Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Description

"The Virginia Opossum, the only marsupial found north of Mexico, is an adaptable omnivore at home on the ground and in the trees. Opossums prefer forested habitats, but they are quite successful even in urban areas. They are active at night, year-round: in freezing weather, an unlucky opossum can lose its ear-tips and the end of its tail to frostbite.  Like all marsupials, opossums give birth to tiny, undeveloped young. The embryos develop in the mother's womb for less than two weeks, then the newborn opossums crawl from the birth canal to the mother's pouch, where they fasten tight to a nipple. They stay there, attached to the nipple, for 55 or 60 days. A female opossum usually has 13 nipples, and litters are usually smaller than that, but a baby that cannot attach to a nipple dies. After about 60 days the young opossums leave the pouch, but they stay close to their mother—sometimes riding on her back when they are out at night—and nurse for another month or more."

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Kerr, R., 1792.  The animal kingdom, or zoological system, of the celebrated Sir Charles Linnaeus. Class I. Mammalia, p.193.   London, 651 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

The Virginia Opossum is a cat-sized, tree-climbing animal with a pale face, naked leaf-like ears, and pink, pointy nose. Their underfur is pale in color with a coarse, grizzled overcoat that makes the animal appear gray to brown to black. On the ground they move about with a slow, hobbling gait. The opossum is unlike any other animal in the United States: it has 50 teeth, a pouch in which it carries its young, a prehensile tail and opposable thumbs on its hind feet. Although they can be aggressive when threatened, when facing a larger opponent they often "play dead," entering into a state of catatonia in hopes they will be passed over. Their flexible tail is scaly and mostly hairless, and used for balance and gripping branches and objects making them agile climbers. They do not sleep hanging from their tails. The Virginia opossum has the distinction of being North America's only marsupial, sometimes considered a "pouched" mammal. This is an ancient species is more closely related to the koala and the kangaroo than it is to the rodents in the area. Opossums are mainly active during the night. During the day they sleep in opportunistic dens and nests of other animals or spaces under human structures. In New England, they may make more permanent nests during the winter to return to each day. Virginia opossum are opportunistic scavengers. Their diets include many kinds of bugs and insects, carrion, snails, mice and rats, and fallen fruit. They are useful in their environments as they will eat food other animals might not.
Public Domain

National Biological Information Infrastructure (NBII) at http://www.nbii.gov

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in Central America, from Costa Rica to Mexico and in the United States east of the Rocky Mountains, and north into southwestern Ontario, Canada. Some populations are also found along the west coast of the United States. Their range, limited by winter temperatures and snow depth, appears to be expanding northwards (Gardner, 2005).This species can be found from lowlands to 3,000 m (Reid, 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Opossums are found in North America, from Central America and Mexico in the south, through the United States east of the Rocky Mountains and north into southwestern Ontario. Opossums are also found along the west coast of the United States. Their range appears to be expanding northward (McManus, 1974).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Most of eastern U.S. and adjacent southeastern Canada, ranging west to South Dakota, Wyoming, Colorado, and Arizona, south to southern Central America; introduced in Pacific Coast states, ranging up Columbia River to Idaho. Range is expanding north and west.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Opossums have a heavy set body that resembles a large house cat. They have a long head with a pointed snout. Their faces have long whiskers. All opossums have long, tapered tails with a scaly appearance. Females have a fur-lined pouch to carry their young (Baker, 1983). The color of the opossum varies by the region. Northern populations have thick underfur that is white in color and has black tips. The pale guard hairs give the opossum a gray appearance. In southern populations, the underfur is much sparser. Both northern and southern populations have white cheek hairs (McManus, 1974). Total length varies between 350 and 940 mm, tail length varies between 216 and 470mm. Males are larger than females with male weight ranging from 0.8 to 6.4 kg and female weight ranging from 0.3 to 3.7 kg (Wilson and Ruff, 1999).

Range mass: 0.3 to 6.4 kg.

Range length: 35.0 to 94.0 cm.

Average length: 74.0 cm.

Other Physical Features: endothermic ; bilateral symmetry

Average basal metabolic rate: 5.299 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 102 cm

Weight: 6300 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are slightly larger and much heavier than females, with larger canine teeth.

Length:
Average: 740 mm
Range: 350-940 mm

Weight:
Range: 0.8-6.4 kg males, 0.3-3.7 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in a variety of habitats, ranging from relatively arid to mesic environments. They prefer wet areas, however, especially woodlands and thickets near streams and swamps. Also in suburban areas. The opportunistic denning and feeding habits of the Virginia opossum has led to the success of the species, especially in areas of habitat fragmentation. High reproductive potential further contributes to increasing population size (McManus, 1974). Abandoned burrows, buildings, hollow logs, and tree cavities are generally used for den sites.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Opossums are found in a variety of environments, ranging from relatively arid to mesic environments. They prefer wet areas, however, especially streams and swamps. It is hard to determine the exact home range of an opossum because of their unusual movement patterns (McManus, 1974).

Habitat Regions: temperate

Terrestrial Biomes: forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Very adaptable; may be found in most habitats. Prefers wooded riparian habitats. Also in suburban areas. Abandoned burrows, buildings, hollow logs, and tree cavities are generally used for den sites. In southeastern New York, all weaning dens were in burrows; weaning dens were in more densely vegetated habitats than were nonweaning dens (Hossler et al. 1994).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Home range often elongate, varies from 1-58 acres; average 11.5 (Lay 1942). Mean radius from nest site 2000 ft. Ontario population had average range length of 3200 ft (Llewellyn and Dale 1964).

Virginia Opossums are also considered to be nomadic, remaining in an area only six months to a year (Hunsaker and Shupe 1977). Home ranges in the United States varied from 4.7 to 254 hectares, averaging about 20 hectares (Hunsaker 1977); in Venezuela home ranges varied from an average of 11.3 hectares in the dry season to 13.2 hectares in the wet season (Sunquist et al. 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Opossums are omnivorous, including a wide variety of food in their diet (Baker, 1983). A majority of their diet is composed of insects and carrion. Opossums are also known to eat plants, including fruits and grains in season.

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Highly opportunistic. Foods include insects and other invertebrates, fruits, grains, carrion, small vertebrates, and human garbage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

As scavengers, Virginia opossums play an important role in the ecosystem by eating foods and garbage that other animals may not. They are important prey items for predators in the areas where they occur.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Virginia opossums are well-known for pretending to be dead to avoid being eaten by predators. This is called "playing dead" or "playing possum." When a Virginia opossum thinks that it is being threatened it will go into a catatonic state where it appears to be dead, they go limp and their breathing becomes almost undetectable. They re-awaken when the perceived danger passes.

Virginia opossums are preyed on by predators such as coyotes, foxes, large owls, and hawks. As young they may also be preyed on by snakes and smaller birds of prey, such as falcons. Humans hunt Virginia opossums for food.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Didelphis virginiana is prey of:
Strigiformes
Accipitridae
Homo sapiens
Canis latrans
Vulpes vulpes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Populations typically include a high percentage of young. Winter density was 1/9.9 ha and 1/44.5 ha at two locations in Tennessee (Kissell and Kennedy 1992).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Cyclicity

Comments: Almost exclusively nocturnal. Maximum activity between 2300 and 0200 h (McManus 1971). Activity decreases during cold periods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Virginia opossums rarely live for longer than 18 months. The oldest known opossum in the wild was 3 years old when last captured. Although they are preyed upon by several predators, most are killed by cars.

Range lifespan

Status: wild:
3.0 (high) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.6 years (captivity) Observations: In the wild, these animals do not live more than 2 or 3 years. One animal has been known to live 6.6 years in captivity (Richard Weigl 2005). Animals living on predator-free islands, live longer, start reproducing at later ages, have smaller litter sizes, and appear to age slower than their mainland counterparts (Austad 1993).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating season for opossums lasts from January to July. Copulation is usually initiated by the male. After copulation, the female rejects any more solicitations. The egg is fertilized in the Fallopian tubes. Birth occurs about 12.5 to 13 days after copulation. The average litter size ranges from 7 to 9. Depending on latitude, opossums have one or two litters per year. The young opossums weigh about 0.16 grams at birth. They are fixed to the nipple for the first 50 to 65 days of their lives. By 95 to 105 days, the young no longer depend on their mother. There is no maternal bond between the mother and young after they are weaned. Females are able to breed in their first season (McManus, 1974).

Breeding season: January-July

Range number of offspring: 1.0 to 13.0.

Average gestation period: 12.5 days.

Range weaning age: 95.0 to 105.0 days.

Range age at sexual or reproductive maturity (female): 6.0 to 12.0 months.

Range age at sexual or reproductive maturity (male): 6.0 to 12.0 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 0.147 g.

Average gestation period: 12 days.

Average number of offspring: 15.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

U.S. mating season January-July. Commonly 2 litters/year, sometimes 3; usually 1/year in north. Gestation lasts 13 days. As many as 23 offspring may compete for 13 or so teats. Average of 8-9 young are weaned after 10-12 weeks. Sexually mature at 9 months. Juveniles experience a high rate of mortality (Hossler et al. 1994). Females seldom live through more than one reproductive season.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Didelphis virginiana

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0523-06|NC_001610|Didelphis virginiana| AATCGTTGACTTTTTTCAACTAACCACAAAGACATCGGAACACTATACTTACTATTTGGTGCCTGAGCAGGCATAGTTGGCACTGCCCTA---AGTCTTTTAATTCGAGCAGAGCTCGGTCAACCAGGTACTTTAATTGGCGAT---GATCAAATTTACAATGTGATCGTAACCGCCCATGCTTTTATTATGATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTGTCCCACTTATA---ATTGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGCTTCTGATTACTTCCTCCATCATTCCTATTACTATTAGCATCCTCAACAATTGAAGCAGGAGCTGGAACAGGTTGAACAGTATATCCACCACTTGCTGGCAACTTAGCCCATGCAGGCGCTTCAGTTGATCTA---GCCATCTTTTCCCTTCATTTAGCAGGTATCTCTTCCATTCTAGGGGCTATCAATTTTATTACTACTATTATTAATATAAAACCTCCCGCAATATCACAATACCAAACTCCCCTGTTCGTCTGATCAGTAATAATCACAGCAGTATTACTCCTTCTATCTCTTCCAGTGCTAGCCGCA---GGAATTACTATACTATTAACAGATCGTAATTTAAATACTACTTTCTTTGACCCTGCTGGAGGAGGGGACCCAATCCTATATCAACATCTATTCTGATTTTTTGGTCACCCAGAAGTTTATATTTTAATTTTACCTGGATTCGGTATAATTTCTCATATCGTAACGTATTATTCAGGCAAGAAA---GAACCTTTCGGTTATATAGGAATAGTCTGAGCCATAATATCTATTGGATTCTTAGGGTTTATTGTCTGAGCACATCATATGTTTACAGTAGGCTTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Didelphis virginiana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 45
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Cuarón, A.D., Emmons, L., Helgen, K., Reid, F., Lew, D., Patterson, B., Delgado, C. & Solari, S.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Schipper, J. (Global Mammal Assessment Team)

Justification
A widespread and common species throughout its range, and is adaptable to human dominated landscapes. Although hunted or trapped locally for food, sport and as predators of poultry, the species has not been adversely affected by human settlement, in fact its range appears to be expanding. Commercial hunting for the fur trade does not appear to have much impact.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Adapted well to the presence of humans. Opossums appear to be extending their geographic range. The population density in the wild is not very high (one animal per ten acres).

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
D. virginiana is common and widespread.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no major threats to this species. Opossums are hunted and trapped for food and fur in certain areas of their range, but the majority of mortality is caused by collision with motor vehicles (Gardner, 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific measures in place to protect the Virginia opposum, it likely occurs in a number of protected areas throughout its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Occasionally opossums have been known to get into human garbage, however their foraging activities are typically not disruptive (Baker, 1983). They are scavengers and rarely prey on live animals. Opossums can carry and transmit human diseases such as rabies, as can most mammals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

In the southeastern United States, opossums are sometimes hunted for food. Opossums are used as research animals in a variety of laboratories, their fur is used occasionally, and they help to control garden pests.

Positive Impacts: body parts are source of valuable material

  • Wilson, D., S. Ruff. 1999. The Smithsonian Book of North American Mammals. Washington and London: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Virginia opossum

The Virginia opossum (Didelphis virginiana), commonly known as the North American opossum or tlacuache in Mexico, is the only marsupial found in North America north of Mexico. A solitary and nocturnal animal about the size of a domestic cat, and thus the largest opossum, it is a successful opportunist. It is familiar to many North Americans as it is often seen near towns, rummaging through garbage cans, or lying by the road, a victim of traffic.[3]

Contents

Name

The Virginia opossum is the original animal named "opossum". The word comes from Algonquian 'wapathemwa' meaning "white animal", not from Greek or Latin, so the plural is opossums. Colloquially, the Virginia opossum is frequently called simply possum. The name is applied more generally to any of the other marsupials of the Didelphimorphia and Paucituberculata orders, which includes a number of opossum species in South America.

The possums of Australia, whose name is derived from a similarity to the Virginia opossum, are also marsupials, but of the order Diprotodontia.

Range

The Virginia opossum is found throughout Central America and North America east of the Rockies from Costa Rica to southern Ontario; it seems to be still expanding its range northward and has been found farther north than Toronto. In recent years their range has expanded west and north all the way into northern Minnesota. Its ancestors evolved in South America, but invaded North America in the Great American Interchange, which was enabled by the formation of the Isthmus of Panama about 3 million years ago.

Originally native to the eastern United States, it was intentionally introduced into the West during the Great Depression, probably as a source of food,[4] and now occupies much of the Pacific coast. Its range has been expanding steadily northwards into Canada.

Description

Dentition, as illustrated in Knight's Sketches in Natural History

Virginia opossums can vary considerably in size, with larger specimens found to the north of the opossum's range and smaller specimens in the tropics. They measure 13–37 inches (35–94 cm) long from their snout to the base of the tail, with the tail adding another 8.5–19 inches (21.6–47 cm). Weight for males ranges from 1.7 to 14 pounds (0.8–6.4 kg) and for females from 11 ounces to 8.2 pounds (0.3–3.7 kg).[5] They are one of the world's most variably sized mammals, since a large male from northern North America weighs about 20 times as much as a small female from the tropics. Their coats are a dull grayish brown, other than on their faces, which are white. Opossums have long, hairless, prehensile tails, which can be used to grab branches and carry small objects. They also have hairless ears and a long, flat nose. Opossums have 50 teeth, the most out of any North American mammal,[6] and opposable, clawless thumbs on their rear limbs.

Opossums have thirteen nipples, arranged in a circle of twelve with one in the middle.[7][8]

Showing opposable "thumb" on back foot.

Perhaps surprisingly for such a widespread and successful species, the Virginia opossum has one of the lowest encephalization quotients of any marsupial.[9] Its brain is 5 times smaller than that of a raccoon.[3]

Tracks

Pacing diagram for Virginia opossum. Key: rectangles represent hind tracks, ellipses fore tracks, left tracks are red, right green. (a) the position of the four feet frozen in mid-pace. (b) the opossum brings right fore and hind feet forward. (c) the opossum brings left fore and hind feet forward. One grid square represents one square inch.
Opossum tracks (photo center) in mud. Left-fore print appears on left center of photo, right-hind print appears right center. The small, circular tracks at bottom center of photo were made by a meadow vole. The yellow ruler (top) is in inches.

Virginia opossum tracks generally show five finger-like toes in both the fore and hind prints. The hind tracks are unusual and distinctive due to the opossum's opposable thumb, which generally prints at an angle of 90 degrees or greater to the other fingers (sometimes near 180 degrees). Individual adult tracks generally measure 1⅞ inches long by 2 inches wide (4.8 × 5.1 cm) for the fore prints and 2½ inches long by 2¼ inches wide (6.4 × 5.7 cm) for the hind prints. Opossums have claws on all fingers fore and hind except on the two thumbs (in the photograph, claw marks show as small holes just beyond the tip of each finger); these generally show in the tracks but may not. In a soft medium, such as the mud in this photograph, the foot pads will clearly show (these are the deep, darker areas where the fingers and toes meet the rest of the hand or foot, which have been filled with plant debris by wind due to the advanced age of the tracks).

The tracks in the photograph were made while the opossum was walking with its typical pacing gait. The four aligned toes on the hind print show the approximate direction of travel.

In a pacing gait, the limbs on one side of the body are moved simultaneously, just prior to moving both limbs on the other side of the body. This is illustrated in the pacing diagram, which explains why the left-fore and right-hind tracks are generally found together (and vice versa). However if the opossum were not walking (but running, for example), the prints would fall in a different pattern. Other animals that generally employ a pacing gait are raccoons, bears, skunks, badgers, woodchucks, porcupines and beavers.

When pacing, the opossum's stride generally measures from 7 to 10 inches, or approximately 18 to 25 cm (in the pacing diagram the stride is 8.5 inches, where one grid square is equal to one square inch). To determine the stride of a pacing gait, measure from the tip (just beyond the fingers or toes in the direction of travel, disregarding claw marks) of one set of fore/hind tracks to the tip of the next set. By taking careful stride and track-size measurements, one can usually determine what species of animal created a set of tracks, even when individual track details are vague or obscured.

Behavior

When injured or threatened, the Virginia opossum is well known for attempting to fake death or "play possum", as seen in this photo.

The Virginia opossum is noted for reacting to threats by feigning death. This is the genesis of the term "playing possum", which means pretending to be dead or injured with intent to deceive. In the case of the opossum, the reaction seems to be involuntary, and to be triggered by extreme fear. It should not be taken as an indication of docility, for under serious threat, an opossum will respond ferociously, hissing, screeching, and showing its teeth. But with enough stimulation, the opossum will enter a near coma, which can last up to four hours. It lies on its side, mouth and eyes open, tongue hanging out, emitting a green fluid from its anus whose putrid odor repels predators. Besides discouraging animals that eat live prey, playing possum also convinces some large animals that the opossum is no threat to their young.

Opossums are omnivorous and eat a wide range of plants and animals such as fruits, insects, and other small animals. Persimmons are one of the opossum's favorite foods during the autumn.[10] Opossums in captivity are known to engage in cannibalism, though this is probably uncommon in the wild.[11] Placing an injured opossum in a confined space with its healthy counterparts is inadvisable.

The Virginia opossum does not hibernate, although it may remain sheltered during cold spells.[12]

Life span

Virginia opossum in northeastern Ohio.

Opossums, like most marsupials, have unusually short life spans for their size and metabolic rate. The Virginia opossum has a maximal life span in the wild of only about two years.[13] Even in captivity, opossums live only about four years.[14] The rapid senescence of opossums is thought to reflect the fact that they have few defenses against predators; given that they would have little prospect of living very long regardless, they are not under selective pressure to develop biochemical mechanisms to enable a long life span.[15] In support of this hypothesis, one population on Sapelo Island, five miles off the coast of Georgia, which has been isolated for up to thousands of years without natural predators, was found by Dr. Steven Austad to have evolved life spans up to 50% longer than those of mainland populations.[16][15]

Historical references

An early description of the opossum comes from explorer John Smith, who wrote in Map of Virginia, with a Description of the Countrey, the Commodities, People, Government and Religion in 1608 that "An Opassom hath an head like a Swine, and a taile like a Rat, and is of the bignes of a Cat. Under her belly she hath a bagge, wherein she lodgeth, carrieth, and sucketh her young."[17][18] The opossum was more formally described in 1698 in a published letter entitled "Carigueya, Seu Marsupiale Americanum Masculum. Or, The Anatomy of a Male Opossum: In a Letter to Dr Edward Tyson," from Mr William Cowper, Chirurgeon, and Fellow of the Royal Society, London, by Edward Tyson, M. D. Fellow of the College of Physicians and of the Royal Society. The letter suggests even earlier descriptions.[19]

Relationship with humans

A baby Virginia Opossum

Like raccoons, opossums can be found in urban environments, where they eat pet food, rotten fruit, and human garbage. Though sometimes mistakenly considered to be rats, opossums are not closely related to rodents. They rarely transmit diseases to humans, and are surprisingly resistant to rabies, mainly because they have lower body temperatures than most placental mammals. In addition, opossums limit the spread of Lyme disease, as they successfully kill off most disease carrying ticks that feed on them.[20]

The opossum was once a favorite game animal in the United States, in particular in the southern regions which have a large body of recipes and folklore relating to it.[21] Their past wide consumption in regions where present is evidenced by recipes available online[22] and in books such as older editions of The Joy of Cooking.[23] A traditional method of preparation is baking, sometimes in a pie or pastry,[24] though at present "possum pie" most often refers to a sweet confection containing no meat of any kind.

Although it is found throughout the country, the Virginia opossum's appearance in folklore and popularity as a food item has tied it closely to the American Southeast. In animation, it is often used to depict uncivilized characters or "hillbillies". The main character in Walt Kelly's long running comic strip Pogo was an opossum. In an attempt to create another icon like the teddy bear, U.S. President William Howard Taft was tied to the character Billy Possum.[25][26] The character did not do well, as public perception of the opossum led to its downfall. In December 2010, a cross-eyed Virginia opossum in Germany's Leipzig Zoo named Heidi became an international celebrity.[27] She appeared on a TV talk show to predict the 2011 Oscar winners, similar to the World Cup predictions made previously by Paul the Octopus, also in Germany.[28]

References

  1. ^ Gardner, Alfred L. (16 November 2005). "Order Didelphimorphia (pp. 3-18)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 6. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=10400045. 
  2. ^ Cuarón, A. D., Emmons, L., Helgen, K., Reid, F., Lew, D., Patterson, B., Delgado, C. & Solari, S. (2008). Didelphis virginiana. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 December 2008. Database entry includes justification for why this species is of least concern
  3. ^ a b "Virginia Opossum". Mass Audubon. http://www.massaudubon.org/Nature_Connection/wildlife/index.php?subject=Mammals&id=71. Retrieved May 11, 2011. "Opossums are frequently encountered as corpses along highways. Some biologists believe that many die as they feed on road-killed animals – a favorite food. Others believe that the opossums’ small brain (5 times smaller than that of a raccoon) suggests that they may just be too dumb to get out of the way of vehicles!" 
  4. ^ The Opossum: Its Amazing Story, William J. Krause and Winifred A. Krause, University of Missouri-Columbia, 2006, p. 23, ISBN 0-9785999-0-X, 9780978599904.
  5. ^ ADW: Didelphis virginiana: Information. Animaldiversity.ummz.umich.edu (1974-05-02). Retrieved on 2011-09-15.
  6. ^ Wildlife Directory: Virginia Opossum — Living with Wildlife — University of Illinois Extension. Web.extension.illinois.edu. Retrieved on 2011-09-15.
  7. ^ With the Wild Things - Transcripts. Digitalcollections.fiu.edu. Retrieved on 2011-09-15.
  8. ^ Mary Stockard, AWRC Mammal Supervisor (2001) Raising Orphaned Baby Opossums. AWRC.org
  9. ^ Ashwell, K.w.s. (April 2008). "Encephalization of Australian and New Guinean Marsupials". Brain, Behavior and Evolution 71 (3): 181–199. doi:10.1159/000114406. ISSN 0006-8977. PMID 18230970. 
  10. ^ Sparano, Vin T. 2000. The Complete outdoors encyclopedia. St. Martin's Press. ISBN 0-312-26722-3
  11. ^ Cannibalism in the Opossum. Opossum Society. Accessed May 7, 2007.
  12. ^ "Virginia Didelphis virginiana". eNature.com. Shearwater Marketing Group. http://enature.com/fieldguides/detail.asp?allSpecies=y&searchText=opossum&curGroupID=5&lgfromWhere=&curPageNum=1. Retrieved 2009-03-24. 
  13. ^ Virginia Opossum. Didelphis virginiana. Great Plains Nature Center. accessed Oct. 15, 2007
  14. ^ The Life Span of Animals Accessed Oct. 15, 2007
  15. ^ a b Karen Wright Staying Alive. Discover Magazine. November 6, 2003 Accessed Oct 15, 2007.
  16. ^ http://www.stateoftomorrow.com/stories/aging/austad.htm
  17. ^ Chrysti the Wordsmith > Radio Scripts > Opossum. Retrieved 2009-12-29.
  18. ^ Possum History. Retrieved 2009-12-29.
  19. ^ Langworthy, Orthello R. (August 1932). "The Panniculus Carnosus and Pouch Musculature of the Opossum, a Marsupial". Journal of Mammalogy 13 (3): 241–251. doi:10.2307/1373999. JSTOR 1373999. 
  20. ^ Biodiversity Loss Raises Disease Risk in Humans, Study Finds. Solveclimatenews.com (2010-12-02). Retrieved on 2011-09-15.
  21. ^ Keith Sutton. Possum days gone by. ESPN Outdoors. January 12, 2009. Retrieved 2009-12-29.
  22. ^ Wild Game Recipes online. Retrieved 2009-12-29.
  23. ^ The joy of the ‘Joy of Cooking,’ circa 1962. Retrieved 2009-12-29.
  24. ^ opossum pie. Retrieved 2009-12-29.
  25. ^ Possum Politics. 'Possum Network. Last accessed November 19, 2006.
  26. ^ Political Postcards. Cyberbee learning. Last accessed November 19, 2006.
  27. ^ Kelsey, Eric. (January 11, 2011). "Cross-eyed opossum capturing hearts". Reuters. Retrieved January 12, 2011.
  28. ^ Kelsey, Eric. (28 February 2011). "German celebrity opossum misses one Oscar pick". Reuters. Retrieved 6 March 2011.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!