Overview

Brief Summary

Biology

Botos are usually observed either singly or in pairs although groups of up to 15 animals have been recorded (5). They appear to be most active during the early morning and late evening (5); slow swimmers they generally travel at around two kilometres per hour (2). Botos are reported to be playful and curious creatures, approaching boats and pulling on paddles as well as interacting with each other (2). Their flexible bodies allow botos to swim in shallow areas and to weave in and out of the trees in floodwaters; they are also known to swim upside down, possibly because their chubby cheeks make downwards vision difficult (2). Botos feed on a variety of fish and crab species (4); using echolocation to locate prey in the murky waters of the rainforest rivers (2). Females reach sexual maturity at between six and ten years of age and the gestation period is around 11 months (7). A single calf is born in July just as the water levels are beginning to drop, thus forcing fish back into the major waterways (7). The interval between births may be as much as five years, and botos are thought to live for as long as 30 years (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Description

The boto is probably the best known of the five river dolphins. It has an extremely distinctive shape with a long, plump body, paddle-shaped fins and a ridge along the back rather than a dorsal fin (4). The head consists of a bulging forehead (known as the 'melon'), small eyes, chubby cheeks and an extremely long beak, which may hold up to 140 teeth (2). Probably the most striking feature of the boto, however, is its colour, which varies from bluish grey to white (5), and even pink (2). Botos have extremely flexible necks, as some of the vertebrae are unfused; they are able to move their head in most directions (4). Local people have often regarded the boto with suspicion and there are a number of myths surrounding the species, such as one in which dolphins turn into handsome men in order to seduce young girls (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

South America, in rivers and lakes in Amazon and Orinoco drainage basins
  • UNESCO-IOC Register of Marine Organisms
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Botos occur throughout the Amazon and Orinoco river basins, from the deltas upstream to where impassable rapids, waterfalls, lack of water, and possibly low temperatures block their movement (Best and da Silva 1989a,b). Three geographic populations have been recognized as subspecies: I. g. geoffrensis in the Amazon basin, except for the Madeira drainage in Bolivia above the Teotonio rapids, I. g. boliviensis in the upper Madeira drainage, and I. g. humboldltiana in the Orinoco basin (Rice 1998).

Besides the Amazon mainstem, I. g. geoffrensis has been recorded in the Tocantins (and das Mortes and Verde affluents), Xingu, Tapajós, Madeira (below the Teotonio rapids), Purus, Juruá, Ucayali, and Marañon (and Samiria affluent) tributaries flowing generally north, and in the Negro, Caqueta (Japurá), Apaporis, Putumayo, Napo, and Tigre tributaries flowing generally south (partial list from Best and da Silva 1989a,b; Leatherwood 1996).

In addition to the Madeira mainstem above the Teotonio rapids, I. g. boliviensis has been reported from the Beni (and Orton affluent), Iténez or Guaporé Basin (and Verde and Iporuporé affluents), and Mamoré Basin and its tributaries and afluents: Pirai, Grande, Ichilo, Chapare, Ibaré, Tijamuchi, Apere, Yacuma and Yata (Pilleri and Gihr 1977, Aliaga-Rossel et al. 2006, Aliaga-Rossel 2010).

In the Orinoco system, besides the mainstem, I. g. humboldtiana has been recorded in the Apuré (and Portuguesa and Guanmar affluents), Capanaparo, Cinaruco, Meta, Bita, Vichada, Tomo, Tuparro, Guaviare (and Guayabero affluent), Inírida, and Atabapo (and Temi affluent) tributaries flowing south and east, and in the Aro, Caura, Parquaza, Ventauri (San Juan affluent) tributaries flowing north and west, as well as in the Casiquiare Canal, which connects the Orinoco with the Negro River (a tributary of the Amazon), above and below the two sets of rapids at Puerto Ayacucho, which are the principal barriers that may (or may not) separate the Amazon and Orinoco populations (as summarized in Pilleri and Gihr 1977; Best and da Silva 1989a,b; Meade and Koehnken 1991). Botos have been seen crossing the first set of rapids at Puerto Ayacucho (Atures) during high water (Fernando Trujillo pers. comm. to B.D. Smith).

The map shows where the species may occur. The species has not been recorded for all the states within the hypothetical range as shown on the map. States for which confirmed records of the species exist are included in the list of native range states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Inia geoffrensis (boto or Amazon River dolphin) can be found in the Amazon and Orinoco river basins and their main tributaries in Bolivia, Brazil, Colombia, Ecuador, Peru, and Venezuela. Their distribution covers approximately 7 million square kilometers and is limited mainly by marine waters, impassable rapids, waterfalls, and excessively shallow parts of the rivers. Three subspecies are recognized, with each subspecies occupying a different area of these river systems: I. g. geoffrensis occupies the central Amazon River basin; I. g. humboldtiana resides in the Orinoco River basin; and I. g. boliviensis can be found in the upper Madeira River, cut off from the Amazon River by impassable rapids. The current distribution of this species does not appear to differ significantly from its estimated distribution in the past.

Biogeographic Regions: neotropical (Native )

  • Best, R., V. da Silva. 1993. Inia geoffrensis. Mammalian Species, 426: 1-8.
  • da Silva, V. 2002. Amazon River Dolphin. Pp. 18-20 in W Perrin, B Würsig, J Thewissen, eds. Encyclopedia of Marine Mammals. San Diego: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The boto is found in the drainage basins of the Amazon and Orinoco Rivers in South America (7). It is known from Peru, Ecuador, Brazil, Bolivia, Venezuela and Columbia and Guyana (1); botos can be found as far as 3,000 kilometres from the coast (2). Some experts recognise different subspecies within the range of the boto; Inia geoffrensis humboldtiana in the Orinoco basin, I. g. boliviensis in the upper Madeira River and I. g. geoffrensis in the remainder of the Amazon basin (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Inia geoffrensis is the largest of the river dolphins, with males achieving a length of up to 2.55 m (average: 2.32 m) and a mass of up to 207 kg (average: 154 kg). Females are smaller, getting up to 2.18 m (average: 2.00 m) in length and 154 kg (average: 100 kg) in mass. This difference in size marks this species as one of the most sexually dimorphic cetaceans, and having larger males makes it unique among river dolphins, where females are generally the larger sex.

Body color varies with age, with young individuals being dark gray and adults possessing a solid or blotched pink hue, although males have been found to be significantly pinker than females. Some adults are darker on their dorsal surface than others, and it is thought that coloration may depend on temperature, clarity of water, and geographic location.

Their bodies appear to be rather fat and heavy, but they are very flexible. None of their cervical vertebrae are fused, which allows them to move their heads in all directions. They possess broad triangular flukes and wide pectoral flippers, which sometimes possess a sixth phalanx. Their long humeri enable their flippers to move in a circular motion, giving them exceptional maneuverability when navigating through vegetation in flooded forests. However, these characters also restrict the overall speed of swimming.

The skulls of I. geoffrensis are less asymmetrical than other odontocetes, but torsion of the prominent rostra and mandibles is not uncommon. Their eyes are small, yet they seem to have good vision both above and underwater. They also have small, flaccid melons on their foreheads that can be shaped by muscular control when used for echolocation.

Botos are distinguished from other river dolphins by several characteristics. On top of their rostrums, they have diagnostic stiff vibrissae. They possess heterodont dentition as well, with their anterior teeth being conical and their posterior teeth having flanges on the lingual portions of the crowns. They also have long, low dorsal keels (from 30 to 61 cm in length) rather than the typical triangular dorsal fins of other dolphins. Inia geoffrensis can be distinguished from Sotalia fluviatilis (tucuxis), a sympatric species of river dolphin, by their color, the mobility of their head and flippers, and their diving behavior.

Range mass: 98.5 to 185 kg.

Range length: 1.24 to 2.55 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger; male more colorful

  • Best, R., V. da Silva. 1989. Amazon River Dolphin, Boto, Inia geoffrensis (de Blainville, 1817). Pp. 1-23 in S Ridgway, R Harrison, eds. Handbook of Marine Mammals: River Dolphins and the Larger Toothed Whales. London: Academic Press.
  • Martin, A., V. da Silva. 2006. Sexual dimorphism and body scarring in the boto (Amazon River dolphin) Inia geoffrensis . Marine Mammal Science, 22: 25-33.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Botos swim into flooded forests in the high-water season and often search for prey among the roots and trunks of partially submerged trees. Mark/recapture studies have shown that some individuals are resident to specific areas year-round (Martin and da Silva 2004a), whereas others move several tens to hundreds of kilometers within the rivers, but there does not appear to be any actual seasonal migration (Martin and da Silva 2004a).

Botos are generally concentrated below channel confluences (Magnusson et al. 1980; Mead and Koehnken 1991; Leatherwood 1996; Vidal et al. 1997; Leatherwood et al. 2000), with mixing of white and black waters (Martin et al. 2004). Their affinity for confluences diminishes during the high water season, probably because the animals move into appended lakes and flooded forests (Leatherwood 1996; Leatherwood et al. 2000; Martin and da Silva 2004b). They occur most often within 150 m of the edges of rivers, with lower densities in the centers of large rivers (Martin et al. 2004).

Botos feed on a large variety of fishes (over 43 species), generally near the bottom (see Best and da Silva 1993; da Silva 2002).

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Within the aforementioned river systems, botos can be found in nearly all types of microhabitats, including in main rivers, small channels, mouths of rivers, lakes, and just below waterfalls and rapids. The water level cycle exerts the strongest influence on habitat use by these dolphins during different parts of the year, both directly, by determining which areas are navigable, and indirectly, by dictating where fish are most abundant. During the dry season, Inia geoffrensis is most abundant in the main river channels because smaller water channels are too shallow and prey items are concentrated along the margins of these rivers. During the wet season, botos can easily navigate smaller tributaries, and individuals even venture into river floodplains and flooded forests. Males and females appear to have different habitat preferences, with males returning to main river channels while water levels are still rising and females and their calves continuing farther inland. Females and calves may remain in the floodplains longer for several reasons. The calmer waters could prevent young botos from getting drawn away by strong river currents, allowing them to rest, nurse, and catch fish in a calmer environment. They may also be at a lower risk of aggression from adult males and predation from other species.

Habitat Regions: tropical ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; temporary pools

  • Martin, A., V. da Silva. 2004. River dolphins and flooded forest: seasonal habitat use and sexual segregation of botos (Inia geoffrensis) in an extreme cetacean environment. Journal of the Zoological Society of London, 263: 295-305.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These freshwater dolphins are found in slow-moving rivers and streams. During the wet season when waters rise and flood nearby forests, botos will also leave the deeper channels and are agile enough to swim through the trees (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

A single boto’s stomach may contain more species of fish than the total number of prey species seen in other dolphins. Their very diverse diet includes at least 43 different species of fish in 19 families, with prey items ranging in size from 5-80 cm (average: 20 cm). They apparently prefer fish from the families Sciaenidae (drums or croakers), Cichlidae (cichlids), Characidae (characins and tetras), and Serrasalmidae (piranhas), but their heterodont dentition allows them to crush armored prey as well, including river turtles (Podocnemis sextuberculata) and crabs (Poppiana argentiniana). Their diet is most diverse during the wet season, when the fish spread out into the floodplain and are more difficult to catch, and becomes more selective during the dry season when fish densities are higher.

Botos are usually solitary feeders, most active between 0600-0900 hours and 1500-1600 hours and consuming about 2.5% of their body weight every day. They often hang out near waterfalls and river mouths where river currents disrupt schools of fish and make them easier to catch. They also make use of disturbances made by canoes to catch disoriented prey. Sometimes they even form loose aggregations with Sotalia fluviatilis (tucuxis) and Pteronura brasiliensis (giant otters) to hunt fish in a coordinated fashion, herding and attacking shoals of fish together. Apparently, there is little competition between these species, as each prefers different types of fish. In addition, food sharing has actually been observed between botos in captivity.

Animal Foods: reptiles; fish; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

The diverse diet of Inia geoffrensis causes it to have an impact on a number of different species. Of its prey items, botos may have the largest effect on the family Sciaenidae, since they seem to prefer these species. They have also formed mutualistic relationships with Sotalia fluviatilis (tucuxis) and Pteronura brasiliensis (giant otters) by forming coordinated hunting groups with them. Botos have several parasitic trematodes and nematodes, many of which are host-specific. If the crescent-shaped wounds seen on botos can indeed be attributed to catfish from the family Trichomycteridae, then they have an ectoparasite as well.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

There are no known records of a natural predator of botos, but black caimans (Melanosuchus niger), bull sharks (Carcharhinus leucas), anacondas (Eunectes), and jaguars (Panthera onca) are potentially capable of handling them. Some botos also possess crescent-shaped wounds that have been attributed to catfish of the families Cetopsidae and Trichomycteridae.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Inia geoffrensis uses echolocation to catch prey, navigate, and perceive its environment. The frequency of these clicks does not appear to be significantly different from that of Tursiops truncatus, with 45 kHz being a dominant frequency. These clicks, which range from 16-170 kHz, are also used to communicate between individuals. Botos in captivity have been shown to make 10 distinct calls, including echolocation-like burst click runs, barks, whimpers, squeaks, and cracks. They also appear to use open mouths when communicating, as suggested by some tooth rake scars seen on all individuals.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; acoustic ; echolocation

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longevity of Inia geoffrensis in the wild is unknown, but healthy individuals in captivity can live from 10-26 years. However, the average longevity of captive botos has been reported to be only about 33 months.

Range lifespan

Status: captivity:
26 (high) years.

Average lifespan

Status: captivity:
3 years.

Average lifespan

Status: wild:
30.0 years.

Average lifespan

Status: captivity:
18.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 31.3 years (captivity) Observations: It is estimated that these animals can live up to 30 years in the wild (http://www.demogr.mpg.de/longevityrecords), but maybe longer. One captive specimen lived 31.3 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Little is known about the mating system of Inia geoffrensis. Before it was determined that this species exhibited sexual dimorphism, some workers postulated that botos were monogamous. However, males are now known to be larger than females, and very aggressive sexual behavior in males has been observed. Some authors have observed hostility between pink botos in the wild, while others have noted extremely aggressive activity during copulation in captivity. Males also have a higher degree of damaged fins, flukes, and blowholes due to biting and abrasion, in addition to more abundant scarring due to tooth-raking. This evidence suggests that there may be intense competition for access to females. This might indicate a polygynous mating system, but polyandry and promiscuity cannot be ruled out.

Courting and foreplay have been observed for botos in captivity. Males seem to initiate sexual activity by nibbling at the flippers or flukes of females, but if the females are not receptive, they might respond aggressively. This might not deter the males, however, who may still try and copulate with her. Copulation has been observed to be very frequent (one pair in captivity copulated 47 times in less than 3.5 hours) and to occur in three different positions: facing ventrally at right angles, lying parallel head-to-head, and head-to-tail.

Male botos reach sexual maturity at about 2.0 m in length, while females attain sexual maturity when they are 1.60-1.75 m long. Reproduction is seasonal, with births occurring between May and July. This birthing period corresponds with peak water levels in rivers, and since females remain in flooded areas longer than males, this offers several advantages. As water levels begin to decrease, the density of prey items in flooded areas begins to increase due to loss of habitat, offering easy access to nourishment for fueling the high energy demands of giving birth and nursing. The gestation period is estimated to be about 11 months, and births in captivity took from 4-5 hours. Mothers give birth to single calves, and once the umbilical cords break, they help their calves to the surface for air. Inia geoffrensis calves are about 0.80 m long at birth and have been shown to grow about 0.21 m per year in captivity. Mothers lactate for well over a year, and several individuals are known to have been lactating and pregnant simultaneously. The interval between births is estimated as being between 15-36 months, and the calving period is 2-3 years.

Breeding interval: Botos breed once every year

Breeding season: Botos breed between June and August

Range number of offspring: 1 to 1.

Average gestation period: 11 months.

Average weaning age: 12 months.

Average time to independence: 2-3 years.

Average age at sexual or reproductive maturity (female): 5 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 6800 g.

Average gestation period: 287 days.

Average number of offspring: 1.

The rather long periods of lactation and calving observed in Inia geoffrensis signify a strong mother-calf bond. Most boto pairs seen in the wild are mothers with their calves, and one pair in captivity was inseparable for three years. Some authors have suggested that this long period of parental care may be for learning and development of the young, as seen in bottlenosed dolphins (Tursiops truncatus).

Parental Investment: precocial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); extended period of juvenile learning

  • Brownell, R. 1984. Review of Reproduction in Platanistid Dolphins. Report of the International Whaling Commission, Special Issue 6: 149-158.
  • Best, R., V. da Silva. 1989. Amazon River Dolphin, Boto, Inia geoffrensis (de Blainville, 1817). Pp. 1-23 in S Ridgway, R Harrison, eds. Handbook of Marine Mammals: River Dolphins and the Larger Toothed Whales. London: Academic Press.
  • Best, R., V. da Silva. 1989. Biology, Status and Conservation of Inia geoffrensis in the Amazon and Orinoco River Basins. International Union for Conservation of Nature and Natural Resources (IUCN), Species Survival Commission, Occasional Paper 3: 22-34.
  • Best, R., V. da Silva. 1993. Inia geoffrensis. Mammalian Species, 426: 1-8.
  • Best, R., V. da Silva. 1984. Preliminary Analysis of Reproductive Parameters of the Boutu, Inia geoffrensis, and the Tucuxi, Sotalia fluviatilis, in the Amazon River System. Report of the International Whaling Commission, Special Issue 6: 361-369.
  • Caldwell, M., D. Caldwell, R. Brill. 1989. Inia geoffrensis in Captivity in the United States. International Union for Conservation of Nature and Natural Resources (IUCN), Species Survival Commission, Occasional Paper 3: 35-41.
  • Harrison, R., R. Brownell. 1971. The Gonads of the South American Dolphins, Inia geoffrensis, Pontoporia blainvillei, and Sotalia fluviatilis . Journal of Mammalogy, 52: 413-419.
  • Martin, A., V. da Silva. 2006. Sexual dimorphism and body scarring in the boto (Amazon River dolphin) Inia geoffrensis . Marine Mammal Science, 22: 25-33.
  • McGuire, T., K. Winemiller. 1998. Occurrence Patterns, Habitat Associations, and Potential Prey of the River Dolphin, Inia geoffrensis, in the Cinaruco River, Venezuela. Biotropica, 30: 625-638.
  • da Silva, V. 2002. Amazon River Dolphin. Pp. 18-20 in W Perrin, B Würsig, J Thewissen, eds. Encyclopedia of Marine Mammals. San Diego: Academic Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Inia geoffrensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATAGACCGTTGACTGTTCTCAACAAACCACAAAGACATCGGAACTCTCTATCTACTATTCGGAGCCTGAGCAGGAATAGTGGGTACTGGCTTAAGCATACTAATTCGTGCAGAACTTGGACAACCCGGTACACTAATCGGAGATGATCAAATCTATAATGTACTAGTGACAGCACACGCCTTCGTAATAATTTTCTTCATAGTTATACCTATCATAATTGGTGGTTTCGGAAACTGATTAGTTCCTCTGATAATCGGAGCACCTGATATAGCCTTCCCTCGTCTAAATAACATAAGCTTCTGATTATTACCCCCTTCCTTCCTATTACTAATAACATCCTCAGTAATTGAAGCTGGCGCAGGCACCGGATGGACTGTCTATCCCCCTCTGGCCGGAAATTTAGCACACGCAGGAGCCTCTGTAGACCTTACTATTTTCTCCCTTCACCTAGCAGGCGTATCCTCAATTCTTGGAGCCATTAATTTTATTACAACTATTATTAATATAAAACCACCCGCTATAACCCAATACCAAACCCCACTCTTCGTGTGGTCAATCCTAGTCACAGCTGTATTACTCCTACTATCACTACCCGTTCTGGCAGCCGGAATTACTATACTACTAACAGACCGAAACCTAAATACAACCTTCTTCGATCCAGCAGGAGGGGGCGACCCAATTCTCTACCAACACTTATTCTGATTCTTTGGCCACCCCGAAGTATATATTCTTATTCTACCCGGTTTTGGAATAGTCTCACACATTGTAACCTATTACTCAGGAAAAAAAGAACCTTTCGGGTACATAGGAATGGTTTGAGCCATAATCTCCATTGGGTTTTTAGGCTTCATCGTATGAGCTCACCACATGTTCACAGTTGGAATAGACGTAGACACACGAGCATATTTCACATCAGCCACTATAATTATTGCAATTCCAACAGGGGTAAAAATCTTCAGCTGATTAGCAACCCTCCATGGAGGTAATATCAAATGATCTCCTGCCCTAATATGAGCTTTAGGGTTCATCTTCTCATTTACTGTCGGAGGCCTAACTGGTATCATCCTAGCAAACTCGTCTCTAGATATTGTTCTCCATGACACCTATTACGTAGTAGCCCATTTCCACTATGTACTCTCAATAGGAGCTGTCTTTGCCATCATAGGGGGCTTTGTCCACTGATTCCCATTATTCTCAGGCTATACACTAAACCCAACATGGGCAAAAATTCACTTCGTAGTTATATTTGTAGGTGTAAACATAACATTTTTCCCACAACACTTTCTAGGCCTATCAGGAATACCTCGACGGTACTCCGACTACCCAGATGCTTACACAATGTGAAACACCATTTCATCAATAGGTTCTTTCATTTCACTAACAGCAGTCATACTAATAATTTTCATCATCTGAGAAGCATTCGCATCTAAACGAGAAGTACTGGCAGTCGAACTCACTACCACAAATCTTGAGTGATTAAACGGATGTCCCCCACCATACCACACATTCGAAGAACCAGTATACATTAACCTAAAACGATCAAGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Inia geoffrensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Reeves, R.R., Jefferson, T.A., Karczmarski, L., Laidre, K., O’Corry-Crowe, G., Rojas-Bracho, L., Secchi, E.R., Slooten, E., Smith, B.D., Wang, J.Y. & Zhou, K.

Reviewer/s
Brownell Jr., R.L. & Cooke, J.

Contributor/s

Justification
The species was previously listed as Vulnerable but is now considered Data Deficient due to the limited amount of current information available on threats, ecology, and population numbers and trends. In areas where botos have been studied, they appear widespread and relatively abundant. However, these areas represent only a small proportion of the species’ total range and often are places where the dolphins have some protection. Therefore, the impressions from those areas may not be representative. Also, much of the information summarized in this assessment is dated and may no longer be valid.

History
  • 1996
    Vulnerable
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Vulnerable
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Human activities are exerting a lot of pressure on Inia geoffrensis populations. There have been many negative interactions with fisheries. As fishing technologies have improved, the incidental catching of botos has greatly increased. They have also been harpooned, shot, and poisoned for stealing fish out of nets and damaging the fishing equipment. A greater human demand for fish decreases the abundance of potential prey items for botos as well.

Hydroelectric dams have been problematic in several ways. They decrease the available food supply by preventing various species of fish from migrating downstream, while also decreasing the oxygen level downstream. Dams split up populations of I. geoffrensis, potentially reducing gene pools in these subpopulations to levels where they may not have enough genetic diversity to survive, thereby increasing the risk of extinction.

Deforestation for agriculture in floodplains reduces fish populations by eliminating the fruits and seeds in the flooded forests that they feed upon, thus decreasing the potential food supply for botos. The rivers inhabited by I. geoffrensis are polluted by pesticides from agricultural fields and heavy metals (including mercury) from gold refining, which negatively affect both botos and their prey items.

Inia geoffrensis is classified as vulnerable by the IUCN. They have traditionally been difficult to keep in captivity, due to aggression and fairly short longevity. If boto numbers begin to dwindle to dangerously low levels in the wild, it would be alarming because populations may not be able to be maintained for long in captivity.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: no special status

  • Vidal, O. 1993. Aquatic Mammal Conservation in Latin America: Problems and Perspectives. Conservation Biology, 7: 788-795.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1), and listed on Appendix II of the Convention on Migratory Species (CMS or Bonn Convention) (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In the Amazon basin, data are available on abundance and encounter rates for only a few river segments: 107 individuals counted (0.19 dolphins/km; ± 0.06) in a 490-km segment of the Solimões River, Brazil in August 1979 (Magnusson et al. 1980); 0.22 dolphins/km (± 0.04) observed in a 1525-km segment of the Solimões River, Brazil during four surveys in March 1983- February 1984 (Best and da Silva 1989b); 78 individuals counted and 346 individuals estimated (CV=0.12) using line and strip transect methods in a 120-km segment (ca. 250 km²) of the Amazon River bordering Peru and Colombia, including the Atacuari, Loretoyacu, and Amacayacu tributaries, and the Caballo Cocha and Tarapoto-El Correo lake systems in June 1993 (Vidal et al. 1997); 0.147 dolphins/km (± 0.121) observed in a 232-km segment of the Amazon-Marañon River, Peru during 11 surveys in March-August 1991-1993 (Leatherwood and Reeves 1995a); 0.41-0.50 dolphins/km observed in a 95-km segment of the Tigre River, Peru during 14 surveys in March-August 1991-1994 (Leatherwood and Reeves 1995b); and 260 ± 50 individuals in 225 km² of the Mamirauá Lake system of Brazil - extrapolated to about 13,000 individuals in the 11,240 km² Mamirauá Sustainable Development Reserve (Martin and da Silva 2004a).

Counts and encounter rates for segments of the Orinoco basin include: 122 individuals counted (1.16 dolphins/km) in a 105-km segment of the Apuré River, Venezuela in 1981 (Pilleri et al. 1982); 0.20 dolphins/km observed in a 201-km segment of the Apuré River, Venezuela in July-August 1989 (Schnapp and Howroyd 1992); 14-15 individuals counted (0.024 dolphins/km) in a 450-km segment of the Orinoco River, Venezuela in 1981 (Pilleri et al. 1982); 8 individuals counted (0.025 dolphins/km) in a 340-km segment of the Casiquiare River, Venezuela in 1981 (Pilleri et al. 1982).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Threats include incidental mortality in fishing gear, deliberate killing for fish bait and attractant and for predator control, damming of rivers (although this is, at present, less of a problem than for the river cetaceans in Asia), and environmental pollution from organochlorines and heavy metals (see da Silva 2002; IWC 2007; Reeves et. Al. 1999).

The Mura Indians hunted botos near Barro do Rio Negro, Brazil during the nineteenth century (Pilleri and Arvy 1981) and the Tucuna and Cocama Indians may have killed them in the Amazon near Leticia (Allen and Neil 1958; Layne and Caldwell 1964) and the lower Ucayali River (Mohr 1964), respectively, until at least the 1950s.

Between 1956 and the early 1970s, more than 100 botos were live-captured and exported mostly to the U.S. and Europe (Brownell 1984) and (a few) to Japan (Tobayama and Kamiya 1989). However, in recent decades, there have been no reported live-captures and exports.

Incidental mortality has not been studied systematically in most areas. However, similar to other small cetaceans, botos are vulnerable to entanglement in a variety of nets (lampara seine nets, fixed gill nets, drifting gill nets; Best and da Silva 1993; Martin et al. 2004) as well as to drop traps intended to catch large fish or manatees in the flooded forest in Peru (Leatherwood 1996)

There is an emergent, but already large-scale, problem involving the deliberate killing of botos in Brazil for fish attractant (IWC 2007). Botos are also killed deliberately in some areas because fishermen regard them as competitors and because the dolphins damage fishing nets (F. Trujillo pers. comm. to B.D. Smith).

Fishing with explosives, although illegal in most areas, is common in some areas of the Amazon Basin (Goulding 1983; Smith 1985). This fishing technique threatens botos due to the concussive effects of explosions. Fishermen also reportedly attempt to kill dolphins that are attracted to prey on the stunned or dead fish (Best and da Silva 1989a).

Water development projects have not been as extensive in the Amazon and Orinoco basins as in Asian rivers inhabited by cetaceans. A population of botos was isolated above the Tucuruí dam in the Tocantins River, but there is no information on their current status. The Balbina dam in the Uatuma River may have isolated botos but there is no information on historic or current occurrence of dolphins in this river. Both of these dams in the Amazon basin, and the Guri dam in the Caroní, an Orinoco tributary, have probably degraded downstream habitat due to their effects on flow and temperature regimes (see Ward and Stanford 1989; Ligon et al. 1995; Kondolf 1997). There are many more proposed dams, especially for northward flowing Amazon tributaries that, if built, would restrict dolphin movements (Best and da Silva 1989a) and probably degrade their habitat.

Mercury is often used to separate gold from soil and rock in mining operations along the Amazon (Pfeiffer ,i>et al. 1993). In the Madeira River almost 60% of children under five years old had accumulated levels of mercury, presumably from eating contaminated fish, high enough to cause neurological damage (Boischio and Henshel 1996). A study of mercury in the sediments and floating plants in the Tucuruí Reservoir of the former Tocantins River, Brazil, emphasized the risk of mercury accumulation in the bed of non-flowing waters (Aula et al. 1995). The effects of the bioaccumulation of mercury in botos are unknown but the high levels recorded in the Amazon ecosystem give reason for concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the most widespread of the river dolphins, botos are threatened by the continued development of the river systems in which they are found (8). Hydroelectric or irrigation schemes that dam rivers act to isolate dolphins in smaller sections of their habitat. These dolphins were previously associated with bad spirits which has perhaps protected them from persecution (7). However, they are now coming into increased conflict with local fisherman who may view the species as competition (8). Dolphins are also caught or injured accidentally during the fishing process; either as bycatch in nets or through collisions with boats and motors (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The species is in Appendix II of CITES.

Research is needed to evaluate better the impact of threats, and to design effective conservation measures.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The boto is fully protected by law in both Brazil and Bolivia and is partially protected in areas of Peru, Venezuela and Colombia (4). It is found within the Amazon River Global 200 Ecoregion, which is receiving some degree of international protection and recognition (7). These bizarre-looking pink dolphins have attracted a lot of attention and now support a tourist trade (5); perhaps this interest will be sufficient to preserve the future of this mysterious river dweller.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

While there is little overlap between the fish that Inia geoffrensis prefers and the species that fisheries seek, botos have been known to tear fish from nets, causing damage to expensive fishing gear and, in some cases, a drastic reduction in fish catch.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There is little direct hunting of botos by native people, although Portuguese colonists may have hunted them to obtain oil for lamps. If botos are found dead, native people may use the fat as a cure for asthma and the oil to treat rheumatic pains or even infections in their cattle. They sometimes use the eyes, genitalia, and teeth as love charms and amulets as well. However, they never use the meat or skin. In addition, fishermen have been known to use botos to lead them to schools of fish.

Positive Impacts: body parts are source of valuable material; source of medicine or drug

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Risks

IUCN Red List Category

Data Deficient (DD)
  • IUCN (2008) Cetacean update of the 2008 IUCN Red List of Threatened Species.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amazon river dolphin

The Amazon river dolphin, or pink river dolphin, Inia geoffrensis, is a freshwater river dolphin endemic to the Orinoco, Amazon and Araguaia/Tocantins River systems of Brazil, Peru, Bolivia, Ecuador, Colombia, and Venezuela. It was previously listed as a vulnerable species by the IUCN due to pollution, overfishing, excessive boat traffic, and habitat loss, but in 2011 it was changed to data deficient due to a lack of current information about threats, ecology, and population numbers and trends.[1]

Other common names of the species include boto, boto cor-de-rosa, boto vermelho, bouto, bufeo, tonina, and pink dolphin.[1]

Description[edit]

The Amazon river dolphin is one of the river dolphins formerly included in the superfamily Platanistoidea, making it paraphyletic; it has since been moved to Inioidea. Although not a large cetacean in general terms, this dolphin is the largest freshwater cetacean; it can grow larger than a human. Body length can range from 1.53 to 2.4 m (5.0 to 7.9 ft), depending on subspecies. Females are typically larger than males. The largest female Amazon river dolphins can range up to 2.5 m (8.2 ft) in length and weigh 98.5 kg (217 lb). The largest male dolphins can range up to 2.0 m (6.6 ft) in length and weigh 94 kg (207 lb).[2][3]

They have unfused neck vertebrae, enabling them to turn their heads 90°. Their flexibility is important in navigating through the flooded forests. Also, they possess long beaks which contain 24 to 34 conical and molar-type teeth on each side of the jaws.[4]

In colour, these dolphins can be either light gray or carnation pink.

Taxonomy[edit]

The species was described by Henri Marie Ducrotay de Blainville in 1817. Rice's 1998 classification[5] lists a single species, Inia geoffrensis in the genus Inia, with three recognised subspecies. Some older classifications, as well as some recent publications,[6] listed the boliviensis population as a separate species. In 2012 the Society for Marine Mammalogy[7] began considering the Bolivian (I. g. boliviensis) and Amazonian (I. g. geoffrensis) subspecies as full species Inia boliviensis and Inia geoffrensis, respectively; however, many of the scientific community consider the I. g. boliviensis population to be a subspecies of I. geoffrensis. The genus Inia separated from its sister taxon during the Miocene epoch.[8]

The two currently recognized species are:

  • I. g. geoffrensis — distributed in the Amazon and Araguaia/Tocantins basins (excluding the Madeira River drainage, upstream of the Teotonio Rapids in Rondônia)
  • I. g. humboldtiana — distributed in the Orinoco basin
  • I. boliviensis — distributed in the Bolivian subbasin of the Amazon basin upstream of the Teotonio Rapids in Rondônia

The Amazon river dolphin is closely related to the newly identified Araguaian river dolphin, which is believed to have become physically separated and diverged into two separate species. Araguaian botos have fewer rows of teeth than their closely related Amazon botos.[9]

Ecology[edit]

The Amazon river dolphin is found throughout the Amazon and Orinoco. It is particularly abundant in lowland rivers with extensive floodplains. During the annual rainy season, these rivers flood large areas of forests and marshes along their banks. The Amazon river dolphin specialises in hunting in these habitats, using its unusually flexible neck and spinal cord to maneuver among the underwater tree trunks, and using its long snout to extract prey fish from hiding places in hollow logs and thickets of submerged vegetation.

When the water levels drop, the dolphins move either into the main river channels or into large lakes in the forest, and take advantage of the concentrated prey in these reduced water bodies. They feed on crustaceans, crabs, small turtles, catfish, shrimp, and piranha and other fish.[4]

Behavior[edit]

Adult males have been observed carrying objects in their mouths, objects such as branches or other floating vegetation, or balls of hardened clay. The males appear to carry these objects as a sociosexual display which is part of their mating system. The behaviour is "triggered by an unusually large number of adult males and/or adult females in a group, or perhaps it attracts such into the group. A plausible explanation of the results is that object carrying is aimed at females and is stimulated by the number of females in the group, while aggression is aimed at other adult males and is stimulated by object carrying in the group."[10]

The male reaches sexual maturity at about 2 m (6.6 ft) and the female at about 1.7 m (5.6 ft). Most calves are born between July and September after a gestation period of 9 to 12 months; they are about 0.81 m (2.7 ft) long at birth and weigh about 6.8 kg (15 lb).[4] The young follow their parents closely for a few months, and often two adults are seen swimming with two or more small juveniles.

Human interaction[edit]

A trained Amazon river dolphin at the Acuario de Valencia

The Amazon river dolphin is listed on appendix II[11] of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). It is listed on Appendix II as it has an unfavourable conservation status or would benefit significantly from international co-operation organized by tailored agreements. In September 2012, Bolivian President Evo Morales enacted a law to protect the dolphin and declared it a national treasure.[12]

The region of the Amazon in Brazil has an extension of 5 million km2 containing diverse fundamental ecosystems.[13][14] One of these ecosystems is a floodplain, or a várzea forest, and is home to a large number of fish species which are an essential resource for human consumption.[15] The várzea is also a major source of income through excessive local commercialized fishing.[13][16][17] Várzea consist of muddy river waters containing a vast number and diversity of nutrient rich species.[10] The abundance of distinct fish species lures the Amazon River dolphin into the várzea areas of high water occurrences during the seasonal flooding.[18]

In addition to attracting predators such as the Amazon river dolphin, these high-water occurrences are an ideal location to draw in the local fisheries. Human fishing activities directly compete with the dolphins for the same fish species, the tambaqui (Colossoma macropomum) and the pirapatinga (Piaractus brachypomus), resulting in deliberate or unintentional catches of the Amazon river dolphin.[19][20][21][13][22][23][24][25] The local fishermen overfish and when the Amazon River dolphins remove the commercialized fish from the nets and lines, it causes damages to the equipment and the capture, as well as a negative reaction from the local fishermen.[21] [23][24] The negative reactions of the local fishermen is also attributed to the Brazilian Institute of Environment and Renewable Natural Resources prohibiting from killing the Amazon river dolphin, yet not compensating the fishermen for the damage done to their equipment and capture.[25]

During the process of catching the commercialized fish, the Amazon river dolphins get caught in the nets and exhaust themselves until they die, or the local fishermen deliberately kill the dolphins that become entangled in their nets.[15] The carcasses are discarded, consumed, or used as bait to attract a scavenger catfish, the piracatinga.[15][26] The use of the Amazon river dolphin carcass as bait for the piracatinga dates back from 2000.[26] The increasing consumption demand by the local inhabitants and Colombia for the piracatinga has created a market for distribution of the Amazon river dolphin carcasses to be used as bait throughout these regions.[25]

Of the 15 dolphins found in the Japurá River, 73% of the carcasses were killed for bait, disposed of, or abandoned in entangled gillnets.[15] The data do not fully represent the actual overall number of deaths of the Amazon river dolphins, whether accidental or intentional, because a variety of factors make it extremely complicated to record and medically examine all the carcasses.[15][20][23] Scavenger species feed upon the carcasses and the complexity of the river currents make it nearly impossible to locate all the carcasses.[15] More importantly, the local fishermen do not report these deaths out of fear that a legal course of action will be taken against them,[15] as the Amazon river dolphin and other cetaceans are protected under the Brazilian federal law prohibiting any takes, harassments, and kills of the species.[27]

Cultural references[edit]

In traditional Amazon River folklore, at night, an Amazon river dolphin becomes a handsome young man who seduces girls, impregnates them, and then returns to the river in the morning to become a dolphin again. This dolphin shapeshifter is called an encantado. The myth has been suggested to have arisen partly because dolphin genitalia bear a resemblance to those of humans. Others believe the myth served (and still serves) as a way of hiding the incestuous relations which are quite common in some small, isolated communities along the river.[28] In the area, tales relate it is bad luck to kill a dolphin. Legend also states that if a person makes eye contact with an Amazon river dolphin, he or she will have lifelong nightmares. Local legends also state the dolphin is the guardian of the Amazonian manatee, and that, should one wish to find a manatee, one must first make peace with the dolphin.

Associated with these legends is the use of various fetishes, such as dried eyeballs and genitalia.[28] These may or may not be accompanied by the intervention of a shaman. A recent study has shown, despite the claim of the seller and the belief of the buyers, none of these fetishes is derived from the boto. They are derived from Sotalia guianensis, are most likely harvested along the coast and the Amazon River delta, and then are traded up the Amazon River. In inland cities far from the coast, many, if not most, of the fetishes are derived from domestic animals such as sheep and pigs.[29]

See also[edit]


References[edit]

  1. ^ a b c R.R. Reeves, T.A. Jefferson, L. Karczmarski, K. Laidre, G. O'Corry-Crowe, L. Rojas-Bracho, E.R. Secchi, E. Slooten, B.D. Smith, J.Y. Wang, & K. Zhou (2011). "Inia geoffrensis". IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature and Natural Resources. 
  2. ^ "Animal Info - Boto (Amazon river dolphin)". Animal Info - Endangered Animals. June 7, 2006. Retrieved December 6, 2011. 
  3. ^ Robin C. Best & Vera M.F. da Silva (1993). "Inia geoffrensis". Mammalian Species (The American Society of Mammalogists) (426): 1–8. 
  4. ^ a b c American Cetacean Society Fact Sheet. "Boto (Amazon river dolphin)". American Cetacean Society. Retrieved December 6, 2011. 
  5. ^ Rice, D. W. (1998). Marine mammals of the world: systematics and distribution. Society of Marine Mammalogy Special Publication Number 4. p. 231. 
  6. ^ Martínez-Agüero, M., S. Flores-Ramírez, and M. Ruiz-García (2006). "First report of major histocompatibility complex class II loci from the Amazon pink river dolphin (genus Inia)". Genetics and Molecular Research 5 (3): 421–431. PMID 17117356. 
  7. ^ Committee on Taxonomy. 2012. List of marine mammal species and subspecies. Society for Marine Mammalogy, www.marinemammalscience.org, consulted on May 6, 2012.
  8. ^ Hamilton, H., S. Caballero, A. G. Collins, and R. L. Brownell Jr. (2001). "Evolution of river dolphins". Proceedings of the Royal Society B 268 (1466): 549–556. doi:10.1098/rspb.2000.1385. PMC 1088639. PMID 11296868. 
  9. ^ Hrbek, Tomas; Da Silva, Vera Maria Ferreira; Dutra, Nicole; Gravena, Waleska; Martin, Anthony R.; Farias, Izeni Pires (2014-01-22). "A New Species of River Dolphin from Brazil or: How Little Do We Know Our Biodiversity". In Turvey, Samuel T. PLOS ONE 9: e83623. doi:10.1371/journal.pone.0083623.  edit
  10. ^ a b Martin A.R., Da Silva V.M.F. and Rothery P. (2008) "Object carrying as social–sexual display in an aquatic mammal" Animal Behavior, Biology Letters, 4: 1243–2145.
  11. ^ Appendix II of the Convention on the Conservation of Migratory Species of Wild Animals (CMS). As amended by the Conference of the Parties in 1985, 1988, 1991, 1994, 1997, 1999, 2002, 2005 and 2008. Effective: 5th March 2009.
  12. ^ "Bolivia enacts law to protect Amazon pink dolphins". BBC News. 18 September 2012. 
  13. ^ a b c Silvano, R.A.M.; Ramires, M.; Zuanon, J. (2009). "Effects of fisheries management on fish communities in the floodplain lakes of a Brazilian Amazonian Reserve". Ecology of Freshwater Fish 18: 156–166. doi:10.1111/j.1600-0633.2008.00333.x. 
  14. ^ Barletta, M.; Jaureguizar, A.J.; Baigun, C.; Fontoura, N.F.; Agostinho, A.A.; Almeida-Val, V.M.F.; Val, A.L.; Torres, R.A.; Jimenes-Segura, L.F.; Giarrizzo, T.; Fabré, N.N.; Batista, V.S.; Lasso, C.; Taphorn, D.C.; Costa, M.F.; Chaves, P.T.; Vieria, J.P.; Corrêa, M.F.M. "Fish and aquatic habitat conservation in South America: A continental overview with an emphasis on Neotropical systems". Journal of Fish Biology 76: 2118–2176. doi:10.1111/j.1095-8649.2010.02684.x. 
  15. ^ a b c d e f g Iriarte, V.; Marmontel, M. (2013). "River Dolphin (Inia geoffrensis, Sotalia fluviatilis) Mortality Events Attributed to Artisanal Fisheries in the Western Brazilian Amazon". Aquatic Mammals 39 (2): 116–124. doi:10.1578/am.39.2.2013.116. 
  16. ^ Isaac, V.J.; Ruffino, M.L. (2007). "Evaluation of fisheries in Middle Amazon". American Fisheries Society Symposium 49: 587–596. 
  17. ^ Neiland, A.E.; Benê, C. (2008). Tropical River Fisheries Valuation:Background papers to a global synthesis. Penang, Malaysia: The World Fish Center. p. 290. 
  18. ^ Arraut, E.M., M. Marmontel, J.E. Mantovani, E.M. Novo, D.W. Macdonald, R.E. Kenward (2009). "The lesser of two evils: seasonal migrations of Amazonian manatees in the Western Amazon". Journal of Zoology 280 (3): 247–256. doi:10.1111/j.1469-7998.2009.00655.x. 
  19. ^ Reeves, R.R.; Smith, B.D.; Crespo, E.A.; Notarbartolo di Sciara, G. (2003). Dolphins, whales and porpoises: 2002-2010 conservation action plan for the world's cetaceans. Gland, Switzerland, and Cambridge, UK: International Union for Conservation of Nature/Species Survival Committee. p. 139. 
  20. ^ a b Martin, A.R.; Da Silva, V.M.F.; Rothery, P. (2008). "Number, seasonal movements, and residency characteristics of river dolphins in an Amazonian floodplain lake system". Canadian Journal of Zoology 82: 1307–1315. doi:10.1139/z04-109. 
  21. ^ a b Loch, C.; Marmontel, M.; Simões-Lopes, P.C. (2009). "Conflicts with fisheries and intentional killing of freshwater dolphins (Cetacea: Odontoceti) in the Western Brazilian Amazon". Biodiversity Conservation. 
  22. ^ Beltrán-Pedreros, S.; Filgueiras-Henriques, L.A. (2010). Biology, evolution and conservation of river dolphins within South America and Asia. New York: Nova Science Publishers Inc. pp. 237–246. 
  23. ^ a b c Crespo, E.A.; Alarcon, D.; Alonso, M.; Bazzalo, M.; Borobia, M.; Cremer, M.; Filla, G.F.; Lodi, L.; Magalhães, F.A.; Marigo, J.; Queiróz, H.L.; Reynolds, J.E. III; Schaeffer, Y.; Dorneles, P.R.; Lailson-Brito, J.; Wetzel, D.L. (2010b). "Report on the working group on major threats and conservation". The Latin American Journal of Aquatic Mammals 8 (1-2): 47–56. doi:10.5597/lajam00153. 
  24. ^ a b Iriarte, V.; Marmontel, M. (2011). "Report of an encounter with a human intentionally entagled Amazon River dolphin (Inia geoffrensis) calf and its release in Tefé River, Amazonas State, Brazil". Uakari 7 (2): 47–56. 
  25. ^ a b c Alves, L.C.P.S.; Andriolo, A.; Zappes, C.A. (2012). "Conflicts between river dolphins (Cetacea:Odontoceti) and fisheries in the Central Amazon: A path toward tragedy?". Zoologia 29 (5): 420–429. doi:10.1590/s1984-46702012000500005. 
  26. ^ a b Estupiñán, G.; Marmontel, M.; Queiroz, H.L.; Roberto e Souza, P.; Valsecchi, J.; da Silva Batista, G.; Barbosa Pereira, S. "A pesca da piracatinga (Calophysus macropterus) na Reserva de Desenvolvimiento Sustentável Mamirauá [The piracatinga fishery (Calophysus macropterus) at Mamirauá Sustainable Development Reserve].". Brazilian Ministry of Science and Technology. Retrieved 16 July 2014. 
  27. ^ Lodi, L.; Barreto, A. (1998). "Legal actions taken in Brazil for the conservation of cetaceans". Journal of International Wildlife Law and Policy I (3): 403–411. doi:10.1080/13880299809353910. 
  28. ^ a b M. A. Cravalho (1999). "Shameless creatures: An ethnozoology of the Amazon river dolphin". Ethnology 38 (1): 47–58. doi:10.2307/3774086. 
  29. ^ Gravena, W., T. Hrbek, V.M.F. da Silva, and I.P. Farias (2008). "Amazon river dolphin love fetishes: From folklore to molecular forensics". Marine Mammal Science 24: 969–978. doi:10.1111/j.1748-7692.2008.00237.x. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!