Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Brief Summary

Description

"The tank-like Nine-banded Armadillo's range has greatly expanded northward in the last 100 years. In the mid-1800s it was found only as far north as southern Texas; by the 1970s it lived in Oklahoma, Kansas, Missouri and Tennessee; now it’s also on the East Coast. Armadillos are typically active at night or twilight. They shuffle along slowly, using their sense of smell to find food—mostly insects, and occasionally worms, snails, eggs, amphibians, and berries. They root and dig with their nose and powerful forefeet to unearth insects or build a burrow. They always give birth to identical, same-sex quadruplets that develop from a single fertilized egg. Only two mammals are known to get a disease called leprosy: humans and armadillos. This has made armadillos important in medical research."

Adaptation: The hips and the neck vertebrae of the nine-banded armadillo, Dasypus novemcinctus, include several bones that are fused in order to make the spine and back relatively rigid, as an adaptation to digging. Much like a mole, the skull is compact and relatively flat, which also makes it a useful tool for moving dirt.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Linnaeus, C., 1758.  Systema Naturae per regna tria naturae, secundum classis, ordines, genera, species cum characteribus, differentiis, synonymis, locis, p. 51. Tenth Edition, Vol. 1. Laurentii Salvii, Uppsala, 1:1-824.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Comprehensive Description

The nine-banded armadillo, Dasypus novencinctus is an easily recognized small mammal considered non-native to the state of Florida. The leathery skin and the carapace of bone-like dermal plates on the back, sides, tail, and top of the head are the prominent identifying features of this animal. The carapace is flexible at the body mid-section due to the presence of a series of overlapping/telescoping bands of dermal plate connected to each other by pliable and hairless skin. Despite the common name, these bands vary in number from as few as 7 to as many as 11. Nine bands are typical in the central portion of the distribution range, but individuals from the northern and southern parts of the range more typically exhibit only eight bands. The head is small, tapering to a pig-like snout adapted for rooting, and the relatively large ears are about half the length of the head (McBee and Baker 1982, Fox 1999).Forelimbs possess four digits and the hind limbs have five. The short, muscular limbs and the long, sharp, curved claws are additional adaptations for a digging/rooting forager. The teeth are reduced with incisors and canines lacking. The teeth the animal does possess are simple and peg-like and lacking enamel in adults (McBee and Baker 1982, Fox 1999).
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Nine-banded armadillos are found in South, Central, and North America, and have the largest range of any extant species of armadillo, from Argentina and Uruguay, through Central America and into the southern United States. As early as 1850, nine-banded armadillos were found no further north than Texas. Beginning in the late 19th century, they gradually expanded their range to the northeast. They have been spotted as far east as Florida and are common as far north as Missouri. In 2000, the dead body of a nine-banded armadillo was discovered in central Illinois. Migration and establishment of populations northward is likely limited by the severity of cold, winter weather, for which the species does not have a strong tolerance. However, if winter seasons become milder, nine-banded armadillos may continue their migration northward. They can survive short periods of severe cold by remaining in a burrow for days at a time. Another factor that has limited their migration westward is dependence on rainfall or other sources of water. For this reason, nine-banded armadillos have not migrated into the arid, desert regions of New Mexico and other western states.

Increasing human populations and development of transportation routes are thought to help rather than hinder the geographic expansion of nine-banded armadillos. The construction of roads and bridges have both facilitated human introduction of nine-banded armadillos into new areas, as well as provided a means for wild nine-banded armadillos to move across the wide waterways and other natural obstacles that would had previously prevented their expansion. Nine-banded armadillos are able swimmers due to their ability to hold air in their digestive tract, increasing buoyancy; they are also able to walk along river bottoms as a result of their ability to maintain a large oxygen debt. Even so, they do not readily cross large bodies of water. Further, human activities have caused a decline in many natural predators of North American nine-banded armadillos.

Biogeographic Regions: nearctic (Introduced , Native ); neotropical (Native )

  • Wilson, D., S. Ruff. 1999. The Smithsonian book of North American mammals. Washington, D.C.: Smithsonian Institution Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America: Biology, Management, and Economics. 1982: John Hopkins University Press.
  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File.
  • Talmage, R. 1954. The Armadillo (Dasypus novemcinctus): a Review of its Natural History, Ecology, Anatomy and Reproductive Physiology. Rice University Studies, 41/2: 135.
  • Van Deelen, T., J. Parrish, E. Heske. 2002. A Nine-Banded Armadillo (Dasypus novemcinctus) from Central Illinois. Southwestern Naturalist, 47/3: 489-491.
  • Taulman, J., L. Robbins. 1996. Recent Range Expansion and Distributional Limits of the Nine-banded Armadillo. Journal of Biogeography, 23/5: 635-648.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Nine-banded armadillos range from Argentina and Uruguay, through Central America and into the southern United States. They have the largest range of any extant species of dasypodidae. Their range has slowly been expanding northward in the United States, and they are now found as far north as Missouri and even Illinois. This shift northward is likely limited by the severity of cold, winter weather. Their ranges have also been shifting westward in the United States, and this is likely limited by their dependence on rainfall or other sources of water.

Increasing human populations and development of transportation routes are thought to help the range expansion of nine-banded armadillos. Roads and bridges help wild nine-banded armadillos to move across wide waterways and other natural obstacles that would had previously prevented their expansion. Human activities have also caused a decline in many natural predators of North American nine-banded armadillos, which also contributes to their expanding range.

Biogeographic Regions: nearctic (Introduced , Native ); neotropical (Native )

  • Wilson, D., S. Ruff. 1999. The Smithsonian book of North American mammals. Washington, D.C.: Smithsonian Institution Press.
  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America: Biology, Management, and Economics. 1982: John Hopkins University Press.
  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File.
  • Talmage, R. 1954. The Armadillo (Dasypus novemcinctus): a Review of its Natural History, Ecology, Anatomy and Reproductive Physiology. Rice University Studies, 41/2: 135.
  • Van Deelen, T., J. Parrish, E. Heske. 2002. A Nine-Banded Armadillo (Dasypus novemcinctus) from Central Illinois. Southwestern Naturalist, 47/3: 489-491.
  • Taulman, J., L. Robbins. 1996. Recent Range Expansion and Distributional Limits of the Nine-banded Armadillo. Journal of Biogeography, 23/5: 635-648.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This armadillo ranges from the southern United States of America through Mexico and Central America, to South America as far south as northern Argentina (McBee and Baker 1982, Gardner 2005). It is also present in the Lesser Antilles, on Grenada and Trinidad and Tobago.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Southern South America (northern Argentina) north through Central America and much of middle and eastern Mexico to New Mexico, southern Kansas, southwestern Missouri, Alabama, ad South Carolina (Mayer 1989, Platt and Snyder 1995). Has expanded its U.S. range considerably in the last century from Texas to much of southeastern U.S. Introduced into Florida and has since expanded. Occurs also in Grenada (Lesser Antilles) and Trinidad and Tobago (Gardner, in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dasypus novencinctus is originally from South America and has historically occurred from Puru and northern Argentina north into the southern part of Texas. Range expansion within the United States has been occurring since the 1850s and the animal now occurs throughout most of Texas and is typically also found east into Louisiana, Alabama and Florida and as far north as Oklahoma and Kansas (Wolfe 1968, Fox1999). The animal is occasionally encountered in Missouri and South Carolina (Schaefer and Hostetler 2003). Van Deelen et al. (2002) reported a single dead specimen from central Illinois and indicated this was the northernmost record of the species east of the Mississippi River. Schaefer and Hostetler (2003) report that Dasypus novencinctus now occurs in upland habitats throughout Florida including the entire India River Lagoon watershed. Only the Keys and parts of the Everglades and Big Cypress swamp remain free from established armadillo populations.
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like many other dasypodidae, nine-banded armadillos are covered by an outer body armor made up of bony plates covered in a leathery keratinous skin. These scales (osteoderms) provide a hard but flexible covering. The scales are typically rectangular or pentagonal in shape and are developed later than the rest of the skeleton. The armor comprises about 16% of body weight and is divided into three main areas of coverage on the body: a pelvic shield, a shield on the shoulder region, and the characteristic bands of the back. Typically, nine-banded armadillos have 9 visible bands, but this number may vary from 8 to 11. Each band is separated by a thin layer of skin and hairs. Scales grow continuously and wear, but are never fully shed. The average body length is 0.752 m. The tail averages about 0.3 m in length and is covered by 12 to 15 rings of scales.

The head of a nine-banded armadillo is covered in these bony/keratinous scales, but their ears are not. Instead, ears are hairless and covered in a rough, bumpy skin. The underside also lacks any armored protection and is of a paler color, generally appearing slightly yellow. The long snout is much softer and pinkish in color, appearing almost pig-like with it narrow, tapered shape. The face, neck, and underside are covered in small clusters of hair.

Nine-banded armadillos have short legs with 4 toes on the forefoot and 5 toes on the hindfoot; all toes have strong claws, and the middle claws are largest of all. They have distinct teeth, which are v-shaped, small and peg-like. Their teeth do not have enamal, and they continue to grow throughout the animal's lifetime. Nine-banded armadillos have long, sticky tongues, which they use in foraging for insecta.

Males weigh slightly more than females: the average male weighs 5.5 to 7.7 kg, while the average female weighs 3.6 to 6.0 kg. Nine-banded armadillos maintain a low body temperature, usually ranging from 30° to 35° C. Their basal metabolic rate is also low given their mass (384.4 kJ/day).

Range mass: 3.6 to 7.7 kg.

Average mass: 5.5 kg.

Range length: .615 to .800 m.

Average length: .752 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 4.655 W.

  • Atansanov, A. 2007. The linear allometric relationship between total metabolic energy per life span and body mass of mammals. Biosystems, 90: 224-233.
  • Peppler, R., S. Stone. 1981. Annual Pattern in Plasma Testosterone in the Male Armadillo, Dayspus novemcinctus. Animal Reproduction Science, 4: 49-53.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The outer body of Nine-banded armadillos are unmistakable. Like many other armadillos, Dasypus novemcinctus is covered by an outer body armor made up of bony plates covered in a leathery keratinous skin. These scales (osteoderms) provide a hard but flexible covering. The osteoderms are typically rectangular or pentagonal in shape and are developed later than the rest of the skeleton. The armor comprises about 16% of body weight and is divided into three main areas of coverage on the body: a pelvic shield, a shield on the shoulder region, and the characteristic bands of the back. Typically, nine-banded armadillos have 9 visible bands, but this number may vary from 8 to 11. Each band is separated by a thin epidermal layer and hairs. Scales grow continuously and wear, but are never fully shed. The average body length is .752 m. The tail averages about 0.3 m long and is covered by 12 to 15 rings of scales.

The head is partially covered in these bony/keratinous scales, but the ears lack them. Instead, ears are hairless and covered in a rough, bumpy skin. The underside also lacks any armored protection and is of a paler color, generally appearing slightly yellow. The long snout is much softer and pinkish in color, appearing almost pig-like with it narrow, tapered shape. The face, neck, and underside are covered in small clusters of hair.

Nine-banded armadillos have short legs with 4 toes on the forefoot and 5 toes on the hindfoot; all digits have strong claws, and the middle claws are largest of all. The skull lacks ossified auditory bullae. It is dorso-ventrally flattened and has a very distinct dentition. The dentary is v-shaped and the total tooth number ranges from 28 to 32 (8/8). Teeth are simple, small and cylindrical (peg-like). They lack enamel and continue to grow throughout the animal's lifetime. Nine-banded armadillos possess long, sticky tongues, which they use in foraging for insects.

Sexual dimorphism in nine-banded armadillos is minor with males weighing slightly more than females (the average male weighs 5.5 to 7.7 kg, while the average female weighs 3.6 to 6.0 kg).  Nine-banded armadillos maintain a low body temperature, usually ranging from 30° to 35° C. Their basal metabolic rate is also low given their mass (384.4 kJ/day).

Range mass: 3.6 to 7.7 kg.

Average mass: 5.5 kg.

Range length: .615 to .800 m.

Average length: .752 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 4.655 W.

  • Atansanov, A. 2007. The linear allometric relationship between total metabolic energy per life span and body mass of mammals. Biosystems, 90: 224-233.
  • Peppler, R., S. Stone. 1981. Annual Pattern in Plasma Testosterone in the Male Armadillo, Dayspus novemcinctus. Animal Reproduction Science, 4: 49-53.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 80 cm

Weight: 7700 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Individuals range in size from 60-80 cm total length and 3.6-7.7 kg with males tending to be larger than females. They are long-lived animals , surviving for as much as 20 years (Fox 1999, Schaefer and Hostetler 2003).
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size in North America

Sexual Dimorphism: Males are heavier than females.

Length:
Range: 615-800 mm

Weight:
Range: 5.5-7.7 kg males, 3.6-6 kg females
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Dasypus novencinctus is unmistakable in Florida.
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Nine-banded armadillos are primarily found in forest and scrub-brush areas in tropical and temperate regions. They are also found in grasslands and savanna regions around woody areas, but they prefer forests over grasslands because they forage in forest litter for small invertebrates. They are not found in arid regions, and they thrive in riparian habitats or areas with plenty of water or at least 38 cm of rain annually. Their preference for wet areas may be because of increased availability of food sources in wet areas and softer soil, which makes digging and burrowing easier. As long as sufficient food and water supplies are available, nine-banded armadillos are very adaptable to different habitats. They have been observed near swampy or marshy regions as well, but do not commonly inhabit them.

Temperature is also an important factor in choice of habitat. Nine-banded armadillos begin to shiver at temperatures below 22°C, but the warmth of the burrow allows an armadillo to inhabit temperate areas during milder winters. Nine-banded armadillos are not found in regions where the average January temperature drops below -2°C. Dense populations tend to occur in areas of low elevation, often around sea-level.

Although nine-banded armadillos do not often inhabit areas of dense human population, they are not limited by human presence. In fact, the northeastern expansion of their range may be related to human development. They appear to travel along man-made roads, bridges, railroads and other travel routes.

Within their habitat in forests, grasslands, and shrublands, nine-banded armadillos make their homes in underground burrows. Burrows vary in size, but can be up to 5 m long and 2 m deep. Nine-banded armadillos may bring some grasses and leaves inside their burrow. They often try to hide the entrance by placing plant debris around it. A nine-banded armadillo may have up to 12 den sites, but the average is 4 or 5. A male and female may share these burrows during mating season, but usually a burrow is only shared by a female and her young or by young siblings.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Stangle, F. 1994. Evolution of a Desert Mammalian Fauna : a 10,000-Year History of Mammals from Culberson and Jeff Davis Counties, Trans-Pecos Texas. Wichita Falls, TX: Midwestern State University Press.
  • 2008. "Dasypus novemcinctus" (On-line). Accessed April 02, 2009 at http://www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It is very adaptable and is present in a variety of habitats (McBee and Baker 1982). It has a high rate of reproduction, and commonly produces quadruplets.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nine-banded armadillos most often inhabit forest and scrub-brush areas in tropical and temperate regions. They are also found in grasslands and savanna regions around woody areas, but much prefer forests over grasslands because they forage in forest litter for small invertebrates. Nine-banded armadillos are not often found in arid regions; they thrive especially in riparian habitats or areas with a sufficient amount of water and/or at least 38 cm of rain annually. This association with water could be due the increased number of available food sources in wetter areas or to the softer soil conditions, making digging and burrowing easier. As long as sufficient food and water supplies are available, nine-banded armadillos are very adaptable to different habitats. They have been observed near swampy or marshy regions as well, but do not commonly inhabit them.

Temperature is also an important factor in choice of habitat. Nine-banded armadillos begin to shiver at temperatures below 22°C, but the warmth of the burrow allows an armadillo to inhabit temperate areas during milder winters. At present, nine-banded armadillos are not common in any regions in which more than 24 freeze-over days occur annually or the average January temperature drops below -2°C. Nine-banded armadillos are also more populous in low-lying lands, often around sea-level.

The habitat of nine-banded armadillos is not limited by human presence. They do not often inhabit areas of dense human population, but the northeastern expansion of nine-banded armadillos in the United States seems to be linked to man-made roads, bridges, railroads and other travel routes. This suggests that armadillos use human developments to their advantage. Their coexistence with humans is often evident by the presence of nine-banded armadillo roadkill along these routes.

Within the forests, grasslands, and shrublands that nine-banded armadillos inhabit, they make their homes in underground burrows. Burrows vary in size, but can be up to 5 m long and 2 m deep. Nine-banded armadillos may bring some grasses and leaves inside their burrow and they often try to hide the entrance by placing plant debris around it. A nine-banded armadillo may have up to 12 den sites, but the average is 4 or 5. A male and female may share these burrows during mating season, but usually a burrow is only shared by a female and her young or by young siblings.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Other Habitat Features: suburban ; agricultural ; riparian

  • Stangle, F. 1994. Evolution of a Desert Mammalian Fauna : a 10,000-Year History of Mammals from Culberson and Jeff Davis Counties, Trans-Pecos Texas. Wichita Falls, TX: Midwestern State University Press.
  • 2008. "Dasypus novemcinctus" (On-line). Accessed April 02, 2009 at http://www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Prefers brushy areas with loose soil; also common in pinelands and hardwood uplands. Individuals make several burrows, often placed at side of creek.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Nine-banded armadillos are generalists and eat almost 500 different types of food items. Over 90% of their diet is composed of animal matter. A larger part of their diet is composed of adult and larval Coleoptera, but nine-banded armadillos also feed on isoptera, Diplopoda, chilopoda, Hymenoptera, orthoptera, arachnida, oligochaeta, and several other insecta and terrestrial invertebrates. After preying on ant hills, nine-banded armadillos often roll around vigorously, presumably to remove ants from themselves. Nine-banded armadillos also feed on small reptilia and amphibia, especially in the winter when these animals are more sluggish. They occasionally take baby mammalia or bird eggs. Less than ten percent of their diet is made up of plant matter, such as fruit, seeds, and fungi. Dirt, twigs, tree bark, and other indigestible materials have been found in their stomachs, but eating these materials is probably accidental. Nine-banded armadillos occasionally eat carrion, but the animal is probably more interested in the maggots that inhabit corpses than the meat itself. Nine-banded armadillos do not chew small prey, but they do chew large invertebrates, vertebrate animal matter, and plant matter. While foraging, nine-banded armadillos rely primarily on their sense of smell to locate food items, and they often visit shallow burrows in search of trapped invertebrates.

Animal Foods: mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: seeds, grains, and nuts; fruit

Other Foods: fungus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Nine-banded armadillos are generalist, opportunistic feeders. Almost 500 separate food items make up their diet, and over ninety percent of their diet (by volume) is made up of animal matter. Adult and larval beetles may be the largest component, but nine-banded armadillos also feed on termites, millipedes, centipedes, ants, grasshoppers, arachnids, earthworms, and several other insects and terrestrial invertebrates. After preying on ant hills, nine-banded armadillos often roll around vigorously, presumably to remove ants from themselves. Nine-banded armadillos also feed on small reptiles and amphibians, especially in the winter when these animals are more sluggish. They occasionally take baby mammals or bird eggs. Less than ten percent of their diet is made up of plant matter, such as fruit, seeds, and fungi. Dirt, twigs, tree bark, and other indigestible materials have been found in their stomachs, but the ingestion of such materials is probably accidental. Nine-banded armadillos occasionally eat carrion, but the animal is probably more interested in the maggots that inhabit corpses than the meat itself. Nine-banded armadillos do not chew small prey, but they do chew large invertebrates, vertebrate animal matter, and plant matter. While foraging, nine-banded armadillos rely primarily on their sense of smell to locate food items, and they often visit shallow burrows in search of trapped invertebrates.

Animal Foods: mammals; amphibians; reptiles; eggs; carrion ; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: seeds, grains, and nuts; fruit

Other Foods: fungus

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore , Eats non-insect arthropods, Vermivore, Scavenger ); omnivore ; mycophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Depends chiefly on beetles, their larvae, and other insects and invertebrates. Plants, eggs, and various small vertebrates generally comprise less than 10% of diet, though fruits may be locally important in summer. In Missouri, diet includes carpenter ants, beetle larvae, snakes, and lizards (see Figg 1993). Forages on and in ground; relies heavily on a keen sense of smell and powerful digging claws while searching for food.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dasypus novencinctus is a rooting generalist forager that consumes primarily animal matter such as insects and other arthropods, earthworms, other inverebrates, small reptiles and amphibians. Plant matter and carrion are also eaten and on occassion birds and small mammals may be eaten as well. The diet is broad and opportunistic; analysis of the stomach contents of more than 800 individuals revealed nearly 500 different dieary items, with animal matter comprising more than 90% of the diet by volume (Davis and Schmidly 1997).Carrion is readily eaten when available, and dead carcasses of animals frequently are visited not only for the carrion present but also for the maggots and pupae of flies found on or near them.
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

dasypodidae, including nine-banded armadillos, are scavengers and consumers of many kinds of invertebrates. They have low body temperatures that they cannot regulate very well because of their carapace. This results in a poor immune system. Thus, nine-banded armadillos are host to a variety of bacterial and protozoan parasites including Mycobacterium_leprae, the bacterium responsible for leprosy. Nine-banded armadillos are also associated with some parasitic ticks, such as Amblyomma_auricularium. Because they inhabit damp, dirt-filled environments, nine-banded armadillos harbor several species of fungi, some of which are responsible for human diseases. It is unclear whether these fungi are commensalists or parasites.

Euthlypis lachrymosa have been observed following nine-banded armadillos while they forage, searching for prey revealed by the armadillos’ activities. Abandoned burrows of nine-banded armadillos may be occupied by pituophis ruthveni. However, these burrows may also pose a threat to large terrestrial vertebrates that accidentally step in them. The carrion of nine-banded armadillos resulting from road kill is becoming an important food source for some species of Aves. Nine-banded armadillos were introduced to Florida, where they may prey on endangered endemic Floridian reptilia. In addition, nine-banded armadillos may force Gopherus_polyphemus, an endangered Floridian tortoise, from their burrows and claim them for itself.

Ecosystem Impact: creates habitat

Mutualist Species:

  • Louisiana pine snakes (Pituophis_ruthveni)
  • fan-tailed warblers (Euthlypis_lachrymosa)

Commensal/Parasitic Species:

  • ticks (Amblyomma_auricularium)
  • fungus (Paracoccidiodies_brasiliensis)
  • Fungi
  • ticks (Ixodides)

  • Szabó, M., M. Olegário, A. Santos. 2007. Tick fauna from two locations in the Brazilian savannah. Experimental and Applied Acarology, 43(1): 73-84.
  • Schaefer, R., J. Fagan. 2006. Commensal foraging by a fan-tailed warbler (Euthlypis lachrymosa) with a nine-banded armadillo (Dasypus novemcinctus) in southwestern Mexico. The Southwestern Naturalist, 51(4): 560 -562.
  • Cheadle, M., S. Tanhauser, J. Dame, D. Sellon, P. Hines, R. MacKay, E. Greiner. 2001. The nine-banded armadillo (Dasypus novemcinctus) is an intermediate host for Sarcocystis neurona. International Journal for Parasitology, 31(4): 330-335.
  • Eulalio, K., R. de Macedo, M. Cavalcanti, L. Martins, M. Lazera, B. Wanke. 2001. Coccidioides immitis isolated from armadillos (Dasypus novemcinctus) in the state of Piaui, northeast Brazil. Mycopathologia, 149(2): 57-61.
  • Ealy, M., R. Fleet, D. Rudolph. 2004. Diel activity patterns of the Louisiana pine snake (Pituophis ruthveni) in eastern Texas. Texas Journal of Science, 56: 383-394.
  • Bagagli, E., S. De Moraes Gimenens Bosco. 2008. Armadillos and dimorphic pathogenic fungi. Pp. 281-293 in S Vizcaíno, W Loughry, eds. The Biology of the Xenarthra. Gainesville: University Press of Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Nine-banded armadillos have many natural predators, including puma concolor, Chrysocyon brachyurus, canis latrans, ursus americanus, canis rufus, Panthera onca, alligator mississippiensis, Lynx rufus, and Accipitridae, which prey on baby nine-banded armadillos. Because of their softer armor, juveniles are more susceptible to predation than adults, and this is reflected in their behavior. Young nine-banded armadillos tend to forage earlier in the day and are more cautious of humans than adults. Nine-banded armadillos can jump straight in the air and sprint over short distances to avoid predators, and often flee to the cover of dense, thorny underbrush or nearby burrows. The tapered design of their tails makes them difficult to grasp and, once inside a burrow, nine-banded armadillos arch their backs and brace themselves against possible removal. Homo sapiens are also predators to nine-banded armadillos. Nine-banded armadillos are hunted in many rural areas for their meat and skin, and auto accidents claim the lives of thousands of individuals each year.

Known Predators:

  • pumas (Puma_concolor)
  • maned wolves (Chrysocyon_brachyurus)
  • coyotes (Canis_latrans)
  • red wolves (Canis_rufus)
  • American black bears (Ursus_americanus)
  • jaguars (Panthera_onca)
  • American alligators (Alligator_mississippiensis)
  • humans (Homo_sapiens)
  • bobcats (Lynx_rufus)
  • raptors (Accipitridae)

  • Weckel, M., W. Giuliano, S. Silver. 2006. Cockscomb revisited: Jaguar diet in the Cockscomb Basin Wildlife Sanctuary, Belize. Biotropica, 38(5): 687-690.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Armadillos are scavengers and consumers of many kinds of invertebrates. They have a relatively lower body temperature than other mammals and their carapace makes them poor thermoregulators. These characteristics result in a poor immune system. Thus, nine-banded armadillos are host to a variety of bacterial and protozoan parasites, perhaps the most notable being Mycobacterium leprae, the bacterium responsible for leprosy. Nine-banded armadillos are also associated with some parasitic ticks, such as Amblyomma auricularium. Because they inhabit damp, dirt-filled environments, nine-banded armadillos harbor several species of fungi, some of which are responsible for human diseases. It is unclear whether these fungi function as commensalists or parasites. For example, nine-banded armadillos infected with the fungus, Paracoccidiodies brasiliensis, which causes a mycosis in humans, appear healthy. Yet the fungus was detected in the animals’ lymph nodes, indicating illness.

Fan-tailed warblers have been observed following nine-banded armadillos while they forage, searching for prey revealed by the armadillos’ activities. The abandoned burrows of nine-banded armadillos may be occupied by pine snakes. However, these burrows may also pose a threat to large terrestrial vertebrates that accidentally step in them. It has been proposed that nine-banded armadillo carrion resulting from road kill is becoming an important food source for some species of birds. Nine-banded armadillos were introduced to Florida, and there is concern that they may be exerting predation pressure on endangered endemic Florida reptiles. In addition, nine-banded armadillos may force Gopherus polyphemus, an endangered Floridian tortoise, from their burrows and claim them for itself.

Ecosystem Impact: creates habitat

Mutualist Species:

Commensal/Parasitic Species:

  • Szabó, M., M. Olegário, A. Santos. 2007. Tick fauna from two locations in the Brazilian savannah. Experimental and Applied Acarology, 43(1): 73-84.
  • Schaefer, R., J. Fagan. 2006. Commensal foraging by a fan-tailed warbler (Euthlypis lachrymosa) with a nine-banded armadillo (Dasypus novemcinctus) in southwestern Mexico. The Southwestern Naturalist, 51(4): 560 -562.
  • Cheadle, M., S. Tanhauser, J. Dame, D. Sellon, P. Hines, R. MacKay, E. Greiner. 2001. The nine-banded armadillo (Dasypus novemcinctus) is an intermediate host for Sarcocystis neurona. International Journal for Parasitology, 31(4): 330-335.
  • Eulalio, K., R. de Macedo, M. Cavalcanti, L. Martins, M. Lazera, B. Wanke. 2001. Coccidioides immitis isolated from armadillos (Dasypus novemcinctus) in the state of Piaui, northeast Brazil. Mycopathologia, 149(2): 57-61.
  • Ealy, M., R. Fleet, D. Rudolph. 2004. Diel activity patterns of the Louisiana pine snake (Pituophis ruthveni) in eastern Texas. Texas Journal of Science, 56: 383-394.
  • Bagagli, E., S. De Moraes Gimenens Bosco. 2008. Armadillos and dimorphic pathogenic fungi. Pp. 281-293 in S Vizcaíno, W Loughry, eds. The Biology of the Xenarthra. Gainesville: University Press of Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Nine-banded armadillos have many natural predators, including pumas, maned wolves, coyotes, black bears, red wolves, jaguars, alligators, bobcats, and raptors, which prey on baby nine-banded armadillos. It is believed that the decline of many natural predator populations in North America has aided in the rapid northern expansion of this species. Because of their softer carapace, juveniles are more susceptible to predation than are adults, and this is reflected in their behavior. Young nine-banded armadillos tend to forage earlier in the day and are more wary of human approach than are adults. Nine-banded armadillos can jump straight in the air and sprint over short distances to avoid predators, and often flee to the cover of dense, thorny underbrush or nearby burrows. The tapered design of their tails makes them difficult to grasp and, once inside a burrow, nine-banded armadillos arch their backs and brace themselves against possible removal. Humans are also predators to nine-banded armadillos, both intentionally and accidentally. Nine-banded armadillos are hunted in many rural areas for their meat and skin, while auto accidents claim the lives of thousands of individuals each year.

Known Predators:

  • Weckel, M., W. Giuliano, S. Silver. 2006. Cockscomb revisited: Jaguar diet in the Cockscomb Basin Wildlife Sanctuary, Belize. Biotropica, 38(5): 687-690.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nine banded armadillos are solitary foragers with overlapping home ranges (McDonough, 1994). They are natural carriers of the prokaryote Mycobacterium leprae, the pathogen causing lepromatid leprosy. D. novemcinctus and humans are the only mammals known to naturally contract the disease Fox 1999). M. leprae is cultured in the foot pads of captive armadillos in leprosy research laboratories.Invasion History: Dasypus novencinctus is a highly successful pioneering species. Generalist habitat and dietary requirements, long lifespans, and various reprodctive specializations (i.e., delayed implantation, see above) allow small founder populations to successfully colonize and establish themselves in new areas (Nixon 1995).Historic natural range expansion of D. novemcinctus into the U.S. was first documented in 1854 with an occurrence in extreme southern Texas along the Rio Grande (Fox 1999). Natural range expansion in the subsequent 150 years is impressive, and has likely been facilitated by anthropogenic habitat alteration, including predator removal and livestock grazing activity. Average rates of range expansion vary from 4-10 km/year in the absence of physical or climatic barriers. Invasion is most rapid in riparian habitats parallel to water courses where armadillos are capable of traversing rivers both through breath-holding and walking across and by ingesting air to impart buoyancy. River and stream banks are probably important avenues for dispersal (Davis and Schmidly 1997).Armadillos were first introduced to Florida in 1924 and the present-day Florida population of D. novemcinctus is derivd from several sources of introduction. The western population resulted from westward range expansion of the Texas population nto the Florida panhandle, and the Atlantic coast population resulted from several human-facilitated introductions (including escape from zoos and from the pet trade) from the 1920s to the 1970s. The panhandle and peninsular populations expanded and eventually merged so D. novemcinctus can now be found in upland habitats nearly statewide (Greenbaum 2002, Schaefer and Hostetler 2003). Potential to Compete With Natives: The rooting activities of to Dasypus novencinctus can damage below-ground portions of native vegetation through exposure to air, sunlight, and desiccation (Greenbaum 2002).D. novemcinctus occasionally prey on the young of ground-nesting birds. Armadillos may also occasionally eat the eggs of quail, turkey, and other ground nesters, although gut analyses have demosntrated minimal importance of eggs in the diet (Davis and Schmidly 1997, Fox 1999). On the other hand, armadillos in Florida have been implicated in the destruction of sea turtle nests and the impacts may be significant. In some areas (e.g., Hobe Sound) where studies have been conducted, D. novemcinctus has raided as many as 14% of all sea turtle nests, accounting for as much as 95% of all nest raiding. As this behavior had not been documented until 1988, it may represent a newly-learned behavior of this highly adaptable invader (Engeman et al. 2002, Greenbaum 2002). Possible Economic Consequences of Invasion: Some commercial crop damage is attributable to Dasypus novencinctus, although it is moderate compared to the damage caused by feral pigs. Armadillo burrowing activity can exacerbate erosion and has on occasion undermined structural foundations (Greenbaum 2002).Although D. novemcinctus has been implicated as a vector for leprosy in humans, the species is probably of overall positive benefit with regard to the disease because it serves as an important leprosy research model. Armadillos are also used as medical research models in the fields of multiple births, organ transplants, birth defects, as well as typhus and trichinosis pathology (Fox 1999, Greenbaum 2002).Armadillos may be of positive economic effect with regard to their imact on populations of insect pests (Davis and Schmidly, 1997). In Latin Amrica and in small pockets within the southern U.S., armadillos are also utilized by humans as food (Fox 1999).
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Sizable nine-banded armadillo populations are established in 67 Florida counties.
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Density estimates range from less than one to 7.5 per acre (Kalmbach 1943).

Home range is 2-20 ha (see Loughry and McDonough 1998). Mean home range size of 12 individuals in Florida was 5.7 hectares (Layne and Glover 1977). In Florida, distance moved between successive sightings of individuals was less than 200 m both within and between years (Loughry and McDonough 1998).

Cannot survive prolonged freezing weather. Suffers high mortality due to being struck by cars. Most juvenile mortality may be due to predation; prolonged drought may result in increased adult mortality (McDonough and Loughry 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Olfaction, or the sense of smell, is incredibly important to nine-banded armadillos and is essential while foraging. Nine-banded armadillos travel with their nose just above the ground and can smell invertebrates up to 20 cm below the surface. They can also stand on their hid legs, bracing themselves with their tail, and sniff the air to locate food. Nine-banded armadillos may also use smell to recognize familiar places and to orient themselves.

Nine-banded armadillos also have a good sense of hearing, which they use to avoid predation. Mating pairs also communicate with a “chucking” sound. Nine-banded armadillos have a poor sense of vision and they are thought to have a poor sense of touch. Dasypodidae species have fewer taste buds than other mammalia, so it is likely that nine-banded armadillos have a poor sense of taste as well.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Olfaction is the primary mode of perception used by nine-banded armadillos. Olfaction is essential while foraging. Nine-banded armadillos travel with their nose just above the ground and can smell invertebrates up to 20 cm below the surface. They can also stand bipedally, bracing themselves with their tail and sniff the air to locate food. Smell may also be important for nine-banded armadillos to orient themselves and recognize familiar places, although there is no evidence that they employ scent trails. The animals’ reliance on scent is reflected by corresponding development in their forebrains.

Nine-banded armadillos also have a good sense of hearing, which the animals use in avoiding predation or other sources of potential danger. Mating pairs also communicate with a “chucking” sound. Nine-banded armadillos have a poor sense of vision, which is useless except at close distances, and they are thought to have a poor sense of touch. Dasypodidae species have fewer taste buds than other mammals, so it is likely that nine-banded armadillos have a poor sense of taste as well.

Communication Channels: tactile ; acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Predominantly nocturnal, frequently seen feeding in broad daylight, especially in winter. Can undergo torpor with reduced metabolic rate (Caire et al. 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Nine-banded armadillos are expected to live from 7 to 8 years to over 20 years in the wild. One nine-banded armadillo in captivity reached 23 years of age. The life of nine-banded armadillos may be limited by climate, predation, and disease. Because they do not have much hair or body fat, nine-banded armadillos do not cope well with cold temperatures. Larger animals can better withstand colder temperatures. Droughts can also impact mortality of this species. Juveniles have a higher mortality rate than adults and in the wild are more likely to be killed by a predator than adults because they are weaker and have softer armor. Disease, particularly leprosy, also contributes to mortality of nine-banded armadillo.

Range lifespan

Status: captivity:
23+ (high) years.

Typical lifespan

Status: wild:
7 to 20+ years.

  • McDonough, C., W. Loughry. 1997. Patterns of mortality in a population of nine-banded armadillos, Dasypus novemcinctus. The American Midland Naturalist, 138(2): 299-305.
  • McDonough, C., W. Loughry. 2008. Behavorial ecology of armadillos. Pp. 103-110 in S Vizcaíno, W Loughry, eds. The Biology of the Xenarthra. Gainesville: University Press of Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

Reported life expectancies of nine-banded armadillos range from as low as 7 to 8 years to more than 20 years. At least one nine-banded armadillo in captivity reached 23 years of age. Juveniles have a higher mortality rate than adults.

The factors influencing longevity of nine-banded armadillos include climate, predation, and disease. Because this species does not have a significant amount of hair or body fat, it does not cope well with cold temperatures. A large adult male can survive no longer than 10 days at 0° C without starving. The larger the animal, the more likely it will survive colder temperatures. Other environmental conditions, such as drought, also have an impact on nine-banded armadillo mortality. In one area that experienced a severe drought, the nine-banded armadillo population completely disappeared due to death or migration (McDonough and Loughry, 1997).

Predation and death by humans, both purposeful and accidental, are other causes of mortality. A juvenile is more likely to be killed by a predator in the wild than is an adult due to its weaker physical state and softer armor.

Disease can be an important contributor to nine-banded armadillo mortality; leprosy, in particular, has an important impact. In one population of nine-banded armadillos, 30% of adults were found to have the bacterium associated with the disease, while 17% had the antibodies, indicating previous exposure.

Range lifespan

Status: captivity:
23+ (high) years.

Typical lifespan

Status: wild:
7 to 20+ years.

  • McDonough, C., W. Loughry. 1997. Patterns of mortality in a population of nine-banded armadillos, Dasypus novemcinctus. The American Midland Naturalist, 138(2): 299-305.
  • McDonough, C., W. Loughry. 2008. Behavorial ecology of armadillos. Pp. 103-110 in S Vizcaíno, W Loughry, eds. The Biology of the Xenarthra. Gainesville: University Press of Florida.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22.3 years (captivity) Observations: These animals have been estimated to live more than 22 years (Ronald Nowak 1999), and one 22.3 years old record, which seems plausible, has been reported (Ernest 2003). Still, their record longevity in captivity is reported to be only 14.8 years (Richard Weigl 2005). Further studies are necessary.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

During the summer breeding season, nine-banded armadillos are often seen pairing. Nine-banded armadillos are typically solitary animals, so a male and female maintaining close proximity to one another is unusual. During pairing, the male remains within a few meters of, and occasionally interacts with, the female as the two forage. Other behaviors accompany the pairing, including dorsal touches, tail wagging, tail lifting by the female (which exposes the genitalia), and sniffing and vigilance by the males, which allows them to maintain their proximity. In some instances, armadillo pairs have been observed sharing a burrow during pairing/breeding season.

It is thought that a male maintains this close proximity to the female in order to claim and protect her from other males. In some cases, a male is aggressive toward other males to prevent them from breeding with the female he is paired with. Maintaining close proximity may also allow the male to determine when the female is receptive to breeding. Females constantly appear to retreat from males, possibly attempting to prevent males from coming too close before she is ready to mate. Females give off secretions from their anal glands that may change in scent when they are ready to mate. Nine-banded armadillos are thought to be polygynous with respect to pairs (one male pairs with multiple females), but pairing may not lead to mating.

Mating System: polygynous

Most females ovulate once a year, usually in early summer (June to July in the northern hemisphere, November to December in the southern hemisphere). Mating occurs during this time of year, with the female positioned on her back. Females almost always give birth of four identical quadruplets. The quadruplets are often born in early spring, after about a 4 month gestation period. Delayed implantation allows birthing to happen during the spring, when temperatures are much warmer and food is abundant.

Young nine-banded armadillos are born in an advanced state of development, closely resembling adults but smaller in size. The eyes open quickly, but their leathery skin does not harden into its characteristic armor for a few weeks. Young of both sexes may begin breeding as early as the summer following their birth, but they may not reach full sexual maturity until 2 years of age. Full development and maturity is attained by 3 or 4 years of age.

Breeding interval: Nine-banded armadillos breed once yearly.

Breeding season: Breeding occurs in early summer (June to July for northern hemisphere, November to December for southern hemisphere).

Range number of offspring: 4 (high) .

Average number of offspring: 4.

Average gestation period: 4 months.

Average birth mass: .085 kg.

Average weaning age: 2-3 months.

Average age at sexual or reproductive maturity (female): 1 to 2 years.

Average age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 66 g.

Average gestation period: 133 days.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Young nine-banded armadillos are typically born in spring but do not leave their burrows until late spring or early summer, after at least a few weeks. When they emerge, they are ready to begin foraging with their mother. The mother may provide milk for up to 2 to 3 months before weaning. After weaning the young may remain with their mother for a few additional months, but mothers to not provide significant care at this point. A young nine-banded armadillo may share a burrow and foraging areas with its siblings during its first summer and early fall.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America: Biology, Management, and Economics. 1982: John Hopkins University Press.
  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File.
  • Stangle, F. 1994. Evolution of a Desert Mammalian Fauna : a 10,000-Year History of Mammals from Culberson and Jeff Davis Counties, Trans-Pecos Texas. Wichita Falls, TX: Midwestern State University Press.
  • McDonough, C. 1997. Pairing Behavior of the Nine-banded Armadillo. American Midland Naturalist, 138(2): 290-298.
  • Loughry, W., P. Prodohl, C. McDonough, W. Nelson, J. Avise. 1998. Correlates of Reproductive Success in a Population of Nine-banded Armadillos. Canadian Journal of Zoology, 76(10): 1815.
  • Loughry, W., C. McDonough. 1994. Scent Discrimination by Infant Nine-Banded Armadillos. Journal of Mammology, 75(4): 1033-1039.
  • 2008. "Dasypus novemcinctus" (On-line). Accessed April 02, 2009 at http://www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

During the summer breeding season, nine-banded armadillos are often seen pairing. Nine-banded armadillos are typically solitary animals, so a male and female maintaining close proximity to one another is unusual. During pairing, the male remains within a few meters of, and occasionally interacts with, the female as the two forage. Other behaviors accompany the pairing, including dorsal touches, tail wagging, tail lifting by the female (which exposes the genitalia), and sniffing and vigilance by the males, which allows them to maintain their proximity. In some instances, armadillo pairs have been observed sharing a burrow during pairing/breeding season.

It is thought that a male maintains this close proximity to the female in order to claim and protect her from other males. Usually only males who have an exclusive home range pair. In some instances, male on male aggression takes place as a male protects his rights to a female. It is likely that maintaining such close proximity allows the male to determine when the female is receptive. Females constantly appear to retreat from males, which may be an effort to prevent the male from keeping too close before she is ready to mate. The secretions by the anal glands may have a scent that changes as a female becomes ready to ovulate. Some observational studies have shown that within a given breeding season, nine-banded armadillos are polygnous with respect to pairing, however, pairing may not lead to copulation. This is a topic still under study.

Mating System: polygynous

Females have a large external clitoris, while males lack an external scrotum and testes are internal. The female reproductive tract includes a simplex uterus and paired ovaries and oviducts. Most females ovulate once a year, usually in early summer (June to July in the northern hemisphere, November to December in the southern hemisphere). Copulation occurs during this time of year, with the female positioned on her back.

During conception, only a single ovum is fertilized. The blastocyst stays in the uterus for about 14 weeks before implantation. During this time, fluids from the uteran lining keep the blastocyst lubricated and provide nutrients. Nine-banded armadillo reproduction involves monozygotic polyembryony. That is, when a blastocyst finally implants in the wall of the uterus, it buds into 4 identical embryos. Every embryo develops its own amniotic cavity. This embryonic process almost always results in the birth of four identical quadruplets.

The quadruplets are often born in early spring, after about a 4 month gestation period. Delayed implantation allows birthing to happen during the spring, when temperatures are much warmer and food is abundant.

Young are born in an advanced state of development, closely resembling their adult counterparts but smaller in size. The eyes open quickly, but their leathery skin does not harden into its characteristic armor for a few weeks. Young of both sexes may begin breeding as early as the summer following their birth, but they may not reach full sexual maturity until the age of 2 years. Full development and maturity is attained by the age of 3 or 4 years.

Breeding interval: Nine-banded armadillos breed once yearly.

Breeding season: Breeding occurs in early summer (June to July for northern hemisphere, November to December for southern hemisphere).

Range number of offspring: 4 (high) .

Average number of offspring: 4.

Average gestation period: 4 months.

Average birth mass: .085 kg.

Average weaning age: 2-3 months.

Average age at sexual or reproductive maturity (female): 1 to 2 years.

Average age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous ; delayed implantation

Average birth mass: 66 g.

Average gestation period: 133 days.

Average number of offspring: 4.

Average age at sexual or reproductive maturity (male)

Sex: male:
365 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
365 days.

Young are typically born in spring but will not leave their burrows until late spring or early summer, after at least a few weeks. When they emerge, they are ready to begin foraging with their mother. The mother may provide milk for up to 2 to 3 months before weaning. After weaning the young may remain with their mother for a few additional months, but no significant long term care or parent-offspring relationship is known. A young nine-banded armadillo may share a burrow and foraging areas with its siblings during its first summer and early fall.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America: Biology, Management, and Economics. 1982: John Hopkins University Press.
  • Macdonald, D. 1984. The Encyclopedia of Mammals. New York, NY: Facts on File.
  • Stangle, F. 1994. Evolution of a Desert Mammalian Fauna : a 10,000-Year History of Mammals from Culberson and Jeff Davis Counties, Trans-Pecos Texas. Wichita Falls, TX: Midwestern State University Press.
  • McDonough, C. 1997. Pairing Behavior of the Nine-banded Armadillo. American Midland Naturalist, 138(2): 290-298.
  • Loughry, W., P. Prodohl, C. McDonough, W. Nelson, J. Avise. 1998. Correlates of Reproductive Success in a Population of Nine-banded Armadillos. Canadian Journal of Zoology, 76(10): 1815.
  • Loughry, W., C. McDonough. 1994. Scent Discrimination by Infant Nine-Banded Armadillos. Journal of Mammology, 75(4): 1033-1039.
  • 2008. "Dasypus novemcinctus" (On-line). Accessed April 02, 2009 at http://www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating occurs in summer; fertilization delayed until Nov. Delayed implantation of blastocyst. True gestation 4-5 months or more. Litter of 4 (usually one sex) born in advanced condition; litter derived from single fertilized ovum. Usually only 1 litter per year. Sexually mature after about 1 year. Storrs et al. 1989 reported that females experience an embryological diapause that may last up to over 2 years; one female gave birth 32 months after the estimated breeding date; some females produced litters in successive years without exposure to males between the first and second litters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dasypus novencinctus become reproductive shortly into their second year of life. Young born in the spring are capable of breeding n the early summer of the following year. The breeding season begins in July, and by the end of the month, approximately half of the reproductive females have become pregnant (Davis and Schmidly 1997). Actual gestation lasts for five months, but delayed implantation (see below) results in a pregnancy that persists for approximately three additional months (Schaefer and Hostetler 2003).
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Growth

The embryology of Dasypus novencinctus is notable in several ways. Within a week of mating, the fertilized ovum forms a blastocyst and is passed to the uterus. There, development ceases and the blastocyst remains unattached in the uterus but nevertheless receives oxygen and nutrition from uterine secretions. Implantation is delayed until November, more than three months after fertilization. At the time of implantation, the blastocyst divides to form four distinct embryonic growth centers which attach to the uterus via a shared placenta. This phenomenon, termed specific polyembryony, results in litters typically consisting of identical quadruplets. After implantation, embryonic development then proceeds normally. A litter is born fully formed and with eyes open in approximately 4 months, usually in March. The young are highly precocial, walking within hours of birth and foraging with their mother within a few weeks. They likely wean within two months but may remain with their mother for a few months more (Davis and Schmidly 1997).Delayed implantation may facilitate the success of pioneering armadillos in temperate climates. Rather than being born around the start of winter, delayed implantation allows young to be born in spring when survival odds are greatest (Davis and Schmidly 1997).
  • Davis W.B. and D.J. Schmidly. 1997. The Mammals of Texas - Online Edition. Texas Tech University. Available online.
  • Engeman R.M., Shwiff S.A., Constantin B., Stahl M., and H.T. Smith. 2002. An economic analysis of predator removal approaches for protecting marine turtle nests at Hobe Sound National Wildlife Refuge. Ecological Economics 42:469-478.
  • Fox D. 1999. Dasypus novemcinctus Animal Diversity Web species profile. Available online.
  • Greenbaum M. 2002. Nine-banded armadillo species profile. Columbia University Introduced Species Summary Project. Available online.
  • McDonough C.M. 1994. Determinants of aggression in nine banded armadillos. Journal of Mammalogy 75:189-198.
  • Nixon J. 1995. Armadillo Online! Available online.
  • Schaefer J.M and M.E. Hostetler. 2003. The nine-banded armadillo (Dasypus novemcinctus). UF/IFAS document WEC 76. Available online.
  • Van Deelen T.R., Parrish J.D., and E.J. Heske.2002. A nine-banded armadillo (Dasypus novemcinctus) from central Illinois. Southwestern Naturalist 47:489-491.
  • Wolfe J.L. 1968. Armadillo distribution in Alabama and northwest Florida. Quarterly Journal of the Florida Academy of Sciences 31:209-212.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Marine Station at Fort Pierce

Source: Indian River Lagoon Species Inventory

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dasypus novemcinctus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCGTTGACTATTTTCAACAAACCACAAAGATATTGGAACTCTATATTTACTATTTGGCGCCTGGGCTGGAATAGTAGGCACCGCCCTAAGTCTACTAATTCGTGCCGAGCTTGGCCAACCAGGCACATTACTAGGAGAC---GATCAAATTTATAATGTAATTGTTACCGCCCATGCATTCATCATAATTTTCTTTATAGTAATACCAATCATGATCGGGGGCTTCGGAAACTGATTAGTCCCATTAATAATTGGCGCGCCCGATATAGCCTTCCCACGAATAAACAACATAAGTTTCTGACTATTACCCCCTTCATTCCTACTCCTACTAGCCTCCTCTATAGTAGAAGCTGGAGCAGGAACAGGCTGAACAGTATACCCGCCACTAGCAGGAAACCTAGCCCACGCAGGAGCATCCGTAGACCTAACAATTTTCTCCCTCCACCTTGCAGGAATCTCATCCATTCTAGGAGCCATCAACTTTATTACTACTATCATCAACATAAAACCCCCCGCAATAACACAATACCAAACCCCATTATTTGTATGATCAGTACTAGTAACAGCAGTCCTACTGCTGCTTTCCCTCCCAGTTCTAGCCGCTGGCATTACCATACTCCTAACAGACCGAAACCTTAATACCACATTCTTCGACCCAGCAGGAGGAGGGGACCCAATTCTCTATCAACATCTATTCTGATTCTTTGGACACCCTGAAGTCTACATCCTCATCTTACCAGGGTTCGGTATAATTTCACACATCGTCACATATTATTCAGGAAAAAAAGAACCATTCGGCTATATGGGCATAGTTTGAGCCATGATATCCATTGGCTTCTTAGGGTTCATTGTATGAGCTCATCACATATTCACAGTAGGAATGGACGTAGATACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dasypus novemcinctus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Due to their high reproduction rate and expanding distribution, nine-banded armadillos are not considered in any danger. In fact, throughout most of their distribution, their population size is increasing.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Abba, A.M. & Superina, M.

Reviewer/s
McDonough, C. & Loughry, J.

Contributor/s
McDonough, C. & Loughry, J.

Justification
Dasypus novemcinctus is listed as Least Concern in view of its very wide distribution, presumed large population, tolerance of habitat alteration, and because there is no evidence of a major population decline.

History
  • 2006
    Least Concern
    (IUCN 2006)
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Due to their high reproduction rate and expanding distribution, nine-banded armadillos are not considered in any danger. In fact, throughout most of their distribution, their population size is increasing.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a common species.

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species; it is hunted throughout its range, but given its high rate of reproduction it seems able to withstand a reasonably high degree of offtake. In North America, it is subject to poisoning as it is often considered a nuisance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species occurs in many protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Despite feeding on crop pests, nine-banded armadillos can be a nuisance for human agriculture. They feed on several crops, including peanuts, corn and cantaloupe. Their burrows pose threats to livestock animals, who may accidentally step in them. Furthermore, their burrows can weaken road shoulders and dikes. They also carry and can transmit diseases.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

dasypodidae, including nine-banded armadillos, play a large role in medical research because they harbor a number of protozoan, bacterial, and fungal pathogens that are responsible for human disease. One well-studied pathogen is the fungus Paracoccidiodies_brasiliensis, which is responsible for a widespread mycosis in Brazil. Another is the bacterium Mycobacterium_leprae, which causes leprosy. Nine-banded armadillos are important predators of a variety of common insect agricultural pests. In addition, nine-banded armadillos are hunted for their meat and skin, which is used to make various trinkets.

Positive Impacts: food ; body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Despite feeding on crop pests, nine-banded armadillos can be a nuisance for human agriculture. They feed on several crops, including peanuts, corn and cantaloupe. Their burrows pose threats to livestock animals, who may accidentally step in them. Furthermore, their burrows can weaken road shoulders and dikes. They also carry and can transmit diseases.

Negative Impacts: injures humans (carries human disease); crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Armadillos, including nine-banded armadillos, play a large role in medical research because they harbor a number of protozoan, bacterial, and fungal pathogens that are responsible for human disease. Perhaps the two most heavily studied pathogens are the fungus Paracoccidiodies brasiliensis, which is responsible for a widespread mycosis in Brazil, and the bacterium Mycobacterium leprae, which causes leprosy. Nine-banded armadillos are important predators of a variety of commong insect agricultural pests. In addition, nine-banded armadillos are hunted for their meat and skin, which is used to make various trinkets.

Positive Impacts: food ; body parts are source of valuable material; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: One of the few species, besides humans, susceptible to infection by Mycobacterium leprae, the bacillus that causes Hansen's Disease (leprosy); critical in research aimed at developing cure (Maugh 1982, Moncrief 1988). Digging sometimes damages lawns and gardens. May distract hunting dogs (that would rather chase armadillos than raccoons) (see Figg 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nine-banded armadillo

The nine-banded armadillo (Dasypus novemcinctus), or the nine-banded, long-nosed armadillo, is a medium-sized mammal. It is found in North, Central, and South America, making it the most widespread of the armadillos.[2] Its ancestors originated in South America, and remained there until thousands of years later when the formation of the Isthmus of Panama allowed them to enter North America as part of the Great American Interchange. The nine-banded armadillo is a solitary, mainly nocturnal[3][4] animal, found in many kinds of habitats, from mature and secondary rainforests to grassland and dry scrub. It is an insectivore, feeding chiefly on ants, termites, and other small invertebrates. The armadillo can jump 3–4 ft (91–120 cm) straight in the air if sufficiently frightened, making it a particular danger on roads.[5] It is the state small mammal of Texas.

Contents

Habitat [edit]

The nine-banded armadillo evolved in a warm, rainy environment, and is still most commonly found in regions resembling its ancestral home. As a very adaptable animal, though, it can also be found in scrublands, open prairies, and tropical rainforests. It cannot thrive in particularly cold or dry environments, as its large surface area, which is not well insulated by fat, makes it especially susceptible to heat and water loss.[6]

Range [edit]

The current (circa 2009-2010) range (shaded red), and predicted future range (shaded pink) of the nine-banded armadillo in the USA

The nine-banded armadillo has been rapidly expanding its range both north and east within the United States, where it is the only regularly occurring species of armadillo. The armadillo crossed the Rio Grande from Mexico in the late 19th century, and was introduced in Florida at about the same time by humans. By 1995, the species had become well-established in Texas, Oklahoma, Louisiana, Arkansas, Mississippi, Alabama, and Florida, and had been sighted as far afield as Kansas, Missouri, Tennessee, Georgia and South Carolina. A decade later, the armadillo had become established in all of those areas and continued its migration, being sighted as far north as southern Nebraska, southern Illinois, and southern Indiana.[7] The primary cause of this rapid expansion is explained simply by the species having few natural predators within the United States, little desire on the part of Americans to hunt or eat the armadillo, and the animals' high reproductive rate. The northern expansion of the armadillo is expected to continue until the species reaches as far north as Ohio, Pennsylvania, and New Jersey, and all points southward on the East Coast of the United States. Further northward and westward expansion will probably be limited by the armadillo's poor tolerance of harsh winters, due to its lack of insulating fat and its inability to hibernate.[7] As of 2009, newspaper reports indicated the nine-banded armadillo seems to have expanded its range northward as far as Omaha, Nebraska in the west, and Kentucky Dam and Evansville, Indiana in the east.[8][broken citation][9][10][dead link][11][not in citation given].[12] In late 2009, the state of North Carolina began considering the establishment of a hunting season for armadillo, following reports that the species has been moving into the southern reaches of the state (roughly between the areas of Charlotte, North Carolina and Wilmington, North Carolina).[13][14] Outside the United States, the nine-banded armadillo ranges southward through Central and South America into northern Argentina and Uruguay, where it is still expanding its range.[6] In 1995, armadillos were only seen in the southern tip of South Carolina, and within two to three years, they had swept across most of the state.[6]

Diet [edit]

Nine-banded armadillos are generally insectivores. They forage for meals by thrusting their snouts into loose soil and leaf litter and frantically digging in erratic patterns, stopping occasionally to dig up grubs, beetles (perhaps the main portion of this species' prey selection), ants, termites, and worms, which their sensitive noses can detect through 8 inches (20 cm) of soil. They then lap up the insects with their sticky tongues. Nine-banded armadillos have been observed to roll about on ant hills in order to dislodge and consume the resident ants. They supplement their diets with amphibians and small reptiles, especially in more wintery months when such prey tends to be more sluggish, and occasionally bird eggs and baby mammals. Carrion is also eaten, although perhaps the species is most attracted to the maggots borne by carcasses rather than the meat itself. Less than 10% of the diet of this species is composed by non-animal matter, though fungi, tubers, fruits and seeds are occasionally eaten.[6][15][16]

Anatomy [edit]

Nine-banded armadillo in natural habitat

Nine-banded armadillos generally weigh from 2.5–6.5 kg (5.5–14 lb), though the largest specimens can scale up to 10 kg (22 lb). They are one of the largest species of armadillo.[17] Head and body length is 38–58 cm (15–23 in), which combines with the 26–53 cm (10–21 in) tail, for a total length of 64–107 cm (25–42 in). They stand 15–25 cm (5.9–9.8 in) tall at the top of the shell.[6][17][18] The outer shell is composed of ossified dermal scutes covered by nonoverlapping, keratinized epidermal scales, which are connected by flexible bands of skin. This armor covers the back, sides, head, tail, and outside surfaces of the legs. The underside of the body and the inner surfaces of the legs have no armored protection. Instead, they are covered by tough skin and a layer of coarse hair. The vertebrae attach to the carapace.[19] The claws on the middle toes of the forefeet are elongated for digging, though not to the same degree as those of the much larger giant armadillo of South America.[6] Their low metabolic rate and poor thermoregulation make them best suited for semitropical environments.[19] Unlike the South American three-banded armadillos, the nine-banded armadillo cannot roll itself into a ball. It is, however, capable of floating across rivers by inflating its intestines, or by sinking and running across riverbeds. The second is possible due to its ability to hold its breath for up to six minutes, an adaptation originally developed for allowing the animal to keep its snout submerged in soil for extended periods while foraging.[19] Although nine is the typical number of bands on the nine-banded armadillo, the actual number varies by geographic range.[19] Armadillos possess the teeth typical of all sloths, and anteaters. The teeth are all small, peg-like molars with open roots and no enamel. Incisors do form in the embryos, but quickly degenerate and are usually absent by birth.[19]

Nine-banded armadillo on its hind legs

Behavior [edit]

Armadillo burrow
in Nuevo León, Mexico

Nine-banded armadillos are solitary, largely nocturnal animals that come out to forage around dusk. They are extensive burrowers, with a single animal sometimes maintaining up to 12 burrows on its range. These burrows are roughly 8 inches (20 cm) wide, 7 feet (2.1 m) deep, and 25 feet (7.6 m) long. Armadillos mark their territory with urine, feces, and excretions from scent glands found on the eyelids, nose, and feet. Females tend to have exclusive, clearly defined territories. Males have larger territories, but theirs often overlap, and can coincide with the ranges of several females. Territorial disputes are settled by kicking and chasing. When they are not foraging, armadillos shuffle along fairly slowly, stopping occasionally to sniff the air for signs of danger.

Predation [edit]

If alarmed, nine-banded armadillos can flee with surprising speed. Occasionally, a large predator may be able to ambush the armadillo before it can clear a distance, and breach the hard carapace with a well-placed bite or swipe. If the fleeing escape fails, the armadillo may quickly dig a shallow trench and lodge itself inside. Predators are rarely able to dislodge the animal once it has burrowed itself, and abandon their prey when they cannot breach the armadillo’s armor nor are able to grasp its tapered tail.[6] Due to their softer carapace, juvenile armadillos are more likely to fall victim to natural predation and their cautious behavior generally reflects this. Young nine-banded armadillos tend to forage earlier in the day and are more wary of the approach of an unknown animal (including humans) than are adults. Known natural predators of nine-banded armadillos include cougars (perhaps the leading predator), maned wolves, coyotes, black bears, red wolves, jaguars, alligators, bobcats and large raptors. By far the leading predator of nine-banded armadillos today is humans, as armadillos are locally harvested for their meat and shells and many thousands of armadillos fall victim to auto accidents every year.[20][21]

Reproduction [edit]

Mating takes place during a two- to three-month-long mating season, which occurs from July–August in the Northern Hemisphere and November–January in the Southern Hemisphere. A single egg is fertilized, but implantation is delayed for three to four months to ensure the young will not be born during an unfavorable time. Once the zygote does implant in the uterus, a gestation period of four months occurs, during which the zygote splits into four identical embryos, each of which develops its own placenta, so blood and nutrients are not mixed between them. After birth, the quadruplets remain in the burrow, living off the mother’s milk for approximately three months. They then begin to forage with the mother, eventually leaving after six months to a year.[6][19]

Nine-banded armadillos reach sexual maturity at the age of one year, and reproduce every year for the rest of their 12–15 year lifespans. A single female can produce up to 56 young over the course of her life. This high reproductive rate is a major cause of the species’ rapid expansion.[6]

Effect on the environment [edit]

The foraging of nine-banded armadillo can cause mild damage to the root systems of certain plants. Skunks, cotton rats, burrowing owls, pine snakes and rattlesnakes, can be found living in abandoned armadillo burrows.[6] Occasionally, the armadillo may threaten the endangered gopher tortoise by aggressively displacing them from their burrows and claiming the burrows for themselves.[15] Studies have shown the fan-tailed warbler habitually follows armadillos to feed on insects and other invertebrates displaced by them.[22]

They are typically hunted for their meat, which is said to taste like pork, but are more frequently killed as a result of their tendency to steal the eggs of poultry and game birds. This has caused certain populations of the nine-banded armadillo to become threatened, although the species as a whole is under no immediate threat.[6] They are also valuable for use in medical research, as they are the only mammal susceptible to the human disease leprosy.[19] In Texas, nine-banded armadillos are raised to participate in armadillo racing, a small-scale, but well-established sport in which the animals scurry down a 40-foot track.[6]

Hoover hog [edit]

During the Great Depression, the species was hunted for its meat in East Texas, where it was known as the poor man’s pork,[23] or the "Hoover hog" by those who considered President Herbert Hoover to be responsible for the depression.[24] Earlier, German settlers in Texas would often refer to the armadillo as Panzerschwein ("armored pig").[citation needed] In 1995, the nine-banded armadillo was, with some resistance, made the state small mammal of Texas,[25] where it is considered a pest and is often seen dead on the roadside. They first forayed into Texas across the Rio Grande from Mexico in the 19th century, eventually spreading across the southeast United States.[24]

Subspecies [edit]

North American subspecies exhibit reduced genetic variability compared with the subspecies of South America, indicating the armadillos of North America are descended from a relatively small number of individuals that migrated from south of the Rio Grande.[19]

Appearances in Popular Culture [edit]

  • During the 7th season of the TV shows called Friends, Ross Geller dressed up as an armadillo to teach his son about the Jewish holiday, Hanukkah. Every year, Ryszard[26] of EDC[27] dress up as an armadillo to present gifts for all the participants in EDC. On his motorcycle, the armadillo rides into the IEA[28] building. At the same time as riding the motorcycle, Ryszard will be clutching a bag of gifts. Without stopping, the armadillo biker will distribute the gifts to the kids at EDC.

References [edit]

  1. ^ IUCN SSC Edentate Specialist Group (2008). Dasypus novemcinctus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 30 December 2008.
  2. ^ Gardner, A. L. (2005). "Order Cingulata". In Wilson, D. E.; Reeder, D. M. Mammal Species of the World (3rd ed.). Johns Hopkins University Press. pp. 94–95. ISBN 978-0-8018-8221-0. OCLC 62265494. 
  3. ^ Armadillo Observation
  4. ^ Mammals of Kansas - Kansas University
  5. ^ "How high can a nine-banded armadillo jump?". Everyday Mysteries. Library of Congress. 
  6. ^ a b c d e f g h i j k l Wildlife Explorer: Nine-Banded Armadillo. USA: International Masters Publishers, 1998.[dubious ]
  7. ^ a b Armadillo Expansion, Armadillo Online, retrieved 7 June 2010 
  8. ^ [1][broken citation]
  9. ^ "Armadillo sightings becoming common", Evansville Courier and Press, 2008, retrieved 7 June 2010 
  10. ^ [2][dead link]
  11. ^ [3][not in citation given]
  12. ^ Sam Venable (2009), "Keeping all fingers intact", Knoxville News Sentinel, retrieved 8 June 2010 
  13. ^ Steve Windham (Chairman), Public Hearings Applying to 2010-2011 Fishing, Hunting and Trapping Seasons (PDF), North Carolina Wildlife Resources Commission, retrieved 7 June 2010 
  14. ^ Jefferson Weaver (9 December 2009). "New regulations feature armored possums". The News Reporter. Retrieved 8 June 2010. 
  15. ^ a b Chapman, J., G. Feldhamer. 1982. Wild Mammals of North America: Biology, Management, and Economics. 1982: John Hopkins University Press.
  16. ^ Schmidly, D., D. William. 1994. The Mammals of Texas. Austin: University of Texas Press.
  17. ^ a b [4]
  18. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  19. ^ a b c d e f g h Feldhamer, George A., Lee C. Drickhamer, Stephen H. Vessey, Joseph F. Merritt, Carey Krajewski (2007), Mammalogy: Adaptation, Diversity, Ecology, Baltimore, Maryland: Johns Hopkins University Press, ISBN 978-0-8018-8695-9, retrieved 7 June 2010 
  20. ^ Moeller, W. 1990. Modern Xenarthrans. Pp. 583-626 in S Parker, ed. Grzimek’s Encyclopedia of Mammals, Vol. 2, English Language Edition. New York: McGraw-Hill, Inc.
  21. ^ Weckel, M., W. Giuliano, S. Silver. 2006. Cockscomb revisited: Jaguar diet in the Cockscomb Basin Wildlife Sanctuary, Belize. Biotropica, 38(5): 687-690.
  22. ^ Schaefer, R., J. Fagan. 2006. Commensal foraging by a fan-tailed warbler (Euthlypis lachrymosa) with a nine-banded armadillo (Dasypus novemcinctus) in southwestern Mexico. The Southwestern Naturalist, 51(4): 560 -562.
  23. ^ http://www.tpwd.state.tx.us/publications/nonpwdpubs/introducing_mammals/armadillos/ TEXAS PARKS & WILDLIFE, Armadillos
  24. ^ a b Armadillo from the Handbook of Texas Online
  25. ^ Texas Symbols, Small Mammal: Armadillo - SHG Resources. Accessed March 2, 2008.
  26. ^ ?
  27. ^ ?
  28. ^ ?
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly included in the order Edentata; included in the order Xenarthra by Jones et al. (1992) and Gardner (in Wilson and Reeder 1993).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!