Overview

Distribution

Range Description

C. didactylus ranges through Venezuela (the delta and south of the Río Orinoco) and the Guianas (French Guiana, Guyana, and Suriname) south into Brazil (Maranhão state west along the Rio Amazonas/Solimões) and west into the upper Amazon Basin of Ecuador and Peru. Its southern limit in the western Amazon of Brazil is unclear. It occurs in the southern departments of Colombia, with its northern limit being the departments of Meta and Guainía. It ranges from sea level up to 2,438 m asl (Britton 1941).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Found in the tropical forest canopies of Central America and northern South America, including portions of Brazil and Peru.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Two-toed sloths have been called the slowest animals on earth. Ranging in length from 21 to 29 inches, Choloepus didactylus is roughly the size and shape of a small dog. The body is composed of a short neck (only 6-7 vertebrae) with four long limbs of equal length, ending in two curved claws. The head is short and flat, with a snub nose, rudimentary ears, and large eyes.

Choloepus didactylus are covered in long brownish-grey hair that curves from stomach to back, opposite that of most mammals. A unique feature of this fur is that each strand has grooves which collect algae, giving the sloth a greenish tint and camouflaging it from predators.

The teeth of the two-toed sloth are small, simple molars that are continously growing but constantly ground down by the mastication of food. To compensate for a lack of sharp teeth, Choloepus didactylus has hardened lips which act to shear and crop leaves.

Range mass: 4 to 8 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
C. didactylus is found in tropical moist lowland and montane forest. Two-toed sloths have nocturnal and solitary habits. Gestation length seems to be approximately 10 months (Eisenberg and Maliniak 1985) but estimates are quite variable.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Choloepus didactylus is strictly arboreal, staying high in the canopy of the tropical rain forests, and maintaining a range of about 10-acres.

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Choloepus didactylus feed primarily on vegetation, including berries, leaves, small twigs, and fruits, cropping the leaves with their lips. On occasion sloths have been known to eat insects and other small prey. They obtain water from vegetation and by lapping dew.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
27.8 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 36.8 years (captivity) Observations: This animal has the lowest and most variable body temperature among mammals (24 to 33ºC) (Ronald Nowak 1999). A 36.8 years old female is reported to be still alive at the Smithsonian National Zoo (http://nationalzoo.si.edu/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Females of this species of sloth reach sexual maturity at 3 years of age, males reach sexual maturity between 4 and 5. After a gestation period of six months, females give birth to one offspring each year. When the young are born they are 10 inches in length and weigh 12 ounces. They cling to their mother's belly for 5 weeks until they have the strength to move on their own.

Average birth mass: 356 g.

Average gestation period: 279 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
1644 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1279 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Choloepus didactylus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.
 
GBMA0641-06|NC_006924|Choloepus didactylus| ACCCGCTGATTATTCTCAACAAACCACAAAGACATTGGAACCTTATATCTACTATTCGGCGCCTGAGCCGGAATAGTAGGCACTGCCCTA---AGCCTGCTAATCCGCGCTGAGCTAGGACAGCCAGGAACATTACTAGGCGAC---GACCAAATCTACAACGTAATCGTCACCGCACACGCATTCGTCATGATTTTTTTTATGGTAATACCAATCATGATTGGTGGTTTCGGAAACTGATTAGTCCCATTGATA---ATTGGAGCTCCCGACATGGCATTCCCTCGAATAAACAACATAAGCTTCTGACTACTACCACCATCATTCCTACTTCTGCTCACCTCCTCAATAGTAGAAGCAGGCGCAGGCACAGGCTGAACTGTATACCCGCCCCTAGCAGGCAACCTGGCCCATGCAGGCCCATCAGTCGATCTA---ACTATCTTTTCCCTTCACCTGGCAGGGATCTCATCAATCCTAGGCGCCATTAATTTTATTACCACTATTATTAACATAAAACCCCCAGCCATGTCCCAGTACCAAACCCCCTTGTTTGTCTGATCAATCCTGATTACGGCAGTCCTCCTTCTCCTCTCACTCCCAGTACTAGCCGCT---GGAATCACCATACTCCTGACAGACCGCAACTTAAATACCACATTTTTTGATCCTGCCGGAGGGGGCGACCCTATTTTATATCAACATTTATTCTGATTCTTCGGACATCCCGAAGTCTATATTCTTATCCTACCAGGCTTCGGTATAATCTCCCATATTGTCACATACTACTCCGGAAAAAAG---GAACCTTTTGGCTATATGGGTATAGTATGAGCCATAATATCAATTGGATTCCTAGGCTTTATTGTTTGAGCCCACCACATGTTTACGGTAGGAATAG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Choloepus didactylus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Plese, T. & Chiarello, A.

Reviewer/s
Abba, A.M. & Superina, M.

Contributor/s

Justification
C. didactylus is listed as Least Concern in view of its wide distribution, presumed large population, its occurrence in a number of protected areas, and because it is unlikely to be declining fast enough to qualify for listing in a more threatened category.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Two-toed sloths are in serious danger of losing their habitat due to logging of rain forests. Aside from captive animals, this is the only area in the world in which this species lives. Several organizations are currently working to protect these areas.

US Federal List: threatened

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Suriname, C. didactylus has been found at densities of 0.9 animals per hectare (Taube et al. 1999). In the Brazilian Amazon, estimated densities range from 0.13 individuals per hectare (Manaus region) to 0.88 animals per hectare in the flooded forests (Mamirauá Reserve; Queiroz 1995, Chiarello 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to C. didactylus. Because they are usually found high in the canopy, motionless and virtually invisible, they are not as commonly hunted as armadillos or tamanduas, and there are taboos against their consumption by some native groups. They are probably hunted opportunistically, but there is no serious bushmeat trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
C. didactylus is present in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There is no direct negative effect of sloths on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Two-toed sloths are a valuable food source and are often hunted for their meat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Linnaeus's Two-toed Sloth

Linnaeus's two-toed sloth!<-- This template has to be "warmed up" before it can be used, for some reason -->

Opisthokonta

Linnaeus's two-toed sloth (Choloepus didactylus), also known as the Southern two-toed sloth or unau, is a species of sloth from South America, found in Venezuela, the Guyanas, Colombia, Ecuador, Peru and Brazil north of the Amazon River.

It is a solitary, nocturnal and arboreal animal, found in rainforests. It is able to swim, making it possible to cross rivers and creeks. The two-toed sloth's main enemies are man, large birds of prey like the Harpy Eagle and Crested Eagle, and cats like the Ocelot.

Modern sloths are divided into two families based on the number of toes on their front feet. Linnaeus's two-toed sloth and Hoffmann's two-toed sloth (Choloepus hoffmanni) are larger than their three-toed cousins. They also have longer hair, bigger eyes, and their back and front legs are more equal in length.[3]

Linnaeus's two-toed sloth has recently been documented eating human faeces from open latrines.[4]

References

  1. ^ Gardner, Alfred (16 November 2005). Wilson, Don E., and Reeder, DeeAnn M., eds. ed. Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). pp. 101. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=11800018. 
  2. ^ Meritt, M. & Members of the IUCN SSC Edentate Specialist Group (2008). Choloepus didactylus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 1 December 2008.
  3. ^ http://nationalzoo.si.edu/Publications/ZooGoer/2004/6/sloths.cfm
  4. ^ Heymann, E. W., Flores Amasifuén, C., Shahuano Tello, N., Tirado Herrera, E. T. & Stojan-Dolar, M (2010). "Disgusting appetite: Two-toed sloths feeding in human latrines". Mammalian Biology. doi:10.1016/j.mambio.2010.03.003. 
  • Louise H. Emmons and Francois Feer, 1997 - Neotropical Rainforest Mammals, A Field Guide.

Gallery


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!