Overview

Brief Summary

Biology

Little is known about the behaviour of the Indo-Pacific humpback dolphin, but small groups of around three to seven individuals are most commonly seen (5). These are slow-swimming dolphins, typically travelling at around 4.8 kilometres per hour (5). Despite this sluggishness, many aerial displays are seen; including breaching, when the dolphin leaps out of the water, lob tailing (slapping the surface of the water with the tail) and spyhopping, when the dolphin raises its head vertically out of the water and then sinks below the surface quietly (6). These dolphins feed primarily on reef-associated and estuarine fish (9). Individuals may be aggressive and this appears to affect dominance rank within the group (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

Humpback dolphins are medium sized and robust. Their melon is slightly depressed and slopes gradually to an indistinct junction with the long, narrow beak. The broad flippers are rounded at the tip and the flukes are broad and full, with a deep median caudal notch. The form of the dorsal fin varies geographically. Colour varies greatly with age and location, in both the timing and extent in the loss of the grey background colour to white.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The Indo-Pacific humpback dolphin has a typically streamlined body and a long slender beak (5). Populations differ in both shape and colour, with those in the west of the range possessing a 'double-step' dorsal fin with a fatty hump upon which the dorsal fin sits (6). Although usually dark grey on their back and lighter underneath, white and pink variations are also known; the most famous of these are the 'pink dolphins' of Hong Kong bay (2). The humpback dolphin has an unusual diving posture, first lifting its beak out of the water and arching its back, and then pausing before dipping below the surface or flipping its tail to dive (2). Given the wide morphological differences, there is some disagreement as to whether the Indo-Pacific humpback dolphin does in fact represent four different species: Sousa plumbea, Sousa lentiginosa, Sousa chinensis and Sousaborneensis respectively (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The primary range of this subpopulation consists of coastal western Taiwan from the estuaries of the Houlong and Jhonggang rivers (MiaoliCounty) in the north to Waishanding Zhou (a large sandbar off ChiayiCounty) in the south (see Figure 1 in the attached PDF). However, one sighting of about 20 dolphins has been confirmed from the inshore waters of Tainan County and a dolphin, almost certainly a “stray,” was observed at the mouth of Fugang Harbour (Taitung County) where adjacent waters are deep and oceanic (i.e., clearly not the preferred habitat of this species). All sightings have been within 3 km off shore with the exception of the mud flats/littoral zone in the ChanghuaCounty, the central part of the distribution, where extensive oyster mariculture structures and associated activities likely exclude dolphins physically (Wang et al. 2007b). The distribution is linear, i.e. similar to that of a riverine species. Most of the dolphins in this subpopulation have been sighted in and around the two main estuaries of western Taiwan (Dadu and Joushuei rivers of Taichung, Changhua and Yunlin counties) (Wang et al. 2007a, b).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Chinensis-type
Indo-Pacific humpback dolphins of the chinensis-type are found in shallow, coastal waters from the east and west coasts of northern Australia and from southern China in the east, throughout the Indo-Malay Archipelago, and westward around the coastal rim of the Bay of Bengal to at least the Orissa coast of eastern India (Ross et al. 1994; Jefferson and Karczmarski 2001; Sutaria and Jefferson 2004). They regularly occur in some enclosed seas, such as the Gulf of Thailand. Their distribution appears to be limited to waters of the continental shelf, and the only places where they range far offshore are those where the water remains shallow (<100 m).

Plumbea-type
The plumbea-type is found in a narrow strip of coastal waters from southwestern tip of South Africa eastward around the rim of the Indian Ocean to the southeastern coast of India (Jefferson and Karczmarski 2001; Ross 2002; IWC 2003). It occurs off Madagascar, Mayotte and the Comoro Islands and around the Arabian Peninsula from the Red Sea into the Arabian (Persian) Gulf and east to Pakistan. There is an extralimital record from Israel in the Mediterranean Sea (apparently a stray that moved through the Suez Canal from the Red Sea – Kerem et al. 2001). In the region between northeastern India and Myanmar (Burma) plumbea-type and chinensis-type dolphins are partially sympatric.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Indo-Pacific humpbacked dolphins, Sousa chinensis, are found the Indian and Pacific Ocean, from the coast of Africa to the coast of China and Australia. There are two distinct forms of this species: Indian humpbacked dolphins Sousa chinensis plumbea and Pacific humpbacked dolphins Sousa chinensis chinensis. Indian humpbacked dolphins are mainly found along the coasts of the Indian Ocean, while Pacific humpbacked dolphins are mainly found along the coasts of Southeast Asia, New Guinea, and Australia. Members of this species have been observed off the coast of over 30 different countries. They do not, however, occur around the Philippines due to the presence of deep oceanic waters.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

  • Folkens, P., R. Reeves. 2002. Guide to Marine Mammals of the World.. New York, New York: Alfred A. Knopf, Inc.
  • Jefferson, T. 2000. Wildlife Monographs. Population Biology of the Indo-Pacific Hump-Backed Dolphin in Hong Kong Waters, 144: 1-65.
  • Shirihai, H., B. Jarrett, G. Kirwan. 2006. Whales, dolphins, and other marine mammals of the world. Princeton, N.J: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific, Kenya, Madagascar, Mozambique, Somalia, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Resident in Red Sea; accidental in Mediterranean (Israel, and Egypt at Port Said, probably from the Suez Canal).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Narrow (Indian Ocean  from South Africa to Sri Lanka).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Found along the coasts of the Indian and western Pacific Oceans (6), from southern China and north Australia in the east, to South Africa in the west.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Indo-Pacific humpback dolphins are medium-sized dolphins, ranging from 1.8 to 3 m in length and weighing 250 to 285 kg when fully grown. Indo-Pacific humpback dolphins in waters near southern Africa express sexual dimorphism, with males larger than females, but sexual dimorphism is not observed in other areas.

The dorsal fin and hump of Indo-Pacific humpbacked dolphins varies with geographical region. In eastern waters, the dorsal fin is short and sits on a wide base that gradually slopes into the body. The tip of the fin is lightly recurved, and the hump is only 5 to 10% of the total body length. In western waters, the dorsal fin is shorter and more recurved, however it sits atop a much wider and longer base that reaches to about 30% of the body length.

Coloration of Indo-Pacific humpbacked dolphins varies greatly with developmental stage and with geographic region. In general, subadults are a mottled grayish-pink color and calves are dark gray. Individuals found in southern African waters are typically dark gray with a lighter ventral surface. They develop a pinkish-white spot on the dorsal fin as they age. Calves in this region are much lighter than those of other regions. Individuals found in the northern Indian Ocean are more brownish-gray in color. In waters around China and other areas of southeast Asia, individuals are pure white, often with a pinkish tint. White Indo-Pacific humpback dolphins also often have a speckling of dark flecks on their body.

Range mass: 250 to 280 kg.

Range length: 1.8 to 3 m.

Sexual Dimorphism: sexes alike; male larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 3 m.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology

The ETS dolphins appear to be year-round residents of the coastal waters of central western Taiwan where dedicated surveys have resulted in sightings from April to August (Wang et al. 2007a). Opportunistic sightings have been made in other months; as of December 2007, the only months with no confirmed sightings were January, February and March, when conditions and opportunities for observations are poor (J.Y. Wang pers. comm., 13 December 2007). In late winter and early spring, grey mullet (Mugil cephalus) fishermen report seeing humpback dolphins near their nets (trammel and gill nets that are commonly used as encircling nets as well). Recreational shore fishermen report that the dolphins are seen most commonly in the winter months in the DaduRiver estuary. Although reports by fishermen need to be viewed skeptically because of the possibility of misidentification, other species of dolphins are generally not present in the near-shore waters of western Taiwan so the chances of confusion are relatively small in this instance (Wang et al. 2007b). All sightings have been in waters less than 25 m deep, most in less than 15 m and within 3 km of shore. The few measurements of sea surface temperatures at sightings have varied from about 24 to 30oC (Wang et al. 2007a).

Schools of dolphins often patrol parallel to the coastline just off the surf zone and large sandbars. Estuaries are likely where most of the foraging occurs. Feeding behind active trawlers (as in Hong Kong and Australia) has not been observed but dolphins move along the length of set trammel or gill nets, possibly searching for injured or net-entangled fish. In general, they appear to be indifferent towards boats (at least the research vessels that have been used to study them – a fishing boat and a large raft made of plastic tubing).

Indo-Pacific humpback dolphins appear to be opportunistic feeders. They take a wide variety of nearshore, estuarine, and reef fishes. They also eat cephalopods in some areas, although crustaceans appear to be rare in the diet (Jefferson and Karczmarski 2001, Ross 2002, Ross et al. 1994). Little is known about the specific feeding habits of the ETS subpopulation but these dolphins have been observed feeding on croakers (Sciaenidae), mullets (Mugilidae), threadfins (Polynemidae) and herring (Clupeidae) (Wang et al. 2007b).


Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Humpback dolphins occur in tropical to warm temperate coastal waters, including open coasts and bays, coastal lagoons, rocky and/or coral reefs, mangrove swamps and estuarine areas (Ross et al. 1994, Jefferson and Karczmarski 2001, Ross 2002). They are rarely encountered more than a few kilometres from shore. They sometimes enter rivers, but rarely move more than a few kilometres upstream and usually remain within the range of tidal influence.

Indo-Pacific humpback dolphins appear to be opportunistic feeders, consuming a wide variety of nearshore, estuarine, and reef fishes. They also eat cephalopods in some areas, but crustaceans are rare in their diet (Jefferson and Karczmarski 2001, Ross 2002).

Chinensis-type
Chinensis-type dolphins often enter rivers, estuaries, and mangroves, preferring coasts with mangrove swamps, lagoons, and estuaries, as well as areas with reefs, sandbanks, and mudbanks (Jefferson and Karczmarski 2001). In at least China and southern Asia, they are rarely found far from estuaries and mangrove habitats (Jefferson and Karczmarski 2001; Wang et al. 2007), and they show a strong preference for river mouths in northern Australia (Parra 2006; Parra et al. 2006b). Aerial surveys of the Great Barrier Reef region demonstrate that humpback dolphins occur mostly close to the coast but also in offshore waters that are relatively sheltered, and near reefs or islands (Corkeron et al. 1997). Fine-scaled resource partitioning between humpback and Australian snubfin dolphins (Orcaella heinsohni) has been documented off Queensland, where the two species favour river mouths and modified habitats but the humpback dolphins occur in slightly deeper (2-5 m deep) waters (Parra 2006).

Plumbea-type
Plumbea-type dolphins are usually seen within a narrow strip of shallow near-shore waters and in estuarine areas (Ross et al. 1994, Jefferson and Karczmarski 2001), seldom in water deeper than 20-30 m (Karczmarski et al. 2000). Seasonality of occurrence, movements, group sizes, and reproduction has been reported in several studies (e.g. Durham 1994, Karczmarski et al. 1999a, 1999b, Guissamulo 2007). The dolphins appear to be selective in their habitat choice (e.g. Karczmarski et al. 2000; Stensland et al. 2006). Dependence on shallow-water habitats as feeding grounds is often evident throughout the year (Karczmarski and Cockcroft 1999; Karczmarski et al. 2000), although the details of the preferred key habitats may differ between groups and locations (Jefferson and Karczmarski 2001; Atkins et al. 2004; Stensland et al. 2006).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Indo-Pacific humpback dolphins have a highly tropical and subtropical distribution. They live in warm waters, generally warmer than 15 degrees Celsius, and at an average depth of 20 m, rarely traveling to waters deeper than 25 m. They are often found in or near bays, estuaries, mangrove forests, sandbanks, rocky and coral reefs and large river mouths. They generally remain close to the shore, but occasionally venture further if water depth remains shallow.

Range depth: 25 (high) m.

Average depth: 20 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; brackish water

Other Habitat Features: estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

tropical to warm temperate coastal waters, also in rivers, estuaries and mangroves
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 8 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 26.345 - 27.501
  Nitrate (umol/L): 0.016 - 0.048
  Salinity (PPS): 34.912 - 39.339
  Oxygen (ml/l): 4.655 - 4.759
  Phosphate (umol/l): 0.160 - 0.225
  Silicate (umol/l): 1.131 - 3.311

Graphical representation

Temperature range (°C): 26.345 - 27.501

Nitrate (umol/L): 0.016 - 0.048

Salinity (PPS): 34.912 - 39.339

Oxygen (ml/l): 4.655 - 4.759

Phosphate (umol/l): 0.160 - 0.225

Silicate (umol/l): 1.131 - 3.311
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

S. chinensis is rarely found more than a few kilometres from shore, preferring coasts with mangrove swamps, lagoons, and estuaries and areas with reefs, sandbanks, and mudbanks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits coastal tropical and subtropical waters, preferring areas that are less than 20 metres deep (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Indo-Pacific humpback dolphins primarily feed on abundant estuarine fish and fish associated with reef environments. They generally feed close to the ocean floor. Some groups feed with the rising tide. Indo-Pacific humpback dolphins are also known to follow trawlers, feeding on discarded organisms.

Animal Foods: fish; mollusks; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Indo-Pacific humpback dolphins eat a variety of fish and are prey to some sharks. They also host some parasites, such as nematodes (Anisakis alexandri), which affect the stomach. In Hong Kong, lungworms (Halocercus pingi) have been observed in their orbits. Barnacles (Halocercus pingi) have also been observed living on the skin of Indo-Pacific humpback dolphins.

Commensal/Parasitic Species:

  • nematodes (Anisakis alexandri)
  • lungworms (Halocercus pingi)
  • barnacles (Halocercus pingi)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sharks are the only known predator of Indo-Pacific humpback dolphins. While unconfirmed, it is likely that killer whales, Orcinus orca also prey on this species. Indo-Pacific humpback dolphins have been known to flee from sharks and to chase sharks to avoid predation.

Known Predators:

  • Sharks

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Indo-Pacific humpback dolphins communicate with each other through clicks, whistles, and screams. Clicks are frequently heard, while screams are the least common and have only been observed in groups exceeding 4 or 5 individuals.

Communication Channels: acoustic

Perception Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Food consists mainly of fish and cephalopods, dolphins temporarily beaching to retrieve bonefish washed onto exposed sandbanks. Fish species comprise sardines, mackerel, mullet and other near-shore fishes.

Some calves may be born throughout the year, but spring or summer calving peaks are the norm. Gestation lasts 10-12 months, and age at sexual maturity is 10 years in females and 12-13 years in males. Some females may cycle outside of the apparent summer breeding season, perhaps indicating a secondary winter season. Maternal care lasts at least 3-4 years, but female-calf separation is seemingly not related to the female's next pregnancy.

The species is usually quite difficult to approach and tends to avoid boats by diving and reappearing some distance away in a different direction. They rarely permit a close approach before diving, splitting up into small groups or single animals.

 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Lifespan of Indo-Pacific humpback dolphins is fairly high in the wild; they generally live 40 or more years. Indo-Pacific humpback dolphins are not commonly raised in captivity. Many die after 3 months in captivity, and one individual in India died after 28 days due to starvation. One individual, however, lived 31 years in captivity.

Range lifespan

Status: captivity:
.08 to 31 years.

Average lifespan

Status: wild:
40 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they may live 25 years in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Little information about the mating systems of Indo-Pacific humpbacked dolphins is documented. However, the most likely reroductive strategy of males is mate searching.

Indo-Pacific humpback dolphins breed once yearly, though births typically occur in the spring and summer. After a gestation period of 10 to 12 months, females usually give birth to 1 offspring that measures approximately 100 cm in length. Young are weaned around 2 years of age, although they are capable of eating solid foods after 6 months. Females reach sexual maturity around 9 to 10 years of age, while males reach sexual maturity around 12 to 13 years of age.

Breeding interval: Indo-Pacific Humpback Dolphins breed once yearly.

Average number of offspring: 1.

Range gestation period: 10 to 12 months.

Range weaning age: 24 to 36 months.

Average weaning age: 24 months.

Range age at sexual or reproductive maturity (female): 9 to 10 years.

Range age at sexual or reproductive maturity (male): 12 to 13 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Female Indo-Pacific humpback dolphins provide considerable care to their young. Calves are weaned around 2 years of age and remain in association with their mother for 3 to 4 years. Allomothering, or non-maternal infant care, has been observed off the coasts of South Africa and Hong Kong.

Parental Investment: female parental care ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Folkens, P., R. Reeves. 2002. Guide to Marine Mammals of the World.. New York, New York: Alfred A. Knopf, Inc.
  • Jefferson, T. 2000. Wildlife Monographs. Population Biology of the Indo-Pacific Hump-Backed Dolphin in Hong Kong Waters, 144: 1-65.
  • Shirihai, H., B. Jarrett, G. Kirwan. 2006. Whales, dolphins, and other marine mammals of the world. Princeton, N.J: Princeton University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sousa chinensis

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2454-09|EU557091|Sousa chinensis| AACCGATGACTATTCTCTACTAATCACAAAGACATTGGTACCCTATATTTACTATTTGGCGCTTGGGCAGGAATAGTAGGCACCGGCCTA---AGTTTGTTAATTCGTGCTGAATTAGGTCAACCTGGCACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTGACAGCTCATGCCTTCGTAATAATTTTCTTTATAGTTATACCTATCATAATTGGAGGTTTTGGGAACTGATTAGTCCCCTTAATA---ATCGGAGCTCCTGATATAGCATTCCCTCGTCTAAACAATATAAGCTTCTGACTACTCCCCCCTTCCTTTCTACTACTAATAGCATCTTCAATAATTGAGGCCGGCGCAGGTACAGGCTGAACTGTATACCCCCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTT---ACCATTTTCTCTCTACACTTAGCCGGTGTATCTTCAATCCTTGGAGCTATTAACTTCATCACAACTATTATTAATATGAAACCACCCGCTATAACTCAATATCAAACACCCCTCTTCGTCTGATCAGTCTTAGTCACAGCAGTCTTACTTTTACTATCATTACCTGTTCTAGCAGCC---GGAATTACTATACTACTAACCGATCGAAATCTAAATACAACCTTTTTCGACCCGGCAGGAGGAGGCGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGCCATCCTGAAGTATATATTTTAATTCTACCCGGCTTTGGAATAATTTCACACATCGTCACTTATTATTCAGGGAAAAAA---GAACCTTTTGGGTATATGGGAATAGTATGAGCTATAGTTTCTATTGGTTTCCTAGGTTTCATTGTATGAGCCCATCATATGTTCACAGTTGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sousa chinensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2008

Assessor/s
Reeves, R.R., Dalebout, M.L., Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J. (Cetacean Red List Authority)

Contributor/s

Justification
The total population (all ages) was estimated at about 100 individuals in the mid-2000s and the extent of occurrence is only a small stretch of coastal waters off western Taiwan (estimated to be ca. 515 km2). Given the number of development projects that are underway or proposed, and the fact that only minimal or no conservation measures are in place to reduce the probable impacts of the various threats (e.g., bycatch in net fisheries, severe reduction of freshwater flow to estuaries, land reclamation), a continuing decline in the subpopulation is projected. Although there is no prospect of obtaining a long enough time series of data to show a decline over the last three generations (about 60 years; see Taylor et al. 2007), a decline almost certainly has occurred (at least since the beginning of Taiwan’s rapid industrialization about 30 years ago) and there is no reason to believe that the causes have stopped, or even slowed. Therefore, it is reasonable to project a continuing decline and this subpopulation meets criterion C2a(ii) for Critically Endangered (total of fewer than 250 mature individuals, projected continuing decline, and at least 90% of mature individuals in a single subpopulation). This subpopulation also may meet criterion D for CR because the total number of mature individuals may be close to (or fewer than) 50 (depending partly on the value used to estimate percent mature – 60% from Jefferson (2000) or 50% from Taylor et al. (2007)).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Reeves, R.R., Dalebout, M.L., Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J. (Cetacean Red List Authority)

Contributor/s

Justification
When considering the status of the entire species Sousa chinensis (including both the chinensis-type and the plumbea-type together), the total population size probably consists of more than 10,000 mature individuals and therefore criterion C for Vulnerable would not apply (although as indicated below, it might apply to each of the two forms when assessed separately). Population reductions can be inferred over much of the species’ range due to heavy fishing pressure (incidental mortality) and habitat loss in coastal and estuarine areas. This inference is supported in some areas by either direct or indirect evidence, including observations of bycatch, interviews with fishermen, and the high and expanding levels of fishing effort with gillnets and other harmful fishing gear. It is possible that the reductions in population size have been large and pervasive enough to cause a net reduction for the entire species of at least 30% over a period of 3 generations (about 60 years; see Taylor et al. 2007) including the past and future. Therefore, the species as a whole comes close to qualifying for Vulnerable based on criterion A4cd, where subcriterion d (actual or potential levels of exploitation) is interpreted to include bycatch. Although the species may not meet any of the criteria for Vulnerable at this time, it is likely to do so in the near future (especially considering the implications of the taxonomic uncertainty described above). Therefore the species is assessed as Near Threatened, and it should be reassessed following taxonomic clarification of the two forms.

Chinensis-type
The available abundance estimates for the chinensis-type humpback dolphin range from a few dozen to over 1,200 for the few small areas of the geographic form’s range that have been studied so far (less than 10%). Although it is possible that the total population numbers in the low tens of thousands, there is no evidence to suggest there are more than that and some reason to suspect the relatively large subpopulation in the Pearl River Estuary, estimated at about 1,200-1,300 individuals, is exceptional. That subpopulation would likely have no more than about 650 mature individuals (estimated % mature = 50% - see Taylor et al. 2007; but also note that there is a direct estimate of 60% mature for that subpopulation – Jefferson 2000, implying as many as 780 mature individuals). Considering the apparently fragmented distribution, the inference of declines in most areas (due to threats as described above and that fact that conservation actions currently are either meager or non-existent in most of the range), and that there could well be fewer than 10,000 mature individuals, the chinensis-type geographic form would qualify as Vulnerable (C2a(i) and possibly also A4cd) if it were assessed separately.

Plumbea-type
All available abundance estimates for plumbea-type humpback dolphins are low (fewer than 500 individuals), and the total number across their range is unlikely to exceed 10,000 individuals. The distribution is discontinuous across most of the range, with probably discrete local subpopulations. Ongoing environmental degradation and loss of key habitats is likely further fragmenting the aggregate population. Exposure to serious environmental stressors throughout their range makes plumbea-type dolphins highly vulnerable, and there are indications of considerable declines in at least some locations. Conservation actions currently are either meager or non-existent throughout the range. It is possible that the decline of plumbea-type animals has been large and pervasive enough throughout their range to cause a net reduction of at least 30% over a period of 3 generations (about 60 years; see Taylor et al. 2007) including the past and future. The plumbea-type geographic form would qualify for Vulnerable (C2a(i) and possibly also A4cd) if it were assessed separately.

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Indo-Pacific humpbacked dolphins are listed as near threatened by the IUCN and on Appendix I by CITES. Because they live in lose proximity to the shore, they often get tangled in fishing nets and, in areas in Africa, in anti-shark nets. Destruction of habitats is most likely the greatest threat to this species. This destruction is caused by environmental contaminants and reclamation of coastal waters.

US Federal List: no special status

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

  • Van Parijs, S., J. Smith, P. Corkeron. 2002. Journal of Applied Ecology. Using Calls to Estimate the Abundance of Inshore Dolphins: A Case Study with Pacific Humpback Dolphins Sousa chinensis, 39/5: 853-864.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Native, resident?

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Data Deficient.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Rare.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1), and listed on Appendix I of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

The subpopulation was estimated to number 99 individuals (CV=51.6%) in the mid-2000s (Wang et al. 2007a). By analogy with the Pearl River Estuary subpopulation of S. chinensis, mature individuals constitute about 60% of this subpopulation (Jefferson 2000), or about 60. Using a default value of 50% percent for this species (Taylor et al. 2007), however, would suggest only about 50 mature individuals. Almost all individually recognizable dolphins were novel in 2002 but by 2004, most had been photographed in previous years (Wang et al. 2007a); the catalogue of recognizable dolphins numbered fewer than 30 at that time (J.Y. Wang pers. comm., December 2007).


Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Chinensis-type
Studies have been carried out in only a few parts of the chinensis-type’s range, and there is no overall estimate of total population size. Certain subpopulations are thought to be depleted, mostly by habitat destruction/degradation and bycatch in fisheries. Most abundance estimates have been less than a few hundred dolphins, but there appear to be at least 1,200 animals (CVs range from 17-119%) in the Pearl River Estuary of southern China, adjacent to and including Hong Kong and Macau (Jefferson 2000, Jefferson 2005). The Pearl River Estuary population is the only one for this geographic form with quantitative data on population trends, and despite the heavy development in the area and numerous threats, the population has shown no evidence of significant decline in the last 11 years (Jefferson 2005).

Other places where abundance has been estimated are Xiamen, with an estimate of 80 (CV=1.08 - Jefferson and Hung 2004), and eastern Taiwan Strait, which is thought to have a population of only about 99 individuals (CV=52% Wang et al. 2007). Declines have been inferred in both of these areas, based on qualitative environmental information. An estimated 237 (95% CI = 189-318) humpback dolphins inhabit waters around the Leizhou Peninsula, southern China (Zhou et al. 2007). Data on the status of humpback dolphins in Australia are scarce, but by analogy with sympatric (and better-studied) dugongs (Dugong dugon), Corkeron et al. (1997) suggested that they were in decline there. The only statistically defensible estimates for Australian waters are of 34-54 (CVs=13-27%) in Cleveland Bay, Queensland (Parra et al. 2006a), and 119-163 (95% CIs = 81-251) in Moreton Bay, Queensland (Corkeron et al. 1997).

Plumbea-type
As in the case of the chinensis-type, there is no overall estimate of total population size for plumbea-type dolphins. All available subpopulation estimates are in low tens to low hundreds: ~ 450 dolphins (95% CIs = 447-485) in the Algoa Bay region, Eastern Cape coast of South Africa (Karczmarski et al. 1999a), 170-244 in the Richard’s Bay region on the KwaZulu-Natal coast, South Africa (Atkins and Atkins 2002), 105 (95% CIs = 30-151) in Maputo Bay, Mozambique (Guissamulo and Cockcroft 2004), ~ 60 dolphins in Bazaruto Archipelago, Mozambique (Guissamulo and Cockcroft 1997) and 58-65 (95% CIs = 56-102) off Zanzibar (Stensland et al. 2006). Quantitative trend data are not available anywhere in the plumbea-type’s range, but there are indications that some subpopulations have declined in numbers in recent years. For instance, the numbers in the Bazaruto Archipelago decreased from ~ 60 in 1992 (Guissamulo 1993) to probably fewer than 30 in 2003, along with considerable deterioration of the shallow-water habitat across the archipelago (Guissamulo and Karczmarski pers. comm.). Mortality in anti-shark nets off the KwaZulu-Natal coast in the late 1980s was estimated to likely exceed the dolphins’ replacement rate (Cockcroft 1990), but there is no more recent information from that area. Mixing among neighbouring populations is uncertain, although in South Africa none was documented between groups inhabiting locations 800 km apart. Quantitative data are limited, but there are indications that the distribution is discontinuous elsewhere in the plumbea-type’s range, with fragmented and likely discrete populations (e.g.. Karczmarski 2000, Baldwin et al. 2004, A.T. Guissamulo pers. comm., V.G. Cockcroft pers. comm.).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats

Fisheries

This population is not known to be hunted presently but is likely to have been hunted at least opportunistically in the past. Entanglements of humpback dolphins in gillnets have been recorded in coastal waters of the Indian Ocean (Ross et al. 1994, Jefferson and Karczmarski 2001). The greatest direct and immediate source of human-caused dolphin mortality for the ETS subpopulation is probably incidental catches in fishing gear (Wang et al. 2007b). There are anecdotal records of incidental catches in trammel and other kinds of gill nets and trawls. Thousands of trammel and gill nets operate in the coastal waters of western Taiwan and this clearly represents one of the most serious threats to this subpopulation.

Habitat Degradation and Reduction

Reduction of freshwater flow and other kinds of degradation of estuaries and adjacent coastal waters (e.g. land reclamation) are almost certainly having an impact on this dolphin population, and there are continuing proposals for large-scale industrial development projects involving land reclamation (e.g., offshore wind farms, steel factory of the Formosa Plastic Group, Chinese Petroleum Company’s petrochemical factory within the animals’ restricted habitat) (Wang et al. 2004b, 2007b). Besides the physical removal of habitat, activities associated with land reclamation, such as pile-driving, can cause disturbance or even direct harm to the dolphins.

Pollution

Pollution (industrial, agricultural and residential discharge with minimal to no treatment) poses a risk to humpback dolphins via the consumption of marine prey species (Clarke et al. 2000, Parsons 2004). Spills of oil and other toxic substances by commercial ships could be catastrophic for a population so small and limited in its distribution.

Parsons (1997) estimated that a humpback dolphin in Hong Kong waters ingests up to 70,500 faecal coliforms/day (minimum) from sewage-contaminated seawater. To put this in context, a one-off ingestion rate of 200-300 coliforms is considered unacceptable for humans (Parsons 2004). Hong Kong discharges over two billion litres of sewage into its coastal waters every day. The ETS humpback dolphins live in the coastal and estuarine waters of western Taiwan where there is minimal treatment for residential and other sewage. Therefore, as in Hong Kong, a high rate of ingestion of contaminants of many kinds is to be expected, with associated concerns for the health of dolphins living in the coastal and estuarine waters of western Taiwan. In January 2008, an international group of scientists making up the Eastern Taiwan Strait Sousa Technical Advisory Working Group was established to provide expert advice and guidance on the conservation of the ETS population.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Most humpback dolphins inhabit coastal or estuarine waters of developing nations, i.e. countries with limited resources and means for environmental protection. Range-wide incidental mortality in fishing gear and habitat degradation and loss represent the greatest threats to this species throughout its range (Ross et al. 1994, Jefferson and Karczmarski 2001).

Chinensis-type
Chinensis-type dolphins are not known to be hunted directly in significant numbers anywhere in their range. However, they are often caught in fishing nets, such as gillnets and trawls, and in anti-shark nets set to protect bathing beaches from large sharks along the coasts of Queensland and New South Wales, Australia (Heinsohn 1979, Ross et al. 1994, Parra et al. 2004). Accurate catch data for humpback dolphins in the Australian nets are unavailable, but kills in anti-shark nets off Queensland are high relative to estimated abundance (Paterson 1990, Corkeron et al. 1997). The greatest direct sources of human-caused dolphin mortality in Hong Kong appear to be incidental catches in fishing gear (most likely pair trawls) and vessel collisions (Jefferson 2000, Parsons and Jefferson 2000). Between 1993 and 1998, at least 3 humpback dolphins were killed by boat strikes and another death was suspected of being caused by a boat strike. This represented 14% of all documented humpback dolphin strandings in Hong Kong during that period (Parsons and Jefferson 2000).

Concentrations of organochlorines in cetaceans from Hong Kong coastal waters are significantly higher than those found in cetaceans in other parts of the world (Parsons and Chan 1998, Minh et al. 1999) and it has been suggested that the reproductive success of Hong Kong’s humpback dolphins (including neonatal survival) is being affected (Parsons 2004; Jefferson et al. 2006). In Hong Kong, high volumes of sewage discharge and the close proximity of contaminated mud pits means that there is considerable potential for trace metal contamination of local dolphins (Parsons 1997). Indeed, mercury concentrations in the tissues of Hong Kong humpback dolphins were found to be an order of magnitude higher than in prey items and in some cases, were high enough (max: 906 µg kg-1 dry weight) to be considered potentially health-threatening (Parsons 2004). Hong Kong discharges over 2 billion litres of sewage into the surrounding waters daily. Parsons (1997) estimated that a humpback dolphin’s minimum daily intake of sewage bacteria through ingestion of contaminated seawater could be up to 70,500 faecal coliforms. To put this in context, a one-off ingestion rate of 200-300 coliforms is considered unacceptable for humans (Parsons 2004).

The disposal of contaminated mud from Hong Kong's dredging and reclamation projects poses an indirect risk to humpback dolphins via their consumption of contaminated prey (Clarke et al. 2000). Humpback dolphins inhabit the waters of several coastal ports in Asia that host large volumes of ship traffic, such as Shanghai, Singapore and Hong Kong. Therefore, it is likely that they are highly contaminated with butyltin (BT) (see Tanabe et al. 1998, Tanabe 1999; Parsons 2004).

Underwater industrial activity, such as pile-driving during pier and bridge construction, are likely to cause acoustic disturbance (e.g. the development of Hong Kong’s new airport). Boat traffic also might interfere with the dolphin’s acoustic communication (Van Parijs et al. 2001).

Plumbea-type
Their near-shore distribution and preference for shallow-water habitats make these dolphins particularly susceptible to the effects of human activities in the coastal zone – all similar to what is described above for chinensis-type animals. Habitat loss (through alteration or destruction of inshore environments) and incidental mortality in fishing gear are among the greatest threats (e.g. Baldwin et al. 1999; Cockcroft and Krohn 1994; Guissamulo 1993; 2007; Karczmarski 2000; 2002; Keith et al. 2002; Rozafindrakoto et al. 2004; Stensland et al. 2006). Deliberate killing for human consumption is known to occur in Africa and Madagascar, and at least in some areas human-caused mortality (deliberate and incidental) is likely to be close to, or even exceed, the dolphins’ reproductive rate. Other threats include coastal and offshore development, oil and gas exploration, pollution, and boat traffic (e.g. Karczmarski 2000, Baldwin et al. 2004). Oil-related deaths of dolphins have been reported from the Arabian (Persian) Gulf (Baldwin et al. 1999). Where investigated, tissue concentrations of organochlorines and other pollutants have been high (among the highest of all marine mammal species in the region), causing concern that the reproductive potential of adults and survival of neonates might be impaired (Cockcroft 1999). Behavioural responsiveness to boat harassment has been recorded in several locations (Karczmarski et al. 1998, Karczmarski 2002, Stensland et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Indo-Pacific humpback dolphins are at risk from factors that also threaten all other cetaceans, such as entanglement in fishing nets, pollution and the depletion of fish stocks worldwide (6). These coastal dolphins are also threatened by boat traffic, a factor that is especially pertinent in Hong Kong where this dolphin's habitat is also the busiest harbour in the world. In South Africa, shark nets may be an important cause of mortality but more data on this potential threat is required (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Sousa spp. are listed in Appendix I of CITES.


Efforts are being made to characterize this dolphin population and the threats it faces, and to integrate relevant information into Taiwan’s environmental impact assessment and mitigation processes (Wang et al. 2007b).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Sousa spp. Are listed in Appendix I of CITES.

For both forms, but especially the plumbea-type, conservation actions are currently either meagre or non-existent. Research is needed to help design effective conservation programmes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Information on population densities and distributions are urgently needed before an effective conservation plan can be put into action.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Indo-Pacific humpback dolphins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Indo-Pacific humpback dolphins are occasionally hunted by humans, but not on a commercial scale. They are not generally held in captivity by aquariums because of high mortality rates for captive individuals.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

IUCN Red List Category

Near Threatened (NT)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Category

subpopulation Eastern Taiwan Strait humpback dolphin : Critically Endangered (CR)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!