Articles on this page are available in 1 other language: Spanish (10) (learn more)

Overview

Distribution

Range Description

The species is found from Tamaulipas, Mexico and is Cozumel and the Yucatan, south to Peru, Bolivia, Paraguay and northeastern Argentina, including Trinidad and the Lesser Antilles (Emmons and Feer, 1997; Eisenberg and Redford, 1999; Gardner, 2007). It can be found to about 2,000 m elevation (Eisenberg and Redford, 1999; Emmons and Feer, 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The range of the southern opossum extends from eastern Mexico to northeastern Argentina (Redford and Eisenberg, 1992).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

There is considerable color variation in southern opossums. Generally there are varying degrees of black in the dorsal pelage, while the ventral side is white. This species is similar to D. albiventris, but has a darker dorsal pelage and black ears. Females are generally smaller than males (Cerqueira, 2000). The length of the head and body ranges from 263mm to 430 mm, with a tail length ranging from 295mm to 450 mm (Elizondo, 1999). Males are larger than females.

Range mass: 0.6 to 2.4 kg.

Range length: 263 to 450 mm.

Average basal metabolic rate: 3.31 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species tolerates a wide variety of habitats, including rainforest and subtropical forest, secondary forest, and near human settlements where they feed on garbage. However, this species appears to be more sensitive to human disturbances than Didelphis albiventris. This species does not live at extreme altitudes (above 2,232 m) or in extremely arid zones.

This species has been reasonably well studied in the northern portion of its range. It is nocturnal, arboreal, and usually solitary, although two or more may be encountered together during the breeding season when males actively court females. The females build a leaf nest in a tree cavity or burrow. Litter size varies with latitude, with smallest litters near the equator. Gestation period takes fourteen to fifteen days (Eisenberg, 1989). Given adequate shelter and a sustained food supply, the home range of a lactating female may be rather stable, but the animals are opportunistic feeders and readily shift home ranges to adapt to fluctuating resources. Mean Home-range ranged up to 123 ha for males, and to 16 ha for females. This species can be sympatric with D. albiventris in southeastern Brazil.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didelphis marsupialis tolerates a variety of habitat types including primary and secondary forests, coffee plantations, urban and suburban area (Elizondo C, 1999), but are not found at elevations above 2,232 m or in arid regions. Didelphis marsupialis is replaced by its close relative, Didelphis albiventris (white-eared Opossum), in montane regions of northern South America (Eisenberg, 1989).

Range elevation: 2,232 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; mountains

Other Habitat Features: urban ; suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Southern opossums are omnivorous and will eat a large variety of food. In captivity they especially like bananas. They are opportunistic feeders and will readily shift home ranges in search of food. Feeding habits of males and females do not differ significantly, but there are differences in food preferences between young and old. Younger individuals primarily consume invertebrates, fruits, and plant remains, whereas older individuals consume all of these, as well as mammals and birds.

Foods eaten include: insects, frogs, birds, small mammals, earthworms, fruits and plant remains.

(Cordero and Nicolas, 1987)

Animal Foods: birds; mammals; amphibians; insects; terrestrial worms

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Didelphis marsupialis plays an important role in food webs. Because of its feeding habits, this species is likely to be important in controlling populations of small mammals and invertebrates. Because it is a prey species, it also plays an important role in regulating populations of owls and small, mammalian carnivores.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The most well-known adaptation for evading predators is known as "playing dead" or "playing opossum." An opossums will lie on its side as if dead with its tails rolled up, eyes and mouth open, and its paws partially closed. (Parker, 1990) Common predators of southern opossums include owls, snakes, and mammalian carnivores.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Didelphis marsupialis is prey of:
Mammalia
Serpentes
Otus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Didelphis marsupialis preys on:
Annelida
Insecta
Amphibia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Development

See Reproduction.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

These animals probably do not live that long in the wild. It has been reported that they usually live about two years in their natural habitat, but they can live up to seven years in captivity.

Average lifespan

Status: wild:
2 years.

Range lifespan

Status: captivity:
7 (high) years.

Average lifespan

Status: captivity:
4.2 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 4.2 years (captivity) Observations: Although there are anecdotal reports suggesting a longer lifespan in captivity, the longest-lived specimen was a 4.2 year old at Rotterdam Zoo (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Males mark territories more heavily with saliva prior to the breeding season. Females construct leafy nests for their new families. (Eisenberg, 1989; Eisenberg and Redford, 1992) Mating is most likely polygynous, with males mating those females present in their territories.

Mating System: polygynous

Mating season begins in January, with males marking their home range more heavily with saliva and females building leaf nests in tree cavities or burrows. In captivity it has been reported that females can have an average litter size of ten, and up to three litters have been reported in one year. Also, the smallest litter sizes are found near the equator.

The young are born naked and blind and on average weigh about 0.005 oz and measure 10 mm in length. This amazingly small body size means that twenty four newborns can fit into a teaspoon! The newborns must find their way to their mother's marsupium or pouch. They can only move with their forelegs, which are more developed than their hind legs. There are two theories as to how the newborns find their way to the marsupium. The first, and best supported, theory is that newborns find their way to the marsupium by smell. Before birth the mother will lick a path to the opening of the pouch so that the young can follow the trail. The second theory is that the young find their way to the pouch through gravity. Once the newborns have found the marsupium, they attach to the teats, which then swell at the tip preventing the newborns from falling off. The young grow rapidly and are ready to leave the marsupium after about sixty days. (Parker, 1990)

The young are weaned around 100 days. The young reach sexual maturity between 8 and 12 months of age. (Eisenberg, 1989; Eisenberg and Redford, 1992)

Breeding season: The mating season begins in January and ends with the onset of the dry season

Average number of offspring: 10.

Average gestation period: 13-14 days.

Average weaning age: 100 days.

Range age at sexual or reproductive maturity (female): 8 to 12 months.

Range age at sexual or reproductive maturity (male): 8 to 12 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 0.2 g.

Average gestation period: 12 days.

Average number of offspring: 6.

The female cares for the young in her marsupium, or pouch, for 60 days. The young are not weaned until they are about 100 days old. (Eisenberg, 1989; Eisenberg and Redford, 1992)

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Didelphis marsupialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNNCTATATTTACTATTTGGTGCCTGAGCAGGCATAACTGGCACTGCCCTAAGTATTCTCATTCGAGCAGAACTTGGTCAACCAGGTACTTTAATTGGTGATGATCAAATTTACAATGTGATTGTAACCGCCCATGCTTTCATTATAATCTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGTAATTGACTTGTTCCACTTATAATTGGAGCTCCTGATATAGCATTCCCACGAATAAACAATATAAGCTTCTGACTTCTTCCTCCGTCATTCCTACTACTACTAGCATCCTCTACTATTGAAGCAGGAGCCGGAACAGGATGAACAGTATATCCACCACTTGCTGGCAACTTAGCCCATGCAGGCGCTTCAGTTGACCTAGCCATCTTCTCCCTTCATCTAGCAGGTATTTCTTCTATTTTAGGAGCCATCAATTTTATTACTACTATTATTAATATAAAACCACCCGCAATATCACAATACCAAACTCCCCTATTCGTCTGATCAGTAATAATCACAGCAGTATTACTCCTTTTATCCCTTCCTGTTCTAGCCGCAGGAATTACTATGCTATTAACAGATCGTAATTTAAATACTACTTTCTTTGATCCTGCTGGGGGAGGAGACCCAATTCTATACCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Didelphis marsupialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 55
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Brito, D., Astua de Moraes, D., Lew, D., Soriano, P., Emmons, L., Cuarón, A.D, Helgen, K., Reid, R. & Vazquez, E.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
This species is listed as Least Concern in because of its wide distribution, presumed large population, tolerance of habitat modification, occurrence in a number of protected areas and because it is unlikely to be declining at nearly the rate required to qualify for listing in a threatened category. Although hunted or trapped locally for food, sport and as predators of poultry, the species does not appear to have been adversely affected by human settlement. Commercial hunting for the fur trade does not appear to have much impact.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species has no special conservation status.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species is common, and is hunted for meat only where other game is scarce (Emmons and Feer, 1997). Densities of 0.25-0.75 individuals per hectare are found in Venezuela (O'Connell, 1979), and of 0.09-1.32 in Panamá (Fleming 1972).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known to this species. In Suriname, it is collected for its meat which is illegally exported to French-Guiana (John de Bruin, in litt.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species can be found in many protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In Venezuela, D. marsupialis is an important host for the parasite Trypanosoma cruzi, which is the source for the human illness known as Chagas Disease (Eisenberg, 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

No reported positive effects on humans exist.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Common opossum

The common opossum (Didelphis marsupialis), also called the southern or black-eared opossum or gambá,[2] is a mammal species living from the northeast of Mexico to Bolivia (reaching the coast of the South Pacific Ocean to the central coast of Peru), including the Lesser Antilles,[2] where it is called manicou.[3] It prefers the woods, but can also live in fields and cities. The common opossum is sometimes used for food in poorer areas by humans.

Contents

Habitat and shelter

This opossum is found in tropical and subtropical forest, both primary and secondary, at altitudes up to 2200 m.[2] They use a wide range of nest sites. Most commonly they will create one in the hollow of a tree; however, they will also dig a burrow or nest in any dark location if nothing else is suitable (which often gets them in trouble with humans).

Description

Physical Appearance and Weight

Skeleton, Natural History Museum of Genoa

The common opossum is similar in size to a house cat. The fur of the opossum is actually yellow in the under-fur, but is hidden by the longer black guard-hairs that cover it, while the tail, fingers, and face are lighter "with the tail being without fur, somewhat similar to a giant rat tail." It can measure nearly 20 inches long. It has large ears that are usually black, and its face is usually a pale peach in color, with black whiskers and eyes that reflect reddish in light. With a body length of nearly a foot, and a tail that can reach almost two feet, the common opossum is one of the larger members of its family. They can weigh in at over three pounds.

Behavior

Their activity is mainly nocturnal and terrestrial, with some arboreal exploration and nesting. Outside of mating they are usually solitary. They are considered pests due to their somewhat raccoon-like behavior. Raiding trash cans, nesting in locations that are not suitable, and causing mayhem if encountered within a human living space, they are often trapped and killed.

Diet

Common opossums have a broad ability to adapt to environmental changes, and their teeth allow them to eat many different types of food, which is obtained mostly on the ground. They can eat small insects, small animals, fruits, vegetables, and also carrion. Their ability to digest almost anything edible gives them a broader range than a human.

Reproduction

The female will have 5-9 offspring between one and three times per year after maturity. The mother raises the young by herself.

Lifespan

The common opossum lives for around 2.5 years.

Classification

They are members the genus Didelphis, which contains the largest American opossums, and the order Didelphinmorphia, to which all western hemisphere opossums belong.

References

  1. ^ Gardner, A. L. (2005). "Order Didelphimorphia". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 5–6. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  2. ^ a b c d Brito, D., Astua de Moraes, D., Lew, D., Soriano, P., Emmons, L., Cuarón, A. D., Helgen, K., Reid, R. & Vazquez, E. (2008). Didelphis marsupialis. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ "Checklist of Mammals of Trinidad and Tobago". Republic of Trinidad and Tobago Biodiversity Clearing House. 2005. Retrieved 2010-10-24. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!