Overview

Brief Summary

Biology

Baijis have long been recognised as one of the world's rarest mammals, and are extremely shy animals, making observation of them in the wild extremely difficult. Consequently, relatively little is known of the species (6). They are most active through the night from early evening to early morning (3). They tend to live in small groups of three to four individuals, with the largest group ever seen comprising of 16 (2). A recent study found that they often swim with finless porpoises (Neophocaena phocaenoides), the only other cetacean in the Yangtze River, which is also threatened (classified as Endangered on the IUCN Red List) (1) (6). Baijis break the surface of the water without creating a splash and breathe smoothly (2). They feed on a wide range of freshwater fish (2), which are eaten whole (7). It is thought that breeding occurs in the first part of the year, with most births peaking between February and April (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

After an intensive, but fruitless, search for this rare cetacean in 2006, it is now believed that the baiji may be extinct; which would earn this dolphin the grim record of being the first cetacean to disappear as a result of human activity (4). It is a very shy and graceful freshwater dolphin, with a rather stocky body, roughly the size of an adult human (3). It is bluish-grey in colour becoming whitish on the underside, but seems white or greyish from a distance (3). In common with other river dolphins, it has a very long, narrow beak with a slightly upturned tip, and small eyes placed high up on the face (2). The dorsal fin is positioned low on the body and is triangular in shape, and the flippers are rounded (2) (5). Females tend to be larger than males (2). The baiji is the only species in this genus, the name of which, Lipotes, derives from the Greek for 'left behind', referring to its limited range (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

In recent times, this species has been endemic to the Yangtze River of China. Some individuals were seen in the Fuchun River, immediately south of the Yangtze, during the great flood of 1955 but disappeared from that area after construction of a hydropower station in 1957 (Zhou 2002). Baiji also occurred historically in Dongting and Poyang Lakes, both appended water bodies of the Yangtze (Zhou et al. 1977, Chen et al. 1980), but apparently do so no longer (Yang et al. 2000, Zhang et al. 2003). Their upstream limit in the Yangtze changed from the Three Gorges area approximately 35 km above Gezhouba Dam near Yichang in the 1940s to approximately 170 km below the dam site near Jingzhou (formerly called Shashi) in the 1990s (Zhou 2002, Zhang et al. 2003). These dolphins were once observed as far downstream as the river mouth near Shanghai (Zhou and Li 1989). No dolphins were found downstream of Jiangyin, located 256 km upstream of the mouth, during surveys in 1997-99 (Zhang et al. 2003). (See Figure 1 in the attached PDF showing the Yangtze River and the locations used to describe the distribution of the baiji).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Lipotes vexillifer, also known by the common name baiji, is found in China in the mouth of the Chang Jiang (Yangtze) to a point about 1900 km up the river, as well as in the middle and lower regions of the Quintangjiang River and in the Dongting and Poyang lakes.

Biogeographic Regions: palearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
China

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

In the past, this river dolphin's range extended from the mouth of the Yangtze River, China, upstream to 50 kilometres above the Gezhouba Dam (1). More recently, it was found only in the middle and lower reaches of the Yangtze River (6), between two large tributary lakes, Dongting and Poyang (1). In 1997, just 17 individuals of this extremely rare species were seen; in 1999 this number fell to just four (6). During an expedition in November and December 2006 an intensive search was undertaken in the Yangtze River, but scientist failed to find a single baiji. It is now thought that the baiji may be extinct (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Baiji, like other dolphins, have streamlined, fusiform bodies. They have rounded flippers and long, beaklike, upturned snouts, which are completely hairless. Their small but functional eyes sit high on their heads, and their blowholes are elliptical and oriented longitudinally. Baiji are pale blue-grey dorsally and white ventrally. They have 30-36 teeth per side of both the upper and lower jaws. Baiji have no fore-stomachs but their main stomachs consist of three chambers, and they lack ceca. The skulls of these dolphins lack maxillary crests, and the palatal portions of the maxillae contact one another.

Female baiji are larger than males. Females range from 185 to 253 cm in length and weigh 64-167 kg, while males range from 141 to 216 cm in length and weigh 42-125 kg.

Range mass: 42 to 167 kg.

Range length: 141 to 253 cm.

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Lipotes vexillifer Miller, 1918
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male;
Preparation: Skull; Partial Skeleton
Collector(s): C. Hoy
Year Collected: 1916
Locality: Tung Ting Lake, Hunan, China, Asia, North Pacific Ocean
  • Type: Miller. 1918. Smithsonian Miscellaneous Collections. 68 (9): 8.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Generally found in eddy counter-currents below meanders and channel convergences (Hua et al. 1989, Zhou and Li 1989, Zhang et al. 2003). Baiji prey on fish of many sizes and various species, including both surface and bottom feeders (Chen et al. 1997).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Baiji are freshwater dolphins that inhabit the lower reaches of China's Yangtze and Quintangjiang rivers, and in the Poyang and Dongting lakes. They prefer to stay near large eddies that form next to sandbars.

Habitat Regions: freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Other Habitat Features: riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The baiji is an exclusive freshwater species (2). Within the Yangtze River, they are attracted to areas where tributaries meet the river, particularly where there are sand bars with large eddies (3) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of baiji consists of mainly, if not entirely, of fish. They use their long beaks to probe muddy bottoms for food. Their dives are short, lasting only 10-20 seconds. Baiji have poor eyesight but use a highly developed echolocation faculty to find food. These creatures seek food in the shallow water near sandbanks or close to the mouth of tributaries of the river.

Animal Foods: fish

Primary Diet: carnivore (Piscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Baiji are top-level consumers in the Yangtze ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There are no reports of predation on baiji, except by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

In the turbid waters of the Yangtze, vision is mostly useless, so baiji use echolocation to navigate and find food. They communicate with one another using whistles and other acoustic signals.

Communication Channels: acoustic

Perception Channels: acoustic ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

One wild-caught baiji was estimated to be 24 years of age; this number provides a minimum estimate of the lifespan of this species.

Range lifespan

Status: wild:
24 (low) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 24 years (captivity) Observations: A highly endangered species, not much is known about the longevity of these animals. One captive specimen lived for 22.5 years (Richard Weigl 2005) and they can live up to 24 years in the wild (Ronald Nowak 2003). Nonetheless, their maximum longevity is likely underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The mating system of baiji is unknown.

Little is known about the reproductive activities of baiji. Ovulation in females is periodic and sperm density in males varies seasonally. The mating season peaks twice a year, in spring and in autumn. The gestation period estimates range from 6 to 12 months. Females give birth to one 80 cm long calf every two years. Baiji reach sexual maturity at 3 to 8 years of age.

Breeding interval: Female baiji breed once every two years.

Breeding season: The mating season peaks twice a year, in spring and in autumn.

Range number of offspring: 1 to 1.

Range gestation period: 6 to 12 months.

Range age at sexual or reproductive maturity (female): 3 to 8 years.

Range age at sexual or reproductive maturity (male): 3 to 8 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average number of offspring: 1.

Mothers carry their calves close to the side of their bodies while swimming, diving, and coming up to breathe. It is unknown how long they nurse their young, and whether there is any association between mother and offspring after the young are weaned.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lipotes vexillifer

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA0656-06|NC_007629|Lipotes vexillifer| AACCGCTGATTATTCTCAACCAATCATAAAGATATTGGCACTTTATATTTACTATTCGGTGCCTGAGCAGGGATAGTAGGTACAGGTTTA---AGCCTACTAATCCGTGCTGAATTAGGTCAACCTGGCACACTCATCGGAGAC---GACCAAATTTACAATGTCTTAGTAACAGCCCATGCCTTCGTAATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGTTTCGGAAACTGACTAGTTCCCCTAATA---ATTGGAGCACCTGATATAGCCTTTCCTCGCCTAAACAATATAAGCTTTTGACTACTTCCCCCCTCATTCCTCCTACTAATAGCATCTTCAGTAATTGAAGCAGGTACAGGCACAGGTTGAACTGTATATCCTCCTTTAGCTGGAAATCTAGCACATGCAGGAGCTTCAGTAGATCTT---ACCATTTTCTCCCTACATCTAGCCGGTGCATCCTCAATCCTCGGAGCCATTAACTTTATCACAACCATCATTAACATAAAACCTCCCGCCATAACTCAGTATCAAACACCCTTATTCGTATGATCAGTCCTAGTCACAGCAGTACTTCTACTACTATCATTACCTGTCCTAGCAGCC---GGAATTACAATACTATTAACAGACCGAAATCTAAATACAACCTTTTTCGACCCCGCAGGGGGAGGCGACCCAATTCTATATCAACATCTTTTCTGATTCTTCGGCCATCCCGAAGTATATATCTTAATCTTACCTGGCTTCGGAATAATTTCACATATCGTAACCTATTACTCAGGAAAAAAA---GAACCTTTCGGATACATAGGAATAGTTTGGGCTATAATCTCAATCGGATTCCTAGGCTTTATCGTGTGAGCTCATCATATATTTACAGTCGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lipotes vexillifer

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(ii);D

Version
3.1

Year Assessed
2008

Assessor/s
Smith, B.D., Zhou, K., Wang, D., Reeves, R.R., Barlow, J., Taylor, B.L. & Pitman, R.

Reviewer/s
Perrin, W.F. (Cetacean Red List Authority) & Stuart, S.N. (Global Mammal Assessment Team)

Contributor/s

Justification
The Baiji is probably the most threatened cetacean in the world. It is a relict species and the only living representative of the family Lipotidae (Zhou, Qian and Li 1978). It meets the definition of a Critically Endangered (CR) species, as it is facing an extremely high risk of extinction in the wild.

Criterion A. Although the species may qualify as CR under this criterion, the lack of standardized survey data makes it difficult to substantiate and quantify the declining trend in population size. Therefore, it was judged more appropriate (i.e., less complicated) to use other criteria for the CR classification.

Criterion B. The species' extent of occurrence has declined by at least several hundred linear kilometers in the Yangtze (from approximately 1,700 to no more than 1,400 km; Zhang et al. 2003) and it reportedly no longer occurs in the two large appended lakes (Dongting and Poyang). However, neither its extent of occurrence nor its area of occupancy appears to fall below the threshold level for CR.

Criterion C. The total population (all ages) is certainly less than 250 and therefore less than 250 mature individuals exist. Subcriterion C2 is probably more suitable than subcriterion C1, in that a continuing decline in numbers of mature individuals is projected and all individuals are considered to belong to a single subpopulation (i.e., >90% of mature individuals are in one subpopulation: C2a(ii)). The species therefore qualifies as CR under this criterion.

Criterion D. There is no evidence to suggest that the total population size is as large as 100 and it is probably no more than a few tens of individuals. A precautionary interpretation of the evidence is that there are fewer than 50 mature individuals, and therefore the species qualifies as CR under this criterion.

Criterion E. The viability of the species was assessed at a workshop in Nanjing, China, in 1993 (Ellis et al. 1993, Zhou et al. 1994). However, results were equivocal as rigorous estimates of key parameters (e.g., population size, natural and human-caused mortality rates, intrinsic rate of increase) were not available and therefore the range of possible outcomes was great.

In addition to the above considerations, which justify CR, this species may already be extinct (Possibly Extinct (PE)). The last documented sighting (supported by photographic evidence) was in 2002 and the last confirmed stranding was in 2001 (Turvey et al. in prep.). In November and December 2006 a comprehensive visual and acoustic survey failed to find a single Baiji in the Yangtze River (Turvey et al. in prep.). Two research vessels covered the known habitat of baiji from Yichang to Shanghai in both the upstream and downstream directions (for quadruple coverage). In addition, one vessel towed a hydrophone to listen for Baiji whistles and clicks during the downstream survey. Although Dongting and Poyang lakes were not covered in the 2006 Yangtze mainstem survey, no Baiji have been seen since 2000 by researchers studying Finless Porpoises in those lakes. A few undocumented sightings have been reported since 2004, but there are no photographs or physical evidence for the species? continued existence. The preponderance of evidence indicates that the Baiji is very close to extinction or may already be extinct.

History
  • 2007
    Critically Endangered
  • 2006
    Critically Endangered
    (IUCN 2006)
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Lipotes vexillifer is probably the most endangered of all cetaceans. It is listed as critically endangered on the IUCN's Red List of Threatened Species, it is listed as endangered by the U.S. Fish and Wildlife Service, and it is on CITES appendix I. The total population is estimated at less than 100 animals; surveys in the late 1990s put the minimum population estimate at 13. A 2006 survey of the entire range of L. vexillifer failed to find any individuals at all, and it is probable that the species is now extinct.

There are three major factors that threaten baiji survival: dams and floodgates that block fish migration in the river's tributaries and lakes, fisheries accidentally killing dolphins, and boat propellers. Population numbers also declined through hunting and development of irrigation facilities. The heavy pollution and underwater noise characteristic of the Yangtze also affects the Baiji. These stresses, as well as lack of food, can inhibit reproduction.

China began providing legal protection in 1975. Programs are being established to breed Lipotes vexillifer in captivity, though no one has yet succeeded at housing wild baiji for long. In 1992 an oxbow jutting off from the main Yangtze river was set aside as a reserve where baiji could be relocated and allowed to live under semi-natural conditions. In the face of ongoing degradation of the Yangtze river, this "ex-situ" conservation strategy may be the species' only hope for survival. In 2006, a survey of the entire range of baiji will be carried out by the baiji.org foundation in collaboration with Chinese administrators and the Institute for Hydrobiology. Scientists are hopeful this survey will give them a better idea of exactly how many baiji remain and where they are located, so that they can eventually be relocated to reserves.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 05/30/1989
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Lipotes vexillifer , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (Possibly Extinct) [CR (PE)] on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The first estimate of abundance based on quantitative survey data (1979-81) was made by Zhou (1982), who guessed that there were only about 400 animals all told. On the basis of surveys conducted in 1985-86, Chen and Hua (1989) made an educated guess that the total population was around 300. Surveys by Zhou and Li (1989) between 1982 and 1986 suggested that there were 100 baiji in a 770 km segment of the lower Yangtze from Hukou to the river mouth, compared with 78 to 79 dolphins counted by Chen and Hua (1989) in the same segment in 1985-86. Repeated surveys of a 500 km segment of the lower Yangtze (Nanjing-Hukou) in 1989-91 produced a maximal count of 12 individuals, leading Zhou et al. (1998) to infer a total abundance of about 30 baiji in that river segment. Those authors reasoned that if the species still inhabited its historical range of about 1,700 linear kilometers of river, with a density similar to that found in their study area, the total population in the early 1990s would have been only about 100. Attempted comprehensive surveys of the entire species' range in 1997-99 resulted in a maximal count (November 1997) of 13 dolphins (including one calf), leading to the generally accepted view that abundance had continued to decline and that the total population was by that time very small. The sighting rate in the three years of surveys declined at an annual rate of about 10% (Zhang et al. 2003). Informed guesses in the early 2000s were that there could be only "a few dozen" (Zhou 2002) and "very likely ? less than a hundred" (Reeves et al. 2003) baiji left (also see Wang 2000, IWC 2001, Zhang et al. 2003). Although no credible time series of counts or abundance estimates is available to provide a rigorous evaluation of trends, there is an overwhelming consensus that the baiji population declined rapidly over the past several decades.

During surveys in the late 1990s baiji were found mainly in several segments of the Yangtze between Tongling and Dongting Lake, such as the Tongling section, the Poyang Lake mouth area, and the Honghu section (Wang 2000, Zhang et al. 2003).

More recent evidence suggests that this species might already be extinct. The last documented sighting (supported by photographic evidence) was in 2002 and the last confirmed stranding was in 2001 (Turvey et al. in prep.). In November and December 2006 a comprehensive visual and acoustic survey failed to find a single baiji in the Yangtze River (Turvey et al. in prep.). Two research vessels covered the known habitat of baiji from Yichang to Shanghai in both the upstream and downstream directions (for quadruple coverage). In addition, one vessel towed a hydrophone to listen for baiji whistles and clicks during the downstream survey. Although Dongting and Poyang Lakes were not covered in the 2006 Yangtze mainstem survey, no baiji have been seen since 2000 by researchers studying finless porpoises in those lakes. A few undocumented sightings have been reported since 2004, but there are no photographs or physical evidence for the species? continued existence. The preponderance of evidence indicates that the baiji is very close to extinction or might already be extinct.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The range contraction and the decline in baiji abundance were caused by a combination of factors, including: possibly some level of direct exploitation historically; incidental mortality from interactions with fisheries; vessel traffic, management of navigation channels, and harbor construction; and loss or degradation of habitat by water development, land use practices, and pollution.

During China's "great leap forward" the baiji's traditionally venerated status as "goddess of the river" was denounced and baiji skin was used to produce handbags and gloves (Zhou and Zhang 1991).

Entanglement in fishing gear was estimated in the 1970s to 1980s to have been responsible for at least half of observed mortality (Lin et al. 1985, Zhou and Li 1989, Chen 1989, Chen et al. 1997). Longlines with thousands of unbaited hooks used for snagging bottom fish ("rolling hooks") accounted for 7 of 13 entanglement deaths recorded in the lower Yangtze between 1978 and 1985 (Zhou and Li 1989) and 15 of 28 in the middle reaches between 1973 and 1983 (Zhou and Wang 1994, also see Chen et al. 1997). Additional deaths from entanglement in rolling hooks were documented in the 1990s (Zhou et al. 1998). Baiji often have scars and open wounds from rolling hooks, and hook remains are sometimes found in the stomachs of dead animals (Lin et al. 1985, Zhou and Li 1989). Deaths also result from entanglement in gill and fyke nets (Zhou and Wang 1994). According to Zhou et al. (1998), both rolling hooks and fyke nets are banned in the Yangtze "because both are harmful to fisheries resources, and because of incidental killing of Baiji", but enforcement of these prohibitions is "very difficult" and therefore incidental mortality is likely to continue.

Electric fishing, although "strictly banned" in the Yangtze (Zhou et al. 1998), is widely practiced, particularly in the centre of the baiji's distribution (IWC 2001). By the early 2000s this fishing method had come to be viewed as the most important and immediate direct threat to the baiji's survival (Zhang et al. 2003). The electric shocks kill baiji outright (Chen and Hua 1989, Wang Ding in IWC 2001: 276) and unselectively kill other aquatic organisms, including the baiji's prey.

Propeller strikes have killed and injured baiji (Zhou and Zhang 1991, Chen et al. 1997) and are considered an increasing threat in view of the rapid industrial and economic growth of China, with its associated expansion of traffic on the Yangtze (Chen 1989, Chen and Hua 1989, Zhou and Li 1989, Zhou 1992, Zhou et al. 1998).

Explosives, used to deepen or widen river channels or for fishing, are another cause of baiji mortality (Lin et al. 1985, Zhou and Li 1989, IWC 2001).

Water development has transformed the baiji's habitat in important ways, e.g., by interrupting their movements upstream of dams, eliminating their access to tributaries and appended lakes, and reducing fish productivity (Liu et al. 2000). A dead baiji found at the bottom of a gate for a ship lock in a Yangtze tributary may have been killed accidentally by the structure (Liu et al. 2000). Chen and Hua (1987) predicted that the controversial Three Gorges Dam, completed in the early 2000s, would eliminate counter-current habitat for approximately 200 km downstream and degrade the existing counter-current systems for another 160 km downstream. Further, stratification in the reservoir will cause the water released below the dam to be cooler than previously, potentially affecting baiji and their prey. The downstream effects of Gezhouba Dam were not as extreme as those predicted for Three Gorges Dam because the former is a low-head, run-of-the-river structure (Zhong and Power 1996), meaning that sediment is allowed to pass through (which allows the formation of the counter-currents where baiji are generally found - see above) and no reservoir forms. Another effect of Three Gorges Dam will be to facilitate large ship traffic in the upper reaches of the Yangtze and thereby increase the amount of underwater noise and the incidence of vessel collisions with baiji (Chen and Hua 1989).

Industrial expansion and intensified agriculture (both facilitated by water development) have already caused major ecological problems in the Yangtze system. For example, Dongting and Poyang Lakes have become much shallower because of siltation from deforestation and agricultural development; in fact, it has been suggested that Dongting Lake could disappear altogether within a decade (Liu et al. 2000).

Pollutant loads in the Yangtze are expected to increase with industrialization and the spread of modern agricultural practices. Approximately 40% of China's industrial and agricultural output comes from the Yangtze basin, with more than 16 billion cubic meters of wastewater discharged into the river annually, of which more than 12 billion cubic meters is industrially polluted and largely untreated (Zhou et al. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The Yangtze River is one of the world's busiest waterways (3), and is subject to a great range of human pressures that have had a devastating effect on the baiji. The main threat causing the decline of this species in recent years is illegal fishing using electricity, which has accounted for 40 percent of known deaths. The dolphins have also become caught in fishing gear, and engineering explosions used to keep navigation channels open are another source of mortality. Vessels carrying pesticides occasionally overturn, causing poisoning of the ecosystem, resulting in further deaths (6). An additional source of pollution comes from the 15.6 billion cubic meters of wastewater discharged into the Yangtze every year, 80 percent of which is not treated. A huge volume of boat traffic uses the river; noise levels are high and boat strikes a possibility. Furthermore, the banks of the Yangtze have been greatly modified in order to prevent flooding of adjacent land; such projects have great impacts on the ecosystem, both during construction and from the resulting habitat changes. Dam construction has been shown to reduce the availability of fish, which is exacerbated by over-fishing and pollution. The recent construction of the infamous Three Gorges Dam, the largest dam in the world, is likely to affect fish stocks and natural flooding patterns (2). For many years the baiji population is thought to have been very small, which in itself may have caused serious problems; small populations often suffer low genetic fitness and are often less able to adapt to environmental changes (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The baiji is designated in the First Category of National Key Protected Wildlife Species and has full legal protection throughout its range. Protection from deliberate killing or injury appears to be effective but, as noted above, prohibitions on harmful fishing methods are generally not very effective and there is no evidence that baiji are protected in any way from the mortality, injury, and health impairment caused by the other threats listed above.

Since the late 1980s, the primary strategy to prevent the baiji's extinction was to capture as many dolphins as possible and to introduce them into "semi-natural reserves", one of which (Tongling) was approved by the Chinese government in the 1980s, and the other (Shishou) in the 1990s. The approach of using semi-natural reserves as components of a broad-based conservation strategy was endorsed by international panels of scientists in 1986 (Perrin and Brownell 1989) and 1993 (Ellis et al. 1993, Zhou et al. 1994). It was premised on the assumption that the total dolphin population in the 1980s was approximately 300 and declining. Importantly, it was also premised on the expectation that an ex situ breeding population, preferably housed at two or more sites, would provide surplus animals for replenishment or reestablishment of the wild population, and not be viewed as an end in itself (Perrin and Brownell 1989, Ralls 1989, Perrin 1999).

However, the expectation that sufficient numbers of baiji could be caught and placed in the reserves to establish a viable ex situ population has proven unrealistic. Six capture expeditions, each lasting 2 to 3 months, were conducted between Chenglingji and Gongan in the 1990s. In 1995 a female baiji was caught and released in the Shishou reserve, a 21 km oxbow channel of the Yangtze River (Liu et al. 1998). Less than seven months later her carcass was found entangled in the escape-prevention net at the outlet of the reserve. At that time, one other baiji was in captivity - a male (Qi Qi) that had been rescued from fishing gear and rehabilitated in 1980. This animal remained in its dolphinarium tank at the Institute of Hydrobiology of the Chinese Academy of Sciences in Wuhan until it died in 2002. At the time of this writing (August 2004; update in April 2007), no Baiji were in either of the semi-natural reserves or in the dolphinarium at Wuhan.

Scientific opinion has been divided on how to proceed with baiji conservation efforts. The Scientific Committee of the International Whaling Commission reviewed the status of the baiji in 2000, but members were unable to reach consensus on whether further attempts at live-capture should or should not be made (IWC 2001). The IUCN SSC Cetacean Specialist Group recommended in 2003 that: (1) available resources should be devoted to eliminating the known threats to the species in its natural habitat; (2) immediate action should be taken at national, provincial and local levels to fully enforce the bans on rolling hooks and electric fishing; and (3) if the capture/translocation effort continues, capture operations should be improved to prevent dolphin injury or mortality, water quality in the reserve should be kept at a high standard and finless porpoises should be removed to ensure against deleterious interactions between them and the dolphin(s) (Reeves et al. 2003). The Chinese Ministry of Agriculture has developed a baiji conservation plan emphasizing the ex situ approach (Ministry of Agriculture 2001, Wang and Zhang 2002).

With the intention of improving the status of fishery resources, the central Chinese government has, since 2001, banned fishing in the entire middle and lower reaches of the Yangtze River (including appended lakes and tributaries) between 1 April and 30 June. This measure, if effective, could give some seasonal relief to baiji from one of the more serious lethal threats to their survival. In addition, serious efforts have been made in recent years to protect baiji and improve their habitat in the Xin-Luo National Baiji Reserve (established in 1992) and in two smaller reserves run by provincial governments (Zhenjiang and Tongling sections). In the Xin-Luo Reserve patrol boats monitor fishing activity, collect baiji sightings, rescue injured animals, and investigate dolphin deaths. Several shore-based monitoring sites have been established in the reserve to observe baiji. Perhaps the most important work carried out by reserve staff is that of enforcing the ban on electric fishing.

It is listed on CITES Appendix I.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In Chinese folklore, the baiji is dubbed 'Goddess of the Yangtze', a beneficent animal once revered by the fishing people of the river. The species was declared a National Treasure of China and has been a protected species since 1975 (3). However, this had very little effect on the population, which continued to decline despite conservation efforts and legal protection. It was thought that the only chance to save the species from extinction would be to remove all of the surviving individuals from the Yangtze into the 'Baiji Semi-natural Reserve' which was created in 1992 (6). However, since the unsuccessful search for any surviving baijis in 2006, it is unlikely that a captive breeding programme will now ever be possible (4). The World Conservation Union (IUCN) has now classified the baiji as Critically Endangered (Possibly Extinct); it cannot be definitively classified as Extinct until further surveys are undertaken (1). Sadly, it seems that this goddess of the Yangtze will be the first cetacean species to become extinct in modern times as a result of human activities (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Baiji have no known negative effects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Baiji are important culturally as they have long been protected by custom. In the past, the fat of accidentally killed individuals was used for medicinal purposes and the flesh consumed. The current plight of baiji--designated a national treasure "of the first order" by China--has raised awareness of the need for conservation of river systems worldwide.

Positive Impacts: food ; source of medicine or drug ; research and education

  • baiji.org Foundation, 2006. "The baiji.org Foundation" (On-line). Accessed January 11, 2007 at www.baiji.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Baiji

The Baiji (Chinese: ; pinyin: About this sound báijìtún ) (Lipotes vexillifer, Lipotes meaning "left behind", vexillifer "flag bearer") is a freshwater dolphin found only in the Yangtze River in China. Nicknamed "Goddess of the Yangtze" (simplified Chinese: 长江女神; traditional Chinese: 長江女神; pinyin: Cháng Jiāng nǚshén) in China, the dolphin is also called Chinese River Dolphin, Yangtze River Dolphin, Whitefin Dolphin and Yangtze Dolphin. It is not to be confused with the Chinese White Dolphin.

The Baiji population declined drastically in decades as China industrialized and made heavy use of the river for fishing, transportation, and hydroelectricity. Efforts were made to conserve the species, but a late 2006 expedition failed to find any Baiji in the river. Organizers declared the Baiji "functionally extinct",[4] which would make it the first aquatic mammal species to become extinct since the demise of the Japanese Sea Lion and the Caribbean Monk Seal in the 1950s. It would also be the first recorded extinction of a well-studied cetacean species (it is unclear if some previously extinct varieties were species or subspecies) to be directly attributable to human influence.

In August 2007, a Chinese man reportedly videotaped a large white animal swimming in the Yangtze.[5] Although Wang Kexiong of the Institute of Hydrobiology of the Chinese Academy of Sciences has tentatively confirmed[6] that the animal on the video is probably a Baiji, the presence of only one or a few animals, particularly of advanced age, is not enough to save a functionally extinct species from true extinction. The last known living Baiji was Qi Qi (淇淇), which died in 2002.

Contents

Anatomy and morphology

Baiji were thought to breed in the first half of the year, the peak calving season being from February to April.[7] A 30% pregnancy rate was observed.[8] Gestation would last 10–11 months, delivering one calf at a time; the interbirth interval was 2 years. Calves measured around 80-90 centimetres (32–35 in) at birth, and nursed for 8–20 months.[9] Males reached sexual maturity at age four, females at age six.[9] Mature males were about 2.3 metres (7.5 ft) long, females 2.5 metres (8 ft), the longest specimen 2.7 metres.[9] The animal weighed 135–230 kilograms (300-510 lb),[9] with a lifespan estimated at 24 years in the wild.[10]

When escaping from danger, the Baiji could reach 60 km/h (37 mph), but usually stayed within 10 to 15 km/h (6–9 mph). Because of its poor vision and hearing, the Baiji relied mainly on sonar for navigation.

Distribution

Historically the Baiji occurred along 1,700 kilometres (1,100 mi) of the middle and lower reaches of the Yangtze from Yichang in the west to the mouth of the river, near to Shanghai. This had been reduced by several hundred kilometres both upstream and downstream, and was limited to the main channel of the Yangtze, principally the middle reaches between the two large tributary lakes, Dongting and Poyang.[11] Approximately 12% of the world’s human population lives and works within the Yangtze River catchment area, putting pressure on the river.[12] The construction of the Three Gorges Dam, along with other smaller damming projects, also led to habitat loss.

Evolutionary history

Fossil records suggest that the dolphin first appeared 25 million years ago and migrated from the Pacific Ocean to the Yangtze River 20 million years ago.[13] It was one of four species of dolphins known to have made fresh water their exclusive habitat. The other three species, including the Boto and the La Plata Dolphin, have survived in the Río de la Plata and Amazon rivers in South America and the Ganges and Indus rivers on the Indian subcontinent.

It is estimated that there were 5,000 Baiji when they were described in the ancient dictionary Erya circa 3rd century BC. A traditional Chinese story describes the Baiji as the reincarnation of a princess who had been drowned by her family after refusing to marry a man she did not love. Regarded as a symbol of peace and prosperity, the dolphin was nicknamed the "Goddess of the Yangtze."

Conservation

In the 1950s, the population was estimated at 6,000 animals,[14] but declined rapidly over the subsequent five decades. Only a few hundred were left by 1970. Then the number dropped down to 400 by the 1980s and then to 13 in 1997 when a full-fledged search was conducted. Now the most endangered cetacean in the world, according to the Guinness Book of World Records,[4] the Baiji was last sighted in August 2004, though there was a possible sighting in 2007.[5] It is listed as an endangered species by the U.S. government under the Endangered Species Act.

Causes of decline

The World Conservation Union (IUCN) has noted the following as threats to the species: a period of hunting by humans during the Great Leap Forward, entanglement in fishing gear, the illegal practice of electric fishing, collisions with boats and ships, habitat loss, and pollution. During the Great Leap Forward, when traditional veneration of the Baiji was denounced, it was hunted for its flesh and skin, and quickly became scarce.[2]

As China developed economically, pressure on the river dolphin grew significantly. Industrial and residential waste flowed into the Yangtze. The riverbed was dredged and reinforced with concrete in many locations. Ship traffic multiplied, boats grew in size, and fishermen employed wider and more lethal nets. Noise pollution caused the nearly blind animal to collide with propellers. Stocks of the dolphin's prey declined drastically in the late 20th century, with some fish populations declining to one thousandth of their pre-industrial levels.[15]

In the 1970s and 1980s, an estimated half of Baiji deaths were attributed to entanglement in fishing gear. By the early 2000s, electric fishing was considered "the most important and immediate direct threat to the Baiji's survival."[2] Though outlawed, this fishing technique is widely practiced throughout China. The building of the Three Gorges Dam further reduced the dolphin's habitat and facilitated an increase in ship traffic.

Timeline

  • circa 3rd century BC: population estimated at 5,000 animals
  • 1950s: population was estimated at 6,000 animals
  • 1958–1962: The Great Leap Forward denounces the animal's traditional venerated status
  • 1970: The Gezhouba Project begins
  • 1979: The People's Republic of China declares the Chinese River Dolphin endangered
  • 1983: National law declares hunting the Chinese River Dolphin illegal
  • 1984: The plight of the Baiji draws headlines in China[16]
  • 1986: Population estimated to be 300
  • 1989: Gezhouba Dam complete
  • 1990: Population estimated to be 200
  • 1994: Construction of the Three Gorges Dam begins
  • 1996: IUCN lists the species as critically endangered
  • 1997: Population estimated to be less than 50 (13 found in survey); a dead baiji was found with 103 open wounds[13]
  • 1998: 7 found in survey
  • 2003: Three Gorges Dam begins filling reservoir
  • 2004: Last confirmed sighting
  • 2006: None found in survey, declared "extinct"
  • 2007: Results of survey published in the journal Biology Letters[17]

Surveys

Results of Yangtze River Baiji surveys between 1979 and 1996 ( * Lower reaches only)[12]
YearSurvey AreaNo. of km surveyedNo. of Baiji sightedNo. of Baiji estimated
1979[18]Wuhan-Chenglingji23019-
1979[19]Nanjing-Taiyangzhou17010
1979–1981[20]Nanjing-Guichi2503–6 groups400
1978-1985[21]Yichang-Nantong1600>20 groups156
1985-1986[22]Yichang-Jiangyin151042 groups300
1979-1986[23]Fujiangsha-Hukou63078-79100*
1987-1990[24]Yichang-Shanghai1669108200
1989–1991[25][26]Hukou-Zhenjian50029120
1991–1996[27]Xinchang-Wuhan41342< 100

Conservation efforts

During the 1970s, China recognized the precarious state of the river dolphin. The government outlawed deliberate killing, restricted fishing, and established nature reserves.

In 1978, the Chinese Academy of Sciences established the Freshwater Dolphin Research Centre (淡水海豚研究中心) as a branch of the Wuhan Institute of Hydrobiology. In the 1980s and 1990s, several attempts were made to capture dolphins and relocate them to a reserve. A breeding program would then allow the species to recover and be reintroduced to the Yangtze after conditions improve. However, capturing the rare, quick dolphins proved to be difficult, and few captives survived more than a few months.[2]

The first Chinese aquatic species protection organisation, the Baiji Dolphin Conservation Foundation of Wuhan (武汉白鱀豚保护基金), was founded in December 1996. It has raised 1,383,924.35 CNY (about 100,000 USD) and used the funds for in vitro cell preservation and to maintain the Baiji facilities, including the Shishou Sanctuary that was flooded in 1998.

Conservation efforts of the Baiji along the Yangtze River

Since 1992 five protected areas of the Yangtze have been designated as Baiji reserves. Four were built in the main Yangtze channel where Baiji are actively protected and fishing is banned: two national reserves (Shishou City and Xin-Luo) and two provincial (Tongling and Zhenjiang). A fifth protected area is an isolated oxbow lake located off of the north bank of the river near to Shishou City: the Tian-e-Zhou Oxbow Semi-natural Reserve. Combined, these five reserves cover just over 350 kilometres (220 mi), about 1/3 of the Baijis range, leaving two-thirds of the species' habitat unprotected.[12]

As well as these five protected areas there are also five "Protection Stations" in Jianli, Chenglingji, Hukou, Wuhu and Zhengjiang. These stations consist of two observers and a motorised fishing boat with the aim of conducting daily patrols, making observations and investigating reports of illegal fishing.[12]

In 2001 the Chinese government approved a Conservation Action Plan for Cetaceans of the Yangtze River. This plan re-emphasised the three measures identified at the 1986 workshop and was adopted as the national policy for the conservation of the Baiji. Despite all of these workshops and conventions little money was available in China to aid the conservation efforts. It has been estimated that US$1 million was needed to begin the project and maintain it for a further 3 years.[28]

Efforts to save the mammals proved to be too little and too late. August Pfluger, chief executive of the Baiji.org Foundation, said, "The strategy of the Chinese government was a good one, but we didn't have time to put it into action."[29]

In-situ conservation

Most scientists agreed that the best course of action was an ex-situ effort working in parallel with an in-situ effort. The deterioration of the Yangtze River had to be reversed to preserve the habitat. The ex-situ projects aimed to raise a large enough population over time so that some, if not all, of the dolphins could be returned to the Yangtze, so the habitat within the river had to be maintained anyway.

Ex-situ conservation

The Shishou Tian-e-Zhou is a 21-kilometre (13 mi) long, 2-kilometre (1.2 mi) wide oxbow lake located near Shishou City in Hubei Province. Shishou has been described as being "like a miniature Yangtze … possessing all of the requirements for a semi-natural reserve". From the designation as a national reserve in 1992 it has been intended to be used for not only the Baiji but also the Yangtze Finless Porpoise. In 1990 the first Finless Porpoises were relocated to the reserve and since then have been surviving and reproducing well. As of April 2005 26 Finless Porpoises were known to live in the reserve. A Baiji was introduced in December 1995, but died during the summer flood of 1996. To deal with these annual floods a dyke was constructed between the Yangtze and Shishou. Now water is controlled from a sluice gate located at the downstream mouth of the oxbow lake. It has been reported that since the installation of this sluice gate, water quality has declined since no annual transfer of nutrients can occur. Roughly 6,700 people live on the ‘island’ within the oxbow lake and so some limited fishing is permitted.[12]

Success of Shishou with the porpoises and with migratory birds and other wetland fauna has encouraged the local Wetlands Management Team to put forward an application to award the site Ramsar status.[30] It has also been noted that the site has incredible potential for ecotourism, which could be used to generate much needed revenue to improve the quality of the reserve. The necessary infrastructure does not currently exist to realize these opportunities

Captive specimens

A Baiji conservation dolphinarium was established at the Institute of Hydrobiology (IHB) in Wuhan in 1992. This was planned as a backup to any other conservation efforts by producing an area completely protected from any threats, and where the Baiji could be easily observed. The site includes an indoor and outdoor holding pool, a water filtration system, food storage and preparation facilities, research labs and a small museum. The aim is to also generate income from tourism which can be put towards the Baiji plight. The pools are not very large (25 m arc [kidney shaped] x 7 m wide x 3.5 m deep, 10 m diameter, 2 m deep and 12 m diameter, 3.5 m deep) and so are not capable of holding many Baijis at one time.

Douglas Adams and Mark Carwardine documented their encounters with the endangered animals on their conservation travels for the BBC programme Last Chance to See. The book by the same name, published in 1990, included pictures of a captive specimen, a male named Qi Qi (淇淇) that lived in the Wuhan Institute of Hydrobiology dolphinarium from 1980 to July 14, 2002. Discovered by a fisherman in Dongting Lake, he became the sole resident of the Baiji Dolphinarium (白鱀豚水族馆) beside East Lake. A sexually mature female was captured in late 1995, but died after half a year in 1996 when the Shishou Tian-e-Zhou Baiji Semi-natural Reserve (石首半自然白鱀豚保护区), which had contained only Finless Porpoises since 1990, was flooded.

Details of captive baijis[12]
(IHB = Institute of Hydrobiology, NNU = Nanjing Normal University, NFRI = Nanjing Fisheries Research Institute)
NameDate rangeLocationSexConditions of rearingSurvival time
Qi Qi1980-01-12 – 2002-07-14IHBMOutdoor & indoor, non-filtered22.5 years
Rong Rong1981-04-22 – 1982-02-03IHBMOutdoor non-filtered228 days
Lian Lian1986-03-31 – 1986-06-14IHBMOutdoor non-filtered76 days
Zhen Zhen1986-03-31 – 1988-09-27IHBFOutdoor non-filtered2.5 years
Ya Ya1981-03-03 1981-03-20NNUFIndoor17 days
Jiang Jiang1981-12-07 – 1982-04-16NFRIMOutdoor non-filtered129 days

Current status

The Xinhua News Agency announced on 4 December 2006 that no Chinese River Dolphins were detected in a six-week survey of the Yangtze River conducted by 30 researchers. The failure of the Yangtze Freshwater Dolphin Expedition (simplified Chinese: 长江淡水豚类考察; traditional Chinese: 長江淡水豚類考察; pinyin: Chāng Jiāng dànshuǐ tún lèikǎochá) raised suspicions of the first unequivocal extinction of a cetacean species due to human action[31] (some extinct baleen whale populations might not have been distinct species). Poor water and weather conditions may have prevented sightings,[4] but expedition leaders declared it "functionally extinct" on 13 December 2006 as fewer are likely to be alive than are needed to propagate the species.[4] However, footage believed to be a baiji from August 2007 was released to the public.[32]

The Japanese Sea Lion and Caribbean Monk Seal disappeared in the 1950s, the last aquatic mammals to become extinct. Several land-based mammal species and subspecies have disappeared since then. If the Baiji is now extinct, the North Pacific Right Whale has become the most endangered marine mammal species.

Some scientists retain hope for the species:

The fact that the expedition didn't see any Baiji dolphins during this expedition does not necessarily mean that the species is extinct or even 'effectively extinct', because it covered a considerable distance in a relatively short period of time... However, we are extremely concerned. The Yangtze is highly degraded, and we spotted dramatically fewer Finless Porpoises than we have in the past.
—Wang Limin, director of the World Wide Fund for Nature, Wuhan office[33]

A report of the expedition was published online in the journal Biology Letters on August 7, 2007, in which the authors conclude "We are forced to conclude that the baiji is now likely to be extinct, probably due to unsustainable by-catch in local fisheries"[34]

"Witness to Extinction: How We Failed To Save The Yangtze River Dolphin", an account of the 2006 baiji survey by Samuel Turvey, the lead author of the Biology Letters paper, was published by Oxford University Press in autumn 2008. This book investigated the baiji's probable extinction within the wider-scale context of how and why international efforts to conserve the species had failed, and whether conservation recovery programmes for other threatened species were likely to face similar potentially disastrous administrative hurdles.

Some reports suggest that information about the baiji and its demise is being suppressed in China.[35] Other reports cite government media English language reports in China Central Television and Xinhua News Agency as evidence to the contrary.[36]

In August 2007, Zeng Yujiang reportedly videotaped a large white animal swimming in the Yangtze in Anhui Province.[5][37] Wang Kexiong of the Institute of Hydrobiology of the Chinese Academy of Sciences has tentatively confirmed that the animal on the video is a baiji.

On October, 3, 2011 the sighting of almost 20 baiji was reported in Chinese media. The sighting was done from a bridge in Nanjing city. It should be noted however, that the sighting has not been confirmed by independent media sources.[38]

The lives of Finless porpoise are also at risk. On October 11, 2007, Chinese state media announced that under a development plan an additional 4,000,000 people will be relocated from their homes near the dam by the year 2020 due to ecological concerns, while a forum of officials and experts warned of a possible “environmental catastrophe” if preventive measures are not taken.[39][40][41] Currently, the quality of water in the Yangtze is falling rapidly, due to the dam's preventing dispersal of pollutants; algae blooms have risen progressively since the dam’s construction; and soil erosion has increased, causing riverbank collapses and landslides.[42] The report detailing this was officially released in September 2007.[43] Senior Chinese government officials and scholars said the dam could cause a “huge disaster ... if steps are not taken promptly.”[42] The same scholars and officials previously had defended the Three Gorges Dam project.[44] Xinhua also reported that tens of billions of yuan had been spent to prevent pollution and geological disasters by tree planting, measures to maintain species diversification, shutting down 1,500 polluting industrial and mining enterprises and building 70 sewage and waste treatment plants, all of which are "progressing well." [44]

References

  1. ^ Mead, James G.; Brownell, Robert L., Jr. (16 November 2005). "Order Cetacea (pp. 723-743)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14300143. 
  2. ^ a b c d Smith, B.D., Zhou, K., Wang, D., Reeves, R.R., Barlow, J., Taylor, B.L. & Pitman, R. (2008). "Lipotes vexillifer". IUCN Red List of Threatened Species. Version 2009.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/12119. Retrieved 05 October 2009. 
  3. ^ a b Miller, Gerrit S (1918). "A new river-dolphin from China". Smithsonian miscellaneous collections 68 (9): 1-12. http://biostor.org/reference/101516. 
  4. ^ a b c d "The Chinese river dolphin is functionally extinct". baiji.org. 2006-12-13. http://www.baiji.org/expeditions/1.html. Retrieved 2006-12-13. 
  5. ^ a b c "Rare Dolphin Seen in China, Experts Say". New York Times. 2007-08-30. http://www.nytimes.com/2007/08/30/world/asia/30china.html?ref=science. Retrieved 2007-08-30. 
  6. ^ "White dolphine appears from the brink". AFP. 2007-08-29. http://dsc.discovery.com/news/2007/08/29/whitedolphin_ani.html. Retrieved 2007-08-31. 
  7. ^ Culik, B. (2003). "Lipotes vexillifer, Baiji". http://www.animalinfo.org/refc.htm#convention%20mig%20spec%202004. Retrieved 2006-12-18. 
  8. ^ IWC. 2000. Report of the Standing Sub-Committee on Small Cetaceans. IWC/52/4. 52nd Meeting of the International Whaling Commission, Adelaide, Australia.
  9. ^ a b c d "Animal Info – Baiji". animalinfo.org. http://www.animalinfo.org/species/cetacean/lipovexi.htm. Retrieved 2006-12-18. 
  10. ^ Nowak, R.M. 1999. Walker's Mammals of the World. 6th Ed. The Johns Hopkins Univ. Press, Baltimore.
  11. ^ Reeves, R.R., Smith, B.D., Crespo,E.A. & Notarbartolo di Sciara, G. (eds.) (2003) Dolphins, Whales and Porpoises: 2002–2010 Conservation Action Plan for the World’s Cetaceans. IUCN/SSC Cetacean Specialist Group. IUCN, Glad, Switzerland and Cambridge, U.K.
  12. ^ a b c d e f "Report of the Workshop on Conservation of the Baiji and Yangtze Finless Porpoise". http://www.iucn.org/themes/marine/pdf/baiji_workshop_report.pdf. Retrieved 2006-12-03. [dead link]
  13. ^ a b Yongchen Wang (2007-01-10). "Farewell to the baiji". China Dialogue. http://www.chinadialogue.net/article/show/single/en/673-Farewell-to-the-baiji. Retrieved 2007-08-19. 
  14. ^ "Rescue Plan Prepared for Yangtze River Dolphins". China Daily. 2002-07-11. http://www.china.org.cn/english/environment/36657.htm. Retrieved 2006-12-18. 
  15. ^ "Last Chance for China's Dolphin". BBC News. 2006-06-27. http://news.bbc.co.uk/2/hi/science/nature/5122074.stm. Retrieved 2006-06-27. 
  16. ^ Adams, Douglas. Last Chance to See. 
  17. ^ Rare river dolphin 'now extinct'. BBC News.
  18. ^ Chen, P.; Liu, P., Liu, R., Lin, K., Pilleri, G. (1980). "Distribution, ecology, behaviour and protection of the dolphins in the middle reaches of the Changjiang River (Wuhan-Yueyang)". Oceanologica Limnologia Sinica 11: 73–84. 
  19. ^ Zhou, K.; Pilleri, G., Li, Y. (1980). "Observations on baiji (Lipotes vexillifer) and finless porpoise (Neophocaena asiaorientalis) in the lower reaches of the Chiang Jiang". Scientia sinica 23: 785–795. 
  20. ^ Zhou, K.; Li, Y., Nishiwaki, M., Kataoka, T. (1982). "A brief report on observations of the baiji (Lipotes vexillifer) in the lower reaches of the Yangtze River between Nanjing and Guichi". Acta Theriologica Sinica 2: 253–254. 
  21. ^ Lin, K.; Chen, P. and Hua, Y. (1985). "Population size and conservation of Lipotes vexillifer". Acta Zoologica Sinica 5: 77–85.  [translated by C.H. Perrin, edited by W.F. Perrin, Southwest Fisheries Science Center Administrative Report LJ-86-27}}
  22. ^ Chen, P. & Hua, Y. (1989) Distribution, population size and protection of Lipotes vexillifer. pp. 78–81 In W.F. Perrin, R. L. Brownell, Jr., K. Zhou and J. Liu (eds.), Biology and conservation of the river dolphins. Occasional Papers of the IUCN Species Survival Commission, No. 3.
  23. ^ Zhou, K. and Li, Y. 1989. Status and aspects of the ecology and behaviour of the baiji (Lipotes vexillifer) in the lower Yangtze River. pp. 86–91 In W. F. Perrin, R. L. Brownell Jr., K. Zhou and J. Liu (eds.), Biology and conservation of the river dolphins. IUCN Species Survival Commission Occasional Paper 3.
  24. ^ Chen, P.; Zhang, X., Wei, Z., Zhao, Q., Wang, X., Zhang, G. and Yang, J. (1993). "Appraisal of the influence upon baiji, Lipotes vexillifer by the Three-gorge Project and conservation strategy". Acta Hydrobiologica Sinica 17: 101–111. 
  25. ^ Zhou, K.; Sun, J. and Gao, A. (1993). "Photo-identification and population monitoring of the baiji (Lipotes vexillifer) on the lower Yangtze". Working paper presented to Baiji Population and Habitat Viability Workshop, Nanjing, China. June 1–4, 1993.. 
  26. ^ Zhou, K.; Sun, J. and Gao, A. (1993). "The population status of the baiji in the lower reaches of the Yangtze". Working paper presented to Baiji Population and Habitat Viability Workshop, Nanjing, China. June 1–4, 1993. 
  27. ^ Wang, D.; Zhang, X., Liu, R. (1998). "Conservation status and the future of baiji and finless porpoise in the Yangtze River of China". Report on the eight international symposium on river and lake environments. ISRLE'96, Wuhan, China.. 
  28. ^ "Conservation of the Yangtze River Dolphin: Emergency Implementation Meeting". http://baiji.org/fileadmin/pdf/EmergencyBaijiImplementationMeetingreport.pdf. Retrieved 2006-12-30. 
  29. ^ "INTERVIEW-Chinese river dolphin almost certainly extinct". Reuters AlertNet. 2006-12-13. http://www.alertnet.org/thenews/newsdesk/PEK307754.htm. Retrieved 2006-12-13. 
  30. ^ "Responsible Ecotourism at Tian-e-Zhou Oxbow Nature Reserve". baiji.org. http://www.baiji.org/initiatives/ecotourism-tian-e-zhou.html. Retrieved 2006-12-03. 
  31. ^ "Rare Yangtze dolphin may be extinct". http://english.hani.co.kr/arti/english_edition/e_entertainment/176223.html. Retrieved 2006-12-05. 
  32. ^ "White Dolphin Appears From the Brink". http://dsc.discovery.com/news/2007/08/29/whitedolphin_ani.html?category=animals&guid=20070829130000&dcitc=w19-506-ak-0001. Retrieved 2007-08-29. 
  33. ^ "Chinese River Dolphin (Baiji) Feared Extinct, Hope Remains for Finless Porpoise". WWF. 2006-12-15. http://releases.usnewswire.com/GetRelease.asp?id=77691. Retrieved 2006-12-15. 
  34. ^ Turvey, Samuel T.; Pitman, Robert L.; Taylor, Barbara L.; Barlow, Jay; Akamatsu, Tomonari; Barrett, Leigh A.; Zhao, Xuijiang; Reeves, Randall R.; Stewert, Brent S.; Wang, Kexiong; Wei, Zhuo; Zhang, Xianfeng; Pusser, L.T.; Richlen, Michael; Brandon, John R. & Wang, Ding (2007-08-07). "First human-caused extinction of a cetacean species?". Biology Letters (Royal Society Publishing) 3 (5): 537–40. doi:10.1098/rsbl.2007.0292. PMC 2391192. PMID 17686754. 10.1098/rsbl.2007.0292. http://www.journals.royalsoc.ac.uk/content/15782wq480207749/?p=cd62e89fd8884abaa16a65995a093b28&pi=0. Retrieved 2007-08-08. 
  35. ^ "R.I.P. Yangtse River Dolphin - Null Hypothesis". http://www.null-hypothesis.co.uk/science/straight-talking/science-mutters/sad_baiji_yangtse_river_dolphin. Retrieved 2006-12-21. 
  36. ^ "Endemic dolphin "extinction" mirrors Yangtze health decline". http://news.xinhuanet.com/english/2007-01/21/content_5632307.htm. 
  37. ^ "Extinct" white-flag dolphin spotted in Yangtze River
  38. ^ "南京市民发现近20头江豚现身长江大桥下". http://news.ifeng.com/society/2/detail_2011_10/03/9629926_0.shtml. 
  39. ^ BBC News, "Millions forced out by China dam", 10-13-07, retrieved 10-13-07.
  40. ^ Xinhua, "Millions more face relocation from Three Gorges Reservoir Area", 10-11-07, retrieved 10-14-07.
  41. ^ Xinhua, "China warns of environmental "catastrophe" from Three Gorges Dam", 09-26-07, retrieved 10-14-07.
  42. ^ a b Yang, Lin (October 12, 2007). "China's Three Gorges Dam Under Fire". Time. http://www.time.com/time/world/article/0,8599,1671000,00.html. 
  43. ^ "MWC News - A Site Without Borders - - China dam to displace millions more". Mwcnews.net. Agencies. http://mwcnews.net/content/view/17341&Itemid=1. Retrieved 2008-11-09. [dead link]
  44. ^ a b Mary Ann Toy, The Age AU, "Three Gorges Dam 'could be huge disaster'", 10-13-07, retrieved 10-13-07.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!