Grampus griseus| AACCGATGACTATTCTCTACCAATCACAAAGACATTGGTACCCTGTATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGTACTGGCCTA---AGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAT---GACCAGCTTTATAATGTTCTAGTAACAGCTCACGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATCGGGGGCTTTGGAAACTGACTAGTACCCTTGATA---ATTGGAGCCCCTGACATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCCTCAATAGTTGAAGCCGGCGCAGGTACAGGCTGAACTGTATACCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCTTCAGTAGACCTT---ACTATTTTCTCTCTACATTTAGCCGGTGTATCTTCAATCCTTGGAGCTATCAACTTCATTACAACTATTATTAATATAAAACCACCTGCTATGACCCAATACCAAACACCCCTCTTCGTCTGATCAGTCTTGGTCACAGCAGTCTTACTTTTATTATCATTACCCGTCTTAGCAGCC---GGAATTACTATACTATTGACTGATCGAAATCTAAACACAACCTTCTTCGACCCGGCAGGGGGAGGAGACCCAATCTTATATCAACACTTGTTCTGATTTTTTGGTCACCCCGAAGTATACATTTTAATTCTACCCGGCTTTGGAATAATTTCACATATTGTTACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATAGGAATAGTATGAGCTATGGTTTCTATTGGTTTCCTGGGTTTCATTGTATGAGCTCATCATATATTTACAGTTGGGATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Grampus griseus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 5
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L.

Reviewer/s
Hammond, P.S. & Perrin, W.F. (Cetacean Red List Authority)

Justification
As with similar species, threats that could cause widespread declines include high levels of anthropogenic sound, especially military sonar and seismic surveys, and bycatch. Threats that could cause declines include entanglement in fisheries and competition with squid fisheries. The combination of the large global range and high abundance with possible declines driven by these more localized threats is believed sufficient to rule out a 30% global reduction over three generations (60 years; Taylor et al. 2007) (criterion A).

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Risso's dolphins are abundant and have a broad geographic range. As a result, they are classified as a species of "least concern" on the IUCN's Red List of Threatened Species. However, because little is known of current population trends, it is difficult to estimate potential conservation needs. Potential threats include direct killings for meat and oil in the Indian Ocean, and by-catch in the north Atlantic, the Mediterranean Sea, the southern Caribbean, the Azores, Peru, and the Solomon Islands. Because this species relies on echolocation to hunt, it is also thought that anthropogenic sounds may influence local populations. Recent climate change may also influence their range and abundance, however, potential effects are currently unclear.

US Federal List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (not resident).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Very rare.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1). Listed on Annex IV of the EC Habitats Directive, and Appendix II of the Bonn Convention (North and Baltic Sea populations), and Appendix III of the Bern Convention (3). All cetaceans (whales and dolphins) are listed on Annex A of EU Council Regulation 338/97; they are therefore treated by the EU as if they are included in CITES Appendix I, so that commercial trade is prohibited. In the UK all cetaceans are fully protected under the Wildlife and Countryside Act, 1981 and the Wildlife (Northern Ireland) Order, 1985 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There are no estimates of global abundance, but there are some estimates for specific areas. Forney and Barlow (1998) observed that the estimated abundance of Risso's dolphins off California was almost an order of magnitude higher in winter (N= 32,376) than in summer (N= 3,980). However, the California, Oregon, Washington subpopulation is now estimated at only 16,066 (CV=28%) whales (Barlow 2003). Hawaiian waters are estimated to contain 2,351 (CV=65%) Risso’s dolphins (Barlow 2006). Abundance estimates off Sri Lanka ranged from 5,500 to 13,000 animals (Kruse et al. 1999). In the eastern Sulu Sea, Dolar et al. (2006) estimated the abundance at 1514 (CV=55%) individuals. There are an estimated 20,479 (CV=59%) Risso’s dolphins off the eastern United States (Waring et al. 2006), 2,169 (CV=32%) in the northern Gulf of Mexico (Mullin and Fulling 2004), 83,300 (CV=17%) in three areas of concentrated occurrence off Japan (Miyashita 1993), and 175,000 in the eastern tropical Pacific (Wade and Gerrodette 1993).

In relative terms, there are several examples of long term changes in abundance and distribution, e.g. in the Southern California Bight (Kruse et al. 1999). In the late 1950s, Risso's dolphins were rarely encountered in this area, and between 1975 and 1978 they were still considered to be a minor constituent of the cetacean fauna of the Bight, representing only 3% of the cetaceans observed. After the El Niño of 1982/83, however, numbers of Risso's dolphins increased, especially around Santa Catalina Island where they came to be considered common (Shane 1995). There is no information on global trends in the abundance.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Occasional direct killing of Risso’s dolphins has occurred. This is generally as a result of the dolphins removing fish from longlines, or in multi-species small cetacean fisheries, such as those that occur in Sri Lanka, the Caribbean, and Indonesia. One regular hunt occurs in Japan, where about 250-500 are taken per year in a drive fishery. Some Risso’s dolphins have been captured for live display in oceanaria, although there are not many of them in oceanaria.

In Sri Lanka, Risso's dolphins are apparently the second most commonly taken cetacean in fisheries, providing fish and meat for human consumption and fish bait; subpopulations there may be adversely affected (see Jefferson et al. 1993; Kruse et al. 1991). An estimated 1,300 Risso's dolphins may be landed annually as a result of this fishery, and abundance estimates in these waters range only from 5,500 to 13,000 animals (Kruse et al. 1999). In Japan, Risso's dolphins are taken periodically for food and fertilizer in set nets and as a limited catch in the small-type whaling industry (Kruse et al. 1999), with reported catches in recent years ranging from about 250–500. They are also a major target of artisanal hunting, and are taken often in gillnets and other fishing gear in the Philippines (Dolar 1994, Dolar et al. 1994). Off eastern Taiwan, Risso’s dolphins are also taken by harpoon opportunistically and oceanic large-mesh driftnets for large pelagic fish appear to take considerable numbers incidentally (Wang pers. comm.).

There are reports of bycatches from the North Atlantic, the Mediterranean Sea, the southern Caribbean, the Azores, Peru, and the Solomon Islands. They are also a rare bycatch in the US tuna purse seine industry, and are taken occasionally in coastal gill net and squid seining industries off the US coast, or shot by aggravated fishermen (Kruse et al. 1999).

This species, like beaked whales that are also deep-divers that feed on squid, is likely to be vulnerable to loud anthropogenic sounds, such as those generated by navy sonar and seismic exploration (Cox et al. 2006).

Predicted impacts of global climate change on the marine environment may affect this species of whale, although the nature of impacts is unclear (Learmonth et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Hunted only incidentally in small cetacean fisheries throughout the world (Leatherwood and Reeves 1983). The only known substantial threat is local--incidental take that occurs in association with the Sri Lankan gillnet fishery in the Indian Ocean (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

This dolphin is vulnerable to hunting (5) and environmental change, chemical and noise pollution (8), and entanglement in fishing nets, which results in drowning (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES. The North and Baltic Sea subpopulations are included in Appendix II of CMS.

This is a circumglobal species, which migrates between summering and wintering grounds. Off California, where these movements are best known, they may cross between US and Mexican waters. Data on abundance, bycatch, and behavior needed in order to develop conservation measures that will enable protection of the natural habitat of the species
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

A UK Biodiversity Action Plan priority species, Risso's dolphin is protected in UK waters by the Wildlife and Countryside Act 1981 and the Wildlife (Northern Ireland) Orders, 1985; it is illegal to intentionally kill, injure, or harass any cetacean (whale or dolphin) species in UK waters (4). The Agreement on the Conservation of Small Cetaceans in the Baltic and North Seas (ASCOBANS) has been signed by seven European countries, including the UK. Provision is made under this agreement to set up protected areas, promote research and monitoring, pollution control and increase public awareness (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Risso’s dolphins are sometimes a by-catch in the U.S. tuna purse seine industry, and are taken occasionally in coastal gill net and squid seining industries off the U.S. coast. They are sometimes a considered a nuisance to fisherman. Risso’s dolphins are high trophic level consumers. As a result, their tissues accumulate pollutants that are prevalent throughout their geographic range, a process known as bioaccumulation, and consuming the meat of this species could be harmful.

  • Storelli, M., G. Macrotrigiano. 2000. Persistent Organchlorine Residues in Risso's Dolphins (Grampus griseus) from the Mediterranean Sea. Marine Pollution Bulletin, 40/6: 555-558.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In Indonesia and the Caribbean, Risso’s dolphins are hunted for their meat and oil. In Japan, they are taken periodically for food and fertilizer. Small numbers are sometimes collected for live exhibitions.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Sometimes maintained in marine aquaria. Meat is used locally for human consumption (IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Risso's dolphin

Risso's dolphin!<-- This template has to be "warmed up" before it can be used, for some reason -->

Risso's dolphin (Grampus griseus) is the only species of dolphin in the genus Grampus.

Contents

Taxonomy

Risso's dolphin is named after Antoine Risso, whose description formed the basis of the first public description of the animal, by Georges Cuvier, in 1812. Another common name for the Risso's dolphin is grampus (also the species' genus), although this common name was more often used for the orca. The etymology of the word grampus is unclear. It may be an agglomeration of the Latin grandis piscis or French grand poisson both meaning big fish. The specific epithet griseus refers to the mottled (almost scarred) grey colour of its body.

Description

Risso's have a relatively large anterior body and dorsal fin, while the posterior tapers to a relatively narrow tail. The bulbous head has a vertical crease in front.[3]

Infants are dorsally gray to brown and ventrally cream-colored, with a white anchor-shaped area between the pectorals and around the mouth. In older calves, the non-white areas darken to nearly black, and then lighten (except for the always dark dorsal fin.) Linear scars mostly from social interaction eventually cover the bulk of the body. Older individuals appear mostly white. Most individuals have 2-7 pairs of teeth, all in the lower jaw.[3]

Length is typically 10 feet (3.0 m) although specimens may reach 14.1 feet (4.3 m).[4] Like most dolphins, males are typically slightly larger than females. This species weighs 300–500 kilograms (660–1,100 lb) making it the largest species called "dolphin".[5][6]

Range and habitat

They are found worldwide in temperate and tropical waters, usually in deep waters rather than close to land. As well as the tropical parts of the Indian, Pacific and Atlantic Oceans, Rissos are also found in the Persian Gulf, Mediterranean and Red Seas, but not the Black Sea. They range as far north as the Gulf of Alaska and southern Greenland and as far south as Tierra del Fuego.[3]

Their preferred environment is just off the continental shelf on steep banks with water depths varying from 400–1,000 metres (1,300–3,300 ft) and water temperature at least 10 °C (50 °F) and preferably 15–20 °C (59–68 °F).[3]

The population around the continental shelf of the United States is estimated in excess of 60,000. In the Pacific a census recorded 175,000 individuals in eastern tropical waters and 85,000 in the west. No global estimate exists.

Ecology

They feed almost exclusively on neritic and oceanic squid, mostly nocturnally. Predation does not appear significant. Mass strandings are infrequent.[3]

These dolphins typically travel in groups of 10-50, but that may reach 400. Smaller, stable subgroups exist within larger groups. They also travel with other cetaceans. They harass and surf the bow waves of gray whales as well as ocean swells.[3]

Reproduction

Gestation requires an estimated 13–14 months, at intervals of 2.4 years. Calving reaches seasonal peaks in the winter in the eastern Pacific and in the summer and fall in the western Pacific. Females mature sexually at ages 8–10, and males at age 10-12. The oldest specimen reached 34.5 years.[3]

Human interaction

Risso's dolphins generally do not approach boats (they occasionally surf bow waves.)[3] A notable exception was an individual named Pelorus Jack who accompanied boats in Admiralty Bay in New Zealand's Marlborough Sounds for more than 20 years. Hunting of this species has never been particularly widespread, and the species is recognised as abundant and safe.

Risso's have successfully been taken into captivity in the United States and Japan, although not with the regularity of bottlenose dolphins or orca. Hybrid Risso's-bottlenose dolphins have been bred in captivity.

Strandings

At least one case report of strandings in Japan's Goto Islands has been associated with parasitic neuropathy of the VIIIth cranial nerve by a trematode in the genus Nasitrema.[7]

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300098. 
  2. ^ Taylor, B.L., Baird, R., Barlow, J., Dawson, S.M., Ford, J., Mead, J.G., Notarbartolo di Sciara, G., Wade, P. & Pitman, R.L. (2008). Grampus griseus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 7 October 2008.
  3. ^ a b c d e f g h Baird, Robin W. (2009). Perrin, William F.; Wursig, Bernd; Thewissen, J. G. M.. eds. Encyclopedia of Marine Mammals (2 ed.). 30 Corporate Drive, Burlington Ma. 01803: Academic Press. p. 975. ISBN 978-0-12-3733553-9. http://www.elsevier.com/wps/find/bookdescription.cws_home/716899/description#description. 
  4. ^ http://animaldiversity.ummz.umich.edu/site/accounts/information/Grampus_griseus.html
  5. ^ American Cetacean Society Fact Sheet - Risso's Dolphin
  6. ^ http://www.whale-web.com/dolphins/risso.html
  7. ^ See Morimitsu et al. 1992. J Wildl Dis 28:656-658
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!