The species is endemic to coastal waters of eastern South America. Although it is found mainly in marine waters and only occasionally in estuaries, it is relatively common in the Uruguayan part of the La Plata River estuary (Praderi 1986). The Franciscana is generally found in turbid waters less than 30 m deep (Pinedo et al. 1989, Secchi and Ott 2000) where it feeds mainly on demersal fish species (e.g., Brownell 1989, Di Beneditto and Ramos 2001, Rodriguez et al. 2002, see Danilewicz et al. 2002 for a comprehensive review). It does not appear to undergo large seasonal migrations and little is known about daily movements (Bordino et al. 1999, Bordino 2002).

Although sometimes described as a ‘river dolphin’, the franciscana is not a freshwater species. Franciscanas apparently do not migrate, although seasonal inshore/offshore movements have been documented in some areas (Bordino et al. 1999, Bordino 2002). Predation by both large sharks and killer whales has been documented (Praderi 1985; Ott and Danilewicz 1996; Santos and Netto 2005).

Franciscanas are generally found in turbid waters et al. 1989, Secchi and Ott 2000). Although they are found mainly in marine waters and only occasionally in estuaries, they are relatively common in the Uruguayan part of the La Plata River estuary (Praderi 1986). Franciscanas are primarily coastal, ranging no farther offshore than the 30 m isobath. Some sightings have been made in waters seaward of the 50 m isobath and 55 km offshore, but the density offshore is very low.

Franciscanas feed on several species of shallow-water fish (e.g., sciaenids, engraulids, gadids, and carangids), cephalopods, and crustaceans (Brownell 1989; Di Beneditto and Ramos 2001; Rodriguez et al. 2002; Danilewicz et al. 2002).

GBMA0128-06|AJ554060|Pontoporia blainvillei| AACCGCTGATTATTCTCAACAAACCACAAAGATATTGGAACTCTATATCTACTATTCGGTGCTTGAGCAGGAATAGTGGGCACCGGCCTA---AGTCTATTAATCCGCGCAGAACTTGGACAGCCCGGCACATTACTCGGAGAT---GATCAAATCTACAACGTATTAGTAACAGCCCACGCCTTTGTAATAATTTTCTTTATGGTTATGCCCATTATAATTGGTGGATTCGGAAACTGACTAGTCCCACTGATA---ATTGGAGCCCCTGACATAGCCTTTCCCCGCCTAAACAACATAAGCTTCTGATTACTTCCCCCTTCCTTCCTACTACTGATAGCATCCTCCATGGTCGAATCCGGTGCAGGCACTGGCTGAACAGTATATCCCCCTCTAGCCGGAAACCTAGCACATGCGGGAGCTTCCGTAGACCTC---ACCATTTTCTCTCTCCACTTAGCAGGAGTATCCTCAATCCTCGGAGCCATTAACTTCATTACAACTATTATCAACATAAAACCCCCTGCCATAACCCAATATCAAACTCCCCTTTTCGTATGATCTATTTTAATCACAGCTATACTACTCCTACTGTCCCTACCCGTCTTAGCAGCT---GGAATTACTATACTATTGACCGACCGAGATCTAAACACAACATTCTTCGATCCCGCAGGAGGAGGAGACCCTATCCTATACCAACACCTGTTCTGATTTTTTGGTCATCCCGAAGTGTATATCCTGATTCTACCCGGTTTTGGAATGATTTCACATATTGTAACTTACTACTCAGGAAAAAAA---GAACCTTTCGGATATATGGGGATAGTCTGAGCTATAATCTCTATCGGATTCCTAGGCTTTATCGTATGAGCCCACCATATATTTACAGTCGGAATAG 
-- end --

Red List Category

Red List Criteria

Version

2003

Secchi, E.R. & Wang, J.Y.

Reeves, R.R., Taylor, B. & Perrin, W.F. (Cetacean Red List Authority)

Although it has been, and remains, a major challenge to obtain quantitative data for proper population assessment, there is reason to believe that the Franciscana is threatened throughout its range, and particularly in areas of intensive gillnet fishing. As stated in the IUCN cetacean action plan, the Franciscana "may be at greater risk of extinction than any other cetacean species in the western South Atlantic," and "the greatest immediate requirement" for its conservation is "to reduce levels of incidental mortality in gillnets" (Reeves et al. 2003). Simulations of the Rio Grande do Sul/Uruguay (hereafter RS/URU) subpopulation using a plausible range of assumed rates of increase and an estimated removal rate based on available abundance and bycatch data suggest a decline over three generations of close to 50%, which would meet the decline threshold for EN under criterion A. The suspected reduction in population size and its causes may not have ceased (subcriterion A2), based on actual or potential levels of exploitation (in the form of bycatch) (subcriterion d under A1). Two other lines of evidence (indices) can be interpreted as corroborative of a marked decline in abundance of this subpopulation: (1) a decline of approximately 71% in the bycatch of franciscanas per unit of fishing effort was reported in Uruguay from the 1960s to 1980s; and (2) stranding rates of franciscanas in southern Brazil decreased by nearly 70% between the 1970s and 1990s. The Cetacean Specialist Group, having reviewed the data and analyses presented by the assessors (and see Secchi and Wang 2002), was reluctant to recommend EN status at this time (May 2003). Instead, it was agreed to recommend VU status, on the understanding that a reassessment and re-evaluation would be conducted in the near future, taking into account newly obtained data on abundance and bycatch, and perhaps treating the existing evidence with somewhat more elaborate statistical methods. Consultation and Peer Review: Information included as supporting documentation for this assessment was discussed with participants at the 4th Workshop for the Coordination of Research and Conservation of Franciscana in the Western South Atlantic (held in Porto Alegre, Brazil, in 2000). That group discussed progress on Franciscana research and expressed support for the need to change the IUCN Red List status of this species. This documentation was drafted principally by Eduardo Secchi and John Wang, and their work was edited and revised by Randall Reeves following extensive review by the membership of the Cetacean Specialist Group prior to submission to IUCN. For further details, see Secchi and Wang (2002).

Red List Category

Red List Criteria

Version

2008

Reeves, R.R., Dalebout, M.L., Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y., Zerbini, A.N. & Zhou, K.

Brownell Jr., R.L. & Cooke, J. (Cetacean Red List Authority)

Justification

History

• 1996
  Data Deficient
  (Baillie and Groombridge 1996)
• 1994
  Insufficiently Known
  (Groombridge 1994)
• 1990
  Insufficiently Known
  (IUCN 1990)
• 1988
  Insufficiently Known
  (IUCN Conservation Monitoring Centre 1988)

There is no current abundance estimate for the species as a whole, but there is an estimate for the management stock inhabiting FMA III (hereafter referred as the RS/URU population). Thirty-four franciscanas (in 29 groups) were recorded during aerial surveys of coastal waters of Rio Grande do Sul State in 1996, giving a mean density of 0.657 individuals/sq. km (95% CI 0.516?0.836) for the 435 sq. km study area after correcting for the probability of missing submerged dolphins (Secchi et al. 2001). Extrapolating this density to the entire stock?s range resulted in an estimate of 42,078 franciscanas (95% CI 33,047?53,542). This extrapolated result must be used very cautiously, however, because it is based on a density estimate for only a small fraction of the coastline, representing approximately 0.7% of the possible range of the population (ca. 64,045 sq. km), and there is limited information on the distribution pattern of franciscanas within their total range.

During the Cetacean Specialist Group's technical review of this proposal, it was noted that the abundance estimate was likely negatively biased because, as the authors acknowledged, it was not corrected for perception bias. It was also noted during the review, however, that the survey was conducted in an area considered to have a relatively high density of franciscanas, and therefore extrapolation of the observed survey density to the entire range of the population likely would positively bias the estimate. Moreover, for financial and logistical reasons, it may be unrealistic to expect more precise or accurate abundance estimates for this population in the foreseeable future.

With those cautions and reservations, it is reasonable to consider the figure of 42,000 as a useful approximation of abundance.

Decreasing

Morphological and molecular data strongly support the existence of two main subpopulations of franciscanas. Multivariate analysis of morphometric data revealed two subpopulations: a smaller form in the northern part of the species' range (north of 27°S) (those in the far north are of intermediate size) and a larger form in the coastal waters of southern Brazil, Uruguay and Argentina (south of 27°S) (Pinedo 1991). Analyses of a highly variable region of mitochondrial DNA (mtDNA) also supported these two geographic forms (Secchi et al. 1998). Ott (2002) and Lázaro et al. (2004) compared the mtDNA of franciscanas from Uruguay and Argentina with those published by Secchi et al. (1998). These studies found support for the existence of a large southern population (composed of animals from Rio Grande do Sul, Uruguay and northern Argentina) that is clearly differentiated from animals in the waters off Rio de Janeiro. In addition, they revealed fixed genetic differences between the populations that suggest essentially no effective genetic exchange (see Secchi et al. 1998; Ott 2002; Lázaro et al. 2004). Ott’s results also clearly showed that individuals inhabiting Paraná and São Paulo waters belong to a genetically distinct subpopulation. This is consistent with morphological data showing that size is not clinal, with animals from Paraná and São Paulo being smaller than those in adjacent populations to the south and north of those States (e.g.. Kasuya and Brownell, 1979; Di Beneditto and Ramos, 2001; Barreto and Rosas, 2006; Barbato et al., 2007) A pairwise analysis of haplotype distances between different geographic locations showed increasing differentiation in the haplotype frequencies with increasing distance, following an isolation-by-distance pattern (Lázaro et al. 2004). Furthermore, recent analysis indicated that haplotype frequencies of samples from Claromecó (in Argentina) were significantly different from those of the rest of the southern population (Ott 2002; Lázaro et al. 2004).

Secchi et al. (2003a) proposed four provisional management units (Franciscana Management Areas, or FMAs) with the following ranges: FMA I - coastal waters of Espírito Santo and Rio de Janeiro states, Brazil (note: confirmation of the hiatus in the Espírito Santo State with increased survey effort will require further division of this FMA); FMA II - São Paulo, Paraná and Santa Catarina states, Brazil; FMA III - coastal waters of Rio Grande do Sul State, southern Brazil and Uruguay; and FMA IV - coastal waters of Argentina, including the provinces of Buenos Aires, Rio Negro and Chubut.

There is no current abundance estimate for the species as a whole, but there is an estimate for the management stock inhabiting FMA III (hereafter referred as the RS/URU management unit). During aerial surveys of coastal waters of Rio Grande do Sul State in 1996 (Secchi et al. 2001), this stock’s abundance was estimated at 42,078 (95% CI 33,047-53,542). This extrapolated result must be used very cautiously, however, because it is based on a density estimate for only a small fraction of the coastline, representing approximately 0.7% of the possible range of the subpopulation (ca. 64,045 sq. km), and there is limited information on the distribution pattern of franciscanas within their total range. This and other estimates of franciscana density and abundance need to be interpreted cautiously as they could be either positively or negatively biased. The IWC Scientific Committee concluded, after reviewing the methods and limitations of franciscana surveys through 2003-2004, that it was not appropriate to consider them as providing minimum estimates of abundance (IWC 2005a).

While the overall abundance of the species would seem relatively high, in most areas the gillnet mortality alone is not thought to be sustainable. Secchi (2006) projected the four management units 25 years into the future based on a stage-structured matrix model using a variety of scenarios of fishing effort. Because there were estimates of franciscana density and abundance only for FMA III and IV (Secchi et al. 2001; Crespo et al. 2004), Secchi (2006) used the density estimated for FMA III ( ) and applied a correction factor based on the ratio of capture per unit of effort (CPUE) between the other areas and FMA III. This was assumed to represent a valid index of abundance because the unit of fishing effort is the same and the fishing gears are similar among management units. The corrected densities were multiplied by the entire area of both FMA I and II to obtain the estimate of total abundance. Uncertainty in the parameter estimates was incorporated through appropriate probability distributions. The scenarios considered most realistic (i.e. those that aimed to compensate for underestimation of the bycatch and that modelled environmental stochasticity) resulted in relatively high probabilities that each management unit would decline by at least 30% below its initial size with the exception of FMA I. However, it should be noted that estimates of bycatch in FMA I come from only one fishing village and it is known that bycatch occurs in other parts of this FMA (e.g. Freitas-Neto and Barbosa 2003).

The modelling exercise described above is considered to underestimate the risk of decline of franciscanas. The most recent data on bycatch (e.g. Rosas et al. 2002; Bordino and Albareda 2005; A. Zerbini as summarized in IWC 2005b) indicate that the numbers caught annually in FMAs II and IV are roughly twice as high as the values used by Secchi (2006) in his projections. In addition, other sources of potential threat (risk factors, as described in the Threats section below) were not considered in Secchi’s study.

Decreasing

Important Anthropogenic Threats:

Incidental mortality in gillnet fisheries
Mortality from incidental entanglement in gillnets is by far the greatest threat to the RS/URU subpopulation (there is no indication of direct exploitation of franciscanas). Incidental mortality ("bycatch") in the shark gillnet fisheries of Punta del Diablo, Uruguay, dates to the early 1940s (Van Erp 1969) and although gillnetting in southern Brazil also began around that time (Haimovici et al. 1997), gillnet fisheries for bottom-dwelling fish were only documented as a major threat to franciscanas in the 1980s. Bycatch has since been reported from the main fishing villages along most of the population's distribution (e.g., Moreno et al. 1997, Praderi 1997, Secchi et al. 1997, Ott et al. 2000, 2002). In Uruguay, Praderi (1997) estimated that at least 3,683 dolphins were killed between 1974 and 1994. The highest and lowest annual estimates were 418 and 66 dolphins caught in 1974 and 1994, respectively. The bycatch was even higher prior to this period. In the late 1960s, the annual bycatch was estimated to be as high as 1,500-2,000 animals (Brownell and Ness 1970, Pilleri 1971). Large-mesh nets targeting sharks were responsible for about 70-90% of the kills (e.g., Praderi 1997, 2000). Depletion of the target shark species led to a drop in the fishing effort using these nets from almost 100% of the total gillnet effort in the 1960s and 1970s to 75% in the early 1980s and only 20% in the mid 1990s. These changes in the Uruguayan coastal fishery may have had a beneficial effect on the recovery of the Franciscana (Praderi 1997) although small-mesh gillnets, which are known to be responsible for a large bycatch of franciscanas in southern Brazil, are currently known to be used in Uruguay to catch sciaenids in nearshore waters where franciscanas occur. Recent and current data on bycatch from Uruguay are unreliable for a number of reasons (e.g., inadequate monitoring of the gillnet fisheries). According to Praderi (2000), the records of mortality are less reliable than they were in the past because Uruguayan fishermen now have a legal disincentive for bringing bycaught franciscanas to land. Specifically, he notes: ".. the number of bycatch is currently limited to information provided by fishermen, who tend to lower the number of franciscanas killed in their reports, fearing sanctions promoted by conservation groups."

An uncontrolled increase in fishing effort using small-mesh nets to catch bony fishes, with an associated high rate of Franciscana bycatch, in adjacent areas of southern Brazil is likely to have offset or nullified any reduction in the bycatch in Uruguay consequent to the decline of the large-mesh shark fishery. Estimates of bycatch levels from monitoring gillnet fleets in Rio Grande do Sul State imply a catch of several hundred dolphins per year (Secchi et al. 1997, Ott 1998). Estimates of the Franciscana bycatch by the artisanal gillnet fishery in southern Rio Grande do Sul in 1999 and 2000 were around 1,350 and 1,530, respectively, and these figures do not account for mortality in trawl nets in the northern part of the province, in gillnets deployed near shore by the industrial fleet, or in "active gillnetting" of Bluefish (Pomatumus saltatrix) (Secchi unpublished data, and see Secchi et al. 1997). Combining all information on bycatch from fleet monitoring programs and interviews results in an annual bycatch estimate of about 1,778 franciscanas for the RS/URU subpopulation (Secchi 1999, Secchi et al. 2003b). This may be an underestimate for at least three reasons: (1) other fishing vessels in addition to coastal gillnetting vessels potentially catch franciscanas but were not monitored (see Secchi et al. 1997); (2) fishermen tend to under-report bycatch (Lien et al. 1994); and (3) bycaught dolphins sometimes fall from the net before it has been hauled or while it is being hauled.

Between 1976 and 1987, 1,085 dead franciscanas were found along the coast of Rio Grande do Sul (Pinedo 1994). Data from beach surveys should be considered cautiously when evaluating the impact of fishery bycatch because they substantially under-represent true bycatch rates (Secchi et al. 1997).

Depletion of fish stocks and temporal changes in diet
Two important prey species of franciscanas (the sciaenids Micropogonias furnieri and Macrodon ancylodon) have been exploited heavily and are currently at very low levels in southern Brazil (Haimovici et al. 1997, Haimovici 1998). This depletion coincided with a large reduction in the frequency of occurrence of these two species in the diet of franciscanas from this region. M. ancylodon and M. furnieri decreased drastically from 41% to 7% and 27.5% to 4%, respectively (Bassoi and Secchi 2000). In contrast, the frequency of occurrence of the Cutlassfish, Trichiurus lepturus, and another sciaenid, Umbrina canosai, in the diet of franciscanas increased from about 5% to 39% and from about 3% to 20%, respectively, between the late 1970s and the mid 1990s. T. lepturus and Cynoscion guatucupa represent 47% of the total estimated bony fish biomass in this region (Haimovici et al. 1996), but these species have only experienced moderate fishing pressure (Haimovici et al. 1997, Haimovici 1998). The latter species has always been the most important prey for franciscanas, but T. lepturus was of only minor importance in the past. Now, T. lepturus is the second most important prey species for franciscanas in this region. Although the effects of this major dietary change are unknown, the energetic implications could be significant.

Potential Additional Threats:

Ingestion of debris
Stomach contents of franciscanas from Rio Grande do Sul have included many kinds of debris: discarded fishing gear (17% of 36 stomachs), cellophane, and plastic fragments (6%) (Bassoi 1997). This problem has also been reported in northern Argentina where cellophane, fishing debris, and plastic were found in 45%, 32% and 16% of the stomachs (Bastida et al. 2000, see also Danilewicz et al. 2002 for a review). The effects of such debris ingestion on health status of individual franciscanas have not been determined, and the subpopulation-level implications are uncertain. However, it is possible that debris is having a negative effect in at least some areas.

Chemical pollution
Coastal oil spills have affected other marine species (e.g., penguins and pinnipeds) but their effects on franciscanas seem to be minimal. Trace metals (Fe, Cu, Zn, Mn and Cd) and chlorinated hydrocarbons have been found in the tissues of franciscanas (O'Shea et al. 1980, Castello et al. 2000, Gerpe et al. 2002, Lailson-Brito, et al. 2002) but the levels of these contaminants are relatively low, possibly because the species' diet is composed largely of juvenile fish (UNEP/CMS 2000).

Population Trends:

Potential rate of population increase versus bycatch rates
The effects of incidental mortality were simulated using available data on abundance and bycatch for the RS/URU Franciscana subpopulation and population rates of increase (ROI) of 2%, 3%, and 4%. These ROI values were selected based on that of the Killer Whale (Orcinus orca), the only odontocete species for which estimates of population growth rate from observed trends in abundance are available (3% according to Brault and Caswell 1993). The simple simulation was used to evaluate whether the Franciscana population's ROI could compensate for removals due to bycatch. To estimate the removal rate for the stock, the mean abundance estimate (i.e., 42,078 franciscanas) was combined with the annual bycatch estimate of 1,778. The removal rate used in the simulation was 4.2%. Population size was projected for 24 years, or three 8-year generations. Generation time was calculated using Caswell's equation that matches the IUCN definition of the average-aged adult of the current cohort (Caswell 1989). The projection predicted the stock to have declined by 58%, 55%, or 52% over the 24-year period, depending on the assumed ROI (2%, 3%, or 4%, respectively).

This analysis was subject to considerable discussion within the Cetacean Specialist Group, primarily centered on the issue of whether it was appropriate to use 1,778 as the estimate of annual bycatch, and whether the abundance estimate could be negatively biased to an appreciable degree. It was acknowledged that all of the values used in the simulation had substantial associated uncertainty. An analysis that better incorporates this uncertainty would be preferred. Nevertheless, there was general agreement that the population trend has been negative and that the population is very near the decline threshold between EN and VU (see Justification above).

Trends in CPUE of franciscanas in Uruguay
An alternative index of population decline was devised, based on the bycatch of franciscanas per unit of fishing effort (CPUE). Praderi's (1997) review of bycatch data from Uruguay between 1974 and 1994 showed high inter-annual fluctuations. However, when the data were corrected for fishing effort, the resulting CPUE of franciscanas generally decreased over the 20-year period. This trend becomes more evident if annual bycatch estimates from the late 1960s and early 1970s are used. In the absence of fishing effort data for the late 1960s and 1970s, information on effort from 1981 to 1984/85 (in Praderi 1997) was used to estimate a rate of effort decline of 25%. A constant rate of decline was assumed for back-calculating to the late 1960s. Bycatch data from Praderi (1997; for the early 1970s to mid 1980s) and Brownell and Ness (1970) and Pilleri (1971) (for the late 1960s) were then used to calculate the CPUE and the trend. This procedure resulted in an estimated decline in CPUE of 71% from the late 1960s to mid 1980s. Using the maximum estimated annual bycatch for the 1960s (2,000 animals) would have resulted in a decline of 75%. No data from later than the mid 1980s were used because the decline in the shark fishery began at that time and led to major changes in fishery dynamics. For instance, fishing effort using gillnets with large mesh sizes decreased markedly and moved inshore. Such changes would affect interpretation of CPUE data. The suggested 71% decline in Franciscana CPUE from the 1960s to mid 1980s might be explained by invoking either temporal changes in the fishing grounds or increased fishing effort (Secchi et al. 2003b). However, no major changes in fishing grounds are known to have occurred prior to the decline of the shark fishery beginning in the mid 1980s, and fishing effort actually decreased from the 1960s to mid 1980s (Praderi 1997). The slight increase in the estimated CPUE during the mid to late 1980s is likely due to the decline of the shark fishery, which forced fishermen to move closer to shore to catch bony fish (Praderi 1997). Such a spatial trend likely would have increased fishing effort in waters with relatively high densities of franciscanas.

Trends in stranding rates in southern Brazil
Long-term trends in fishing effort in the coastal bottom-set gillnet fishery were compared to long-term stranding rates of franciscanas in southern Brazil (Pinedo and Polacheck 1999). Stranding rates prior to 1990 were, on average, more than three times higher and significantly different from those after 1990 (two-way ANOVA; p = 0.001). The results presented by Pinedo and Polacheck (1999) also suggested that stranding rates declined markedly from the late 1970s and early 1980s to the 1990s, after which they have remained low and relatively stable. A decline of nearly 70% in stranding rates was observed in about 20 years. Despite the difficulties of interpreting stranding data, including the fact that the chances of a discarded carcass being washed ashore are affected by many factors, stranding rates can be considered to provide one possible additional index of general trends. Thus, a decline in Franciscana abundance is one plausible explanation for the declining or stable stranding rates observed during a period of increased coastal gillnet fishing effort (Pinedo and Polacheck 1999).

The main problem facing the species is incidental mortality in gillnet fisheries (there is no indication of direct exploitation of franciscanas), which has been observed since at least the early 1940s (Van Erp 1969). In the 1960s, the bycatch in Uruguay alone was as high as 1,500-2,000 animals (Brownell and Ness 1969; Pilleri 1971). Current estimates total at least 2,900 animals per year in all four management stocks, combined (e.g., Ott et al. 2002; Secchi et al. 2003b), but the numbers used to get that total are thought to be underestimated to an unknown extent, primarily due to: (1) captures in other non-monitored types of fisheries (e.g., active gillneting, Secchi et al. 1997; shrimp trawling, Cappozzo et al. 2000); (2) under-reporting of bycatch by fishermen; and (3) dolphins captured sometimes falling from the net before or during haul-out (Secchi et al. 2003b). Bycatch is higher in FMA III with estimates being above 1,300 animals incidentally caught annually (Ott et al. 2002; Secchi et al. 2003b, 2004), followed by FMA IV: approximately 800 individuals (Bordino and Albareda 2005), FMA II: > 700 dolphins (Rosas et al. 2002; IWC 2004), and FMA I: > 110 franciscanas (Di Beneditto 2003).

Stomach contents of franciscanas from Rio Grande do Sul have included many kinds of debris: discarded fishing gear such as pieces of nylon net (17% of 36 stomachs), cellophane, and plastic fragments (6%) (Bassoi 1997). This problem has also been reported in northern Argentina, where cellophane, fishing debris, and plastic were found in 45%, 32% and 16% of the stomachs (Bastida et al. 2000; Danilewicz et al. 2002). The effects of such debris ingestion on health status of individual franciscanas have not been determined, and the subpopulation-level implications are uncertain. However, debris could have a negative effect in at least some areas.

Other potential threats include various forms of habitat degradation (e.g. overfishing; destruction of benthic community and bycatch of small sciaenid fish – main franciscana prey – by trawling) (e.g. Bassoi and Secchi 2000; Danilewicz et al. 2002; Rodríguez et al. 2002).

In Brazil, Federal Laws 5,197 (of 3 Jan. 1967) and 7,643 (of 18 Dec. 1987) afford protection to fauna and prohibit the capture and disturbance of cetaceans in its jurisdictional waters. The Franciscana also appears in the Official List of Brazilian Fauna Species Threatened with Extinction (IBAMA 1989). Regionally, the species was added recently to the list of species threatened with extinction in Rio de Janeiro State (Bergallo et al. 2000) and listed as "vulnerable" in the Red Data Book of threatened species in Rio Grande do Sul State (D. Danilewicz, pers. comm.). In Uruguay, Law No. 16.211 states that the National Fisheries Institute is responsible for the conservation and preservation of marine mammals under Uruguayan jurisdiction. Also, Decree No. 238/1998 adopts measures for the protection and conservation of marine mammals in Uruguayan waters. In Argentina, Law No. 22.421/1981 is the national wildlife conservation legislation and Resolution No. 351/1995 prohibits hunting, capture or appropriation and transit, in federal jurisdiction, of all cetaceans and pinnipeds, which appear in Appendix I of the Law. Regional legislation in the provinces of Buenos Aires, Rio Negro and Chubut also provides indirect protection to the Franciscana (see details on Federal and Regional Legislation in Arias et al. 2002). Because the legislation could negatively affect fishermen?s income and welfare (i.e., fishing offshore increases risk), cooperation may be minimal. Also, better knowledge of the spatial and temporal patterns of the Franciscana bycatch problem is still needed before regulations on fishing practices can be proposed. Other potential alternatives may be found in modifying fishing practices (e.g., Corcuera, 1994 suggested replacing gillnets with longlines as a means to reduce bycatch in Argentine waters). Because fish stocks are also depleted, a wider management strategy that includes other marine species is needed. However, cultural and social needs of the fishing communities must also be considered to avoid further burdening the already difficult socio-economic situation of Latin American countries.

Acoustic pingers were demonstrated to have reduced the bycatch of franciscanas in nets set off Cabo San Antonio, Argentina, during a short-term study (Bordino et al. 2002). However, this modification to the fishing gear also resulted in an undesirable increased rate of depredation on the nets by Southern Sea Lions (Otaria flavescens). Although the use of such acoustic devices may seem inappropriate for this region, it may be a promising alternative to reduce bycatch until other mitigating actions can be developed and implemented, especially in areas where sea lions do not occur (e.g., many small fishing villages along FMA I and II).

The species is listed in Appendix II of CITES. Measures are needed to reduce the level of bycatch of this species, and research is needed to monitor bycatch levels more accurately.