Articles on this page are available in 2 other languages: Spanish (17), Chinese (Simplified) (1) (learn more)

Overview

Brief Summary

Description

The house mouse is one of the most widely distributed and successful mammals in the world (2). It has dull greyish-brown fur and the tail, which is the same length as the body, is thicker and scalier than that of other species of mice (3). It is accompanied by a distinctive strong 'stale' odour and its presence can easily be detected by means of its droppings (2). Forms of this species living in association with man ('commensal' forms) tend to be larger and darker than 'wild' forms, and have longer tails (3). The voice is a familiar high-pitched 'squeak' (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Biology

House mice are typically active at night, but will emerge during the day if food is scarce (3). They are extremely agile, with an excellent sense of balance, and are able to jump and swim fairly well (3). The senses of hearing and smell are highly developed and communication is largely through scent (5). They have an extremely broad diet, incorporating most human foodstuffs, invertebrates and occasionally more bizarre household items such as soap and tobacco (2). In urban situations, territories are usually set up, which males defend aggressively (3). Breeding tends to occur throughout the year, with five to ten litters produced each year, each one consisting of between four and eight young (3). The nest is constructed of shredded matter such as paper or cloth (2) and females may share a nest if the population density is high (3) . The young are born virtually hairless, with sealed eyes and ears. They are fully furred after 14 days and weaned after 18 - 20 days, when they begin to emerge from the nest (3).  House mice are well-known pests, contaminating foodstuffs and grains and carrying a number of diseases and parasites that are transmissible to humans (3). Its close association with humans has led to it featuring widely in folklore (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Interesting Facts

Mice can jump a vertical distance of over 12 inches.

European Bioinformatics Institute

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Succinct

Common rodent originating from the Asian continent that often considered a pest organism and is popular as a mammallian model in biomedical studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Introduction

The house mouse (Mus musculus) probably has a world distribution more extensive than any mammal apart from humans. Its geographic spread has been facilitated by its commensal relationship with humans which extends back at least 8,000 years. They do considerable damage by destroying crops and consuming and/or contaminating food supplies intended for human consumption. They are prolific breeders, sometimes errupting and reaching plague proportions. They have also been implicated in the extinction of indigenous species in ecosytems they have invaded and colonised which are outside their natural range. An important factor in the success of the house mouse is their behavioural plasticity brought about by the decoupling of genetics and behaviour. This enables the house mouse to adapt quickly and to survive and prosper in new environments.

Discover Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Specimen Information

Globally, see GBIF.
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Original Description

Linnæus, C. 1758. Systema naturæ
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Mus musculus was originally a Palaearctic species, but through its close association with humans it has been widely introduced across the globe (Musser and Carleton, 2005). The species is widespread over all continents, except Antarctica, and has become established in North and South America, sub-Saharan Africa, Australia, and many oceanic islands (Macholán 1999). The list of countries of occurrence is incomplete.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Native to Old World. Spread over the world's continents and islands (except Antarctica) in association with humans (Musser and carleton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"
Global Distribution

Throughout the world

Western Ghats Distribution

INDIA Karnataka ? Locations Kerala ? Locations; Thiruvazhamkunnu Maharashtra ? Locations; Chandrapur; Nasik; Pune: Ratnagiri

Known Presence in Protected Areas

India Kerala: Eravikulam NP; Periyar TR. Tamil Nadu: Mudumalai Wildlife Sanctuary, Indira Gandhi Wildlife Sanctuary, Kalakad Mundanthurai Tiger Reservem Karnataka; Nagrhole National Park, Maharashtra; Chandoli NP,

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

House mice may originally be from Europe and Asia, from the Mediterranean region to China, but they are now distributed throughout the world by humans and live as a human commensal.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution in Egypt

Widespread.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Mus musculus may have originally been distributed from the Mediterranean region to China, but it has now been spread throughout the world by humans and lives as a human commensal.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

It is thought that the house mouse originated on the steppes of central Asia and possibly the Mediterranean area. It is now found around the world as a result of introduction by humans. It is known that the species has been present in Britain since at least the Iron Age, as remains have been found in deposits dating from this period. At present, the species is found throughout Britain and Ireland where there are human settlements (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

House mice are from 65 to 95 mm long from the tip of their nose to the end of their body, their tails are 60 to 105 mm long. Their fur ranges in color from light brown to black, and they generally have white or buffy bellys. They have long tails that have very little fur and have circular rows of scales. House mice tend to have longer tails and darker fur when living closely with humans. They range from 12 to 30 g in weight. Many domestic forms of mice have been developed that vary in color from white to black and with spots.

Range mass: 12.0 to 30.0 g.

Range length: 65.0 to 95.0 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.271 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

House mice are from 65 to 95 mm long from the tip of their nose to the end of their body, their tails are 60 to 105 mm long. Their fur ranges in color from light brown to black, and they generally have white or buffy bellys. They have long tails that have very little fur and have circular rows of scales (annulations). House mice tend to have longer tails and darker fur when living closely with humans. They range from 12 to 30 g in weight. Many domestic forms of mice have been developed that vary in color from white to black and with spots.

Range mass: 12.0 to 30.0 g.

Range length: 65.0 to 95.0 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.271 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 20 cm

Weight: 23 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Occupies buildings/other structures, as well as natural habitats such as fields, cropland, and (in Hawaii) low elevation forests, beaches, sometimes high elevation forest and scrub (Tomich 1986, Sugihara 1997). In some areas, movement into buildings coincides with the onset of cold weather in late fall. Young are born in a nest that may be communally constructed in a well-concealed site.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
House mice are typically commensal, and are found in a very wide range of man-made habitats including houses, farm outbuildings, other types of buildings, and even coal mines and frozen meat stores. Sometimes it is feral in areas where it has been introduced, and in some parts of its native range it maintains wild populations in outdoor habitats such as arable land, pastures, coastal sand dunes, salt marshes, and scrubby road verges (Macholán 1999, Wilson and Reeder 2005). House mice tend not to be found in forests and deserts (Macholán 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Habitat

"
Habitat

Temperate forest; tropical dry deciduous forests, subtropical dry deciduous forests; tropical evergreen forest, subtropical evergreen forest [In Sri Lanka]; scrublands; grasslands; arid and semi-arid regions; cold desert; arable land; pastureland; urban areas

Niche

Ruderal, scrub and forested tracts

Habitat Status

Quantitative and qualitative increase due to increase in human habitations and creation of suitable microhabitats

"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

House mice generally live close to humans, in places like houses and barns. Some individuals spend the summer in fields and move into barns and houses with the onset of cool autumn weather. Because house mice take advantage of human shelters and food, they have been able to live in areas like deserts where, without humans, they would not be able to live.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

House mice generally live in close association with humans-- in houses, barns, granaries, etc. They also occupy cultivated fields, fencerows, and even wooded areas, but they seldom stray far from buildings. Some individuals spend the summer in fields and move into barns and houses with the onset of cool autumn weather. Because of their association with humans, house mice have been able inhabit inhospitable areas (such as tundra and desert) which they would not be able to occupy independently.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As a commensal species, the house mouse lives in close association with humans (4). In addition to houses, it has been found in a range of urban situations, including shops, mills, warehouses, factories, coal mines and even cold stores. In rural areas it occurs in farm buildings, rubbish tips, piggeries, poultry houses, granaries and open fields (3). They nest in woodpiles, beneath floors, behind rafters and in other concealed locations. In the wild state, the house mouse lives in crevices in rocks or in underground burrows (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These mice are often common in cultivated fields and in and around cabins and barns. Mus musculus lives in houses, groceries, factories, grain storage buildings, old fields, pastures, and roadsides.

Discover Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Variable diet of plant/animal foods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

In the wild, house mice eat many kinds of plant matter, including seeds, roots, leaves, and stems. They will also eat insects (Coleoptera, Lepidoptera, and Blattaria) and meat if it is available. If house mice live near humans, they will eat any human food that is available as well as glue, soap, and other household materials. Many mice will gather and then store their food for later use.

Animal Foods: carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

In the wild, house mice eat many kinds of plant matter, such as seeds, fleshy roots, leaves and stems. Insects (beetle larvae, caterpillars, and cockroaches) and meat (carrion) may be taken when available. In human habitation, Mus musculus consumes any human food that is accessible as well as glue, soap, and other household materials. Many mice store their food or live within a human food storage facility.

Animal Foods: carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Where house mice are abundant they can consume huge quantities of grains, making these foods unavailable to other (perhaps native) animals. House mice are also important prey items for many small predators.

Species Used as Host:

  • Humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

House mice are eaten by a wide variety of small predators throughout the world, including Felis silvestris, Vulpes vulpes, Mustela, Mustela, Herpestidae, large Squamata, Squamata, Accipitridae, Falconidae, and Strigiformes. House mice try to avoid predation by keeping out of the open and by being fast. They are also capable of reproducing very rapidly, which means that populations can recover quickly from predation.

Known Predators:

  • domestic cats (Felis_silvestris)
  • red foxes (Vulpes_vulpes)
  • weasels (Mustela)
  • ferrets (Mustela)
  • mongooses (Herpestidae)
  • large lizards (Squamata)
  • snakes (Serpentes)
  • hawks (Accipitridae)
  • falcons (Falconidae)
  • owls (Strigiformes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus (albino)

Animal / parasite / ectoparasite / blood sucker
Nosopsyllus fasciatus sucks the blood of body of Mus musculus (albino)
Other: major host/prey

Animal / parasite / ectoparasite
Polyplax serrata ectoparasitises body of Mus musculus (albino)

Animal / parasite / endoparasite
Syphacia endoparasitises caecum of Mus musculus (albino)
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Animal / parasite / endoparasite
Eimeria falciformis endoparasitises Mus musculus
Other: sole host/prey

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus

Animal / parasite / ectoparasite / blood sucker
Nosopsyllus fasciatus sucks the blood of body of Mus musculus
Other: major host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Where house mice are abundant they can consume huge quantities of grains, making these foods unavailable to other (perhaps native) animals. House mice are also important prey items for many small predators.

Species Used as Host:

  • Humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

House mice are eaten by a wide variety of small predators throughout the world, including cats, foxes, weasels, ferrets, mongooses, large lizards, snakes, hawks, falcons, and owls. House mice try to avoid predation by keeping out of the open and by being fast. They are also capable of reproducing very rapidly, which means that populations can recover quickly from predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Mus musculus is prey of:
Athene cunicularia
Squamata
Strigiformes
Accipitridae
Falconidae
Herpestidae
Mustela
Felis silvestris
Vulpes vulpes

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
  • L. D. Harris and L. Paur, A quantitative food web analysis of a shortgrass community, Technical Report No. 154, Grassland Biome. U.S. International Biological Program (1972), from p. 17.
  • Myers, P., R. Espinosa, C. S. Parr, T. Jones, G. S. Hammond, and T. A. Dewey. 2006. The Animal Diversity Web (online). Accessed February 16, 2011 at http://animaldiversity.org. http://www.animaldiversity.org
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Lives in colonies. Densities vary greatly. Peak densities reach 750 or more individuals per ha (Lidicker 1966). Peaks in abundance (irruptions) occur late summer-fall in Hawaii (Tomich 1986). Home range is less than an acre.

On western Mauna Kea, Hawaii, Amarasekare (1994) found no evidence that this species preys on eggs, young, or adults of endemic birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecological Determinants/Niche

As commensal animals, house mice live in close association with man — in his houses, outbuildings, stores, and other structures. Where conditions permit, feral mice may be found in fields, along watercourses, and in other places where vegetation is dense enough to afford concealment. These feral animals make runways through the grass, or they may utilize runways made by cotton rats and other meadow-inhabiting species. In the agricultural regions where irrigation is practiced house mice often are found in the vegetation along irrigation ditches, sometimes sharing common runways with native mice (Mammals of Texas-House mouse).

Discover Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Behaviour

"Nocturnal, fossorial"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

House mice have excellent vision and hearing, a keen sense of smell, and use their whiskers to feel air movements and surface textures. House mice often squeak to each other in the nest. They use pheromones and other smells to communicate with each other about social dominance, family composition, and reproductive readiness. It was recently discovered that male mice produce complex, ultrasonic songs in response to female sex pheromones.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic ; ultrasound

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

House mice have excellent vision and hearing, a keen sense of smell, and use their whiskers to feel air movements and surface textures. House mice often squeak to each other in the nest. They use pheromones and other smells to communicate with each other about social dominance, family composition, and reproductive readiness. It was recently discovered that male mice produce complex, ultrasonic songs in response to female sex pheromones.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic ; ultrasound

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Primarily nocturnal, though also diurnal during population peaks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4 years (captivity) Observations: A major model of biomedical research, mice are amongst the fastest ageing mammals exhibiting a variety of physiological, functional and pathological changes with age. The record longevity for normal mice is 4 years, belonging to one wild-derived specimen (Miller et al. 2002). Mutant and caloric restricted mice, however, can live over 4 years (Bartke and Brown-Borg 2004), though these are not deemed suitable for species comparisons. Record longevity belongs to a mutant dwarf mouse that lived 1819 days (Andrzej Bartke, pers. comm.). Smaller mice tend to live longer (Miller et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Lifespan/Longevity

If a house mouse is a pet, the average life span is about 2 years, but mutant and calorie-restricted captive individuals have lived for as long as 5 years. Wild-derived captive Mus_musculus individuals have lived up to 4 years in captivity. In the wild, most mice do not live beyond 12-18 months.

Range lifespan

Status: wild:
12.0 to 18.0 months.

Range lifespan

Status: captivity:
5.0 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Typical lifespan

Status: wild:
12.0 to 18.0 months.

Typical lifespan

Status: captivity:
5 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

If a house mouse is a pet, the average life span is about 2 years, but mutant and calorie-restricted captive individuals have lived for as long as 5 years. Wild-derived captive Mus musculus individuals have lived up to 4 years in captivity. In the wild, most mice do not live beyond 12-18 months.

Range lifespan

Status: wild:
12.0 to 18.0 months.

Range lifespan

Status: captivity:
5.0 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Typical lifespan

Status: wild:
12.0 to 18.0 months.

Typical lifespan

Status: captivity:
5 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeds throughout the year under mild indoor conditions, breeds seasonally in natural habitats. Gestation lasts 19-21 days (may be longer if female is lactating). Young are weaned in about 18 days. Produces many litters of 3-12 (typically 4-5) young per year. Sexually mature in 5-10 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

House mice have a polygynous mating system, where each male mates with multiple females. Males sing when they smell females who are ready to mate, which might attract females.

Mating System: polygynous

House mice are able to reproduce throughout the year, often having 5-10 litters each year when conditions are favorable. Pregnancy lasts for 19 to 21 days and 5 to 6 young are born per litter, though there can be as many as 12. Young weigh about 1 gram at birth and are naked, blind, and helpless. At 10 days old they have fur and at 14 days old they open their eyes. The young are nursed for 21 days and reach adulthood at 5 to 7 weeks old.

Breeding season: Throughout the year

Range number of offspring: 3.0 to 12.0.

Average number of offspring: 5.0.

Range gestation period: 21.0 (high) days.

Average weaning age: 21.0 days.

Range age at sexual or reproductive maturity (female): 5.0 to 7.0 weeks.

Range age at sexual or reproductive maturity (male): 5.0 to 7.0 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 1.25 g.

Average number of offspring: 7.

Young mice are cared for in their mother's nest until they reach 21 days old. Soon after this most young mice leave their mother's territory, though young females are more likely to stay nearby.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

House mice have a polygynous mating system. The recent discovery of ultrasonic songs produced by male mice, when exposed to female sex pheromones, suggests that this behavior may be involved in mate choice.

Mating System: polygynous

Mus musculus is characterized by tremendous reproductive potential. Breeding occurs throughout the year, although wild mice may have a reproductive season extending only from April to September. The estrous cycle is 4-6 days long, with estrus lasting less than a day. Females experience a postpartum estrus 12-18 hours after giving birth. Females generally have 5-10 litters per year if conditions are suitable, but as many as 14 have been reported. Gestation is 19-21 days but may be extended by several days if the female is lactating. Litters consist of 3-12 (generally 5 or 6) offspring, which are born naked and blind. They are fully furred after 10 days, open their eyes at 14 days, are weaned at 3 weeks, and reach sexual maturity at 5-7 weeks. Average life span is about 2 years in captivity, but individuals have lived for as long as 6 years. In the wild, most mice do not live beyond 12-18 months.

Breeding season: Throughout the year

Range number of offspring: 3.0 to 12.0.

Average number of offspring: 5.0.

Range gestation period: 21.0 (high) days.

Average weaning age: 21.0 days.

Range age at sexual or reproductive maturity (female): 5.0 to 7.0 weeks.

Range age at sexual or reproductive maturity (male): 5.0 to 7.0 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 1.25 g.

Average number of offspring: 7.

Young mice are cared for in their mother's nest until they reach 21 days old. Soon after this most young mice leave their mother's territory, though young females are more likely to stay nearby.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction and Life History

Female house mice have an estrous cycle that is 4-6 days long, with estrus itself lasting less than a day. If several females are held together under crowded conditions, they will often not have an estrus at all; if they are then exposed to male urine, they will become estrous after 72 hours. The gestation period is about 19-21 days, and they give birth to a litter of 3-14 young (average 6-8). One female can have some 5-10 litters per year, so their population can increase very quickly. Breeding occurs throughout the year (however, animals living in the wild don't reproduce in the colder months, even though they don't hibernate). The newborn are blind and furless. Fur starts to grow some three days after birth and the eyes open one to two weeks after birth. Females reach sexual maturity at about 6 weeks and males at about 8 weeks, but both can breed as early as five weeks. House mice usually live under a year in the wild, because of a high level of predation and exposure to harsh environments. In protected environments, however, they often live two to three years. The Methuselah Mouse Prize is a competition to breed or engineer extremely long-lived laboratory mice. As of 2005, the record holder was a genetically engineered mouse that lived for 1819 days, nearly 5 years. Another record holder that was kept in a stimulating environment but did not receive any genetic, pharmacological or dietary treatment lived for 1551 days, over 4 years.
GNU Free Documentation License (GNU FDL)

Wikipedia

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Chromosomal Data

21 chromosomes
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mus musculus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 81 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGTTGATTATTCTCAACCAATCACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTATATTCTTATCCTCCCAGGATTTGGAATTATTTCACATGTAGTTACTTACTACTCCGGAAAAAAAGAACCTTTCGGCTATATAGGAATAGTATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGCCACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTGCAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCCTTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTTATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAGCCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCAGGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACACATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACATTCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCAGACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATCATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGGCCTTTGCTTCAAAACGAGAAGTAATATCAGTATCGTATGCTTCAACAAATTTAGAATGACTTCATGGCTGCCCTCCACCATATCACACATTCGAGGAACCAACCTATGTAAAAGTAAAATAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Mus musculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 65
Specimens with Barcodes: 133
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Musser, G., Amori, G., Hutterer, R., Kryštufek, B., Yigit, N. & Mitsain, G.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Contributor/s

Justification
A widespread and abundant species that thrives in anthropogenic habitats, hence listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

LEAST CONCERN
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

There are no problems with the numbers of house mice in the world. In some areas, there can be as many as 10 mice per square meter. Overall, populations are doing extremely well, this is helped by human construction of houses, barns, and other structures.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Commensal populations of Mus musculus are generally stable and densities can be as high as 10 mice per square meter. In the wild, populations are less stable and densities may be less than 1 mouse per 100 square meters. Overall, populations are flourishing and are in fact aided by human construction of houses, barns, and other structures.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Non-native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Very common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
A widespread and abundant species; common except in some extreme habitats (e.g. at high altitude) (Macholán 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

This species is abundant throughout its range and is considered a pest
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species faces no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

"Habitat loss and degradation due to infrastructure development; accidental mortality due to poisoning, pest control activities, excessive use of pesticides, habitat alteration, natural disasters in the form of drought, fire, interspecific competition"
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Legislation

"India Schedule V of the Indian Wildlife (Protection) Act, 1972, amended up to 2002."
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Protection Legal Status

Not listed
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Olson and Lewis (1995) for information on damage prevention and control techniques, including exclusion, proper sanitation, and lethal and nonlethal control methods (e.g., repellents, toxicants, traps).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Not protected under international legislation; commonly regarded as a pest. Present in many protected areas. A highly successful colonist of artificial environments; no conservation measures are required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: Often a pest when associated with humans. Consumes stored foods; contaminates about ten times as much food as it consumes. Nest construction and chewing may damage appliances and wiring, sometimes resulting in fires. Involved in the transmission of several diseases, including hantavirus, which causes often-fatal respiratory distress syndrome in humans. See Olson and Lewis (1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Uses

Harvested for local consumption purposes
Creative Commons Attribution 3.0 (CC BY 3.0)

© India Biodiversity Portal

Source: India Biodiversity Portal

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

House mice contribute to the spread of several human and animal diseases, including bubonic plague. They also carry a virus that may contribute to breast cancer in humans. Where abundant, house mice consume large quantities of crops and contaminate foods with their droppings. They can destroy woodwork, furniture, upholstery, and clothing.

Negative Impacts: injures humans (carries human disease); crop pest; household pest

  • Indik, S., W. Günzburg, B. Salmons, F. Rouault. 2005. Mouse mammary tumor virus infects human cells. Cancer Research, 65 (15): 6651-6659.
  • Stewart, T., R. Sage, A. Stewart, D. Cameron. 2000. Breast cancer incidence highest in the range of one species of house mouse, Mus domesticus. British Journal of Cancer, 82(2): 446-451.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

House mice have been widely used as research animals in medicine and genetics, and they have contributed to advances in these areas. They are also popular pets and may sometimes act to control insect pests.

Positive Impacts: pet trade ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

House mice do not cause such serious health and economic problems as do Rattus norvegicus and Rattus rattus. Mice are agricultural pests in some areas, however, and they do consume and contaminate stored human food with their droppings. They also destroy woodwork, furniture, upholstery, and clothing. In addition, they contribute to the spread of diseases such as murine typhus, rickettsial pox, tularemia, food poisoning (Salmonella), and bubonic plague. Recent research has also shown that they carry a virus--the mouse mammary tumor virus (MMTV)--that may contribute to breast cancer in humans.

Negative Impacts: injures humans (carries human disease); crop pest; household pest

  • Indik, S., W. Günzburg, B. Salmons, F. Rouault. 2005. Mouse mammary tumor virus infects human cells. Cancer Research, 65 (15): 6651-6659.
  • Stewart, T., R. Sage, A. Stewart, D. Cameron. 2000. Breast cancer incidence highest in the range of one species of house mouse, Mus domesticus. British Journal of Cancer, 82(2): 446-451.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Domesticated forms and albinos have been developed which are commonly used as laboratory animals (especially in medicine and genetics), and as pets. Mus musculus also has a small role as an insect destroyer, but this is minimal.

Positive Impacts: pet trade ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Mice used in research

Mice are genetically very similar to humans. They also reproduce rapidly, have short life spans, are inexpensive and easy to handle, and can be genetically manipulated at the molecular level.

In addition to the human genome, the genomes of about 800 organisms have been sequenced in recent years. These include the mouse Mus musculus, the fruitfly Drosophila melanogaster, the worm Caenorhabditis elegans, the bacterium Escherichia coli, the yeast Saccharomyces cerevisiae, the plant Arabidopsis thaliana, and many microbes.

Genome sizes of Mus musculus being studied

organism: Mus musculus (mouse)

estimated size (base pairs): 2.6 billion

estimated gene number: ~25,000

average gene density: 1 gene per 100,000 bases

chromosome number: 40
  • Rat Genome Sequencing Project Consortium. Genome Sequence of the Brown Norway Rat Yields Insights into Mammalian Evolution. Nature 428: 493-521. (1 April 2004)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Eli E. Agbayani

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

House mouse

The house mouse (Mus musculus) is a small mammal of the order Rodentia, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. It is one of the most numerous species of the genus Mus. Although a wild animal, the house mouse mainly lives in association with humans.

The house mouse has been domesticated as the pet or fancy mouse, and as the laboratory mouse, which is one of the most important model organisms in biology and medicine. The complete mouse reference genome was sequenced in 2002.[2][3] It is by far the mammal most commonly genetically altered for scientific research.[4][dead link]

Characteristics[edit]

House mice have an adult body length (nose to base of tail) of 7.5–10 cm (3.0–3.9 in) and a tail length of 5–10 cm (2.0–3.9 in). The weight is typically 10–25 g (0.4–0.9 oz). In the wild they vary in color from light to dark agouti (light to dark brown) but domesticated fancy mice and laboratory mice are produced in many colors ranging from white to champagne to black.[5] They have short hair and some, but not all, sub-species have a light belly.[6] The ears and tail have little hair. The hind feet are short compared to Apodemus mice, only 15–19 mm (0.59–0.75 in) long; the normal gait is a run with a stride of about 4.5 cm (1.8 in), though they can jump vertically up to 45 cm (18 in).[7] The voice is a high-pitched squeak.[8][9] House mice thrive under a variety of conditions: they are found in and around homes and commercial structures, as well as in open fields and agricultural lands.

New-born males and females can be distinguished on close examination as the anogenital distance in males is approximately double that of the female.[10] From the age of about 10 days females have five pairs of mammary glands and nipples; males have no nipples.[11] When sexually mature, the most striking and obvious difference is the presence of testicles on the males. These are large compared to the rest of the body and can be retracted into the body.

The tail, which is used for balance,[12][13][14] has only a thin covering of hair as it is the main peripheral organ of heat loss in thermoregulation[13] along with — to a lesser extent — the hairless parts of the paws and ears. Blood flow to the tail can be precisely controlled in response to changes in ambient temperature using a system of arteriovenous anastomoses to increase the temperature of the skin on the tail by as much as 10 °C to lose body heat.[15] Tail length varies according to the environmental temperature of the mouse during post-natal development and so mice living in colder regions tend to have shorter tails.[16] The tail is also used for balance when the mouse is climbing or running, or as a base when the animal stands on its hind legs (a behaviour known as "tripoding"), and to convey information about the dominance status of an individual in encounters with other mice.[17]

In addition to the regular pea-size thymus organ in the chest, house mice have a second functional pinhead-size thymus organ in the neck next to the trachea.[18]

Taxonomy and subspecies[edit]

Euarchontoglires
Glires

Rodentia (rodents)



Lagomorpha (rabbits, hares, pikas)



Euarchonta

Scandentia (treeshrews)


Primatomorpha

Dermoptera (flying lemurs)




Primates (†Plesiadapiformes, Strepsirrhini, Haplorrhini)






Mice are mammals of the Glires clade, which means they are amongst the closest relatives of humans other than lagomorphs, treeshrews, flying lemurs and other primates.

The three widely accepted subspecies are increasingly treated as distinct species:[19][20]

Two additional subspecies have been recognized more recently:[20]

Many more names have been given to house mice, but are now regarded as synonyms of other subspecies. Some populations are hybrids of different subspecies, including the Japanese house mouse (M. m. molossinus).[20][22]

Behavior[edit]

Eating

House mice usually run, walk, or stand on all fours, but when eating, fighting, or orienting themselves, they rear up on their hind legs with additional support from the tail - a behaviour known as "tripoding". Mice are good jumpers, climbers, and swimmers, and are generally considered to be thigmotactic, i.e. usually attempts to maintain contact with vertical surfaces.

Mice are mostly crepuscular or nocturnal; they are averse to bright lights. The average sleep time of a captive house mouse is reported to be 12.5 hours per day.[23] They live in a wide variety of hidden places near food sources, and construct nests from various soft materials. Mice are territorial, and one dominant male usually lives together with several females and young. Dominant males respect each other's territory and normally enter another's territory only if it is vacant. If two or more males are housed together in a cage, they will often become aggressive unless they have been raised together from birth.

House mice primarily feed on plant matter, but are omnivorous. They will eat their own feces to acquire nutrients produced by bacteria in their intestines. House mice, like most other rodents, do not vomit.

Mice are generally afraid of rats which often kill and eat mice, a behavior known as muricide. Despite this, free-living populations of rats and mice do exist together in forest areas in New Zealand, North America and elsewhere. House mice are generally poor competitors and in most areas cannot survive away from human settlements in areas where other small mammals, such as wood mice, are present.[24] However, in some areas (such as Australia), mice are able to coexist with other small rodent species.[25]

Social behaviour[edit]

The social behaviour of the house mouse is not rigidly fixed into species-specific patterns but is instead adaptable to the environmental conditions, such as the availability of food and space.[26][27] This adaptability allows house mice to inhabit diverse areas ranging from sandy dunes to apartment buildings.[26]

House mice have two forms of social behaviour, the expression of which depends on the environmental context. House mice in buildings and other urbanized areas with close proximity to humans are known as commensal.[26] Commensal mice populations often have an excessive food source resulting in high population densities and small home ranges. This causes a switch from territorial behaviour to a hierarchy of individuals.[26][28] When populations have an excess of food, there is less female-female aggression, which usually occurs to gain access to food or to prevent infanticide.[26] Male-male aggression occurs in commensal populations, mainly to defend female mates and protect a small territory.[26][27] The high level of male-male aggression, with a low female-female aggression level is common in polygamous populations.[29] The social unit of commensal house mouse populations generally consists of one male and two or more females, usually related.[29][30] These groups breed cooperatively, with the females communally nursing. This cooperative breeding and rearing by related females helps increase reproductive success. When no related females are present, breeding groups can form from non-related females.[30]

In open areas such as shrubs and fields, the house mouse population is known as noncommensal. These populations are often limited by water or food supply and have large territories.[27] Female-female aggression in the noncommensal house mouse populations is much higher, reaching a level generally attributed to free-ranging species. Male aggression is also higher in noncommensal populations. In commensal populations, males come into contact with other males quite frequently due to high population densities and aggression must be mediated or the risk of injury becomes too great.[26]

Both commensal and noncommensal house mouse males aggressively defend their territory and act to exclude all intruders. Males mark their territory by scent marking with urine. In marked territories, intruders showed significantly lower aggression than the territory residents.[27] House mice show a male-biased dispersal; males generally leave their birth sites and migrate to form new territories whereas females generally stay and are opportunistic breeders rather than seasonal.[31]

Senses and communication[edit]

Vision[edit]

The visual apparatus of mice is basically similar to that of humans but differs in that they are dichromats and have only two types of cone cells whereas humans are trichromats and have three. This means that mice do not perceive some of the colors in the human visual spectrum.[32] However, the ventral area of the mouse retina has a much greater density of ultraviolet-sensitive cones than other areas of the retina, although the biological significance of this structure is unknown.[33][34][35] In 2007, mice genetically engineered by scientists at the University of California to produce the third type of cone were shown to be able to distinguish a range of colors similar to that perceived by tetrachromats.[32]

Olfaction[edit]

House mice also rely on pheromones for social communication, some of which are produced by the preputial glands of both sexes. The tear fluid and urine of male mice also contains pheromones, such as major urinary proteins.[36][37] Mice detect pheromones mainly with the vomeronasal organ (Jacobson's organ), located at the bottom of the nose.

The urine of house mice, especially that of males, has a characteristic strong odor. At least 10 different compounds, such as alkanes, alcohols, etc., are detectable in the urine. Among them, five compounds are specific to males, namely 3-cyclohexene-1-methanol, aminotriazole (3-amino-s-triazole), 4-ethyl phenol, 3-ethyl-2,7-dimethyl octane and 1-iodoundecane.[38]

Odours from adult males or from pregnant or lactating females can speed up or retard sexual maturation in juvenile females and synchronise reproductive cycles in mature females (i.e. the Whitten effect). Odours of unfamiliar male mice may terminate pregnancies, i.e. the Bruce effect.

Touch[edit]

Mice can sense surfaces and air movements with their whiskers which are also used during thigmotaxis. If mice are blind from birth, super-normal growth of the vibrissae occurs presumably as a compensatory response,[39] or if the vibrissae are absent, the use of vision is intensified.[40]

Life cycle and reproduction[edit]

A four-day-old mouse
A two-week-old mouse, just about to open its eyes

Female house mice have an estrous cycle about four to six days long, with estrus itself lasting less than a day. If several females are held together under crowded conditions, they will often not have an estrus at all. If they are then exposed to male urine, they will come into estrus after 72 hours.

Male house mice court females by emitting characteristic ultrasonic calls in the 30 kHz–110 kHz range. The calls are most frequent during courtship when the male is sniffing and following the female; however, the calls continue after mating has begun, at which time the calls are coincident with mounting behaviour. Males can be induced to emit these calls by female pheromones. The vocalizations appear to differ between individuals and have been compared to bird songs because of their complexity.[41] While females have the capability to produce ultrasonic calls, they typically do not do so during mating behaviour.

Following copulation, female mice will normally develop a copulation plug which prevents further copulation. This plug stays in place for some 24 hours. The gestation period is about 19–21 days, and they give birth to a litter of 3–14 young (average six to eight). One female can have 5 to 10 litters per year, so the mouse population can increase very quickly. Breeding occurs throughout the year. (However, animals living in the wild do not reproduce in the colder months, even though they do not hibernate.)

The pups are born blind and without fur or ears. The ears are fully developed by the fourth day, fur begins to appear at about six days and the eyes open around 13 days after birth; the pups are weaned at around 21 days. Females reach sexual maturity at about six weeks of age and males at about eight weeks, but both can copulate as early as five weeks. If the infants live in high temperatured area from birth, they will become less-haired.[42]

Life expectancy[edit]

House mice usually live under a year in the wild, due to a high level of predation and exposure to harsh environments. In protected environments, however, they often live two to three years. The Methuselah Mouse Prize is a competition to breed or engineer extremely long-lived laboratory mice. As of 2005, the record holder was a genetically engineered mouse that lived for 1,819 days (4 years, 358 days).[43] Another record holder that was kept in an enriched environment but did not receive any genetic, pharmacological, or dietary treatment lived for 1,551 days (4 years, 90 days).[44][45]

Mice and humans[edit]

See also: Fancy mouse

House mice usually live in proximity to humans, in or around houses or fields. Originally native to Asia (probably northern India),[46] they spread to the Mediterranean Basin about 8000 BC, only spreading into the rest of Europe around 1000 BC.[47] This time lag is thought to be because the mice require agrarian human settlements above a certain size.[47] They have since been spread to all parts of the globe by humans.

Many studies have been done on mouse phylogenies to reconstruct early human movements. For example, one study suggests the possibility of a previously unsuspected early link between Northern Europe and Madeira on the basis of the origin of Madeiran mice.[48]

An individually ventilated and sealed cage for laboratory mice

House mice can transmit diseases, and can damage food and food packaging. Some of the diseases the house mouse carries can be deadly: for example, leptospirosis, murine typhus, rickettsialpox, tularemia, lymphocytic choriomeningitis [49] and potentially bubonic plague.[50] House mice can also cause substantial damage when feeding on grain. House mice were thought to be the primary reason for the taming of the domestic cat. Various mousetraps have been developed to catch mice.

The first written reference to mice kept as pets occurs in the Erya, the oldest extant Chinese dictionary, from a mention in an 1100 BC version.[51] Human domestication led to numerous strains of "fancy" or hobby mice with a variety of colours and a docile temperament.[52] Domestic varieties of the house mouse are bred as a food source for some carnivorous pet reptiles, birds, arthropods, and fish.[52]

Invasive species[edit]

Mice have become an invasive species on islands to where they have spread during the period of European exploration and colonisation.

New Zealand had no land mammals other than the lesser short-tailed bat (Mystacina tuberculata) prior to human occupation, and the house mouse is one of many species that have been introduced. Mice are responsible for a reduction in native bird species since they eat some of the same foods as birds. They are also known to kill lizards and have a large effect on native insects.[53]

Gough Island in the South Atlantic is used by 20 species of seabird for breeding, including almost all of the world's Tristan albatross (Diomedea dabbenena) and Atlantic petrel (Pterodroma incerta). Until house mice arrived on the island in the 19th century with sailors, the birds did not have any mammalian predators. The mice have since grown unusually large and have learned to attack albatross chicks, which can be nearly 1 m tall, but are largely immobile, by working in groups and gnawing on them until they bleed to death.[54]

In the grain belt of south-eastern Australia, the introduced species Mus domesticus breed so successfully that every three years or so they reach plague proportions, achieving densities of 1000 per hectare causing massive disruption to communities, and losses to agriculture of A$36 million annually.[55]

In folk culture[edit]

Importance of mice as a house and agricultural pest resulted in a development of a variety of mice-related rituals and stories in world's cultures. Already the ancient Egyptians had a story about "The mouse as vizier".[56]

Many Southern Slavs had a traditional annual "Mouse Day" celebration. In the eastern Balkans (most of Bulgaria, Macedonia, the Torlak districts of Serbia), the "Mouse Day" (Bulgarian: Миши ден, Мишин ден) was celebrated on October 9 of the Julian calendar (corresponds to October 27 of the Gregorian calendar in the 20th and 21st centuries), the next day after the feast of St Demetrius. In the western Balkans (Bosnia, Croatia) the Mouse Day would usually be celebrated in the spring, during the Maslenitsa week or early in the Lent.[57]

References[edit]

  1. ^ Musser G, Amori G, Hutterer R, Kryštufek B, Yigit N & Mitsain G (2008). Mus musculus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 10 October 2008.
  2. ^ Gregory SG, Sekhon M, Schein J, Zhao S, Osoegawa K, Scott CE, Evans RS et al. (2002-08-15). "A physical map of the mouse genome". Nature 418: 743–750. doi:10.1038/nature00957. PMID 12181558. 
  3. ^ Mouse Genome Sequencing Consortium, Waterston RH, Lindblad-Toh K, Birney E, Rogers J, Abril JF, Agarwal P et al. (2002-12-05). "Initial sequencing and comparative analysis of the mouse genome". Nature 420 (6915): 520–562. doi:10.1038/nature01262. PMID 12466850. 
  4. ^ "GA mouse welfare assessment". National Centre for the Replacement, Refinement and Reduction of Animals in Research. Retrieved 29 July 2013. 
  5. ^ Berry 1970, p. 222
  6. ^ Berry 1970, p. 221
  7. ^ Baker RO, Bodman GR, Timm RM (1994). "Rodent-Proof Construction and Exclusion Methods". In Hygnstrom SE, Timm RM, Larson GE. Prevention and Control of Wildlife Damage. University of Nebraska-Lincoln. 
  8. ^ Lyneborg L (1971). Mammals of Europe. Blandford Press. 
  9. ^ Lawrence MJ, & Brown RW (1974). Mammals of Britain Their Tracks, Trails and Signs. Blandford Press. 
  10. ^ Hotchkiss AK, Vandenbergh JG (July 2005). "The anogenital distance index of mice (Mus musculus domesticus): an analysis". Contemporary Topics in Laboratory Animal Science 44 (4): 46–8. PMID 16050669. 
  11. ^ Mayer JA, Foley J, De La Cruz D, Chuong CM, Widelitz R (November 2008). "Conversion of the nipple to hair-bearing epithelia by lowering bone morphogenetic protein pathway activity at the dermal-epidermal interface". The American Journal of Pathology 173 (5): 1339–48. doi:10.2353/ajpath.2008.070920. PMC 2570124. PMID 18832580. 
  12. ^ Greene, E.C. (1935). "Anatomy of the rat.". Transactions of the American Philosophical Society 27: 3. doi:10.2307/1005513. 
  13. ^ a b Siegel, M.I. (2005). "The tail, locomotion and balance in mice.". American Journal of Physical Anthropology 33 (1). 
  14. ^ Buck, C.W, Tolman N. and Tolman, W. (1925). "The tail as a balancing organ in mice.". Journal of Mammalogy 6 (4): 267–271. doi:10.2307/1373415. 
  15. ^ Le Bars, Daniel; Gozario, M. Cadden, S.W. (1 December 2001). "Animal models of nociception". Pharmacological Reviews (American Society for Pharmacology and Experimental Therapeutics) 53 (4): 597–652. Retrieved 16 December 2013. 
  16. ^ Berry 1970, p. 225
  17. ^ Víctor Sánchez-Cordero, Rodrigo A. Medellín, ed. (2005). Contribuciones mastozoológicas en homenaje a Bernardo Villa. México, D.F. : UNAM, Instituto de Biología. pp. 160–161. 
  18. ^ Terszowski G et al., G (2006-04-14). "Evidence for a Functional Second Thymus in Mice". Science 312 (5771): 284. doi:10.1126/science.1123497. ISSN 0036-8075. PMID 16513945. 
  19. ^ Mitchell-Jones AJ, Amori G, Bogdanowicz W, Krystufek B, Reijnders PJH, Spitzenberger F, Stubbe M, Thissen JBM, Vohralik V, & Zima J (1999). The Atlas of European Mammals. T. & A. D. Poyser. ISBN 0-85661-130-1. 
  20. ^ a b c Musser & Carleton 2005
  21. ^ Prager EM, Orrego C and Sage RD (1998). "Genetic variation and phylogeography of Central Asian and other house mice, including a major new mitochondrial lineage in Yemen". Genetics 150 (2): 835–861. PMC 1460354. PMID 9755213. 
  22. ^ Bonhomme F, Miyashita N, Boursot, Catalan J and Moriwaki K (1989). "Genetic variation and polyphyletic origin in Japanese Mus musculus". Heredity 63 (3): 299–308. doi:10.1038/hdy.1989.102. PMID 2613534. 
  23. ^ "40 Winks?" Jennifer S. Holland, National Geographic Vol. 220, No. 10. July 2011.
  24. ^ Tattersall FH, Smith RH & Nowell F (1997). "Experimental colonization of contrasting habitats by house mice". Zeitschrift für Säugetierkunde 62: 350–8. 
  25. ^ Moro D and Morris K (2000). "Movements and refugia of Lakeland Downs short-tailed mice, Leggadina lakedownensis, and house mice, Mus domesticus, on Thevenard Island, Western Australia". Wildlife Research 27: 11–20. doi:10.1071/WR99016. 
  26. ^ a b c d e f g Frynta, Daniel; Marke´ ta Sla´bova´, Hana Va´chova´, Radka Volfova´, and Pavel Munclinger (2005). "Aggression and commensalism in house mouse: a comparative study across Europe and the near east". Aggressive Behaviour 31: 283–293. doi:10.1002/ab.15555. 
  27. ^ a b c d Gray, Samantha; Jane Hurst (1997). "Behavioural mechanisms underlying the spatial dispersion of commensal Mus domesticus and grassland Mus spretus". Animal Behavior 53: 511–524. doi:10.1006/anbe.1996.0301. 
  28. ^ Wolff, RJ (1985). "Mating behaviour and female choice: their relation to social structure in wild caught house mice (Mus musculus) housed in a semi-natural environment". Journal of Zoology, London 207: 43–51. doi:10.1111/j.1469-7998.1985.tb04914.x. 
  29. ^ a b Szenczi, Peter; Oxana Ba´nszegi, Zita Groo´, and Vilmos Altba¨cker (2012). "Development of the social behavior of two mice species with contrasting social systems". Aggressive Behavior 38: 288–297. doi:10.1002/ab.21431. 
  30. ^ a b Dobson, Stephen; Claude Baudoin (2002). "Experimental tests of spatial association and kinship in monogamous mice (Mus spicilegus) and polygynous mice (Mus musculus domesticus)". Canadian Journal of Zoology 80: 980–986. doi:10.1139/z02-055. 
  31. ^ Gerlach, G (1996). "Emigration mechanisms in feral house mice: A laboratory investigation of the influence of social structure, population density, and aggression". Behavioral and Ecological Sociobiology 39: 159–170. doi:10.1007/s002650050277. 
  32. ^ a b Smee, Lucy Odling (22 March 2007). "Mice made to see a rainbow of colours". Nature. Macmillan Publishers Limited. Retrieved 2 August 2014. 
  33. ^ Calderone J.B., Jacobs G.H. (1995). "Regional variations in the relative sensitivity to UV light in the mouse retina". Visual Neuroscience 12: 463–468. doi:10.1017/s0952523800008361. 
  34. ^ Yokohyama S., Shi Y.S. (2000). "Genetics and evolution of ultraviolet vision in vertebrates". FEBS Letters 486: 167–172. doi:10.1016/s0014-5793(00)02269-9. 
  35. ^ Neitz M., Neitz J. (2001). "The uncommon retina of the common house mouse". Trends in Neuroscience 24: 248–249. doi:10.1016/s0166-2236(00)01773-2. 
  36. ^ Kimoto, H; Haga, S; Sato, K; Touhara, K (Oct 2005). "Sex-specific peptides from exocrine glands stimulate mouse vomeronasal sensory neurons". Nature 437 (7060): 898–901. doi:10.1038/nature04033. ISSN 0028-0836. PMID 16208374. 
  37. ^ Chamero P, Marton TF, Logan DW, et al., P (December 2007). "Identification of protein pheromones that promote aggressive behaviour". Nature 450 (7171): 899–902. doi:10.1038/nature05997. ISSN 0028-0836. PMID 18064011. 
  38. ^ Achiraman S & Archunan G, S (Dec 2002). "Characterization of urinary volatiles in Swiss male mice (Mus musculus): bioassay of identified compounds". J Biosci 27 (7): 679–86. doi:10.1007/BF02708376. ISSN 0250-5991. PMID 12571373. 
  39. ^ Rauschecker J.P., Tian B., Korte M. et al. (1992). "Crossmodal changes in the somatosensory vibrissa barrel system of visually deprived animals". Proceedings of the National Academy of Sciences USA 89: 5063–5067. doi:10.1073/pnas.89.11.5063. 
  40. ^ Sokolov, V.E., Tikhonova, G.N. and Tikhonov, I.A., (1996). Role of sense systems in the behavior of Ryukyu mice. Izvestiya Akademii Nauk Seriya Biologicheskaya 2: 169–175
  41. ^ Holy, TE; Guo, Z (December 2005). "Ultrasonic songs of male mice". PLoS Biol 3 (12): e386. doi:10.1371/journal.pbio.0030386. PMC 1275525. PMID 16248680. 
  42. ^ Anon. "Mouse Husbandry, Breeding and Development". University of Carolina, Irvine, Transgenic Mouse Facility Guidelines. University of Carolina. Retrieved 15 December 2013. 
  43. ^ "Latest Mprize Winners". Andrzej Bartke Mprize for Longevity. Methuselah Foundation. 2003–2013. Retrieved 2013-04-02. 
  44. ^ Connor, Steve (31 Oct 2004). "Oldest mouse in captivity wins top science award". The Independent (UK). Retrieved 30 July 2013. 
  45. ^ "Reversal Prize". Methuselah Foundation. Retrieved 2009-03-14. 
  46. ^ Boursot P, Din W, Anand R, Darviche D, Dod B, Von Deimling F, Talwar GP and Bonhomme F (1996). "Origin and radiation of the house mouse: mitochondrial DNA phylogeny". Journal of Evolutionary Biology 9: 391–415. doi:10.1046/j.1420-9101.1996.9040391.x. 
  47. ^ a b Cucci T, Vigne J-D and Auffray J-C (2005). "First occurrence of the house mouse (Mus musculus domesticus Schwarz & Schwarz, 1943) in the Western Mediterranean: a zooarchaeological revision of subfossil occurrences". Biological Journal of the Linnean Society 84: 429–445. doi:10.1111/j.1095-8312.2005.00445.x. 
  48. ^ Gündüz I, Auffray J-C, Britton-Davidian J, Catalan J, Ganem G, Ramalhinho MG, Mathias ML and Searle JB (2001). "Molecular studies on the colonization of the Madeiran archipelago by house mice". Molecular Ecology 10 (8): 2023–9. doi:10.1046/j.0962-1083.2001.01346.x. PMID 11555245. 
  49. ^ M. Madon, 2002 "Vertebrates of public health importance in California" Mosquito & Vector Control Association of America, Chapter 6, Section D, page 56.
  50. ^ Mc Carthy, Eugene M. "Diseases carried by mice". Online Biological Dictionary. Macroevolution. Retrieved 18 December 2013. 
  51. ^ "The History Of Fancy Mice". American Fancy Rat and Mouse Association. Retrieved 29 July 2013. 
  52. ^ a b the Rat and Mouse Club of America
  53. ^ King, Caroline, ed. (1995). The Handbook of New Zealand Mammals. Auckland, N.Z.: Oxford University Press in association with the Mammal Society, New Zealand Branch. ISBN 0195583205. 
  54. ^ Wanless RM, Angel A, Cuthbert RJ, Hilton GM & Ryan PG (2007). "Can predation by invasive mice drive seabird extinctions?". Biology Letters 3 (3): 241–4. doi:10.1098/rsbl.2007.0120. PMC 2464706. PMID 17412667. 
  55. ^ Anon. "Mice: a case study". Biotechnology Australia. Commonwealth of Australia. Retrieved 18 December 2013. 
  56. ^ The mouse as vizier, sourced to: Emma Brunner-Traut, Tiergeschichten aus dem Pharaonenland, Mainz, Zabern, 2000.
  57. ^ Plotnikova, Anna Arkadievna (Анна Аркадьевна Плотникова) (2004), Этнолингвистическая география Южной Славии (Ethnolinguistic Geography of the South Slav Lands), Moscow: Indrik, pp. 64–68, ISBN 5857592879  (Russian)

Bibliography[edit]

  • Musser, G.G.; Carleton, M.D. (2005). "Superfamily Muroidea". In Wilson, D.E.; Reeder, D.M. Mammal Species of the World: a taxonomic and geographic reference (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 894–1531. ISBN 978-0-8018-8221-0. 

Further reading[edit]

  • Nyby J. (2001). "Ch. 1 Auditory communication in adults". In Willott, James F. Handbook of Mouse Auditory Research: From Behavior to Molecular Biology. Boca Raton: CRC Press. pp. 3–18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

References and More Information

Names and Taxonomy

Taxonomy

Comments: This species comprises several groups that may be species or subspecies; Musser and Carleton (in Wilson and Reeder 2005) recognized them as subspecies and provided an extensive discussion of Mus systematics. Populations in nearly all of the United States descended from the European M. musculus domesticus, but Asian M. m. castaneus may also be present in part of southern California (Musser and Carleton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!