Overview

Distribution

Range Description

T. tetradactyla is found to the east of the Andes from Colombia, Venezuela, Trinidad Island, and the Guianas (French Guiana, Guyana, and Suriname), south to northern Uruguay and northern Argentina. It ranges from sea level to 2,000 m asl (Emmons and Feer 1990).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tamandua tetradactyla is found in South America from Venezuela and Trinidad to northern Argentina, southern Brazil, and Uruguay at elevations to 2000 m.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Head and body length ranges from 535 to 880mm and tail length from 400 to 590mm. The individual and geographic variation observed in the southern tamandua has made the taxonomic description of these animals a difficult task. Animals from the southeastern part of the range are "strongly vested," meaning that they have black markings from shoulder to rump; the black patch widens near the shoulders and encircles the forelimbs. The rest of the body can be blonde, tan, or brown. Animals from northern Brazil and Venezuela to west of the Andes are solid blonde, brown, or black, or are only lightly vested. Tamanduas have four clawed digits on the forefeet and five on the hindfeet. To avoid puncturing their palms with their sharp claws, they walk on the outsides of their hands. The underside and the end of the prehensile tail are hairless. The snout is long and decurved with an opening only as wide as the diameter of a pencil, from which the tongue is protruded.

Average mass: 4500 g.

Average basal metabolic rate: 5.015 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
T. tetradactyla is adaptable to a variety of habitats, including gallery forests adjacent to savannas, and lowland and montane moist tropical rain forest (Eisenberg 1989). Typically, this solitary species has pale tan or golden fur with a black vest, but uniformly tan to black coloration also occurs (Wetzel 1985). It mainly feeds on ants and termites, but also attacks bees nests to eat honey (Emmons and Feer 1990). The female gives birth to a single young once per year (Silveira 1968).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Tamandua tetradactyla inhabits various wet and dry forests, including tropical rainforest, savanna, and thorn scrub. It seems to be most common in habitats near streams and rivers, especially those thick with vines and epiphytes (presumably because its prey is common in these areas).

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Southern tamanduas eat ants and termites (mainly arboreal forms), which they locate by scent. They avoid eating ants that are armed with strong chemical defenses, such as army ants and leaf-eating ants. Tamanduas are also thought to eat honey and bees and, in captivity, have been known to eat fruit and meat as well. Anteaters extract their prey by using their extremely strong forelibs to rip open nests and their elongate snouts and rounded tongues (up to 40 cm in length) to lick up the insects.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
9.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 19 years (captivity) Observations: One specimen was estimated to be 19 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females of Tamandua tetradactyla are polyestrous; mating generally takes place in the fall. Gestation ranges from 130 to 150 days and one young is born in the spring. At birth the young anteater does not resemble its parents; its coat varies from white to black. It rides on the mother's back for a period of time and is sometimes deposited on a safe branch while the mother forages. The maximum captive lifespan recorded is 9 years 6 months.

Average gestation period: 160 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tamandua tetradactyla

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0099-06|AJ421450|Tamandua tetradactyla| TCACGTTGACTATTCTCAACAAATCATAAAGATATCGGCACCCTATATTTACTATTTGGTGCTTGAGCCGGAATAGTTGGTACAGGCCTA---AGCATCCTTATCCGCGCAGAGCTTGGACAACCTGGCACCCTATTAGGAGAT---GACCAAATTTACAACGTTATTGTAACCGCACACGCATTTGTAATAATCTTCTTTATAGTCATACCTATTATAATTGGAGGGTTCGGCAACTGACTTGTTCCTCTAATA---ATTGGCGCTCCAGACATAGCCTTTCCACGTATAAACAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTACTACTGGCATCTTCTATAGTAGAAGCAGGAGCAGGTACAGGTTGAACTGTCTATCCACCCCTAGCTGGAAACCTAACCCATGCAGGAGCATCCGTAGATCTA---ACCATCTTCTCACTACACCTAGCAGGAGTCTCTTCAATCTTAGGCGCAATCAACTTCATCACTACTATTATTAATATAAAACCTCCAGCAATAAACCAATATCAAACCCCATTATTCGTATGATCAGTACTAGTAACGGCAGTACTTCTTTTACTATCACTCCCTGTCTTAGCTGCC---GGTATTACTATACTCCTAACAGACCGTAACTTAAATACTACATTCTTTGACCCTGCTGGAGGTGGGGACCCAATCTTGTACCAACATCTATTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTCCCAGGATTTGGAATAATCTCACATATCGTTACATACTACTCTGGAAAAAAA---GAACCATTTGGGTATATAGGCATAGTATGAGCTATAATATCCATTGGATTCTTGGGCTTTATCGTTTGAGCACATCACATATTTACAGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tamandua tetradactyla

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 7
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Miranda, F., Meritt, D.A.Jr.

Reviewer/s
Fallabrino, A. & Superina, M.

Contributor/s
Fallabrino, A., Tirira, D., Arteaga, M. & Rogel, T.

Justification
T. tetradactyla is listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Tamandua tetradacyla from southestern Brazil are listed as CITES Appendix II. These animals, though widespread, are uncommon. They are killed by hunters, who claim that tamanduas kill dogs. They are also killed for the thick tendons in their tails, from which rope is made.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
T. tetradactyla is a relatively common species.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this small anteater, although in some portions of its range it is hunted for meat, by domestic dogs, or sold as a pet species (Aguiar and Fonseca 2008; Noss et al. 2008; D.A. Meritt Jr. pers. comm. 2010). Habitat loss and degradation, wildfires, and road traffic represent a threat in some areas. In Uruguay, T. tetradactyla is affected by habitat loss due to the increase in eucalyptus plantations (A. Fallabrino pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
T. tetradactyla is present in a number of protected areas. Further systematic studies on T. tetradactyla are needed to investigate population densities and dynamics in different parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Tamanduas are sometimes used by Amazonian Indians to rid their homes of ants and termites. Also, as mentioned above, the tendons of their tails are used to make rope.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern tamandua

The southern tamandua, also called a collared anteater, or lesser anteater (Tamandua tetradactyla), is a species of anteater from South America. It is a solitary animal, found in many habitats from mature to highly disturbed secondary forests and arid savannas. It feeds on ants, termites and bees. It has very strong foreclaws that can be used to break insect nests or to defend itself.

Contents

Distribution and habitat

The southern tamandua is found in South America from Venezuela and Trinidad to northern Argentina, southern Brazil, and Uruguay at elevations to 1,600 metres (5,200 ft). It inhabits both wet and dry forests, including tropical rainforest, savanna, and thorn scrub.[3] It seems to be most common in habitats near streams and rivers, especially those thick with vines and epiphytes (presumably because its prey is common in these areas).[citation needed]

The oldest fossil tamanduas date from the Pleistocene of South America, although genetic evidence suggests that they may have diverged from their closest relative, the giant anteater, in the late Miocene, 12.9 million years ago.[4]

Subspecies

There are four recognised subspecies:

Physical description

The southern tamandua is a medium-sized anteater, with a combined head and body length ranging from 34 to 65 centimetres (13 to 26 in), and a prehensile tail 37 to 67 centimetres (15 to 26 in) long. Adults weigh from 3.4 to 8.4 kilograms (7.5 to 19 lb); there is no significant difference in size between males and females.[3] Like their close relative, the northern tamandua, they have four clawed digits on the forefeet and five on the hindfeet, and walk on the outer surface of their forefeet, to avoid puncturing their palms with their sharp claws. The underside and the tip of the tail are hairless. The snout is long and decurved with an opening only as wide as the diameter of a stick, from which the tongue is protruded. Although there are also some differences in the shape of the skull, they can most easily be distinguished from the northern tamandua by their slightly longer ears, which average around 5 centimetres (2.0 in), instead of 4 centimetres (1.6 in) as in the northern species[3].

The individual and geographic variation observed in the southern tamandua has made the taxonomic description of these animals a difficult task. Animals from the southeastern part of the range are "strongly vested", meaning that they have black markings from shoulder to rump; the black patch widens near the shoulders and encircles the forelimbs . The rest of the body can be blonde, tan, or brown. Animals from northern Brazil and Venezuela to west of the Andes are solid blonde, brown, or black, or are only lightly vested.[citation needed]

Reproduction

Females are polyestrous; mating generally takes place in the fall. Gestation ranges from 130 to 190 days[3] and one young is born in the spring. At birth the young anteater does not resemble its parents; its coat varies from white to black. It rides on the mother's back for a period of time and is sometimes deposited on a safe branch while the mother forages.

Behavior

The tamandua is mainly nocturnal but is occasionally active during the day. They nest in hollow tree trunks or in the burrows of other animals, such as armadillos. They are solitary, occupying home ranges that average from 100 to 375 hectares (250 to 930 acres), depending on the local environment.[3]

They may communicate when aggravated by hissing and releasing an unpleasant scent from the anal gland. It spends much of its time foraging arboreally; a study in various habitats in Venezuela[citation needed] showed that this anteater spends 13 to 64 percent of its time in trees. In fact, the southern tamandua is quite clumsy on the ground and ambles along, incapable of the gallop that its relative, the giant anteater, can achieve.

The southern tamandua uses its powerful forearms in self-defense. If it is threatened in a tree it grasps a branch with its hindfeet and tail, leaving its arms and long, curved claws free for combat. If attacked on the ground, this anteater backs up against a rock or a tree and grabs the opponent with its forearms. In the rainforest, the southern tamandua is surrounded during the day by a cloud of flies and mosquitoes and is often seen wiping these insects from its eyes.[citation needed] This animal has small eyes and poor vision, but its large, upright ears indicate that hearing is an important sense.

Diet

Southern tamanduas eat ants and termites in roughly equal proportions, although they may also eat a small quantity of fruit. They locate their food by scent, and prey on a wide range of species, including army ants, carpenter ants, and Nasutitermes.[3] They avoid eating ants that are armed with strong chemical defenses, such as leaf-eating ants[citation needed]. Tamanduas are also thought[by whom?] to eat honey and bees and, in captivity, have been known to eat fruit and meat as well. Anteaters extract their prey by using their extremely strong forelimbs to rip open nests and their elongated snouts and rounded tongues (up to 40 centimetres (16 in) in length) to lick up the insects.

Although it has the same diet as the giant anteater, both animals are able to live alongside one another, perhaps because the southern tamandua is able to reach nests in trees, while its larger cousin cannot.[3]

Conservation

An 1887 illustration of tamandua by C. Wendt.

The southern anteater is listed as CITES Appendix II in southeastern Brazil. Although widespread, they are uncommon. They are killed by hunters, who claim that tamanduas kill dogs. They are also killed for the thick tendons in their tails, from which rope is made. Tamanduas are sometimes used by Amazonian Indians to rid their homes of ants and termites.[citation needed]

References

  1. ^ Gardner, Alfred L. (16 November 2005). "Order Pilosa (pp. 100-103)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 103. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11800048. 
  2. ^ Miranda, F. & Meritt, D. A. Jr. (2011). "Tamandua tetradactyla". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21350. Retrieved 18 January 2012. 
  3. ^ a b c d e f g Hayssen, V. (2011). "Tamandua tetradactyla (Pilosa: Myrmecophagidae)". Mammalian Species 43 (1): 64–74. doi:10.1644/875.1. 
  4. ^ Barros, M.C., et al. (2003). "Phylogenetic analysis of 16S mitochondrial DNA data in sloths and anteaters". Genetics and Molecular Biology 26 (1): 5–11. doi:10.1590/S1415-47572003000100002. 
  • Louise H. Emmons and Francois Feer, 1997 - Neotropical Rainforest Mammals, A Field Guide.
  • Gorog, A. 1999. "Tamandua tetradactyla" from Animal Diversity Web.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!