Articles on this page are available in 1 other language: Spanish (6) (learn more)

Overview

Brief Summary

Biology

House mice are typically active at night, but will emerge during the day if food is scarce (3). They are extremely agile, with an excellent sense of balance, and are able to jump and swim fairly well (3). The senses of hearing and smell are highly developed and communication is largely through scent (5). They have an extremely broad diet, incorporating most human foodstuffs, invertebrates and occasionally more bizarre household items such as soap and tobacco (2). In urban situations, territories are usually set up, which males defend aggressively (3). Breeding tends to occur throughout the year, with five to ten litters produced each year, each one consisting of between four and eight young (3). The nest is constructed of shredded matter such as paper or cloth (2) and females may share a nest if the population density is high (3) . The young are born virtually hairless, with sealed eyes and ears. They are fully furred after 14 days and weaned after 18 - 20 days, when they begin to emerge from the nest (3).  House mice are well-known pests, contaminating foodstuffs and grains and carrying a number of diseases and parasites that are transmissible to humans (3). Its close association with humans has led to it featuring widely in folklore (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Interesting Facts

Mice can jump a vertical distance of over 12 inches.

European Bioinformatics Institute

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Succinct

Common rodent originating from the Asian continent that often considered a pest organism and is popular as a mammallian model in biomedical studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Introduction

The house mouse (Mus musculus) probably has a world distribution more extensive than any mammal apart from humans. Its geographic spread has been facilitated by its commensal relationship with humans which extends back at least 8,000 years. They do considerable damage by destroying crops and consuming and/or contaminating food supplies intended for human consumption. They are prolific breeders, sometimes errupting and reaching plague proportions. They have also been implicated in the extinction of indigenous species in ecosytems they have invaded and colonised which are outside their natural range. An important factor in the success of the house mouse is their behavioural plasticity brought about by the decoupling of genetics and behaviour. This enables the house mouse to adapt quickly and to survive and prosper in new environments.

Discover Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The house mouse is one of the most widely distributed and successful mammals in the world (2). It has dull greyish-brown fur and the tail, which is the same length as the body, is thicker and scalier than that of other species of mice (3). It is accompanied by a distinctive strong 'stale' odour and its presence can easily be detected by means of its droppings (2). Forms of this species living in association with man ('commensal' forms) tend to be larger and darker than 'wild' forms, and have longer tails (3). The voice is a familiar high-pitched 'squeak' (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Description

Small mouse and the only Egyptian mouse with no spines in the fur. Highly variable in color from grayish through beige to light or dark brown. Flanks paler. Underside whitish, often tinged buff though may be dark. Shade seems to be related to habitat. Head with pointed muzzle, indistinctly marked (unlike spiny mice) with indistinct paler spot below eye and behind ears. Ears proportionately smaller than in Cairo Spiny Mouse. Tail as upper parts above, paler below, equal to or slightly longer than body. 150-200 tail rings can be seen beneath fur. No terminal tuft.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Specimen Information

Globally, see GBIF.
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Original Description

Linnæus, C. 1758. Systema naturæ
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Mus musculus was originally a Palaearctic species, but through its close association with humans it has been widely introduced across the globe (Musser and Carleton, 2005). The species is widespread over all continents, except Antarctica, and has become established in North and South America, sub-Saharan Africa, Australia, and many oceanic islands (Macholán 1999). The list of countries of occurrence is incomplete.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Geographic Range

Mus musculus may have originally been distributed from the Mediterranean region to China, but it has now been spread throughout the world by humans and lives as a human commensal.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Records

112 records. Latest in 2000 (Kafr El Sheikh).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread. AOO=445 km². EOO=610246 km². 11 locations.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Distribution

Widespread (worldwide).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Native to Old World. Spread over the world's continents and islands (except Antarctica) in association with humans (Musser and carleton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

It is thought that the house mouse originated on the steppes of central Asia and possibly the Mediterranean area. It is now found around the world as a result of introduction by humans. It is known that the species has been present in Britain since at least the Iron Age, as remains have been found in deposits dating from this period. At present, the species is found throughout Britain and Ireland where there are human settlements (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

House mice are from 65 to 95 mm long from the tip of their nose to the end of their body, their tails are 60 to 105 mm long. Their fur ranges in color from light brown to black, and they generally have white or buffy bellys. They have long tails that have very little fur and have circular rows of scales (annulations). House mice tend to have longer tails and darker fur when living closely with humans. They range from 12 to 30 g in weight. Many domestic forms of mice have been developed that vary in color from white to black and with spots.

Range mass: 12.0 to 30.0 g.

Range length: 65.0 to 95.0 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average basal metabolic rate: 0.271 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Size

Length 71-93 mm, tail 66-95 mm, weight 8-21 gm.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 20 cm

Weight: 23 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Look Alikes

Taxonomy

The ssp in Egypt should be domesticus Schwarz & Schwarz, but apparently there are also pockets of the type ssp in the Delta (Wilson & Reeder 2005), unrecognised by Osborn & Helmy (1980).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
House mice are typically commensal, and are found in a very wide range of man-made habitats including houses, farm outbuildings, other types of buildings, and even coal mines and frozen meat stores. Sometimes it is feral in areas where it has been introduced, and in some parts of its native range it maintains wild populations in outdoor habitats such as arable land, pastures, coastal sand dunes, salt marshes, and scrubby road verges (Macholán 1999, Wilson and Reeder 2005). House mice tend not to be found in forests and deserts (Macholán 1999).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

House mice generally live in close association with humans-- in houses, barns, granaries, etc. They also occupy cultivated fields, fencerows, and even wooded areas, but they seldom stray far from buildings. Some individuals spend the summer in fields and move into barns and houses with the onset of cool autumn weather. Because of their association with humans, house mice have been able inhabit inhospitable areas (such as tundra and desert) which they would not be able to occupy independently.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits a wide range of habitat from agricultural areas, vil­lages, towns, cities to coastal desert. Also beaches, seashore, salt marshes, meadows, canal banks, and palm and olive groves. Absent only from true desert but often present at oases where probably transported by humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Occupies buildings/other structures, as well as natural habitats such as fields, cropland, and (in Hawaii) low elevation forests, beaches, sometimes high elevation forest and scrub (Tomich 1986, Sugihara 1997). In some areas, movement into buildings coincides with the onset of cold weather in late fall. Young are born in a nest that may be communally constructed in a well-concealed site.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

As a commensal species, the house mouse lives in close association with humans (4). In addition to houses, it has been found in a range of urban situations, including shops, mills, warehouses, factories, coal mines and even cold stores. In rural areas it occurs in farm buildings, rubbish tips, piggeries, poultry houses, granaries and open fields (3). They nest in woodpiles, beneath floors, behind rafters and in other concealed locations. In the wild state, the house mouse lives in crevices in rocks or in underground burrows (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

These mice are often common in cultivated fields and in and around cabins and barns. Mus musculus lives in houses, groceries, factories, grain storage buildings, old fields, pastures, and roadsides.

Discover Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

In the wild, house mice eat many kinds of plant matter, such as seeds, fleshy roots, leaves and stems. Insects (beetle larvae, caterpillars, and cockroaches) and meat (carrion) may be taken when available. In human habitation, Mus musculus consumes any human food that is accessible as well as glue, soap, and other household materials. Many mice store their food or live within a human food storage facility.

Animal Foods: carrion ; insects; terrestrial non-insect arthropods

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Variable diet of plant/animal foods.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Where house mice are abundant they can consume huge quantities of grains, making these foods unavailable to other (perhaps native) animals. House mice are also important prey items for many small predators.

Species Used as Host:

  • Humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

House mice are eaten by a wide variety of small predators throughout the world, including cats, foxes, weasels, ferrets, mongooses, large lizards, snakes, hawks, falcons, and owls. House mice try to avoid predation by keeping out of the open and by being fast. They are also capable of reproducing very rapidly, which means that populations can recover quickly from predation.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Mus musculus is prey of:
Athene cunicularia
Squamata
Strigiformes
Accipitridae
Falconidae
Herpestidae
Mustela
Felis silvestris
Vulpes vulpes

Based on studies in:
USA: California, Cabrillo Point (Grassland)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus (albino)

Animal / parasite / ectoparasite / blood sucker
Nosopsyllus fasciatus sucks the blood of body of Mus musculus (albino)
Other: major host/prey

Animal / parasite / ectoparasite
Polyplax serrata ectoparasitises body of Mus musculus (albino)

Animal / parasite / endoparasite
Syphacia endoparasitises caecum of Mus musculus (albino)
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
Eimeria falciformis endoparasitises Mus musculus
Other: sole host/prey

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
tapeworm of Hymenolepis nana endoparasitises intestine of Mus musculus

Animal / parasite / ectoparasite / blood sucker
Nosopsyllus fasciatus sucks the blood of body of Mus musculus
Other: major host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Lives in colonies. Densities vary greatly. Peak densities reach 750 or more individuals per ha (Lidicker 1966). Peaks in abundance (irruptions) occur late summer-fall in Hawaii (Tomich 1986). Home range is less than an acre.

On western Mauna Kea, Hawaii, Amarasekare (1994) found no evidence that this species preys on eggs, young, or adults of endemic birds.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecological Determinants/Niche

As commensal animals, house mice live in close association with man — in his houses, outbuildings, stores, and other structures. Where conditions permit, feral mice may be found in fields, along watercourses, and in other places where vegetation is dense enough to afford concealment. These feral animals make runways through the grass, or they may utilize runways made by cotton rats and other meadow-inhabiting species. In the agricultural regions where irrigation is practiced house mice often are found in the vegetation along irrigation ditches, sometimes sharing common runways with native mice (Mammals of Texas-House mouse).

Discover Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

House mice have excellent vision and hearing, a keen sense of smell, and use their whiskers to feel air movements and surface textures. House mice often squeak to each other in the nest. They use pheromones and other smells to communicate with each other about social dominance, family composition, and reproductive readiness. It was recently discovered that male mice produce complex, ultrasonic songs in response to female sex pheromones.

Communication Channels: acoustic ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; acoustic ; ultrasound

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behaviour

Generally nocturnal but may be active during the day. Usually lives in a sheltered, shallow burrow, self excavated, with nest lining. Feeds on plants, fruit, crops, waste, insects. Lives in small groups in supericial holes. Causes losses to stored crops, and carries some diseases. Wary and secretive. Voice the oft-imitated squeak. Gestation about 22 days. Probably breeds throughout the year. Individual litter size up to 10 or more, but communal litters may consist of many more young.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Primarily nocturnal, though also diurnal during population peaks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 4 years (captivity) Observations: A major model of biomedical research, mice are amongst the fastest ageing mammals exhibiting a variety of physiological, functional and pathological changes with age. The record longevity for normal mice is 4 years, belonging to one wild-derived specimen (Miller et al. 2002). Mutant and caloric restricted mice, however, can live over 4 years (Bartke and Brown-Borg 2004), though these are not deemed suitable for species comparisons. Record longevity belongs to a mutant dwarf mouse that lived 1819 days (Andrzej Bartke, pers. comm.). Smaller mice tend to live longer (Miller et al. 2002).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Lifespan/Longevity

If a house mouse is a pet, the average life span is about 2 years, but mutant and calorie-restricted captive individuals have lived for as long as 5 years. Wild-derived captive Mus musculus individuals have lived up to 4 years in captivity. In the wild, most mice do not live beyond 12-18 months.

Range lifespan

Status: wild:
12.0 to 18.0 months.

Range lifespan

Status: captivity:
5.0 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Typical lifespan

Status: wild:
12.0 to 18.0 months.

Typical lifespan

Status: captivity:
5 (high) years.

Average lifespan

Status: captivity:
2.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

House mice have a polygynous mating system. The recent discovery of ultrasonic songs produced by male mice, when exposed to female sex pheromones, suggests that this behavior may be involved in mate choice.

Mating System: polygynous

Mus musculus is characterized by tremendous reproductive potential. Breeding occurs throughout the year, although wild mice may have a reproductive season extending only from April to September. The estrous cycle is 4-6 days long, with estrus lasting less than a day. Females experience a postpartum estrus 12-18 hours after giving birth. Females generally have 5-10 litters per year if conditions are suitable, but as many as 14 have been reported. Gestation is 19-21 days but may be extended by several days if the female is lactating. Litters consist of 3-12 (generally 5 or 6) offspring, which are born naked and blind. They are fully furred after 10 days, open their eyes at 14 days, are weaned at 3 weeks, and reach sexual maturity at 5-7 weeks. Average life span is about 2 years in captivity, but individuals have lived for as long as 6 years. In the wild, most mice do not live beyond 12-18 months.

Breeding season: Throughout the year

Range number of offspring: 3.0 to 12.0.

Average number of offspring: 5.0.

Range gestation period: 21.0 (high) days.

Average weaning age: 21.0 days.

Range age at sexual or reproductive maturity (female): 5.0 to 7.0 weeks.

Range age at sexual or reproductive maturity (male): 5.0 to 7.0 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (Internal ); viviparous

Average birth mass: 1.25 g.

Average number of offspring: 7.

Young mice are cared for in their mother's nest until they reach 21 days old. Soon after this most young mice leave their mother's territory, though young females are more likely to stay nearby.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

  • Holy, T., Z. Guo. 2005. Ultrasonic songs of male mice. Public Library of Science, Biology, 3/12. Accessed November 02, 2005 at http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030386.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds throughout the year under mild indoor conditions, breeds seasonally in natural habitats. Gestation lasts 19-21 days (may be longer if female is lactating). Young are weaned in about 18 days. Produces many litters of 3-12 (typically 4-5) young per year. Sexually mature in 5-10 weeks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction and Life History

Female house mice have an estrous cycle that is 4-6 days long, with estrus itself lasting less than a day. If several females are held together under crowded conditions, they will often not have an estrus at all; if they are then exposed to male urine, they will become estrous after 72 hours. The gestation period is about 19-21 days, and they give birth to a litter of 3-14 young (average 6-8). One female can have some 5-10 litters per year, so their population can increase very quickly. Breeding occurs throughout the year (however, animals living in the wild don't reproduce in the colder months, even though they don't hibernate). The newborn are blind and furless. Fur starts to grow some three days after birth and the eyes open one to two weeks after birth. Females reach sexual maturity at about 6 weeks and males at about 8 weeks, but both can breed as early as five weeks. House mice usually live under a year in the wild, because of a high level of predation and exposure to harsh environments. In protected environments, however, they often live two to three years. The Methuselah Mouse Prize is a competition to breed or engineer extremely long-lived laboratory mice. As of 2005, the record holder was a genetically engineered mouse that lived for 1819 days, nearly 5 years. Another record holder that was kept in a stimulating environment but did not receive any genetic, pharmacological or dietary treatment lived for 1551 days, over 4 years.
GNU Free Documentation License (GNU FDL)

Wikipedia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physiology and Cell Biology

Cell Biology

Chromosomal Data

21 chromosomes
Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Mus musculus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 55 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GTENK017-11|PRJNA9559|Mus musculus| AATCGTTGATTATTCTCAACCAATCACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCTGAGCGGGAATAGTGGGTACTGCACTA---AGTATTTTAATTCGAGCAGAATTAGGTCAACCAGGTGCACTTTTAGGAGAT---GACCAAATTTACAATGTTATCGTAACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAATTGGAGGCTTTGGAAACTGACTTGTCCCACTAATA---ATCGGAGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATCATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAGGATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCATCAGTAGACCTA---ACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTATTTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAGCCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACAGCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCA---GGCATTACTATACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAGGAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCAGAAGTTTATATTCTTATCCTCCCAGGATTTGGAATTATTTCACATGTAGTTACTTACTACTCCGGAAAAAAA---GAACCTTTCGGCTATATAGGAATAGTATGAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCACATATTCACAGTAGGATTAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Mus musculus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 54
Species: 115
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Creative Commons Attribution 3.0 (CC BY 3.0)

Indra Neil Sarkar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Musser, G., Amori, G., Hutterer, R., Kryštufek, B., Yigit, N. & Mitsain, G.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Temple, H. (Global Mammal Assessment Team)

Justification
A widespread and abundant species that thrives in anthropogenic habitats, hence listed as Least Concern.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Commensal populations of Mus musculus are generally stable and densities can be as high as 10 mice per square meter. In the wild, populations are less stable and densities may be less than 1 mouse per 100 square meters. Overall, populations are flourishing and are in fact aided by human construction of houses, barns, and other structures.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Non-native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN

Not Assessed (non-native).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Abundance

Common.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Very common (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A widespread and abundant species; common except in some extreme habitats (e.g. at high altitude) (Macholán 1999).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species faces no major threats.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Not protected under international legislation; commonly regarded as a pest. Present in many protected areas. A highly successful colonist of artificial environments; no conservation measures are required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: See Olson and Lewis (1995) for information on damage prevention and control techniques, including exclusion, proper sanitation, and lethal and nonlethal control methods (e.g., repellents, toxicants, traps).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

House mice do not cause such serious health and economic problems as do Rattus norvegicus and Rattus rattus. Mice are agricultural pests in some areas, however, and they do consume and contaminate stored human food with their droppings. They also destroy woodwork, furniture, upholstery, and clothing. In addition, they contribute to the spread of diseases such as murine typhus, rickettsial pox, tularemia, food poisoning (Salmonella), and bubonic plague. Recent research has also shown that they carry a virus--the mouse mammary tumor virus (MMTV)--that may contribute to breast cancer in humans.

Negative Impacts: injures humans (carries human disease); crop pest; household pest

  • Indik, S., W. Günzburg, B. Salmons, F. Rouault. 2005. Mouse mammary tumor virus infects human cells. Cancer Research, 65 (15): 6651-6659.
  • Stewart, T., R. Sage, A. Stewart, D. Cameron. 2000. Breast cancer incidence highest in the range of one species of house mouse, Mus domesticus. British Journal of Cancer, 82(2): 446-451.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Domesticated forms and albinos have been developed which are commonly used as laboratory animals (especially in medicine and genetics), and as pets. Mus musculus also has a small role as an insect destroyer, but this is minimal.

Positive Impacts: pet trade ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Often a pest when associated with humans. Consumes stored foods; contaminates about ten times as much food as it consumes. Nest construction and chewing may damage appliances and wiring, sometimes resulting in fires. Involved in the transmission of several diseases, including hantavirus, which causes often-fatal respiratory distress syndrome in humans. See Olson and Lewis (1995).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mice used in research

Mice are genetically very similar to humans. They also reproduce rapidly, have short life spans, are inexpensive and easy to handle, and can be genetically manipulated at the molecular level.

In addition to the human genome, the genomes of about 800 organisms have been sequenced in recent years. These include the mouse Mus musculus, the fruitfly Drosophila melanogaster, the worm Caenorhabditis elegans, the bacterium Escherichia coli, the yeast Saccharomyces cerevisiae, the plant Arabidopsis thaliana, and many microbes.

Genome sizes of Mus musculus being studied

organism: Mus musculus (mouse)

estimated size (base pairs): 2.6 billion

estimated gene number: ~25,000

average gene density: 1 gene per 100,000 bases

chromosome number: 40
  • Rat Genome Sequencing Project Consortium. Genome Sequence of the Brown Norway Rat Yields Insights into Mammalian Evolution. Nature 428: 493-521. (1 April 2004)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Eli E. Agbayani

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

House mouse

The house mouse (Mus musculus) is a small rodent, a mouse, one of the most numerous species of the genus Mus.

As a wild animal the house mouse mainly lives associated with humans, causing damage to crops and stored food.

The house mouse has been domesticated as the pet or fancy mouse, and as the laboratory mouse which is one of the most important model organisms in biology and medicine. It is by far the most commonly used genetically altered laboratory mammal.[2]

Contents

Characteristics

House mice have an adult body length (nose to base of tail) of 7.5–10 cm (3.0–3.9 in) and a tail length of 5–10 cm (2.0–3.9 in). The weight is typically 10–25 g (0.4–0.9 oz). They vary in colour from white to grey, and light brown to black. They have short hair and a light belly. The ears and tail have little hair. The hind feet are short compared to Apodemus mice, only 15–19 mm (0.59–0.75 in) long; the normal gait is a run with a stride of about 4.5 cm (1.8 in), though they can jump vertically up to 45 cm (18 in).[3] The voice is a high-pitched squeak.[4][5] House mice thrive under a variety of conditions: they are found in and around homes and commercial structures as well as in open fields and agricultural lands.

Reconstructed image of a House Mouse skull.

Young males and females are not easily distinguished: like people, females have a significantly smaller distance between their anus and genital opening. Females have 5 pairs of mammary glands and nipples; males have no nipples.[6] When sexually mature, the most striking and obvious difference is the presence of testicles on the males. These are large compared to the rest of the body and can be retracted into the body. In addition to the regular pea-size thymus organ in the chest, house mice have a second functional pinhead-size thymus organ in the neck next to the trachea.[7]

Subspecies

There are three widely accepted subspecies, increasingly treated as distinct species:[8][9]

Two additional subspecies have been more recently recognized:[9]

Many more names have been given to house mice, but are now regarded as synonyms of other subspecies. Some populations are hybrids of different subspecies, including the Japanese house mouse ("molossinus").[9][11]

Behaviour

Eating
Mus musculus - japanese house mouse.ogv
Video of a Japanese pet mouse eating at Ueno Zoo.

House mice usually run, walk, or stand on all fours, but when eating, fighting, or orienting themselves, they stand only on the hind legs, supported by the tail. When they run, the horizontal tail serves for balance; the end stands up vertically, unless the mouse is frightened. Mice are good jumpers, climbers, and swimmers.

Mice are mostly active during dusk or night; they do not like bright lights. They live in a wide variety of hidden places that are near food sources and construct nests from various soft materials. Mice are territorial, and one dominant male usually lives together with several females and young. Dominant males respect each other's territory and normally enter another's territory only if it is vacant. If two or more males are held together in a cage, they will often turn aggressive unless they have been raised together from birth.

House mice primarily feed on plant matter but are omnivorous. They will eat their droppings to acquire nutrients produced by bacteria in their intestines. House mice, like most other rodents, do not vomit.

Mice are afraid of rats, which often kill and (partially) eat mice. This rat behaviour is known as muricide. Despite this behaviour free-living populations of rats and mice do exist together in forest areas in New Zealand, North America and elsewhere. House mice are generally poor competitors and in most areas cannot survive away from human settlements in areas where other small mammals, such as wood mice, are present.[12] However, in some areas (such as Australia), mice are able to co-exist with other small rodent species.[13]

Senses and communication

Vision

As primarily nocturnal animals, house mice have little or no colour vision. Their visual apparatus is basically similar to humans but differs markedly in at least one respect. The ventral area of the mouse retina has a much greater density of ultraviolet (UV) sensitive cones than other areas of the retina, although the biological significance of this structure is unknown.[14][15][16]

Hearing

Mice can hear over a broad spectrum of frequencies. They can detect frequencies from 80 Hz to 100 kHz (i.e. into the ultrasound range), but are most sensitive in the 15–20 kHz range and around 50 kHz. They communicate both in the human audible range with squeaks (for long-distance warnings), and in the ultrasound range (for short-distance communication).[citation needed]

Olfaction

House mice also rely on pheromones for social communication, some of which are produced by the preputial glands of both sexes. The tear fluid and urine of male mice also contains pheromones, such as major urinary proteins.[17][18] Mice detect pheromones mainly with the vomeronasal organ (Jacobson's organ), located at the bottom of the nose.

The urine of house mice, especially that of males, has a characteristic strong odor. At least ten different compounds such as alkanes, alcohols, etc. are detectable in the urine. Among the ten, five compounds are specific to males, namely 3-cyclohexene-1-methanol, Aminotriazole (3-amino-s-triazole), 4-ethyl phenol, 3-ethyl-2,7-dimethyl octane and 1-iodoundecane.[19]

Odours from adult males or from pregnant or lactating females can speed up or retard sexual maturation in juvenile females and synchronise reproductive cycles in mature females (i.e. the Whitten effect). Odours of unfamiliar male mice may terminate pregnancies, i.e. the Bruce effect.

Touch

Mice can sense surfaces and air movements with their whiskers which are also used during thigmotaxis. If mice are blind from birth there is super-normal growth of the vibrissae presumably as a compensatory response,[20] or if the vibrissae are absent, the use of vision is intensified.[21]

Life cycle and reproduction

A 7-day-old mouse suckling on an anaesthetized mother.
A baby mouse, 4 days old.
2 weeks old, just about to open its eyes.

Female house mice have an estrous cycle that is 4–6 days long, with estrus itself lasting less than a day. If several females are held together under crowded conditions, they will often not have an estrus at all. If they are then exposed to male urine, they will become estrous after 72 hours.

Male house mice court females by emitting characteristic ultrasonic calls in the 30 kHz–110 kHz range. The calls are most frequent during courtship when the male is sniffing and following the female; however, the calls continue after mating has begun at which time the calls are coincident with mounting behaviour. Males can be induced to emit these calls by female pheromones. The vocalizations appear to be different in different individuals and have been compared to birdsongs because of their complexity.[22] While females have the capability to produce ultrasonic calls, they typically do not do so during mating behaviour.

Following copulation, female mice will normally develop a copulation plug which prevents further copulation. This plug stays in place for some 24 hours. The gestation period is about 19–21 days, and they give birth to a litter of 3–14 young (average 6–8). One female can have some 5–10 litters per year, so the mice population can increase very quickly. Breeding occurs throughout the year (however, animals living in the wild don't reproduce in the colder months, even though they don't hibernate). The newborn are blind and without fur. Fur starts to grow some three days after birth and the eyes open one to two weeks after birth. Males reach sexual maturity at about 6 weeks and females at about 8 weeks, but both can breed as early as five weeks.

Sleep

The average sleep time of a captive House mouse is said[by whom?] to be 12½ hours per day.[23]

Life expectancy

House mice usually live under a year in the wild. This is due to a high level of predation and exposure to harsh environments. In protected environments, however, they often live two to three years. The Methuselah Mouse Prize is a competition to breed or engineer extremely long-lived laboratory mice. As of 2005, the record holder was a genetically engineered mouse that lived for 1819 days (nearly five years). Another record holder that was kept in a stimulating environment but did not receive any genetic, pharmacological, or dietary treatment lived for 1551 days (over four years).

Mice and humans

House mice usually live in proximity to humans, in or around houses or fields. Originally native to Asia (probably northern India),[24] they spread to the Mediterranean Basin about 8000 BC, only spreading into the rest of Europe around 1000 BC.[25] This time lag is thought to be because the mice require agrarian human settlements above a certain size.[25] They have since been spread to all parts of the globe by humans.

Many studies have been done on mouse phylogenies to reconstruct early human movements. For example one study showed a previously unsuspected early link between Denmark and Madeira on the basis of the origin of the Madeiran mice.[26]

An individually ventilated and sealed cage for laboratory mice

House mice can transmit diseases, and can damage food and food packaging. Some of the diseases the house mouse carries can be deadly: for example, Leptospirosis, Murine typhus, Rickettsialpox, Tularemia, lymphocytic choriomeningitis [27] and potentially Bubonic plague.[citation needed] House mice can also cause substantial damage when feeding on grain. It is thought that house mice were the primary reason for the taming of the domestic cat. Various mousetraps have been developed to catch mice.

The first written reference to mice kept as pets occurs in the Erya, the oldest extant Chinese dictionary, from a mention in an 1100 B.C. version.[28] Human domestication led to numerous strains of "fancy" or hobby mice with a variety of colours and a docile temperament.[29] Domestic varieties of the house mouse called "feeder" mice are also used as food for some carnivorous pet reptiles, birds, arthropods, and fish. Mice bred for this purpose are genetically identical to other domestic mice, and they can be kept as pets themselves.[29]

Mice as an invasive species

Gough Island in the South Atlantic is used by 20 species of seabird for breeding, including almost all of the world's Tristan Albatross (Diomedea dabbenena) and Atlantic Petrel (Pterodroma incerta). Until house mice arrived on the island in the 19th century with seamen, the birds did not have any mammalian predators. The mice have since grown unusually large and have learned to attack albatross chicks, which can be nearly one metre tall but are largely immobile, by working in groups and gnawing on them until they bleed to death. The estimated 700,000 mice on the island kill a total of over one million bird chicks per year.[30]

Laboratory mice

Lab mouse mg 3263.jpg
Laboratory mouse (note the ear tag)

Mice are the most commonly used mammalian research model with hundreds of established inbred, outbred, and transgenic strains. They are common experimental animals in biology and psychology, primarily because they are mammals, are relatively easy to maintain and handle, reproduce quickly, and share a high degree of homology with humans. The mouse genome has been sequenced, and many mouse genes have human homologues. In addition to being small, relatively inexpensive, and easily maintained, there are further benefits to the use of mice in laboratory research. Because mice can reproduce quickly, several generations of mice can be observed in a relatively short period of time.[31]

Most laboratory mice are hybrids of different subspecies, most commonly of Mus musculus domesticus and Mus musculus musculus. Laboratory mice can have a variety of coat colours including agouti, black and albino. Many (but not all) laboratory strains are inbred, so as to make them genetically almost identical. The different strains are identified with specific letter-digit combinations; for example C57BL/6 and BALB/c. The first such inbred strains were produced by Clarence Cook Little in 1909. Little was influential in promoting the mouse as a laboratory organism.[32]

Albino laboratory mice

Legislation of use in science

In the United States, laboratory mice are not regulated under the Animal Welfare Act (AWA) administered by the USDA APHIS. However, the Public Health Service Act (PHS) as administered by the National Institutes of Health (NIH) does offer a standard for their care and use. Compliance with PHS is required in order to receive federal funding. PHS Policy is administered by the Office of Laboratory Animal Welfare (OLAW). Many academic research institutes seek accreditation voluntarily, often through Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC), which maintains the standards of care found within The Guide for the Care and Use of Laboratory Animals and the PHS Policy. This accreditation is voluntary not a prerequisite for federal funding.[33] In the UK, as with all other vertebrates and some invertebrates, any scientific procedure which is likely to cause lasting distress or suffering is regulated by the Home Office under the Animals (Scientific Procedures) Act 1986.

Genome

mice genetically engineered to express green fluorescent protein under UV light

Sequencing of the mouse genome was completed in late 2002. The haploid genome is about three billion bases long (3000 Mb distributed over 20 chromosomes) and therefore equal to the size of the human genome.[34] Estimating the number of genes contained in the mouse genome is difficult, in part because the definition of a gene is still being debated and extended. The current estimated gene count is 23,786.[35] This estimate takes into account knowledge of molecular biology as well as comparative genomic data. For comparison, humans are estimated to have 23,686 genes.[36]

T-haplotype

The t-haplotype is a selfish element that works to disable the function of the wild house mouse, Mus musculus, sperm to ensure the fertilization of the female egg with their own sperm. This gamete killer designed and structured to suppress recombination of genes, is a single unit, of linked genes, located near the centromere of chromosome 17 and is approximately 30-40 Mb long.[37] One part of the t-haplotype is the responder-insensitive allele Tcr. Tcr gives protection from the distorting drivers, since it shows haploid-specific expression, which means that only sperm that carry the haploid are rescued from being killed.[38] While advantageous, the frequency of this selfish element is reported as low.[39]

The low t – haplotype frequency in the wild house mouse population is a paradox. Although +/t male mice carry equal ratios of both gamete types (+ and t) and the wild type chromosome becomes functionally inactivated as well as 90% of the offspring inherit the t chromosomes, wild house mouse populations have remained polymorphic.[39] It would be hypothesized that the high TRD, transmission distortion ratio, of t-haplotypes would become fixed in a natural population, if 90% of the offspring were inheriting the t chromosome, but due to several factors this is not the case. There have been investigations of different subspecies mice populations in different locations. Studies have found that there were low t frequencies in enclosure populations as well as in different subspecies. Huang et al. (2001),[40] in Taiwan, observed a low frequency in the subspecies, Mus castaneus, which has also been observed by both Ardlie and Silver (1998)[39] and Carroll et al. (2004).[41] Based on these findings, it can be assumed that the general mechanisms of these low t frequencies in mouse populations are similar across subspecies and geographical location, making the unraveling of this paradox beneficial to not only the Mus domesticus species of mouse, but for other species of mouse such as Mus castaneus.

Explanations for the low frequency of t-haplotypes include factors such as population size, inbreeding, heterozygosity, and polyandry in the wild house mouse population.

Mutant and transgenic strains

A knockout mouse (left) that is a model of obesity, compared with a normal mouse.

Various mutant strains of mice have been created by a number of methods:

Since 1998, it has been possible to clone mice from cells derived from adult animals.

Injection procedures

Routes of administration of injections in laboratory mice are mainly subcutaneous, intraperitoneal and intravenous. Intramuscular administration is not recommended due to small muscle mass.[43] Intracerebral administration is also possible. Each procedure has recommended injection site, approximate needle gauge and recommended maximal injected volume at a single time at one site, as given in table:

RouteRecommended site[43]Needle gauge[43]Maximal volume[44]
subcutaneousdorsum, between scapula25-26 ga2-3 ml
intraperitonealleft lower quadrant25-27 ga2-3 ml
intravenouslateral tail vein27-28 ga0.2 ml
intramuscularhindlimb, caudal thigh26-27 ga0.05 ml
intracerebralcranium27 ga

To facilitate intravenous injection into the tail, laboratory mice can be carefully warmed under heat lamps to vasodilate the vessels.[43]

Anesthesia

A common regimen for general anesthesia for the house mouse is ketamine (in the dose of 100 mg per kilogram body weight) plus xylazine (in the dose of 5–10 mg/kg), injected by the intraperitoneal route.[45] It has a duration of effect of about 30 minutes.[45]

Notes

  1. ^ Musser G, Amori G, Hutterer R, Kryštufek B, Yigit N & Mitsain G (2008). Mus musculus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 10 October 2008.
  2. ^ the National Centre for Replacement, Refinement, and Reduction of Animals in Research
  3. ^ Baker RO, Bodman GR, Timm RM (1994). "Rodent-Proof Construction and Exclusion Methods". In Hygnstrom SE, Timm RM, Larson GE. Prevention and Control of Wildlife Damage. University of Nebraska-Lincoln. http://digitalcommons.unl.edu/icwdmhandbook/27/. 
  4. ^ Lyneborg L (1971). Mammals of Europe. Blandford Press. 
  5. ^ Lawrence MJ, & Brown RW (1974). Mammals of Britain Their Tracks, Trails and Signs. Blandford Press. 
  6. ^ "Julie Ann Mayer, John Foley, Damon De La Cruz, Cheng-Ming Chuong, and Randall Widelitz" ("november 2008"). ["http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2570124/" "Conversion of the Nipple to Hair-Bearing Epithelia by Lowering Bone Morphogenetic Protein Pathway Activity at the Dermal-Epidermal Interface"]. "http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2570124/". 
  7. ^ Terszowski G et al., G (2006-03-02). "Evidence for a Functional Second Thymus in Mice". Science 312 (5771): 284. doi:10.1126/science.1123497. ISSN 0036-8075. PMID 16513945. 
  8. ^ Mitchell-Jones AJ, Amori G, Bogdanowicz W, Krystufek B, Reijnders PJH, Spitzenberger F, Stubbe M, Thissen JBM, Vohralik V, & Zima J (1999). The Atlas of European Mammals. T. & A. D. Poyser. ISBN 0-85661-130-1. 
  9. ^ a b c Musser & Carleton 2005
  10. ^ Prager EM, Orrego C and Sage RD (1998). "Genetic variation and phylogeography of Central Asian and other house mice, including a major new mitochondrial lineage in Yemen". Genetics 150 (2): 835–861. PMC 1460354. PMID 9755213. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=1460354. 
  11. ^ Bonhomme F, Miyashita N, Boursot, Catalan J and Moriwaki K (1989). "Genetic variation and polyphyletic origin in Japanese Mus musculus". Heredity 63 (3): 299–308. doi:10.1038/hdy.1989.102. PMID 2613534. 
  12. ^ Tattersall FH, Smith RH & Nowell F (1997). "Experimental colonization of contrasting habitats by house mice". Zeitschrift für Säugetierkunde 62: 350–8. 
  13. ^ Moro D and Morris K (2000). "Movements and refugia of Lakeland Downs short-tailed mice, Leggadina lakedownensis, and house mice, Mus domesticus, on Thevenard Island, Western Australia". Wildlife Research 27: 11–20. doi:10.1071/WR99016. 
  14. ^ Calderone, J.B. and Jacobs, G.H., (1995). Regional variations in the relative sensitivity to UV light in the mouse retina. Visual Neuroscience, 12: 463–468
  15. ^ Yokohyama, S. and Shi, Y.S. (2000). Genetics and evolution of ultraviolet vision in vertebrates. FEBS Letters, 486: 167–172
  16. ^ Neitz, M. and Neitz, J. (2001). The uncommon retina of the common house mouse. Trends in Neuroscience, 24: 248–249
  17. ^ Kimoto, H; Haga, S; Sato, K; Touhara, K (Oct 2005). "Sex-specific peptides from exocrine glands stimulate mouse vomeronasal sensory neurons". Nature 437 (7060): 898–901. doi:10.1038/nature04033. ISSN 0028-0836. PMID 16208374. http://www.nature.com/nature/journal/v437/n7060/abs/nature04033.html. 
  18. ^ Chamero P, Marton TF, Logan DW, et al., P (December 2007). "Identification of protein pheromones that promote aggressive behaviour". Nature 450 (7171): 899–902. doi:10.1038/nature05997. ISSN 0028-0836. PMID 18064011. 
  19. ^ Achiraman S & Archunan G, S (Dec 2002). "Characterization of urinary volatiles in Swiss male mice (Mus musculus): bioassay of identified compounds". J Biosci 27 (7): 679–86. doi:10.1007/BF02708376. ISSN 0250-5991. PMID 12571373. 
  20. ^ Rauschecker, J.P., Tian, B. and Korte, M., (1992). Crossmodal changes in the somatosensory vibrissa barrel system of visually deprived animals. Proceedings of the National Academy of Sciences USA 89: 5063–5067
  21. ^ Sokolov, V.E., Tikhonova, G.N. and Tikhonov, I.A., (1996). Role of sense systems in the behavior of Ryukyu mice. Izvestiya Akademii Nauk Seriya Biologicheskaya 2: 169–175
  22. ^ Holy, TE; Guo, Z (December 2005). "Ultrasonic Songs of Male Mice". PLoS Biol 3 (12): e386. doi:10.1371/journal.pbio.0030386. PMC 1275525. PMID 16248680. http://biology.plosjournals.org/perlserv/?request=get-document&doi=10.1371/journal.pbio.0030386. 
  23. ^ "40 Winks?" Jennifer S. Holland, National Geographic Vol. 220, No. 1. July 2011.
  24. ^ Boursot P, Din W, Anand R, Darviche D, Dod B, Von Deimling F, Talwar GP and Bonhomme F (1996). "Origin and radiation of the house mouse: mitochondrial DNA phylogeny". Journal of Evolutionary Biology 9: 391–415. doi:10.1046/j.1420-9101.1996.9040391.x. 
  25. ^ a b Cucci T, Vigne J-D and Auffray J-C (2005). "First occurrence of the house mouse (Mus musculus domesticus Schwarz & Schwarz, 1943) in the Western Mediterranean: a zooarchaeological revision of subfossil occurrences". Biological Journal of the Linnean Society 84: 429–445. doi:10.1111/j.1095-8312.2005.00445.x. 
  26. ^ Gündüz I, Auffray J-C, Britton-Davidian J, Catalan J, Ganem G, Ramalhinho MG, Mathias ML and Searle JB (2001). "Molecular studies on the colonization of the Madeiran archipelago by house mice". Molecular Ecology 10 (8): 2023–9. doi:10.1046/j.0962-1083.2001.01346.x. PMID 11555245. 
  27. ^ M. Madon, 2002 "Vertebrates of public health importance in California" Mosquito & Vector Control Association of America, Chapter 6, Section D, page 56.
  28. ^ American Fancy Rat and Mouse Association
  29. ^ a b the Rat and Mouse Club of America
  30. ^ Wanless RM, Angel A, Cuthbert RJ, Hilton GM & Ryan PG (2007). "Can predation by invasive mice drive seabird extinctions?". Biology Letters 3 (3): 241–4. doi:10.1098/rsbl.2007.0120. PMC 2464706. PMID 17412667. http://www.journals.royalsoc.ac.uk/content/110824/. 
  31. ^ "MGI — Biology of the Laboratory Mouse". Informatics.jax.org. http://www.informatics.jax.org/greenbook/frames/frame11.shtml. Retrieved 2010-07-29. 
  32. ^ Crow JF (August 2002). "C. C. Little, cancer and inbred mice". Genetics 161 (4): 1357–61. PMC 1462216. PMID 12196385. http://www.genetics.org/cgi/content/full/161/4/1357. 
  33. ^ "Office of Laboratory Animal Welfare: PHS Policy on Humane Care and Use of Laboratory Animals". Grants.nih.gov. http://grants.nih.gov/grants/olaw/references/phspol.htm. Retrieved 2010-07-29. 
  34. ^ No items found - Books Results
  35. ^ Ensembl gene build 47, based upon NCBI assembly m37, Apr 2007
  36. ^ Ensembl gene build 47, based upon NCBI assembly 36, Oct 2005
  37. ^ Silver, L. 1993. The peculiar journey of a selfish chromosome: mouse t-haplotypes and meiotic drive. Trends in Genetics 9:250.
  38. ^ Lyon, M. 2003. Transmission ratio distortion in mice. Annual Review Genetics 37:393-408.
  39. ^ a b c Ardlie, K., and L. Silver. 1998. Low frequency of t haplotypes in natural populations of house mice (Mus musculus domesticus). Evolution 52: 1185-1196.
  40. ^ Huang, S. –W., Ardlie, K.G., and H.-T. Yu. 2001. Frequency and distribution of t-haplotypes in the southeast asian house mouse (Mus musculus castaneus) in Taiwan. Molecular Ecology 10:2349-2354.
  41. ^ Carroll, L., S. Meagher, L. Morrison, D. Penn, and W. Potts. 2004. Fitness effects of a selfish gene (the Mus t complex) are revealed in an ecological context. Evolution 58:1318–1328.
  42. ^ "JAX Mice Database — 002983 MRL.CBAJms-Fas/J". Jaxmice.jax.org. http://jaxmice.jax.org/strain/002983.html. Retrieved 2010-07-29. 
  43. ^ a b c d Guidelines for Selecting Route and Needle Size From Duke University and Medical Center - Animal Care & Use Program. Retrieved April 2011
  44. ^ A Compendium of Drugs Used for Laboratory Animal Anesthesia, Analgesia, Tranquilization and Restraint at Drexel University College of Medicine. Retrieved April 2011
  45. ^ a b Guidelines for Systemic Anesthetics (Mouse) From Duke University and Medical Center - Animal Care & Use Program. Retrieved April 2011

References

  • Musser, G.G.; Carleton, M.D. (2005). "Superfamily Muroidea". In Wilson, D.E.; Reeder, D.M.. Mammal Species of the World: a taxonomic and geographic reference (3rd ed.). Baltimore: Johns Hopkins University Press. pp. 894–1531. ISBN 978-0-8018-8221-0. http://www.bucknell.edu/msw3. 
  • Nyby J. (2001). "Ch. 1 Auditory communication in adults". In Willott, James F.. Handbook of Mouse Auditory Research: From Behavior to Molecular Biology. Boca Raton: CRC Press. pp. 3–18. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Mouse

A mouse (plural: mice) is a small mammal belonging to the order of rodents, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. The best known mouse species is the common house mouse (Mus musculus). It is also a popular pet. In some places, certain kinds of field mice are also common. This rodent is eaten by large birds such as hawks and eagles. They are known to invade homes for food and occasionally shelter.

The American White-footed Mouse (Peromyscus leucopus) and the deer mouse (Peromyscus maniculatus), as well as other common species of mouse-like rodents around the world, also sometimes live in houses. These, however, are in other genera.

Cats, wild dogs, foxes, birds of prey, snakes and even certain kinds of arthropods have been known to prey heavily upon mice. Nevertheless, because of its remarkable adaptability to almost any environment, the mouse is one of the most successful mammalian genera living on Earth today.

Mice can at times be harmful rodents, damaging and eating crops,[1] causing structural damage and spreading diseases through their parasites and feces.[2] In North America, breathing dust that has come in contact with mouse excrement has been linked to hantavirus, which may lead to Hantavirus Pulmonary Syndrome (HPS).

Primarily nocturnal animals, mice compensate for their poor eyesight with a keen sense of hearing, and rely especially on their sense of smell to locate food and avoid predators.[3]

Mice and rats are the most commonly used animals for laboratory tests.[4]

Contents

Reproduction

1 day old pups

Breeding onset is at about 50 days of age in both females and males, although females may have their first estrus at 25–40 days. Mice are polyestrous and breed year round; ovulation is spontaneous. The duration of the estrous cycle is 4–5 days and estrus itself lasts about 12 hours, occurring in the evening. Vaginal smears are useful in timed matings to determine the stage of the estrous cycle. Mating is usually nocturnal and may be confirmed by the presence of a copulatory plug in the vagina up to 24 hours post-copulation. The presence of sperm on a vaginal smear is also a reliable indicator of mating.[5]

Female mice housed together tend to go into anestrus and do not cycle. If exposed to a male mouse or the pheromones of a male mouse, most of the females will go into estrus in about 72 hours. This synchronization of the estrous cycle is known as the Whitten effect. The exposure of a recently bred mouse to the pheromones of a strange male mouse may prevent implantation (or pseudopregnancy), a phenomenon known as the Bruce effect.[5]

The average gestation period is 20 days. A fertile postpartum estrus occurs 14–24 hours following parturition, and simultaneous lactation and gestation prolongs gestation 3–10 days owing to delayed implantation. The average litter size is 10–12 during optimum production, but is highly strain-dependent. As a general rule, inbred mice tend to have longer gestation periods and smaller litters than outbred and hybrid mice. The young are called pups and weigh 0.5–1.5 g (0.018–0.053 oz) at birth, are hairless, and have closed eyelids and ears. Cannibalism is uncommon, but females should not be disturbed during parturition and for at least 2 days postpartum. Pups are weaned at 3 weeks of age; weaning weight is 10–12 g (0.35–0.42 oz). If the postpartum estrus is not utilized, the female resumes cycling 2–5 days post-weaning.[5]

Newborn male mice are distinguished from newborn females by noting the greater anogenital distance and larger genital papilla in the male. This is best accomplished by lifting the tails of littermates and comparing perineums.[5]

Laboratory mice

Mice are common experimental animals in biology and psychology primarily because they are mammals, and also because they share a high degree of homology with humans. They are the most commonly used mammalian model organism, more common than rats. The mouse genome has been sequenced, and virtually all mouse genes have human homologs. They can also be manipulated in ways that would be considered unethical to do with humans (note Animal Rights). A knockout mouse is a genetically engineered mouse that has had one or more of its genes made inoperable through a gene knockout.

There are other reasons why mice are used in laboratory research. Mice are small, inexpensive, easily maintained, and can reproduce quickly. Several generations of mice can be observed in a relatively short period of time. Mice are generally very docile if raised from birth and given sufficient human contact. However, certain strains have been known to be quite temperamental. Mice and rats have the same organs in the same places, just different proportions.

Subgenera

Field mouse of the subgenus Mus.

All members of the Mus genus are referred to as mice. However, the term mouse can also be applied to species outside of this genus. Mouse often refers to any small muroid rodent, while rat refers to larger muroid rodents. Therefore these terms are not taxonomically specific. For simplicity, only the rodent subgenera belonging to the Mus genus are listed here.

Genus Mus - Typical mice

As pets

Pet mice

Many people buy mice as companion pets. They can be playful, loving and can grow used to being handled. Like pet rats, pet mice should not be left unsupervised outside as they have many natural predators, including (but not limited to) birds, lizards, cats, and dogs. Male mice tend to have a stronger odor than the females. However, mice are careful groomers and as pets they never need bathing. Well looked after mice can make ideal pets. Some common mouse care products are:

  • Cage – Usually a hamster or gerbil cage, but special mouse cages are now available.
  • Food – Special pelleted and seed-based food is available. Mice can generally eat most rodent food (for rats, mice, hamsters, gerbils, etc.)
  • Bedding – Usually made of hardwood pulp, such as aspen, sometimes from shredded, uninked paper or recycled virgin wood pulp. Using corn husk bedding is avoided because it promotes Aspergillis fungus, and can grow mold once it gets wet, which is rough on their feet.

Nutrition

In nature, mice are largely herbivores, consuming any kind of fruit or grain from plants.[6] Consequently, mice adapt well to urban areas and are known for eating almost all types of food scraps. In captivity, mice are commonly fed commercial pelleted mouse diet. These diets are nutritionally complete, but they still need a large variety of vegetables. Food intake is approximately 15 g (0.53 oz) per 100 g (3.5 oz) of body weight per day; water intake is approximately 15 ml (0.53 imp fl oz; 0.51 US fl oz) per 100 g of body weight per day.[5]

As food

"Pinkie" mice for sale as reptile food

Mice are a staple in the diet of many small carnivores. Humans have eaten mice since prehistoric times and still eat them as a delicacy throughout eastern Zambia and northern Malawi,[7], where they are a seasonal source of protein. Mice are no longer routinely consumed by humans elsewhere.

In various countries mice are used as food[8] for pets such as snakes, lizards, frogs, tarantulas and birds of prey, and many pet stores carry mice for this purpose. Some countries, such as Germany and the United Kingdom, have banned the practice of feeding live mice, citing ethical concerns regarding both predator and prey.[9]

Common terms used to refer to different ages/sizes of mice when sold for pet food are "pinkies", "fuzzies", "crawlers", "hoppers", and "adults".[10] Pinkies are newborn mice that have not yet grown fur; fuzzies have some fur but are not very mobile; hoppers have a full coat of hair and are fully mobile but are smaller than adult mice. Mice without fur are easier for the animal to consume; however, mice with fur may be more convincing as animal feed. These terms are also used to refer to the various growth stages of rats (see Fancy rat).

Use for sense of smell

Israeli scientists have tested mice as a new form of airport security detector. It consists of three concealed cartridges, each containing eight specially trained mice. If they sense traces of explosives or drugs, they will trigger the alarm. According to the New Scientist, the mice work four-hour shifts and are more accurate than using dogs or x-ray machines.[11]

See also

Notes

  1. ^ Meerburg BG, Singleton GR, Leirs H (2009). "The Year of the Rat ends: time to fight hunger!". Pest Manag Sci 65 (4): 351–2. doi:10.1002/ps.1718. PMID 19206089. http://www3.interscience.wiley.com/journal/121686000/abstract. 
  2. ^ Meerburg BG, Singleton GR, Kijlstra A (2009). "Rodent-borne diseases and their risks for public health". Crit Rev Microbiol 35 (3): 221–70. doi:10.1080/10408410902989837. PMID 19548807. http://www.informahealthcare.com/doi/pdf/10.1080/10408410902989837. 
  3. ^ The Humane society of the United States
  4. ^ Knudson, Mary (1981-05-14). "Hopkins thalidomide research results in new drug test". http://pqasb.pqarchiver.com/baltsun/access/1845956812.html?FMT=ABS&FMTS=ABS:AI&type=historic&date=May+14%2C+1981&author=&pub=The+Sun+%281837-1985%29&desc=Hopkins+thalidomide+research+results+in+new+drug+test&pqatl=google. 
  5. ^ a b c d e Louisiana Veterinary Medical Association
  6. ^ Mouse: Northwestern University Ecodome Information Page
  7. ^ Tembo, Mwizenge S.. "Mice as a Delicacy: the Significance of Mice in the Diet of the Tumbuka People of Eastern Zambia". Archived from the original on 2008-06-23. http://web.archive.org/web/20080623091951/http://www.bridgewater.edu/~mtembo/mbeba.html. Retrieved 2008-08-13. 
  8. ^ Food - Frozen mice & rats, Canberra Exotic Pets / reptilesinc.com.au, accessed 2009-11-14
  9. ^ "Snake feeding: Rodents, Food infections, Feeding Schedule". http://www.animalhospitals-usa.com/reptiles/snake_feeding.html. Retrieved 2009-05-29. 
  10. ^ "South Florida's True Rodent Professionals". http://www.southfloridarodents.com/. Retrieved 2009-05-29. 
  11. ^ "Mice trained for airport security". The Daily Telegraph (London). 2011-02-03. http://www.telegraph.co.uk/travel/travelnews/8300223/Mice-trained-for-airport-security.html. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

References and More Information

Names and Taxonomy

Taxonomy

Comments: This species comprises several groups that may be species or subspecies; Musser and Carleton (in Wilson and Reeder 2005) recognized them as subspecies and provided an extensive discussion of Mus systematics. Populations in nearly all of the United States descended from the European M. musculus domesticus, but Asian M. m. castaneus may also be present in part of southern California (Musser and Carleton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!