Articles on this page are available in 2 other languages: Spanish (29), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Description

Rough-toothed dolphins are usually seen swimming in schools of 10-20 individuals, although groups of 50 or more have been reported. They are sometimes seen cruising along at high speed, with their beaks at the surface and their dorsal fins above the water, for fairly long periods of time. They live in deep offshore waters, and knowledge of their range comes more from reports of strandings than sightings at seas. Rough-toothed dolphins have large eyes, which may enhance their vision when they make deep dives. Females are sexually mature at about the age of 10, and males at about 14. The maximum life span is thought to be about 32 years.

Links:
Mammal Species of the World
  • Original description: "Lesson, René Primevère, 1828. Histoire naturelle générale et particulière des Mammifères et des Oiseaux découverts depuis 1788 jusqu'à nos jours, Baudoin Frères, Paris, 1:206."
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Although widespread, the rough-toothed dolphin is not frequently encountered, and thus few studies have been conducted on its ecology and biology (2). Like many other dolphins, it is a sociable animal, commonly moving in groups of 10 to 20 individuals, although larger groups have also been observed, such as one consisting of up to 300 dolphins in Hawaii. In these groups, the rough-toothed dolphin has been seen with other dolphin species, as well as often associating with flotsam, the rubbish and debris found floating in the ocean (2). Often described as a sluggish or lethargic creature, the rough-toothed dolphin often swims with its chin and head above the water's surface, skimming along with a distinctive splash (2) (4). It is not the most acrobatic of dolphins, but will occasionally leap and ride the bow waves of boats (2). It feeds on a range of fish and cephalopods, with its robust, rough teeth suggesting that some particularly large fish may be eaten. Algae have also been found in the stomachs of rough-toothed dolphins, although this may have been eaten accidentally (2). It is known to dive to 70 metres to capture its prey and remain underwater for 15 minutes, although evidence suggests that this dolphin is actually capable of undertaking much deeper dives. With males reaching sexual maturity at 14 years, and females at 10 years, the rough-toothed dolphin is known to live for up to 32 to 36 years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

With a head that slopes smoothly down into a long beak, and large flippers that are set fairly far back on the body (2), this rather primitive-looking dolphin is sometimes said to be somewhat reptilian in appearance (4). Named for the subtle ridges and wrinkles on the teeth (4), the body of the rough-toothed dolphin is patterned black, white and grey. It has a white underside, mid-grey sides, and a black to dark grey back. A darker region on the back, called a cape, runs narrowly from the top of the head to behind the tall, curved-back dorsal fin, where it widens (2). The body often bears the scars of bites from cookie-cutter sharks, leaving behind white patches, splotches and spots (2). Young rough-toothed dolphins often lack these white marks, and are more subdued in colour (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Worldwide in tropical and warm temperate seas; not known to be particularly numerous anywhere. Virginia to West Indies in western Atlantic; northern California to Peru in eastern Pacific (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Atlantic: Virginia, Georgia, Florida, the Gulf of Mexico, the West Indies, and off northeastern coast of South America
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

circum-global between 40°N and 35°S
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The Rough-toothed Dolphin is a tropical to subtropical species, which generally inhabits deep, oceanic waters of all three major oceans, rarely ranging north of 40°N or south of 35°S (Jefferson 2002). However, in some areas (such as off the coast of Brazil and West Africa), rough-toothed dolphins may occur in more shallow coastal waters. They are found in many semi-enclosed bodies of water (such as the Gulf of Thailand, Red Sea, Gulf of Mexico, Caribbean Sea, and Gulf of California), but they are regarded as visitors in the Mediterranean Sea (Watkins et al. 1987, Miyazaki and Perrin 1994, Reeves and Notarbartolo di Sciara 2006).

The map shows where the species may occur based on oceanography. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states. States within the hypothetical range but for which no confirmed records exist are included in the Presence Uncertain list.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Red and Mediterranean Sea.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Rough-toothed dolphins, Steno bredanensis have a broad geographic range which ecompasses tropical and subtropical oceans. They have been frequently sighted along various coastal areas such as Kaua’i, Ni’ihau, and O’ahu of the Hawaiian Islands, the Mediterranean Sea, the Sicily Channel, Tahiti, Moorea, and the Windward Islands.

Biogeographic Regions: nearctic (Native ); oriental (Native ); ethiopian (Native ); neotropical (Native ); oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Gannier, A., K. West. 2005. Distribution of the rough-toothed dolphin (Steno bredanensis) around the Windward Islands. Pacific Science, 59, 1: 17-24.
  • Kuczaj II, S., D. Yeater. 2007. Observations of rough-toothed dolphins (Steno bredanensis) off the coast of Utila, Honduras. Journal of the Marine Biological Association of United Kingdom, 87: 141-148.
  • Ritter, F. 2007. Behavioral responses of rough-toothed dolphins to a dead newborn calf. Marine Mammal Science, 23, 2: 429-433.
  • Shirihai, H., B. Jarrett. 2006. Whales, Dolphins, and other Marine Mammals of the World. Princeton, New Jersey: Princeton University Press.
  • Watkins, W., P. Tyack, K. Moore, G. Notarbartolo-di-Sciara. 1987. Steno bredanensis in the Mediterranean Sea. Marine Mammal Science, 3: 78-82.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The rough-toothed dolphin is found in all three major oceans of the world (the Atlantic, Pacific and Indian) (2), typically between 40 degrees north and 35 degrees south (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The average adult rough-toothed dolphin reaches a length of 2 to 2.65 m and a mass of 90 to 160 kg. This species is the only dolphin species that possesses a long beak. The elongated beak is dual colored; the upper jaw is blue and gray while the lower is pale pink and white. Their colorings may vary geographically. The body of rough-toothed dolphins is dark grey with white or light colored spots on their sides. The belly, lips, and parts of the lower jaw are white. Rough-toothed dolphins have a distinctive color pattern, consisting of a dark narrow cape which passes over the eyes and arches high on the sides of the body. Some of these animals show white and yellowish scars, due to encounters with large squid, cookie-cutter sharks, other rough-toothed dolphins, and interactions with boats. Males and females are similar in appearance. However, some males can grow larger and possess a more pronounced post-anal hump and prevalent scars. Rough-toothed dolphins are commonly misidentified as bottlenose dolphins, spinner dolphins, and spotted dolphins, but closer examination of the beak, head shape, and jaw color can help distinguish these species.

Range mass: 90 to 160 kg.

Range length: 2.00 to 2.65 m.

Sexual Dimorphism: male larger

  • Carwardine, M. 1995. Whales, Dolphins and Porpoises. London: Dorling Kindersley Books.
  • 1998. "Rough-toothed Dolphin" (On-line). Hebridean Whale and Dolphin Trust. Accessed March 20, 2001 at http://www.gn.apc.org/whales/dolphin8.htm.
  • Jefferson, T. 2002. Rough-toothed dolphin Steno bredanensis. Pp. 1055-1059 in W Perrin, J Thewissen, B Wursig, eds. Encyclopedia of Marine Mammals, Vol. None, 1st Edition. San Diego: Academic Press.
  • Kays, R., D. Wilson. 2009. Mammals of North America. Princeton, New Jersey: Princeton University Press.
  • Rouch, T., S. Poss. 1998. "Species at Risk in the Gulf of Mexico Ecosystem, Steno bredanensis" (On-line). Accessed March 20, 2001 at http://lionfish.ims.usm.edu/~musweb/stenbred.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 280 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Length:
Range: 2-2.7 m males; 2-2.6 m females

Weight:
Range: 90-155 kg
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Comments: Tropical and warm temperate seas, especially far offshore in deep water; normally where sea surface temperature is above 25 C (Leatherwood and Reeves 1983). Sometimes associated with yellowfin tuna in eastern tropical Pacific.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

tropical to subtropical, oceanic
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Most often, Steno bredanensis is found in deep water far offshore, usually beyond the continental shelf (Maigret 1994), but may be seen close inshore in areas of steep bottom relief (Ritter 2002). In the eastern tropical Pacific, they tend to associate with other cetaceans (especially pilot whales and Fraser’s dolphins) (Miyazaki and Perrin 1994). Rough-toothed Dolphins feed on cephalopods and fish, including large fish such as Coryphaena hippurus (Pitman and Stinchcomb 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although rough-toothed dolphins reside in both shallow and deep ocean waters, they prefer deep waters greater than 1500 m in depth. They have been found at depths of up to 2000 m. Their location is often driven by the amount of nutrients in a given area. Rough-tooth dolphins are most commonly spotted in temperate waters. They prefer sea surface temperatures of 25 ̊C during the warm season but have been discovered during the cold season in waters ranging from 17 to 24 ̊C. Rough-toothed dolphins are rarely seen ranging north of 40 degrees latitude or south of 35 degrees latitude.

Range depth: 5 to 2000 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; reef ; coastal

  • Jefferson, T., S. Leatherwood, M. Webber. 1993. Marine Mammals of the World. Rome: Food and Agriculture Organization of the United Nations.
  • Baird, R., D. Webster, S. Mahaffy, D. McSweeney, G. Schorr, A. Ligon. 2008. Site fidelity and association patterns in a deep-water dolphin: rough-toothed dolphins (Steno bredanensis) in the Hawaiian Archipelago. Marine Mammal Science, 24, 3: 535-553.
  • West, K. 2002. Ecology and biology of the rough-toothed dolphin (Steno bredanensis). University of Hawaii Library: University of Hawaii and L'Universite' de la Polynesie Francaise.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 452 specimens in 1 taxon.
Water temperature and chemistry ranges based on 411 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 15.689 - 29.261
  Nitrate (umol/L): 0.008 - 10.051
  Salinity (PPS): 31.668 - 36.431
  Oxygen (ml/l): 4.491 - 5.820
  Phosphate (umol/l): 0.056 - 0.897
  Silicate (umol/l): 0.769 - 7.399

Graphical representation

Temperature range (°C): 15.689 - 29.261

Nitrate (umol/L): 0.008 - 10.051

Salinity (PPS): 31.668 - 36.431

Oxygen (ml/l): 4.491 - 5.820

Phosphate (umol/l): 0.056 - 0.897

Silicate (umol/l): 0.769 - 7.399
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This dolphin inhabits tropical and warm temperate waters (2), usually measuring over 25 degrees Celsius (5), where it is generally found in deep, offshore waters (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Eats pelagic octopus, squids, and various fishes (Leatherwood and Reeves 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

The diet of carnivorous rough-toothed dolphins includes silverside, saury, needlefish, mahimahi, and squid. Their preference, however, is mahimahi. Rough-toothed dolphins are excellent divers and are known to dive to great depths in search of cephalopods and large fish. They chase their prey and toss it around with their beaks. As their common name suggests, they have rough teeth, which allow them to tear apart their prey. Rough-toothed dolphins forage in groups of 3 to 5 for predator efficiency, and they share their meals. Members of this species are also known to forage on "bait balls" of schooling fish.

Animal Foods: fish; mollusks

Primary Diet: carnivore (Piscivore , Molluscivore )

  • Pitman, R., C. Stinchcomb. 2002. Rough-toothed dolphins (Steno bredanensis) as predators of mahimahi (Coryphaena hippurus). Pacific Science, 56, 4: 447-450.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Rough-toothed dolphins help regulate adult populations of mahimahi. They also host a variety of parasites. Larvae and adult Anisakis have been found in their stomach, causing ulcers, internal bleeding, and gastritis. These nematodes may be transmitted by the sharing of food among dolphins and this parasite species' dependence upon various intermediate hosts. Several helminth parasites can also infect the intestines of rough-toothed dolphins, including the cestode Tetrabothrius forsteri. Several trematodes also parasitize rough-nosed dolphins, including Campula palliate in the liver and bile duct, Pholeter gastrophilus in the forestomach, and Synthesium tursionis in the intestines.

Commensal/Parasitic Species:

  • Carvalho, V., C. Bevilaqua, A. Iniguez, H. Mathews-Cascon, F. Ribeiro, L. Pessoa, A. Meirelles, J. Borges, J. Marigo, L. Soares, F. Silva. 2010. Metazoan parasites of cetaceans off the northeastern coast of Brazil. Veterinary Parasitology, 173: 116-122.
  • Forrester, D., D. Robertson. 1975. Helminths of rough-toothed dolphins, Steno bredanensis lesson 1828, from Florida waters. The Journal of Parasitology, 61, 5: 922.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Currently, there are no known predators of rough-toothed dolphins other than humans. Although they have been found with scars from bites of cookie-cutter sharks, there is no record of this species being consumed by a shark. Rough-tooth dolphins are, however, incidentally caught in fishing nets. Some humans eat this species of dolphin.

Known Predators:

  • Monteiro-Neto, C., T. Teixeira Alves-Junior, F. Capibaribe Avila, A. Alves Campos, A. Fernandes Costa, C. Pereira Negrao Silva, M. Andrade Furtado-Neto. 2000. Impact of fisheries on the tucuxi (Sotalia fluviatilis) and rough-toothed dolphin (Steno bredanensis) populations off Ceara state, northeastern Brazil. Aquatic Mammals, 26, 1: 49-56.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Sometimes observed in groups, usually 50 or fewer (Leatherwood and Reeves 1983); average group size was 6 in U.S. waters (see IUCN 1991). Single and mass strandings sometimes occur.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Rough-toothed dolphins communicate with other dolphins through echolocation clicks, whistles, burst pulse signals, and synchronous swimming patterns. Echolocation clicks help provide a sense of location, directionality, and with identifying objects. Burst pulse signals, which can be heard by the human ear, can be social or reinforce echolocation functions. Whistles are used socially among dolphins. Rough-toothed dolphins often travel in a close school with either synchronous or asynchronous swimming patterns. In the group of synchronous dolphins, a single dolphin produces higher frequency echolocation calls than the rest of the group. Rough-toothed dolphins are also found traveling alone, and these dolphins produce lower frequency echolocation calls.

Communication Channels: tactile ; acoustic

Perception Channels: acoustic ; ultrasound ; echolocation

  • Gotz, T., U. VerfuB, H. Schnitzler. 2006. 'Eavesdropping' in wild rough-toothed dolphins (Steno bredanensis)?. Biology Letters, 2: 5-7.
  • Oswald, J., S. Rankin, J. Barlow, M. Lammers. 2007. A tool for real-time acoustic species identification of delphinid whistles. Acoustical Society of America, 122, no. 1: 587-595.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Rough-toothed dolphins off the coast of Japan can live to be 32 to 36 years of age, though it is presumed that members of this species may live considerably longer. The oldest individual was estimated to be 48 years old and was found stranded from the Florida coast. The longest lived individual in captivity, however, was only 12 years of age.

Range lifespan

Status: wild:
32 to 48 years.

Range lifespan

Status: captivity:
12 (high) years.

Average lifespan

Status: wild:
32.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32 years (wild) Observations: Maximum longevity could be underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In the western North Pacific, average age of mature males was 14 years, average age of mature females was 10 years; maximum age 30-32 years (see IUCN 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little information is available regarding the mating systems of rough-toothed dolphins in the wild.

The reproductive habits of rough-toothed dolphins are not well known, though captive studies provide some information. At birth, rough-toothed dolphins measure 1 to 1.3 m in length. Calves attempt to nurse within an hour of birth, but are initially unsuccessful, unable to connect to their mother’s mammary slits. Within the first 3 days, calves can successfully nurse, which takes place underwater and occurs throughout the day. Calves nurse, rest, and play on a daily basis. Play time generally follows nursing and includes exploration to the surface while staying in close proximity to the mother. Calves rest around midday for about 60 minutes. At 2 months of age, calves begin to eat fish and decrease nursing time.

Rough-toothed dolphins exhibit sexual dimorphism, and mature males are longer than mature females. In both sexes, the most rapid growth occurs in the first 5 years. Females reach sexual maturity at 9 to 10 years of age at a length of 212 to 217 cm and a weight of 101 to 108 kg. Males reach sexual maturity at 5 to 10 years of age at a length of about 216 cm and a weight of 92 to 102 kg.

Range weaning age: 2 (low) months.

Range age at sexual or reproductive maturity (female): 9 to 10 years.

Range age at sexual or reproductive maturity (male): 5 to 10 years.

Key Reproductive Features: gonochoric/gonochoristic/dioecious (sexes separate); viviparous

In captivity, female rough-toothed dolphins protect their calves by swimming in close proximity to their young and positioning themselves between the calf and other dolphins. The length of the mother-calf relationship is unknown. A female rough-toothed dolphin, presumed to be the mother, was observed supporting a dead calf at water's surface for several days. During this time, she was escorted and protected by a number of male rough-toothed dolphins. This may demonstrate a prolonged mother-calf association in rough-toothed dolphins. Such behavior has been observed in the tight social groups of other marine mammals.

Parental Investment: precocial ; female parental care ; pre-hatching/birth (Provisioning: Female); pre-weaning/fledging (Provisioning: Female); pre-independence (Provisioning: Female)

  • 1998. "Rough-toothed Dolphin" (On-line). Hebridean Whale and Dolphin Trust. Accessed March 20, 2001 at http://www.gn.apc.org/whales/dolphin8.htm.
  • Dohl, T., K. Norris, I. Kang. 1974. A Porpoise Hybrid: Tursiops X Steno. Journal of Mammalogy, 55, 1: 217-221.
  • Jefferson, T. 2002. Rough-toothed dolphin Steno bredanensis. Pp. 1055-1059 in W Perrin, J Thewissen, B Wursig, eds. Encyclopedia of Marine Mammals, Vol. None, 1st Edition. San Diego: Academic Press.
  • Kuczaj II, S., D. Yeater. 2007. Observations of rough-toothed dolphins (Steno bredanensis) off the coast of Utila, Honduras. Journal of the Marine Biological Association of United Kingdom, 87: 141-148.
  • Lodi, L. 1992. Epimeletic behavior of free-ranging rough-toothed dolphins, Steno bredanensis, from Brazil. Marine Mammal Science, 8, 3: 284-287.
  • Ritter, F. 2007. Behavioral responses of rough-toothed dolphins to a dead newborn calf. Marine Mammal Science, 23, 2: 429-433.
  • West, K. 2002. Ecology and biology of the rough-toothed dolphin (Steno bredanensis). University of Hawaii Library: University of Hawaii and L'Universite' de la Polynesie Francaise.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Steno bredanensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GGCACTGGTCTAAGCTTGTTGATTCGTGCCGAATTAGGTCAACCTGGTACACTTATCGGAGAC---GACCAGCTTTATAATGTTCTAGTAACAGCTCATGCTTTCGTAATAATCTTCTTTATAGTTATGCCTATCATAATTGGGGGTTTCGGGAACTGATTAGTTCCTTTGATAATCGGAGCCCCTGATATAGCATTCCCTCGTCTAAACAACATAAGCTTCTGACTACTCCCCCCTTCATTTCTACTACTGATAGCATCTTCGATAGTTGAAGCCGGCGCAGGTACAGGCTGAACTGTATATCCTCCTCTAGCCGGAAATCTAGCACATGCAGGAGCCTCAGTAGACCTTACTATTTTCTCTCTACATTTAGCCGGTGTGTCTTCAATCCTTGGGGCTATTAACTTCATTACAACTATTATTAATATAAAACCACCTGCTATAACCCAATACCAAACACCTCTCTTCGTCTGATCTGTCTTGGTCACAGCAGTCCTACTTTTACTATCATTACCTGTCTTAGCAGCCGGAATTACTATACTATTAACTGACCGAAATCTAAATACAACCTTTTTCGACCCGGCAGGAGGAGGTGACCCAATCTTATATCAACACTTATTCTGATTTTTTGGTCACCCTGAAGTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Steno bredanensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NU - Unrankable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K.A., Karkzmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y. , Wells, R.S. & Wilson, B.

Reviewer/s
Rojas-Bracho, L. & Smith, B.D.

Contributor/s

Justification
The species is widespread and abundant (with current population estimates around 150,000) and there have been no reported population declines or major threats identified.

History
  • 1996
    Data Deficient
  • 1994
    Insufficiently Known
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although listed as a species of list concern on the ICUN Red List, Steno bredanensis is experiencing an increase in mortality rate. Fisheries along the coast of Ceara, Brazil incidentally catch rough-toothed dolphins in gill nets. Individuals caught in gill nets are thrown overboard or used as bait for sharks. Small numbers of rough-toothed dolphins are targeted as food for humans by direct and drive fisheries, located in the West Indies, West Africa, Japan, and the Solomon Islands. Habitat destruction due to anthropogenic disturbances also threaten populations of this species.

Severe to profound hearing loss was found in 5 out of 14 rough-toothed dolphins stranded or entangled in fishing gear from 2004-2009. Hearing loss in marine mammals is contributed to five factors: congenital genetic factors, intense chronic noise from boats, old age, intense noises such as explosions, and ototoxic drug treatments that are administered during rehabilitation from dolphin strands. Hearing loss in 2 out of the 5 rough-toothed dolphins affected was contributed to genetic factors because they were young dolphins.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Mann, D., M. Hill-Cook, C. Manire, D. Greenhow, E. Montie, J. Powell, R. Wells, G. Bauer, P. Cunningham-Smith, R. Lingenfelser, R. DiGiovanni, A. Stone, M. Brodsky, R. Stevens, G. Kieffer, P. Hoetjes. 2010. Hearing loss in stranded odontocete dolphins and whales. PLoS ONE, 5 (11) e 13824: 1-5.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Accidental?

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
There are few estimates of abundance for this species. An estimated 145,900 (CV=32%) Rough-toothed Dolphins inhabit the eastern tropical Pacific (Wade and Gerrodette 1993), and about 2,746 (CV=36%) occur in the northern Gulf of Mexico (Waring et al. 2008), including an estimated 1,238 (CV=65%) on the continental shelf (Fulling et al. 2003). The US NMFS has estimated the regional population around Hawaii to be 19,904 (CV=52%), based on recent vessel surveys (Carretta et al. 2006).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Apparently not taken in large numbers incidental to fisheries, though the level of incidental take in pelagic driftnet fisheries is unknown (IUCN 1991). More information on population size and incidental and direct harvest is needed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
No fisheries are known to specifically target this species, but small numbers are taken in drive fisheries at Okinawa in the Ryukyus and other islands of Japan, the Solomon Islands and Papua New Guinea, by harpoon in Japan, St. Vincent in the Lesser Antilles, and in West Africa. They were possibly formerly were taken at St. Helena in the South Atlantic. However, only 23 Rough-toothed Dolphins were captured in Japan (Okinawa) during the period 1976-81 (Miyazaki and Perrin 1994). Recent information suggests catches in Taiwan (J. Wang pers. comm.).

A few Rough-toothed Dolphins are killed incidentally in tuna purse seines in the eastern tropical Pacific: 21 were estimated killed during the period 1971-75 and 36 died in a single net haul in 1982. Small numbers are also taken as by-catch in gillnet and driftnet fisheries in Sri Lanka, Brazil, the central North Pacific and probably elsewhere around the world in tropical and warm-temperate waters (Miyazaki and Perrin 1994). Monteiro-Neto et al. (2000) reported on fishery-related mortality along the coast of Ceara State, northeast Brazil, commenting on the possible conservation implications for the local subpopulations. Seasonally, incidental catches were more frequent during the austral spring (October-December). Rough-toothed Dolphins are also taken by gill nets, driftnets and pelagic long-lines in Taiwan (J. Wang pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The greatest threat to the rough-toothed dolphin is likely to be incidental capture in fishing nets (2). While this dolphin is directly hunted in several areas for its meat (5), including Japan, Sri Lanka, Indonesia, the Solomon Islands and Papua New Guinea (2), relatively small numbers are taken (6), and as it inhabits offshore waters, it is unlikely to be affected by habitat degradation and pollution to the same extent that coastal-dwelling dolphins are (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is listed in Appendix II of CITES.

The biology, life history, population size, and separation into subpopulations, as well as migratory behaviour are insufficiently known. Research on this species should be encouraged.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The rough-toothed dolphin is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that any trade in this species should be carefully monitored (3). This dolphin is also held in captivity in a number of countries where, incidentally, they have been found to be bold and inventive animals (2). Studies of the rough-toothed dolphin in captivity may allow knowledge of this species' biology to be furthered (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Small numbers are taken for human consumption in the western and southwestern Pacific and West Africa (IUCN 1991). Has been kept successfully in captivity for display purposes (Tomich 1986).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of rough-toothed dolphins on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Steno bredanensis individuals are caught and consumed by humans in the West Indies, West Africa, Japan, and the Solomon Islands.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Least Concern (LC)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Rough-toothed dolphin

The rough-toothed dolphin (Steno bredanensis) is a species of dolphin that can be found in deep warm and tropical waters around the world.

The species was first described by Georges Cuvier in 1823. The genus name Steno, of which this species is the only member, comes from the Greek for 'narrow', referring to the animal's beak — which is a diagnostic characteristic of the species. The specific name honours van Breda, who studied Cuvier's writings. There are no recognised subspecies.

Physical description[edit]

The rough-toothed dolphin is a relatively large species, with adults ranging from 2.09 to 2.83 metres (6.9 to 9.3 ft) in length, and weighing between 90 and 155 kilograms (198 and 342 lb); males are larger than females. Its most visible characteristic feature is its conical head and slender nose; other dolphins either have a shorter snout or a more visibly bulging melon on the forehead. As the common name for the species implies, the teeth are also distinctive, having a roughened surface formed by numerous narrow irregular ridges. They have been reported to have between nineteen and twenty-eight teeth in each quarter of the jaw.[2]

The flippers are set back further along the body than in other similar dolphins, although, at sea this dolphin may be confused with spinner, spotted and bottlenose dolphins. The dorsal fin is pronounced, being from 18 to 28 centimetres (7.1 to 11.0 in) in height. The animal's flanks are a light gray, while the back and dorsal fin are a much darker gray. Older individuals often have distinctive pinkish, yellow, or white markings around the mouth and along the underside.[2]

Population and distribution[edit]

The distribution and population of the Rough-toothed Dolphin is poorly understood. They inhabit the Pacific, Atlantic, and Indian Oceans, and in the Mediterranean Sea, in warm temperate to tropical waters, with occasional reports from cooler environments. Live sightings are almost universally made far off-shore,[citation needed] beyond the continental shelf, in water at least 1 kilometre (0.62 mi) deep.[3]

Most of the research activity concerning the dolphin has been directed in the eastern Pacific, where a population estimate of 150,000 has been obtained.[by whom?] Fossils belonging to the genus Steno are known from Europe and date to the early to mid Pliocene.[2]

Behaviour and diet[edit]

Rough-toothed dolphins are typically social animals, although solitary individuals are also sighted.[3] An average group has between ten and twenty members, but they can vary from as few as two to as many as ninety.[4][5] Such groups are thought to be temporary assemblages, composed of smaller, more permanent groups of two to eight closely related individuals that occasionally join together with others.[6] They have also been reported to school together with other species of dolphin, and with pilot whales, false killer whales, and humpback whales.

Rough-toothed dolphins have been reported to bow-ride on a number of occasions,[4][5][6] although apparently they do not do so as frequently as many other dolphin species.[2] They do, however, commonly "skim", by swimming with their heads and chin above the surface of the water. They are known to be able to dive to at least 50 metres (160 ft)[7] and be able to stay underwater for at least fifteen minutes.[2] Their echolocation clicks are unusually brief, lasting no more than 0.2 seconds, and have a relatively low frequency, ranging from 2.7 to 256 kHz, with a maximum peak frequency of 25 kHz. They also make longer whistles with a frequency between 3 and 12 kHz.[2][7]

Although details of their diet are sketchy, the stomach contents of stranded dolphins have included such fish such as silversides, sauries, houndfish, smelts, cutlassfish, and various squid and octopuses. Predators on rough-toothed dolphins are thought to include killer whales and sharks.[2]

Reproduction[edit]

Rough-toothed dolphins give birth to a single young, after an unknown period of gestation; it is also unknown whether or not they have a distinct breeding season. The young are about 100 centimetres (39 in) long at birth, and grow rapidly for the first five years of life. Females reach sexual maturity somewhere between six[8] and ten[2] years of age, and males between five and ten years.[2]

Conservation[edit]

The population is not believed to be threatened by human activities. A small number of individuals have been harpooned by Japanese whalers. Others have been caught in seine nets by trawlers fishing for tuna. They adapt well to captivity and have proven to be intelligent and creative. Less than a dozen rough-toothed dolphins live in dolphinaria around the world.[citation needed] The Rough-toothed dolphin is covered by the Agreement on the Conservation of Small Cetaceans of the Baltic, North East Atlantic, Irish and North Seas (ASCOBANS) and the Agreement on the Conservation of Cetaceans in the Black Sea, Mediterranean Sea and Contiguous Atlantic Area (ACCOBAMS). The species is further included in the Memorandum of Understanding Concerning the Conservation of the Manatee and Small Cetaceans of Western Africa and Macaronesia (Western African Aquatic Mammals MoU) and the Memorandum of Understanding for the Conservation of Cetaceans and Their Habitats in the Pacific Islands Region (Pacific Cetaceans MoU)

See also[edit]

References[edit]

  1. ^ Hammond, P.S., Bearzi, G., Bjørge, A., Forney, K., Karczmarski, L., Kasuya, T., Perrin, W.F., Scott, M.D., Wang, J.Y., Wells, R.S. & Wilson, B. (2008). "Steno bredanensis". IUCN Red List of Threatened Species. Version 2012.2. International Union for Conservation of Nature. Retrieved 18 January 2013. 
  2. ^ a b c d e f g h i West, K.L., et al. (2011). "Steno bredanensis (Cetacea: Delphinidae)". Mammalian Species 43 (1): 177–189. doi:10.1644/886.1. 
  3. ^ a b Gannier, A. & West, K.L. (2005). "Distribution of the rough-toothed dolphin (Steno bredanensis) around the Windward Islands (French Polynesia)". Pacific Science 59 (1): 17–24. doi:10.1353/psc.2005.0007. 
  4. ^ a b Baird, R.W. et al. (2008). "Site fidelity and association patterns in a deep-water dolphin: Rough-toothed dolphins (Steno bredanensis) in the Hawaiian Archipelago". Marine Mammal Science 24 (3): 535–663. doi:10.1111/j.1748-7692.2008.00201.x. 
  5. ^ a b Ritter, F. (2002). "Behavioral observations of rough-toothed dolphins (Steno bredanensis) off La Gomera, Canary Islands (1995–2000), with special reference to their interactions with humans". Aquatic Mammals 28 (1): 46–59. 
  6. ^ a b Kuczaj, S.A. & Yeater, D.B. (2007). "Observations of rough-toothed dolphins (Steno bredanensis) off the coast of Utila, Honduras". Journal of the Marine Biological Association of the United Kingdom 87 (1): 141–148. doi:10.1017/S0025315407054999. 
  7. ^ a b Watkins, W.A. et al. (1987). "Steno bredanensis in the Mediterranean Sea". Marine Mammal Science 3 (1): 78–82. doi:10.1111/j.1748-7692.1987.tb00152.x. 
  8. ^ Siciliano, S., et al. (2007). "Age and growth of some delphinids in south-eastern Brazil". Journal of the Marine Biological Association of the United Kingdom 87 (1): 293–303. doi:10.1017/S0025315407053398. 
  • Steno bredanensis pp. 269–280, by J Maigret in Handbuch der Säugetiere Europas. Band 6: Meeressäuger Teil 1A: Wale und Delphine 1 Niethammer J, Krapp F, (Eds.) (1995).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!