Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Brief Summary

Description

With no dorsal fin, a slender body shape that tapers steadily toward the tail, and small flippers and flukes, the northern right whale dolphin appears to be built for speed. It has been clocked at 34 km per hour and can dive as deep as 200 m to feed on deepwater fish. The species is common in deep waters of the continental shelf, or offshore waters, and it also occurs in large numbers where undersea canyons bring deep waters near the coast. It is known only from temperate North Pacific waters.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Peale, T.R., 1848.  U.S. exploring expeditions 1838, 1839, 1840, 1841, 1842 under the command of Charles Wilkes, U.S.N., Mammalogy and Ornithology, 8:35. Asherman and Co., Philadelphia, 8:1-338.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: North Pacific Ocean, mainly in moderate temperate waters. Mainly British Columbia to Baja California, Kuril Islands to Japan in western Pacific; sometimes north to Aleutians and Gulf of Alaska; in the eastern Pacific, apparently most common off central and southern California; at least as far south as 35 degrees north in the central Pacific (Jefferson and Newcomer 1993). Rare in Canadian waters (Baird and Stacey 1991). Eastern and western Pacific populations may be separated by an area of very low density south of the western Aleutians (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Northern Right Whale Dolphin is found in deep, temperate waters of the North Pacific Ocean, between about 30°N and 50°N.

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

These cetaceans are found only in the northern Pacific Ocean, between the latitudes 35 degrees North and 51 degrees North.

Biogeographic Regions: pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Northern right whale dolphins have an unusually slender body shape, and they do not have a dorsal fin or ridge. They have small, curved flippers, and small flukes. They are mostly black, but they have a well defined white band on their belly. Males and females have the same body shape and color pattern, the only sexually dimorphism being that males can attain greater length (up to 3 meters) and weight than females.

Range mass: 90 to 113 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 310 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: 2-3.1 m males; 2-2.6 m females

Weight:
Range: up to 113 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Relatively deep continental shelf and offshore waters with temperatures of 8-24 C (see Jefferson and Newcomer 1993). Favors deeper-water habitats but does approach shore at the heads of deep canyons, especially in winter (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

oceanic, cold and warm temperate
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The habitat of this species includes deep oceanic waters from the outer continental shelf across the temperate North Pacific. They are sometimes seen nearshore, especially where deep water approaches the coast (such as underwater canyons), and apparently prefer "coastal-type" waters in the California Current system (see Jefferson et al. 1994). Ferrero (1998) observed in the central North Pacific that sea surface temperature was the most influential habitat parameter, with L. borealis occupying warmer waters than either Phocoenoides dalli or Lagenorhynchus obliquidens.

Groups of Northern Right Whale Dolphins mixed with other marine mammals, especially Pacific White-sided Dolphins (with which they share a nearly identical range) and Risso’s Dolphins, are not uncommon (Baird and Stacey 1991).

Although market squid and lanternfish are the major prey items for Northern Right Whale Dolphins off southern California, a variety of other species are taken by this species throughout the range. These include various species of cephalopods, hakes, sauries, and several species of surface and midwater fishes.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These animals live in deep continental shelf and offshore waters where the temperatures vary between 8 and 24 degrees C. They approach shore only where very deep water can be found near the coast.

Aquatic Biomes: benthic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 631 specimens in 1 taxon.
Water temperature and chemistry ranges based on 446 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 11.144 - 16.503
  Nitrate (umol/L): 0.204 - 4.675
  Salinity (PPS): 30.381 - 33.496
  Oxygen (ml/l): 5.646 - 6.583
  Phosphate (umol/l): 0.330 - 0.800
  Silicate (umol/l): 1.436 - 16.169

Graphical representation

Temperature range (°C): 11.144 - 16.503

Nitrate (umol/L): 0.204 - 4.675

Salinity (PPS): 30.381 - 33.496

Oxygen (ml/l): 5.646 - 6.583

Phosphate (umol/l): 0.330 - 0.800

Silicate (umol/l): 1.436 - 16.169
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Distribution tends to shift south and inshore during cooler months, north and offshore summer through fall; movement possibly are related to the availability of spawning squid (Leatherwood and Reeves 1983, Jefferson and Newcomer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Most common food items are market squid and lanternfish; other prey includes other squids, Pacific hake, saury, and epi- and mesopelagic fishes of the families Centrolophidae, Melamphaidae, Bathylagidae, and Paralepididae (Leatherwood and Reeves 1983, Jefferson and Newcomer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Northern right whale dolphins feed mainly on squid and lanternfish, but they also eat other kinds of fish.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Global Abundance

100,000 - 1,000,000 individuals

Comments: One of the most abundant oceanic dolphins in the temperate North Pacific (Leatherwood and Reeves 1983). Preliminary estimate of total population: 247,000-535,000 (Mangel, cited by Jefferson and Newcomer 1993). Hiramatsu (1991) estimated the population at 535,000 (95% confidence interval 394,000-738,000). Several 10,000s off California (see Jefferson and Newcomer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Travels in groups of up to several thousand; average group size about 100 (eastern Pacific) to 200 (western Pacific). Commonly associates with other cetaceans, especially the Pacific white-sided dolphin. Tends to avoid boats but may bowride. Fast swimmer.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Newborn are most commonly reported in winter or early spring; sexually mature at length of about 2 m (Leatherwood and Reeves 1983, Jefferson and Newcomer 1993). Based on samples caught in squid driftnets in the central North Pacific, about half of females were mature; among mature females, 16% were pregnant, 3% were pregnant and lactating, 33% were post partum, 24% were lactating (no recent pregnancy), 10% were resting, and 14% were of unknown condition; gestation period was 12.1-12.3 months; calving appeared to peak in July and August; average of sexual maturity was 10 years; the oldest male was 27 years old, the oldest female 42 years old; minimum calving interval was 2 years (Ferrero and Walker 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Virtually nothing is known about reproduction or mating in this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lissodelphis borealis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACCTTGTATTTACTATTTGGCGCCTGAGCAGGAATAGTGGGTACTGGTCTGAGCTTGTTGATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGACGACCAACTTTATAATGTTCTAGTAACAGCTCATGCCTTCGTAATAATTTTCTTTATGGTGATACCTATTATAATTGGGGGTTTTGGAAACTGATTAGTTCCCTTGATAATCGGAGCCCCTGACATAGCGTTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCCTTCCTACTACTGATAGCATCTTCGATAATTGAGGCCGGCGCAGGTACAGGCTGAACCGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCGGGAGCCTCAGTAGACCTTACCATTTTCTCTCTACATCTAGCCGGTGTATCTTCAATCCTTGGAGCTATCAACTTCATTACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACGCCTCTCTTCGTCTGATCAGTCTTAGTCACAGCAATCTTACTTCTACTATCACTACCTGTCTTAGCAGCCGGAATTACTATACTATTAACTGATCGAAATCTAAACACAACCTTTTTTGACCCGGCAGGAGGAGGGGACCCAATCTTATATCAACACTTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lissodelphis borealis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K.A., Karkzmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y. , Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D.

Contributor/s

Justification
Lissodelphis borealis is widespread and abundant, with population estimates in the high tens to low hundreds of thousands throughout their North Pacific range. High levels of bycatch during the 1970s and 1980s are estimated to have reduced their population size within the last three generations by an unknown amount, but the most realistic scenarios suggest the decline was 30% or less. The primary threat to this species (high seas driftnet fishing), which caused the population decline, has largely been eliminated since 1993.

History
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The North Pacific squid driftnet fishery operated out of Japan, Korea, and Taiwan targets northern right whale dolphins. It is estimated that between 1985 and 1990 this fishery took 15,000 to 20,000 dolphins per year. The population has been depleted to anywhere from 24 to 73 percent of its pre-exploitation size. A moratorium on high seas driftnets could allow population levels to increase to previous levels. This species is listed on CITES Appendix II.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10 to >90%

Comments: Current abundance is 24 to 73 percent of the abundance in 1978, depending on which estimate of current population is assumed (Mangel 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Estimates of abundance are available for a subset of the range of Northern Right Whale Dolphins. Across the oceanic North Pacific, Buckland et al. (1993) estimated 68,000 (CV=71%) and Miyashita (1993) estimated 307,000 Northern Right Whale Dolphins, with wide confidence limits, from sighting data, whereas Hiramatsu (1993) estimated about 400,000 dolphins for the same region based on bycatch data. All estimates have high uncertainty, and Buckland (1993) considered the two higher estimates to be positively biased. In the eastern North Pacific, the distribution of this species has been documented to vary seasonally (Forney and Barlow 1998), and abundance estimates along the U.S. West Coast have ranged from about 9,000 to 21,000 dolphins (Forney 1995, Barlow and Forney, in press). The average abundance in this region during 1996-2001 was estimated to be about 11,000 (CV = 26%); Barlow and Forney, in press).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: This is the major marine mammal taken incidently in the extensive squid driftnet fishery that operates out of Japan, Korea, and Taiwan, which probably has greatly reduced the population in the western Pacific (take was estimated at 15,000-20,000 per year in the late 1980s); occasionally taken in salmon gillnet fisheries and in driftnets set for sharks and swordfish (Jefferson and Newcomer 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Lissodelphis borealis experienced very high levels of fishery-induced mortality in international high-seas, large-scale driftnet fisheries, from about 38°N to 46°N and 171°E to 151°W. Assessing the impact of this mortality is complicated by the possible existence of a coastal population off California and the Pacific Northwest that is separate from offshore populations that were subject to high levels of bycatch (Dizon et al. 1994). Total numbers killed by the North Pacific squid driftnet fleets of Japan, Taiwan, and South Korea in the late 1980s were estimated at about 15,000–24,000 per year, and this mortality is considered to have depleted the oceanic population by an unknown amount. Using a variety of assumptions about population estimates, growth rates, and bycatch levels, Mangel (1993) presented a range of analyses that indicate declines of less than 30% were most likely, although more severe declines of up to 45–75% could not entirely be ruled out under certain scenarios, including a few biologically unrealistic ones. The UN moratorium on large-scale high-seas driftnets that came into effect in 1993 relieved this pressure to a considerable extent, but the continued use of driftnets to catch billfish, sharks, squid, and tuna inside the exclusive economic zones (EEZ) of North Pacific countries and some continued illegal fishing on the high-seas results in the killing of unknown numbers of Northern Right Whale Dolphins each year.

Incidental catches have also occurred in Japanese and Russian purse seines, Japanese salmon driftnets, and U.S. shark and swordfish driftnets. Small numbers have been killed in commercial and experimental salmon drift-net operations in the western and central Pacific (Jefferson et al. 1994). An estimated 386 Northern Right Whale Dolphins were killed between 1990 and 2002 in U.S. driftnets targeting sharks and swordfish off the California, Oregon and Washington (Julian and Beeson 1998, Carretta et al. 2005). A short-lived Canadian experimental driftnet fishery for flying squid killed a total of 13 in 1986 and 1987 (Jefferson et al. 1994). Northern Right Whale Dolphins have also been observed entangled in net debris in the western Pacific. The total reported take of Northern Right Whale Dolphins by Japan in 1987 was 261 individuals, of which 254 were discarded as bycatch (Government of Japan 1989).

Northern Right Whale Dolphins have never been subject to extensive directed hunt, although they have sometimes been taken in Japan’s small-cetacean fisheries. In the western Pacific, coastal fisheries off Japan have taken them for many years, with 465 reported killed in the harpoon fishery in 1949. Although this fishery mainly targets other small cetaceans, Northern Right Whale Dolphins continue to be taken (Jefferson et al. 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES

The most significant conservation measure for this species was the United Nations (U.N.) moratorium on high-seas driftnet fishing. In the eastern North Pacific, the U.S drift gillnet fishery has been required since 1996 to use acoustic warning devices (pingers) to reduce cetacean bycatch, although low levels of bycatch of Lissodelphis borealis have continued (Carretta et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Sometimes taken in Japanese harpoon fisheries (for human consumption) and Japanese and Russian purse-seine fisheries, but there is no fishery in which this species has been the main target (see Jefferson and Newcomer 1993). Generally has not done well in captivity.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

The blubber from these animals is used to make oil.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Northern right whale dolphin

The Northern right whale dolphin (Lissodelphis borealis) is a small and slender species of marine mammal found in the North Pacific Ocean. The Northern right whale dolphin travels in groups of up to 2000, often with other cetaceans, in deep waters of the North Pacific. The dolphin is one of two species of right whale dolphin, the other being found in cooler oceans of the southern hemisphere.

Classification[edit]

The species was first described by Titian Peale in 1848. The genus Lissodelphis is placed within Delphinidae, the oceanic dolphin family of cetaceans.[2] The epithet of the genus was derived from Greek lisso, smooth, and delphis;[3] the specific epithet, borealis, indicates the northern distribution. The common names for the species formerly included Northern right whale porpoise, Snake porpoise, and Pacific right whale porpoise.[4][5] Both species in the genus are also referred by the name Right whale dolphin, a name derived from the Right whales Eubalaena, which also lack a dorsal fin.[3][6]

Characteristics[edit]

The species has a streamlined body with a sloping forehead, they are more slender than other delphinids, and lack any fin or ridge on their smoothly curving backs.[7][8] The beak is short and well defined, a straight mouthline, and an irregular white patch on chin. The flippers are small, curved, narrow and pointed, the body is mostly black while the underside is partly white or lighter in colour. The tail flukes are triangular and, like the flippers, pointed. Adults weigh between 60–100 kg (130–220 lb).[7] They have 74 to 108 thin and sharp teeth, not externally visible.[8] As young calves, these dolphins are greyish brown or sometimes cream. They stay like this for a year, before their body turns mainly black, with a clear white belly, and a white streak to their lower jaw.

Adults range in size from 2 metres (6 ft 7 in) in length, females are recorded as 2.3–2.6 m (7 ft 7 in–8 ft 6 in), males at 3.1 m (10 ft), the sexes are otherwise similar in colour and appearance.[8][4] Newborns are around 90 centimetres (35 in). Northern Right Whale Dolphins have less white on their bodies than the Southern species.

Northern right whale dolphin are found as individuals, or in groups as large as 2000.[7] The group's average number is 110 in the eastern North Pacific and 200 individuals in the western North Pacific. They often associate with Pacific white-sided dolphins.[8]

They can reach speeds of up to 30–40 kilometres per hour (19–25 mph) across the open ocean, never along shallow coasts. They can dive up to 200 metres (660 ft) in search of fish, especially lanternfish, and squid.[8] They are found in temperate to cold waters, 24 to 8 °C (75 to 46 °F), from latitudes 51°N to 31°N between the west coast of North America and Asia.

Yankee whalers occasionally took this species for food in the mid-19th century.[9] Records from the late twentieth century show large numbers of Lissodelphis borealis were caught in drift nets, used for large scale squid fishing, which is estimated to have reduced the population by one to three quarters.[8] The current population trend is unknown, IUCN Redlist gives the conservation status as Least Concern.[1]

Behaviour[edit]

This species usually travel in groups of 5–200 animals. When travelling fast the group will look like they're bouncing along on the water, as they make low leaps together, sometimes travelling as far as 7 metres in one leap. They are timid animals, and usually avoid boats. These graceful swimmers may bow-ride sometimes, and are spotted occasionally doing acrobatics, such as breaching, belly-flopping, side slapping, and lobtailing.

See also[edit]

References[edit]

  1. ^ a b Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). Lissodelphis borealis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 24 March 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b "Lissodelphis borealis (Peale, 1848)". Integrated Taxonomic Information System. 
  3. ^ a b Fertl, Dagmar. "Southern Right Whale Dolphin". Whales & Whale Spotting. Retrieved 2009-07-16. 
  4. ^ a b "Lissodelphis borealis (Peale, 1848)". discoverlife.org. Smithsonian Institution. Retrieved 2009-07-15. 
  5. ^ "Lissodelphis borealis (Peale, 1848)". Encyclopedia of life. eol.org. Retrieved 2009-07-15. 
  6. ^ "Lissodelphis peronii". Species Profile and Threats Database. Department of the Environment, Water, Heritage and the Arts, Canberra. Retrieved 2009-07-16. 
  7. ^ a b c Jefferson, Thomas A.; Newcomer, M. (23 April 1993). "Lissodelphis borealis". Mammalian Species (The American Society of Mammalogists) (425): 1–6. 
  8. ^ a b c d e f "Lissodelphis borealis Right Whale Dolphin". MarineBio. Retrieved 2009-07-15. 
  9. ^ Erie, of Fairhaven, 1852 (Nicholson Whaling Collection).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This may be a monotypic genus (Mead and Brownell, in Wilson and Reeder 1993, 2005); i.e., L. borealis may be conspecific with L. peronii of the Southern Hemisphere.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!