Articles on this page are available in 3 other languages: Chinese (Simplified) (1), Spanish (5), Dutch (1) (learn more)

Overview

Brief Summary

Brown rats like to live in the vicinity of people, since there is always a place to hide and something to eat. They eat just about everything: seeds, grains, beets, insects, meat, eggs, worms, young birds, small rodents, snails, amphibians and garbage. Brown rats are active at night. They are hunted by owls and predators (including domestic cats), and fiercely pursued by people. They are so intelligent that they aren't readily caught in traps.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Considered one of the most serious mammalian pests ever known, the brown rat is a true omnivore, eating a huge range of food including invertebrates, frogs, small mammals, birds' eggs, scavenged meat and bones, cereals and seeds (4), fruit, carrion, and any food discarded by humans (1). They have also been known to catch and eat fish (2). They are mainly nocturnal, but like many mammals they become increasingly active in the day where they are undisturbed by humans (4). They generally move around on the ground, but are also expert jumpers, climbers and swimmers (1), holding their tail aloft for balance when swimming (2). Brown rats live in 'packs' in which there is a dominant male who gains priority access to food, water and resting sites, and defends a harem of females, preventing subordinate males from mating (1). This rat is one of the most prolific of all mammals (1). Females become sexually mature at just 8-12 weeks, gestation is between 21 and 23 days, and females are able to conceive whilst suckling a previous litter, often mating within 18 hours of giving birth (1). They can breed throughout the year if the weather is mild and there is plenty of food; 13 litters are possible each year, each one consisting of 7-9 young (4). Maximum-known longevity is 3 years, but in the wild, life span is probably less than 18 months (4). The greatest cause of mortality is poisoning by rodenticides, but predators such as cats, foxes, dogs, mink, stoats and owls also take their toll (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The brown or Norway rat is a supreme generalist; its opportunistic lifestyle, agility and prolific breeding potential have helped it to colonise practically every part of the world (2). The fur of this rat varies in colour but is generally brown or greyish-brown with some black hairs, becoming paler on the underside (2). The tail is long and largely hairless, the naked ears are prominent (1) and the eyes are relatively small (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Although Norway rats were originally from northern China. They can now be found in nearly every part of the world as a human commensal. They were native only to the Palearctic region, but have been introduced to all other biogeographic regions except Antarctica. They are most commonly found in urban areas.

Biogeographic Regions: nearctic (Introduced ); palearctic (Introduced , Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution in Egypt

Widespread (Nile Valley, Delta, coastal areas).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species was originally native to south-east Siberia, north-east China and parts of Japan, but it occurs worldwide as an introduced species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Norway rats (Rattus norvegicus) are originally native to northern China. Following a series of introductions, the species had found its way to Eastern Europe by the early eighteenth century. By the year 1800, they occurred in every European country. Records show the first sighting of R. norvegicus in the New World occur in the 1770's as ship stowaways. Today, Norway rats (also known as brown rats) can be found on every continent of the world except Antarctica.

Biogeographic Regions: nearctic (Introduced ); palearctic (Native ); oriental (Introduced ); ethiopian (Introduced ); neotropical (Introduced ); australian (Introduced ); oceanic islands (Introduced )

Other Geographic Terms: cosmopolitan

  • Nowak, R., J. Paradiso. 1983. Walker's Mammals of the World: Fourth Edition. Baltimore, MD: The Johns Hopkins University Press.
  • Silver, J. 1927. The Introduction and Spread of House Rats in the United States. Journal of Mammalogy, 8/1: 58-60.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Assumed native in eastern Asia; introduced worldwide but most common in colder climates of high latitudes; in warmer regions, restricted to habitats highly modified by humans (Musser and carleton, in Wilson and Reeder 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The brown rat is believed to have originated from China. It reached Europe at some point in the early 18th century and was first seen in England in 1720 (4). At present it has a very wide distribution in Britain in both urban and rural areas, but is absent from a number of smaller islands. It is widespread and common in urban areas across the globe, with the exception of some tropical and subtropical areas (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

On average, Norway rats have lengths from nose to tip of tail of about 399 mm while the tail itself is 187 mm. Norway rats have coarse-fur, large furless ears, and a scaly tail. Norway rats tend to be brown or dark gray with scattered black hairs, while their bellies are pale gray or grayish brown.

Range mass: 200 to 500 g.

Average length: 399 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.404 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Rattus norvegicus is a rather large member of the mouse family. On average, these rats reach nearly 400 mm nose-to-tail, and weigh 140 to 500 g. Males are usually larger than females. In natural populations, these rats are covered with coarse, brownish fur (sometimes splotched with black or white hairs) on their dorsal surface, which usually lightens to a gray or tan color nearing the underside. Various strains of these rats bred in captivity may be white, brown, or black. The ears and tail are bald. The length of the tail is shorter than the length of the body. Molars are lophodont and the dentary is 1/1-0/0-0/0-3/3. The ears of Norway rats are typically shorter than those of related species, and do not cover up the eyes when pulled down. Norway rats can be easily mistaken for black rats, however, the temporal ridges of the Norway rat are straight, whereas those of the black rat are curved.

Range mass: 140 to 500 g.

Average mass: 400 g.

Average length: 399 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 1.404 W.

  • Calhoun, J. 1962. The Ecology and Sociology of the Norway Rat. Bethesda, MD: U.S. Department of Health, Education and Welfare.
  • Avalos, L., C. Callahan. 2001. "Classification and Characteristics of Mammals" (On-line). Accessed March 28, 2004 at http://www.humboldt.edu/~cmc43/mammalcharacters.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 46 cm

Weight: 485 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Rattus norvegicus
Catalog Number: USNM 199620
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Young adult
Preparation: Skin; Skull
Collector(s): A. Sowerby
Year Collected: 1914
Locality: I-Mien-Po [= Yimianpo], near, Heilongjiang, China, Asia
Elevation (m): 152
  • Type: Howell, A. B. 1928 Mar 16. Proceedings of the Biological Society of Washington. 41: 42.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Rattus norvegicus
Catalog Number: USNM 172569
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): A. Sowerby
Year Collected: 1909
Locality: Yenanfu [= Yan'an], 12 mi S, Shaanxi, China, Asia
Elevation (m): 1219
  • Type: Howell, A. B. 1927 Mar 05. Proceedings of the Biological Society of Washington. 40: 44.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Rattus norvegicus
Catalog Number: USNM 125212
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female; Adult
Preparation: Skin; Skull
Collector(s): E. Mearns
Year Collected: 1904
Locality: Zamboanga, at old Spanish hospital, Mindanao, Zamboanga Province, Philippines, Asia
  • Type: Mearns, E. A. 1905 May 13. Proceedings of the United States National Museum. 28: 441.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Rattus norvegicus
Catalog Number: USNM 144020
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Male; Adult
Preparation: Skin; Skull
Collector(s): W. Simpson
Year Collected: 1905
Locality: Taocheo [= Lintan], Gansu, China, Asia
  • Type: Miller, G. S. 1914 May 11. Proceedings of the Biological Society of Washington. 27: 90.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Norway rats probably originally lived in forested habitats. They are now found almost exclusively in areas near human settlements. They live wherever there is an abundance of food and shelter, from the subways and crowded buildings of cities, to the corn and grain fields of farm country, to the salt marshes of the Atlantic Coast.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; chaparral ; forest ; scrub forest

Other Habitat Features: urban ; suburban ; agricultural ; riparian ; estuarine

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is present in lowland and coastal regions wherever humans are. It is more common in colder climates (e.g. at higher northern and southern latitudes); in warmer and tropical regions it is restricted to habitats highly modified by humans (sewers, buildings, ports, etc.). It does not compete with R. rattus, as the latter is scansorial/arboreal whereas R. norvegicus is strictly terrestrial.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Asia, R. norvegicus was native to forests and brushy areas. Today, however, Norway rats find preferred habitat to be alongside the rapid expansion of the human population. Nearly every port city in the world has a substantial population of these rodents. They occupy a variety of habitats including garbage dumps, sewers, open fields and woodlands, basements, and nearly anywhere else that food and shelter might be found. Anywhere that humans are located, R. norvegicus will most likely follow.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: taiga ; desert or dune ; savanna or grassland ; chaparral ; forest ; rainforest ; scrub forest ; mountains

Wetlands: marsh ; swamp ; bog

Other Habitat Features: urban ; suburban ; agricultural ; riparian

  • Parker, S. 1990. Grzimek's Encyclopedia of Mammals: Volume 3. New York: McGraw-Hill Publishing Company.
  • Hamilton, W. 1998. The Mammals of Eastern United States, 3rd edition. Ithaca, NY: Comstock Publishing.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Buildings and other structures in cities, villages, and farm country, also dumps and open areas near abundant food. Most common in colder climates of high latitudes; in warmer regions restricted to habitats highly modified by humans (Musser and Carleton, in Wilson and Reeder 1993). In Hawaii: locally common in some lowland cane fields, rare or absent in extensive grassland and most native forests (Tomich 1986). In Oklahoma, moved from fields to buildings in fall (Caire et al. 1989). Young are born in nests in buildings, under debris, or underground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species is associated with farm buildings in rural areas. Refuse tips, sewer systems, hedges and field margins are also suitable habitats (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Norway rats are true omnivores. Norway rats eat a huge variety of foods including everything from soap to candy, milk, meat, vegetables, poultry, eggs and all grains, nuts and fruits. Norway rats are also very big eaters. They can eat a third of their weight in a day. Norway rats are capable of catching Actinopterygii and small rodents, such as Mus musculus, and they readily eat dead animals. In cities, Norway rats enjoy human food that is uneaten or spoiled.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Norway rats are excellent foragers. Using their sense of smell and touch, they are able to survive quite easily given that there is a steady supply of any type of food. In metropolitan areas, they survive mainly on discarded human food, and anything else that can be eaten without negative consequences. Some Norway rats living near the sea have been observed catching fish with their paws. Also preyed upon by Norway rats are chicks, mice, birds, and small lizards. They have even been known to attack infant human beings.

Examination of a wild R. norvegicus stomach in Germany revealed 4000 items, most of which were plants, although studies have shown that Norway rats prefer meat when given the option.

Animal Foods: birds; mammals; amphibians; reptiles; fish; eggs; carrion ; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit; nectar; flowers; sap or other plant fluids

Other Foods: fungus; detritus

Foraging Behavior: stores or caches food

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Very opportunistic feeder; diet of vegetable and animal matter, garbage, and carrion.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Animal / dung saprobe
solitary or confluent gymnothecium of Arachniotus ruber is saprobic in/on dung or excretions of dung of Rattus norvegicus

Animal / pathogen
Foot and Mouth virus (FMD) infects Rattus norvegicus
Other: minor host/prey

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Where they are abundant, Norway rats are an important component of the ecosystem because they consume foods that would otherwise be available to other animals. The typical ecosystem of Norway rats is an urban one so their presence most directly influences humans. In these urban environments there are few predators to take advantage of the large numbers of rats available as prey.

Mutualist Species:

  • humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Norway rats typically construct burrows or build their nests in protected places, such as sewers and basements. They are active at night and they swim and dive well. All of these factors contribute to avoiding predators.

Known Predators:

  • Felis silvestris
  • Vulpes vulpes
  • Falconiformes
  • Mustela
  • other small predators

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Norway rats are excellent competitors and will readily drive out competing rat species, such as Rattus rattus. Because of their foraging habits, Norway rats act as seed dispersers. Their burrows also tend to aerate the soil. As prey, they help to sustain predator populations. Norway rats are commensal species with humans.

Ecosystem Impact: disperses seeds; soil aeration

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Rattus norvegicus is preyed on by any number of carnivorous mammals, birds, and reptiles. Humans also kill very large numbers of Norway rats as pests.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Rattus norvegicus is prey of:
Mustela
Felis silvestris
Vulpes vulpes
Falconiformes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Rattus norvegicus preys on:
Podilymbus podiceps
Zenaida asiatica
Progne dominicensis
Phoebastria nigripes

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

General Ecology

Home range is usually less than an acre. Can become locally abundant. Lives in highly organized colonies. Throughout range in different habitats, median survival time relatively consistent at about 3 months, annual survival rate at about 5%.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Like most mammals, Norway rats communicate in a variety of way. They make sounds and use body postures to communicate various moods and intents. They have good hearing and a very sensitive sense of touch. They are able to sense small vibrations in the ground and feel their way through total darkness with their paws and whiskers. They also have a spectacular sense of smell. Scent is the Norway rats' best sensory channel, and it is used to find food and distinguish between individuals of a group.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: scent marks ; vibrations

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Like most mammals, Norway rats use a variety of communication avenues. They are vocal, and also use visual cues such as body postures when communicating. Norway rats have relatively good hearing and tactile capabilities. They are able to sense very minute vibrations in the ground, and feel their way through total darkness with their paws and whiskers. However, these rats would not have such an advantage over all other foragers if it were not for their spectacular sense of smell. Scent is the Norway rats' best sensory channel, and it is used to find food and distinguish between individuals of a group.

Communication Channels: visual ; tactile ; acoustic ; chemical

Other Communication Modes: pheromones ; scent marks

Perception Channels: visual ; acoustic ; vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cyclicity

Comments: Mostly nocturnal.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In captivity Norway rats may live to be 4 years old. Their average lifespan is probably about 2 years.

Range lifespan

Status: captivity:
4.0 (high) years.

Average lifespan

Status: wild:
2.0 years.

Average lifespan

Status: captivity:
5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The maximum lifespan of R. norvegicus is 4 years (in captivity). In the wild, it is assumed that they live for upwards of 2 years.

Range lifespan

Status: captivity:
4 (high) years.

Average lifespan

Status: wild:
2 years.

Typical lifespan

Status: captivity:
2 to 3 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 5 years (captivity) Observations: This common laboratory animal is one of the fastest ageing mammals. Even in captivity, most animals do not normally live more than 3-4 years. Maximum longevity has been reported to be 5-6 years (Caleb Finch 1990), though anecdotal reports of animals living more than 5 years have not been verified. Caloric restriction extends lifespan and appears to delay ageing (Yu et al. 1982).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Norway rats don't have single mates, instead they breed with many others through their lifetime.

Mating System: polygynous ; cooperative breeder

If there is enough food and shelter Norway rats will breed throughout the year, although more births occur in spring and autumn. Females can have between 1 and 12 litters each year, though they usually have 6 to 8 litters each year. Females are pregnant for 21 to 26 days. Each litter usually contains 7 babies but some litters can have between 2 and 22 young!  The young are born blind, naked, and helpless at birth; the eyes open in 14 to 17 days, and the young are weaned when 3 weeks old. Sexual maturity is reached at 3 months, although males must wait longer until they are able to challenge the dominant male.

Breeding interval: Norway rats can breed many times in a year, up to 12 times.

Breeding season: Norway rats breed throughout the year

Range number of offspring: 2.0 to 22.0.

Average number of offspring: 7.0.

Range gestation period: 26.0 (high) days.

Average weaning age: 22.0 days.

Average age at sexual or reproductive maturity (female): 3.0 months.

Average age at sexual or reproductive maturity (male): 3.0 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous

Average birth mass: 5.81 g.

Average number of offspring: 9.9.

Average age at sexual or reproductive maturity (male)

Sex: male:
70 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
90 days.

Young are cared for and nursed in their mother's nest until they are weaned. Soon after that they leave the nest and establish their own territory or home range.

Parental Investment: altricial ; female parental care

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The mating system of R. norvegicus is best described as polygynandrous. Social animals, Norway rats tend to breed in large groups. Once a female enters her six-hour estrus period, she may mate as many as five-hundred times with competing males.

Mating System: polygynandrous (promiscuous) ; cooperative breeder

Although not technically a seasonal breeder, a mating increase occurs in the warmer months of the year. An average female is capable of giving birth approximately seven times per year. Around 18 hours after giving birth, females experience postpartum estrus, and mate again. This reproductive function is responsible for the huge birthrates of Norway rats, which can reach 60 young each year per female. After a short gestation period of 22 to 24 days, the litter of approximately 8 pups is born. The young are very small and underdeveloped. It takes 14 to 17 days for the young's eyes to open. Newborns weigh an average of 5 grams and are milk-fed until weaning occurs at 3 to 4 weeks, and the young then leave the nest.

Often, the litters of numerous females will occupy the same nest, and all the young are cared for by the adults, regardless of who the true mothers are. This communal care makes the species something of a cooperative breeder.

Males usually reach sexual maturity at 3 months and females at 4. However, it is usually the female who mates first because competition for mates among males prevents the smaller, less-dominant individuals from succeeding immediately. Rattus norvegicus is capable of mating for up to two years.

Breeding interval: Norway rats may breed up to 7 times per year

Breeding season: Breeding occurs year round, but is less pronounced during colder months.

Range number of offspring: 2 to 14.

Range gestation period: 22 to 24 days.

Range weaning age: 3 to 4 weeks.

Range time to independence: 4 to 5 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 months.

Range age at sexual or reproductive maturity (male): 3 to 4 months.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization ; viviparous ; post-partum estrous

Average birth mass: 5.81 g.

Average number of offspring: 9.9.

Parental care is provided by females. Because these animals often nest communally, the litters of several different females often occupy the same nest. In nesting groups of more than one female, if a mother is killed, the other females will take over nursing the newborns. Males do not particupate in parental care.

Parental Investment: no parental involvement; altricial ; female parental care ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Protecting: Female)

  • Parker, S. 1990. Grzimek's Encyclopedia of Mammals: Volume 3. New York: McGraw-Hill Publishing Company.
  • Barnett, S. 1963. The Rat. Chicago & London: University of Chicago Press.
  • Calhoun, J. 1962. The Ecology and Sociology of the Norway Rat. Bethesda, MD: U.S. Department of Health, Education and Welfare.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeds throughout the year, particularly from spring to fall. Gestation lasts 21-24 days or up to a week longer in lactating females. Litter size is 2-14 (average about 9). Averages 6 litters per year (range 3-12). Sexually mature in 80-85 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rattus norvegicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 41 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTAAACCGTTGACTCTTTTCAACTAACCACAAAGATATCGGAACCCTCTACCTATTATTTGGAGCCTGAGCAGGAATAGTAGGGACAGCTTTGAGTATTCTAATTCGAGCTGAACTAGGACAGCCAGGCGCACTCCTAGGAGATGACCAAATCTATAATGTCATCGTCACAGCCCATGCATTCGTAATAATTTTCTTTATAGTAATACCTATAATAATTGGAGGCTTCGGAAACTGACTTGTACCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGAATAAATAACATAAGCTTTTGACTGCTTCCTCCATCATTTCTACTCCTTTTAGCATCCTCCATAGTAGAAGCTGGAGCTGGAACAGGATGAACAGTATATCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGGGTATCCGTAGATTTAACTATTTTTTCCCTCCACCTAGCCGGGGTGTCTTCTATCTTAGGAGCTATCAACTTTATCACCACTATCATTAATATAAAACCCCCTGCTATAACCCAATATCAGACACCTCTCTTTGTATGATCCGTACTAATTACAGCCGTCCTACTACTTCTCTCACTGCCAGTATTAGCAGCAGGTATCACTATACTCCTTACAGACCGAAATCTAAATACTACTTTCTTCGACCCCGCTGGAGGTGGAGACCCAATTCTTTATCAACACCTATTCTGATTCTTCGGCCACCCAGAAGTGTACATCTTAATTCTTCCAGGGTTTGGAATTATTTCACATGTAGTTACCTATTACTCTGGAAAAAAAGAACCCTTCGGATATATAGGTATGGTATGAACCATAATATCTATTGGCTTCCTAGGATTTATTGTATGAGCACATCACATATTCACAGTAGGCCTAGATGTAGACACCCGAGCCTACTTTACATCTGCCACTATAATTATCGCAATTCCTACAGGCGTAAAAGTATTCAGCTGACTCGCTACACTACATGGAGGAAATATCAAATGATCCCCCGCCATATTATGAGCCTTAGGGTTTATCTTCTTATTCACAGTAGGGGGCCTAACAGGGATCGTACTATCTAACTCATCCCTTGACATTGTACTTCATGATACATACTACGTAGTAGCTCACTTCCACTATGTCTTATCTATAGGAGCAGTATTCGCCATCATAGCTGGCTTCGTCCACTGATTCCCACTATTCTCAGGCTATACCCTAAATGACACATGAGCAAAAGCCCACTTTGCCATTATATTTGTAGGTGTAAACATAACATTTTTTCCTCAACACTTCCTAGGATTAGCAGGGATACCTCGTCGTTACTCTGATTATCCAGATGCTTATACCACATGAAATACAGTCTCCTCTATAGGCTCATTCATCTCACTTACGGCCGTCCTTGTAATGATCTTCATGATTTGAGAAGCCTTCGCATCAAAACGAGAAGTGCTCTCAATTTCCTACTCTTCAACTAACCTAGAATGACTGCATGGATGCCCCCCACCTTACCACACATTCGAAGAACCTTCCTATGTAAAAGTTAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rattus norvegicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 56
Specimens with Barcodes: 87
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Norway rats are widespread and abundant and are not considered threatened. Humans often try to control the numbers of rats by trapping and poisoning.

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Ruedas, L.

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Tsytsulina, K. (Global Mammal Assessment Team)

Contributor/s

Justification
A common species with no major threats.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These animals are not a conservation concern. In fact, humans spend a great deal of effort trying to eradicate them.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Non-native, resident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNA - Not Applicable

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Not legally protected in the UK. No conservation designations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Often abundant in suitable habitat (e.g. in urban areas).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brown rats are controlled as they are serious pests. They carry dangerous diseases, and cause serious damage to property and crops (1). Brown rats have developed resistance to rodenticides, and many newer poisons are unfortunately highly toxic to many other vertebrates (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
None in place and none required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Not relevant.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Some people think that Norway rats cause more harm than good. Many consider these rats to be the greatest mammal pest of all time. They have caused more deaths than all the wars in history. Rat-borne diseases are thought to have killed more people in the last 1000 years than all of the wars and revolutions ever fought. They harbor lice and fleas and have been the source of bubonic plague, typhus, trichinosus, tularemia, infectious jaundice, and many other serious diseases. These rats also cause considerable damage to property including crops, destroying and pollution of human food storage, and damage to insides and outsides of buildings. It is estimated that rats cause almost 1 billion dollars in damage in the United States each year. Rats kill poultry, domestic livestock, and game birds and are responsible for the endangerment or extinction of many species of wildlife, especially those found on islands.

Negative Impacts: injures humans (bites or stings, carries human disease); crop pest; causes or carries domestic animal disease ; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Norway rats have been widely used in medical and genetic research. This research has led to important advances in physiology, genetics, immunology, pathology, and epidemiology. They are also popular pets and have been important in research on behavior because of their ability to learn quickly and because it is easy to keep them in laboratory settings.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Some consider Norway rats to be the greatest mammal pest of all time. They have caused more deaths than all the wars in history. Rat-borne diseases are thought to have killed more people in the last 1000 years than all of the wars and revolutions ever fought. They harbor lice and fleas that carry bubonic plague, typhus, trichinosus, tularemia, infectious jaundice, and many other serious diseases. These rats also cause considerable damage to property including crops, destroying and pollution of human food storage, and damage to insides and outsides of buildings. It is estimated that rats cause almost 1 billion dollars in damage in the United States each year. Rats kill poultry, domestic livestock, and game birds and are responsible for the endangerment or extinction of many species of wildlife, especially those found on islands.

Negative Impacts: injures humans (bites or stings, causes disease in humans , carries human disease); crop pest; causes or carries domestic animal disease ; household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Norway rats have been widely used in medical and genetic research. This research has led to important advances in physiology, genetics, immunology, pathology, and epidemiology. They are also popular pets and have been important in research on behavior because of their ability to learn quickly and because it is easy to keep them in laboratory settings.

Positive Impacts: pet trade ; research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Often a severe pest; eats stored grain and small farm animals, public health menace, etc.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Risks

Species Impact: Implicated as a contributor in the decline of the ancient murrelet and other burrow-nesting seabirds (see Bertram and Nagorsen 1995).

In New York, Draud et al. (2004) documented a high rate of predation on hatchling and juvenile diamondback terrapins by Norway rats.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Brown rat

The brown rat, common rat, street rat, sewer rat, Hanover rat, Norway rat, brown Norway rat, Norwegian rat, or wharf rat (Rattus norvegicus) is one of the best known and most common rats.

One of the largest muroids, it is a brown or grey rodent with a body up to 25 cm (10 in) long, and a similar tail length; the male weighs on average 350 g (12 oz) and the female 250 g (9 oz). Thought to have originated in northern China, this rodent has now spread to all continents except Antarctica, and is the dominant rat in Europe and much of North America—making it by at least this particular definition the most "successful" mammal on the planet after humans.[2] Indeed, with rare exceptions, the brown rat lives wherever humans live, particularly in urban areas.

Selective breeding of Rattus norvegicus has produced the laboratory rat, an important model organism in biological research, as well as pet rats.

Contents

Naming and etymology [edit]

Originally called the "Hanover rat" by people wishing to link problems in 18th century England with the House of Hanover,[3] it is not known for certain why the brown rat is named Rattus norvegicus (Norwegian rat), as it did not originate from Norway. However, the English naturalist John Berkenhout, author of the 1769 book Outlines of the Natural History of Great Britain, is most likely responsible for popularizing the misnomer. Berkenhout gave the brown rat the binomial name Rattus norvegicus, believing it had migrated to England from Norwegian ships in 1728, although no brown rat had entered Norway at that time.

By the early to middle part of the 19th century, British academics were aware that the brown rat was not native to Norway, hypothesizing (incorrectly) that it may have come from Ireland, Gibraltar or across the English Channel with William the Conqueror.[4] As early as 1850, however,a more correct understanding of the rat's origins was beginning to develop.[5] The British novelist Charles Dickens acknowledged the misnomer in his weekly journal, All the Year Round, writing:

"Now there is a mystery about the native country of the best known species of rat, the common brown rat. It is frequently called, in books and otherwise, the 'Norway rat', and it is said to have been imported into this country in a ship-load of timber from Norway. Against this hypothesis stands the fact that when the brown rat had become common in this country, it was unknown in Norway, although there was a small animal like a rat, but really a lemming, which made its home there."[6]

Academics began to understand the origins and corrected etymology of the brown rat towards the end of the 19th century, as seen in the 1895 text Natural History by American scholar Alfred Henry Miles:

"The brown rat is the species common in England, and best known throughout the world. It is said to have travelled from Persia to England less than two hundred years ago and to have spread from thence to other countries visited by English ships. it is believed that the Brown Rat is so called due to the resemblance its fur holds to rat faeces or alternatively, sloppy rat diarrhoea."[7]

Though the assumptions surrounding this species' origins were not yet entirely accurate, by the 20th century, it was established among naturalists that the brown rat did not originate in Norway, rather the species came from central Asia and (likely) China.[8] Despite this, this species' common name of "Norway rat" is still in use today.

Description [edit]

Comparison of the physique of a black rat (Rattus rattus) with a brown rat (Rattus norvegicus)

The fur is coarse and usually brown or dark grey, while the underparts are lighter grey or brown. The length can be up to 25 cm (10 in), with the tail a further 25 cm (10 in), the same length as the body. Adult body weight averages 550 g (19 oz) in males and about 350 g (12 oz) in females, but a very large individual can reach 900 g (32 oz). Rats weighing over 1 kg (2.2 lb) are exceptional, and stories of rats as big as cats are exaggerations, or misidentifications of other rodents, such as the coypu and muskrat.

Brown rats have acute hearing, are sensitive to ultrasound, and possess a very highly developed olfactory sense. Their average heart rate is 300 to 400 beats per minute, with a respiratory rate of around 100 per minute. The vision of a pigmented rat is poor, around 20/600, while a nonpigmented (albino) with no melanin in its eyes has both around 20/1200 vision and a terrible scattering of light within its vision. Brown rats are dichromates which perceive colours rather like a human with red-green colorblindness, and their colour saturation may be quite faint. Their blue perception, however, also has UV receptors, allowing them to see ultraviolet lights that some species cannot.[9]

Biology and behavior [edit]

Brown rat skull

The brown rat is nocturnal and is a good swimmer, both on the surface and underwater, but unlike the related black rat (Rattus rattus), it is a poor climber. Brown rats dig well, and often excavate extensive burrow systems. A 2007 study found brown rats to possess metacognition, a mental ability previously only found in humans and some primates,[10] but further analysis suggested they may have been following simple operant conditioning principles.[11]

Communication [edit]

Brown rats are capable of producing ultrasonic vocalizations. As pups, young rats use different types of ultrasonic cries to elicit and direct maternal search behavior,[12] as well as to regulate their mother's movements in the nest.[13] Although pups will produce ultrasounds around any other rats at 7 days old, by 14 days old they significantly reduce ultrasound production around male rats as a defensive response.[14] Adult rats will emit ultrasonic vocalizations in response to predators or perceived danger;[15] the frequency and duration of such cries depends on the sex and reproductive status of the rat.[16][17] The female rat will also emit ultrasonic vocalizations during mating.[18]

Chirping [edit]

Rats may also emit short, high frequency, ultrasonic, socially induced vocalization during rough and tumble play, before receiving morphine, or mating, and when tickled. The vocalization, described as a distinct "chirping", has been likened to laughter, and is interpreted as an expectation of something rewarding.[19] Like most rat vocalizations, the chirping is too high in pitch for humans to hear without special equipment. Bat detectors are often used by pet owners for this purpose.

In clinical studies, the chirping is associated with positive emotional feelings, and social bonding occurs with the tickler, resulting in the rats becoming conditioned to seek the tickling. However, as the rats age, the tendency to chirp appears to decline.[20]

Rat chirp also can be used for mosquito control.[citation needed]

Other ultrasonic vocalisations, including a lower-frequency 'boom' or 'whoom' noise can be produced by bucks in a calm state, when grooming or settling down to sleep.[citation needed]

Audible communication [edit]

Brown rats also produce communicative noises capable of being heard by humans. The most commonly heard in domestic rats is bruxing, or teeth-grinding, which is most usually triggered by happiness, but can also be 'self-comforting' in stressful situations, such as a visit to the vet. The noise is best described as either a quick clicking or 'burring' sound, varying from animal to animal.

In addition, they commonly squeak along a range of tones from high, abrupt pain squeaks to soft, persistent 'singing' sounds during confrontations.

Diet [edit]

The brown rat is a true omnivore and will consume almost anything, but cereals form a substantial part of its diet.

Brown rat eating sunflower seeds

Martin Schein, founder of the Animal Behavior Society in 1964, studied the diet of brown rats and came to the conclusion that the most-liked foods of brown rats include scrambled eggs, macaroni and cheese, and cooked corn kernels. According to Schein, the least-liked foods were raw beets, peaches, and raw celery.[21]

Foraging behavior is often population-specific, and varies by environment and food source.[2] Brown rats living near a hatchery in West Virginia catch fingerling fish.[22] Some colonies along the banks of the Po River in Italy will dive for mollusks,[23][24] a practice demonstrating social learning among members of this species.[25] Rats on the island of Norderoog in the North Sea stalk and kill sparrows and ducks.[26]

Reproduction and life cycle [edit]

The brown rat can breed throughout the year if conditions are suitable, with a female producing up to five litters a year. The gestation period is only 21 days, and litters can number up to 14, although seven is common. They reach sexual maturity in about five weeks. The maximum life span is up to three years, although most barely manage one. A yearly mortality rate of 95% is estimated, with predators and interspecies conflict as major causes.

When lactating, female rats display a 24-hour rhythm of maternal behavior, and will usually spend more time attending to smaller litters than large ones.[27]

Brown rats live in large, hierarchical groups, either in burrows or subsurface places, such as sewers and cellars. When food is in short supply, the rats lower in social order are the first to die. If a large fraction of a rat population is exterminated, the remaining rats will increase their reproductive rate, and quickly restore the old population level.[citation needed]

Social behavior [edit]

Rats commonly groom each other and sleep together.[28] As with dogs, rats create a social hierarchy, and each rat has its own place in the pack. Rats are said to establish an order of hierarchy, so one rat will be dominant over another one.[29] Groups of rats tend to "play fight", which can involve any combination of jumping, chasing, tumbling, and "boxing". Play fighting involves rats going for each other's necks, while serious fighting involves strikes at the others' back ends.[30] If living space become limited, rats may turn to aggressive behavior, which may result in the death of some animals, reducing the burden over the living space.

Rats like most mammals also form family groups, a mother and her young.[31] This applies to both groups of males and females. However, rats are territorial animals, meaning that they usually act aggressively or scared of strange rats. Rats will fluff up their hair, hiss, squeal, and move their tails around when defending their territory.[32] Rats will chase each other, groom each other, sleep in group nests, wrestle with each other, have dominance squabbles, communicate, and play in various other ways with each other.[32] Huddling is an additional important part of rat socialization. Huddling is often supposed to have a heat-conserving function. Nestling rats especially depend on heat from their mother, since they cannot regulate their own temperature. Huddling is an extreme form of herding. Other forms of interaction include, crawling under, which is literally the act of crawling underneath one another,walking over, also explained in the name, then there is allo-grooming, so-called to distinguish it from self-grooming. And lastly there is another type of contact called nosing, where a rat gently pushes with its nose at another rat near the neck.[31]

Burrowing [edit]

Rats are known to burrow extensively, both in the wild and in captivity, if given access to a suitable substrate.[33] Rats generally begin a new burrow adjacent to an object or structure, as this provides a sturdy "roof" for the section of the burrow nearest to the ground's surface.[34] Burrows usually develop to eventually include multiple levels of tunnels, as well as a secondary entrance.[33] Older male rats will generally not burrow, while young males and females will burrow vigorously.[33][35]

Burrows provide rats with shelter and food storage, as well as safe, thermoregulated nest sites.[33] Rats use their burrows to escape from perceived threats in the surrounding environment; for example, rats will retreat to their burrows following a sudden, loud noise or while fleeing an intruder.[36] Burrowing can therefore be described as a "pre-encounter defensive behavior", as opposed to a "postencounter defensive behavior", such as flight, freezing, or avoidance of a threatening stimulus.

Distribution and habitat [edit]

Likely originating from the plains of Asia, northern China and Mongolia, the brown rat spread to other parts of the world sometime in the Middle Ages.[37][38][39] The question of when brown rats became commensal with humans remains unsettled, but as a species, they have spread and established themselves along routes of human migration and now live almost everywhere humans are. .[40]

The brown rat may have been present in Europe as early as 1553, a conclusion drawn from an illustration and description by Swiss naturalist Conrad Gesner in his book Historiae animalium, published 1551–1558.[41] Though Gesner's description could apply to the black rat, his mention of a large percentage of albino specimens—not uncommon among wild populations of brown rats—adds credibility to this conclusion.[42] Reliable reports dating to the 18th century document the presence of the brown rat in Ireland in 1722, England in 1730, France in 1735, Germany in 1750, and Spain in 1800,[42] becoming widespread during the Industrial Revolution.[43] It did not reach North America until around 1750–1755.[41][44]

As it spread from Asia, the brown rat generally displaced the black rat in areas where humans lived. In addition to being larger and more aggressive, the change from wooden structures and thatched roofs to bricked and tiled buildings favored the burrowing brown rats over the arboreal black rats. In addition, brown rats eat a wider variety of foods, and are more resistant to weather extremes.[45]

In the absence of humans, brown rats prefer damp environments, such as river banks.[43] However, the great majority are now linked to man-made environments, such as sewage systems.

Brown rat in a flower box in the East Village of New York City

It is often said that there are as many rats in cities as people, but this varies from area to area depending on climate, living conditions, etc. Brown rats in cities tend not to wander extensively, often staying within 20 m (66 ft) of their nest if a suitable concentrated food supply is available, but they will range more widely where food availability is lower. In New York City, there is great debate over the size of the rat population, with estimates from almost 100 million rats to as few as 250,000.[46] Experts suggest New York is a particularly attractive place for rats because of its aging infrastructure, high moisture and poverty rates.[46] In addition to sewers, rats are very comfortable living in alleyways and residential buildings, as there is usually a large and continuous food source in those areas.[47]

In the United Kingdom, some figures show the rat population has been rising, with estimations that 81 million rats reside in the UK.[48] Those figures would mean there are 1.3 rats per person in the country. High rat populations in the UK are often attributed to the mild climate, which allow them higher survival rates during the winter months.

The only brown rat-free zones in the world are the Arctic, the Antarctic, some especially isolated islands, such as Iceland, the province of Alberta in Canada,[49] and certain conservation areas in New Zealand.[50][51]

Antarctica is almost completely covered by ice and has no permanent human inhabitants, making it uninhabitable by rats. The Arctic has extremely cold winters that rats cannot survive outdoors, and the human population density is extremely low, making it difficult for rats to travel from one habitation to another. When the occasional rat infestation is noticed and eliminated, the rats are unable to reinfest it from an adjacent one. Isolated islands are also able to eliminate rat populations because of low human population density and geographic distance from other rat populations.

Alaska [edit]

Rat Island in Alaska was infested with brown rats after a Japanese shipwreck in 1780. They had a devastating effect on the native bird life. An eradication program was started in 2007 and the island was declared rat free in June 2009.

Alberta, Canada [edit]

Alberta, Canada, is unusual in that rat infestation was eliminated by aggressive government action. Although it is a major agricultural area, it is far from any seaport and only a portion of its eastern boundary with Saskatchewan provides a favorable entry route for rats. They cannot survive in the boreal forest to the north, the Rocky Mountains to the west, nor the semiarid High Plains of Montana to the south. The first brown rat did not reach Alberta until 1950, and in 1951, the province launched a rat-control program that included shooting and poisoning rats, and bulldozing, burning down, and blowing up rat-infested buildings. The effort was backed by legislation that required every person and every municipality to destroy and prevent the establishment of designated pests. If they failed, the provincial government could carry out the necessary measures and charge the costs to the landowner or municipality.[52]

In the first year of the program, 64 tonnes (71 short tons) of arsenic trioxide were spread throughout 8,000 buildings on farms along the Saskatchewan border. In 1953, the much less toxic and more effective poison, warfarin, was introduced. By 1960, the number of rat infestations in Alberta dropped to below 200 per year.[53]

Currently, only zoos, universities, and research institutes are allowed to own caged rats in Alberta, and possession of an unlicensed rat (including pet rats) is punishable by a $5,000 fine or 60 days in jail. The adjacent and similarly landlocked province of Saskatchewan initiated a rat control program in 1972, and has managed to reduce the number of rats in the province substantially, although they have not been eliminated.[54]

New Zealand [edit]

First arriving before 1800 (perhaps on James Cook's vessels),[55] brown rats have posed a serious threat to many of New Zealand's native animals. Rat eradication programmes within New Zealand have led to rat-free zones on offshore islands and even on fenced "ecological islands" on the mainland. Before an eradication effort was launched in 2001, the sub-Antarctic Campbell Island had the highest population density of brown rats in the world.[56]

Diseases [edit]

Similar to other rodents, brown rats may carry a number of pathogens,[57] which can result in disease, including Weil's disease, rat bite fever, cryptosporidiosis, viral hemorrhagic fever, Q fever and hantavirus pulmonary syndrome. In the United Kingdom, brown rats are an important reservoir for Coxiella burnetii, the bacterium that causes Q fever, with seroprevalence for the bacteria found to be as high as 53% in some wild populations.[58]

This species can also serve as a reservoir for Toxoplasma gondii, the parasite that causes toxoplasmosis, though the disease usually spreads from rats to humans when domestic cats feed on infected brown rats.[59] The parasite has a long history with the brown rat, and there are indications that the parasite has evolved to alter an infected rat's perception to cat predation, making it more susceptible to predation and increasing the likelihood of transmission.[60]

Surveys and specimens of brown rat populations throughout the world have shown this species is often associated with outbreaks of trichinosis,[61][62] but the extent to which the brown rat is responsible in transmitting Trichinella larvae to humans and other synanthropic animals is at least somewhat debatable.[63] Trichinella pseudospiralis, a parasite previously not considered to be a potential pathogen in humans or domestic animals, has been found to be pathogenic in humans and carried by brown rats.[64]

Brown rats are sometimes mistakenly thought to be a major reservoir of bubonic plague, a possible cause of the Black Death. However, the bacterium responsible, Yersinia pestis, is commonly endemic in only a few rodent species and is usually transmitted zoonotically by rat fleas—common carrier rodents today include ground squirrels and wood rats. However, brown rats may suffer from plague, as can many nonrodent species, including dogs, cats, and humans.[65] The original carrier for the plague-infected fleas thought to be responsible for the Black Death was the black rat, and it has been hypothesized that the displacement of black rats by brown rats led to the decline of bubonic plague.[66] This theory has, however, been deprecated, as the dates of these displacements do not match the increases and decreases in plague outbreaks.[67]

Control [edit]

Some of the common methods used to control the number of Brown rats include:

Trapping [edit]

Using traditional break-back traps, glue traps, live cage traps and other humane traps

Poisoning [edit]

There are many types of poison available for the purpose of controlling the Brown rat. The use of poison is controlled in most of the countries in the world so it is important to check state legislations.

Proofing [edit]

Prevention is the best cure. There are ways to stop the infestation occurring at the first place, such as blocking access points, better waste management, better sewage design.

In captivity [edit]

Uses in science [edit]

Selective breeding of albino brown rats rescued from being killed in a now-outlawed sport called rat baiting has produced the albino laboratory rat.[68] Like mice, these rats are frequently subjects of medical, psychological and other biological experiments, and constitute an important model organism. This is because they grow quickly to sexual maturity and are easy to keep and to breed in captivity. When modern biologists refer to "rats", they almost always mean Rattus norvegicus.

As pets [edit]

The brown rat is kept as a pet in many parts of the world. Australia, the United Kingdom, and the United States are just a few of the countries that have formed fancy rat associations similar in nature to the American Kennel Club, establishing standards, orchestrating events, and promoting responsible pet ownership.

The many different types of domesticated brown rats include variations in coat patterns, as well as the style of the coat, such as Hairless or Rex, and more recently developed variations in body size and structure, including dwarf and tailless fancy rats..

References [edit]

  1. ^ Ruedas, L. (2008). "Rattus norvegicus". IUCN Red List of Threatened Species. Version 2011.1. International Union for Conservation of Nature. Retrieved 9 August 2011. 
  2. ^ a b Fragaszy, Dorothy Munkenbeck; Perry, Susan (2003). The Biology of Traditions: Models and Evidence. Cambridge University Press. p. 165. ISBN 0-521-81597-5. 
  3. ^ Donaldson, Henry Herbert. (1915) The Rat. pp. 13.
  4. ^ Friends' Intelligencer. (1858) Volume 14. William W. Moore, publisher. pp. 398.
  5. ^ Chambers, William and Robert Chambers. (1850) Chambers's Edinburgh Journal. pp. 132.
  6. ^ Dickens, Charles. (1888) All the Year Round. New Series. Volume XLII, Number 1018. pp. 517.
  7. ^ Miles, Alfred Henry. (1895) Natural History. Dodd, Mead & Company. pp. 227
  8. ^ Cornish, Charles John. (1908) The Standard Library of Natural History. The University Society, Inc. Volume 1, Chapter 9. pp. 159
  9. ^ Hanson, Anne (14 March 2007). "What Do Rats See?". Rat Behavior and Biology. ratbehavior.org. Retrieved 2007-12-01. 
  10. ^ "Rats Capable Of Reflecting On Mental Processes". Science Daily – sourced from university of Georgia. 9 March 2007. Retrieved 2007-08-02. 
  11. ^ ^ Smith, J. David; Beran, M. J., Couchman, J. J., & Coutinho, M. V. C. (2008). "The Comparative Study of Metacognition: Sharper Paradigms, Safer Inferences". Psychonomic Bulletin & Review 15 (4): 679–691. http://pbr.psychonomic-journals.org/content/15/4/679.full.pdf+html.
  12. ^ Brunelli, Susan A., Shair, Harry N., Hofer, Myron A. (1994). "Hypothermic vocalizations of rat pups (Rattus norvegicus) elicit and direct maternal search behavior". Journal of Comparative Psychology. 108 (3): 298–303. doi:10.1037/0735-7036.108.3.298. 
  13. ^ White, N, Adox, R, Reddy, A, Barfield, R (1992). "Regulation of rat maternal behavior by broadband pup vocalizations". Behavioral and Neural Biology. 58 (2): 131–137. doi:10.1016/0163-1047(92)90363-9. 
  14. ^ Takahashi, L. K. (1992). "Developmental expression of defensive responses during exposure to conspecific adults in preweanling rats (Rattus norvegicus)". Journal of Comparative Psychology 106 (1): 69–77. doi:10.1037/0735-7036.106.1.69. PMID 1313347. 
  15. ^ Brudzynski, Stefan M. (2005). "Principles of Rat Communication: Quantitative Parameters of Ultrasonic Calls in Rats". Behavior Genetics. 35 (1): 85–92. doi:10.1007/s10519-004-0858-3. 
  16. ^ Blanchard, RJ, Agullana, R, McGee, L, Weiss, S, Blanchard, DC (1992). "Sex differences in the incidence and sonographic characteristics of antipredator ultrasonic cries in the laboratory rat (Rattus norvegicus)". Journal of Comparative Psychology 106 (3): 270–277. doi:10.1037/0735-7036.106.3.270. PMID 1395496. 
  17. ^ Haney, M.; Miczek, K.A. (1993). "Ultrasounds during agonistic interactions between female rats (Rattus norvegicus)". Journal of Comparative Psychology 107 (4): 373–379. doi:10.1037/0735-7036.107.4.373. PMID 8112049. 
  18. ^ Thomas, D. A.; Barfield, R. J. (1985). "Ultrasonic vocalization of the female rat (Rattus norvegicus) during mating". Animal Behaviour. 33 (3): 720–725. doi:10.1016/S0003-3472(85)80002-6. 
  19. ^ Science News 2001
  20. ^ Panksepp, J; Burgdorf, J (2003). ""Laughing" rats and the evolutionary antecedents of human joy?" (PDF). Physiology & behavior 79 (3): 533–47. doi:10.1016/S0031-9384(03)00159-8. PMID 12954448. 
  21. ^ Schein, Martin W.; Holmes Orgain (1 November 1953). "A Preliminary Analysis of Garbage as Food for the Norway Rat". Am. J. Trop. Med. Hyg. 2 (6): 1117–30. PMID 13104820. Retrieved 2007-04-04. 
  22. ^ Cottam, C.; Stickel, W. H.; Stickel, L. F.; Coleman, R. H.; Mickey, A. B.; Schellbach, L.; Schorger, A. W.; Negus, N. C. et al. (1948). "Aquatic habits of the Norway rat". Journal of Mammalogy 29 (3): 299. JSTOR 1375396. 
  23. ^ Gandolfi, G.; Parisi, V. (1972). "Predazione su Unio Pictorum L. da parte del ratto, Rattus norvegicus (Berkenhout)". Acta Naturalia 8: 1–27. 
  24. ^ Parisi, V.; Gandolfi, G. (1974). "Further aspects of the predation by rats on various mollusc species". Bollettino di Zoologia 41: 87–106. doi:10.1080/11250007409430096. 
  25. ^ Galef, Jr.; Bennett, G. (1980). "Diving for Food: Analysis of a Possible Case of Social Learning in Wild Rats (Rattus norvegicus)" (PDF). Journal of Comparative and Physiological Psychology 94 (3): 416–425. doi:10.1037/h0077678. 
  26. ^ Steiniger, Fritz (1950). "Beitrage zur Sociologie und sonstigen Biologie der Wanderratte". Zeitschrift fur Tierpsychologie 7: 356–79. doi:10.1111/j.1439-0310.1950.tb01630.x. 
  27. ^ Grota, L. J.; Ader, R. (1969). "Continuous recording of maternal behaviour in Rattus norvegicus". Animal Behaviour 17 (4): 722–29. doi:10.1016/S0003-3472(69)80019-9. 
  28. ^ Social behaviour of fancy rat
  29. ^ Rats: Fancy Rat Behaviour
  30. ^ Norway Rat Behavior Repertoire
  31. ^ a b Barnett, S. (1975). The Rat: a study in behavior (pp. 52-115). Chicago, MI: The University of Chicago Press.
  32. ^ a b "Why Rats Need Company". National Fancy Rat Society. Retrieved 9/1/2011. 
  33. ^ a b c d Boice, R. (1977). "Burrows of Wild and Albino Rats: Effects of Domestication, Outdoor Raising, Age, Experience, and Maternal State". Journal of Comparative and Physiological Psychology 91 (3): 649–661. doi:10.1037/h0077338. PMID 559696. 
  34. ^ Calhoun, J. B. (1962) Bethesda, MD: U.S. Department of Health, Education, and Welfare.
  35. ^ Price, A. O. (1977). "Burrowing in Wild and Domestic Norway Rats". Journal of Mammology 58 (2): 239–240. doi:10.2307/1379585. JSTOR 1379585. 
  36. ^ Kitaoka, A. (1994). "Defensive aspects of burrowing behavior in rats (Rattus norvegicus): A descriptive and correlational study". Behavioural Processes 31: 13–28. doi:10.1016/0376-6357(94)90034-5. 
  37. ^ Tate, G.H.H. (1936). "Some muridae of the Indo-Australian region". Bulletin of the American Museum of Natural History 72: 501–728. hdl:2246/834. 
  38. ^ Silver, J. (1941). "The house rat". Wildlife Circ. 6: 1–18. 
  39. ^ Southern, H.N. (1964). The Handbook of the British Mammals. Oxford: Blackwell Scientific. 
  40. ^ Yoshida, T.H. (1980). Cytogenetics of the Black Rat: Karyotype Evolution and Species Differentiation. University of Tokyo Press. ISBN 0-8391-4131-9. 
  41. ^ a b Freye, H.A., and Thenius, E. (1968) Die Nagetiere. Grzimeks Tierleben. (B. Grzimek, ed.) Volume 11. Kindler, Zurich. pp. 204–211.
  42. ^ a b Suckow et al. (2006) The Laboratory Rat, 2nd ed. Academic Press. pp. 74. ISBN 0-12-074903-3.
  43. ^ a b Amori, G. & Cristaldi, M. (1999). Mitchell-Jones, Anthony J., ed. The Atlas of European Mammals. London: Academic Press. pp. 278–279. ISBN 0-85661-130-1. 
  44. ^ Nowak, Robert M. (1999) Walker's Mammals of the World. JHU Press. pp. 1521. ISBN 0-8018-5789-9.
  45. ^ Teisha Rowland. "Ancient Origins of Pet Rats", Santa Barbara Independent, 4 December 2009.
  46. ^ a b "New Yorkers vs. the Rat". Retrieved 2008-03-15. 
  47. ^ Sullivan, Robert (2003). Rats: observations on the history and habitat of the city's most unwanted inhabitants. New York: Bloomsbury. ISBN 1-58234-385-3. 
  48. ^ Spanton, Tim (4 February 2008). "Britain plagued by 80 m rats". The Sun (London). Retrieved 2008-03-15. 
  49. ^ Handwerk, Brian (31 March 2003). "Canada Province Rat-Free for 50 Years". National Geographic News (National Geographic Society). Retrieved 2007-11-30. 
  50. ^ http://www.beehive.govt.nz/node/16920
  51. ^ Perrow, Martin and A. J. Davy. (2002) Handbook of Ecological Restoration. Cambridge University Press. pp. 362–363. ISBN 0-521-79128-6.
  52. ^ Bourne, John (1 October 2002). "The History of Rat Control In Alberta". Agriculture and Food. Alberta Department of Agriculture. Retrieved 2007-12-01. 
  53. ^ "Keep Alberta Rat-free for another 50 years". Alberta Department of Agriculture. Retrieved 2007-08-02. 
  54. ^ "Rat Control in Saskatchewan" (PDF). Saskatchewan Agriculture, Food and Rural Revitalization. 1 October 2003. Retrieved 2007-12-01. 
  55. ^ Atkinson, I.A.E. (1973). "Spread of the Ship Rat (Rattus r. rattus L.) in New Zealand". Journal of the Royal Society of New Zealand 2 (3): 457–472. 
  56. ^ "NZ routs island rats". BBC News. 26 May 2003. Retrieved 2007-08-02. 
  57. ^ Meerburg BG, Singleton GR, Kijlstra A (2009). "Rodent-borne diseases and their risks for public health". Crit Rev Microbiol 35 (3): 221–70. doi:10.1080/10408410902989837. PMID 19548807. 
  58. ^ Webster, JP, Lloyd, G, Macdonald, DW. (1995). "Q fever (Coxiella burnetii) reservoir in wild brown rat (Rattus norvegicus) populations in the UK.". Parasitology 110: 31–55. doi:10.1017/S0031182000081014. 
  59. ^ Dubeya, J. P.; Frenkel, J. K. (1998). "Toxoplasmosis of rats: a review, with considerations of their value as an animal model and their possible role in epidemiology". Veterinary Parasitology. 77 (1): 1–32. doi:10.1016/S0304-4017(97)00227-6. 
  60. ^ Berdoy, M; Webster, JP; MacDonald, DW (2000). "Fatal attraction in rats infected with Toxoplasma gondii." (PDF). Proceedings of the Royal Society of London: Biological Sciences 267 (1452): 1591–1594. doi:10.1098/rspb.2000.1182. JSTOR 2665707. PMC 1690701. PMID 11007336. 
  61. ^ Samuel et al. (2001) Parasitic Diseases of Wild Mammals. Blackwell Publishing. pp. 380–393. ISBN 0-8138-2978-X.
  62. ^ Leiby, D. A., Duffy, C. H., Darwin Murrell, K., Schad, G. A. (1990). "Trichinella spiralis in an Agricultural Ecosystem: Transmission in the Rat Population". The Journal of Parasitology. 76 (3): 360–364. doi:10.2307/3282667. JSTOR 3282667. 
  63. ^ Stojcevic, D, Zivicnjak, T, Marinculic, A, Marucci, G, Andelko, G, Brstilo, M, Pavo, L, Pozio, E (2004). "The Epidemiological Investigation of Trichinella Infection in Brown Rats (Rattus norvegicus) and Domestic Pigs in Croatia Suggests That Rats are not a Reservoir at the Farm Level". Journal of Parasitology 90 (3): 666–670. doi:10.1645/GE-158R. PMID 15270124. 
  64. ^ Ranque, S; Faugère, B; Pozio, E; La Rosa, G; Tamburrini, A; Pellissier, JF; Brouqui, P (2000). "Trichinella pseudospiralis outbreak in France.". Emerging Infectious Diseases 6 (5): 543–547. doi:10.3201/eid0605.000517. PMC 2627956. PMID 10998388. 
  65. ^ "Merck Veterinary Manual". Retrieved 2010-01-11. 
  66. ^ See e.g.,
  67. ^ See e.g.:
  68. ^ Baker, Henry J.; Lindsey, J. Russel; Weisbroth, Steven H. (1979). The laboratory rat: volume I – biology and diseases. Orlando, FL: Academic Press. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Fancy rat

The fancy rat is a domesticated brown rat (Rattus norvegicus), which is the most common type of pet rat.[1] The name fancy rat derives from the idea of animal fancy or the phrase, "to fancy" (to like, or appreciate).[2]

Fancy rats have their origins as the targets for blood sport in 18th and 19th century Europe. Specially bred as pets since then, fancy rats now come in a wide variety of colours and coat types and there exists several rat fancy groups worldwide. Fancy rats are commonly sold as pets in stores and by breeders. In fiction, pet brown rats tend to be depicted as tamed rather than domesticated, akin to when a character befriends a wolf. As tamed pets, they have played roles that vary from evil, to ambiguous, to lovable.[3]

Domesticated rats are physiologically and psychologically different from their wild relatives, and—when acquired from reliable sources—they pose no more of a health risk than other common pets.[4] For example, domesticated brown rats are not considered a plague threat[5], while exposure to wild rat populations could introduce diseases like Salmonella into the home.[6] While fancy rats are subject to different health risks than their wild counterparts, they are consequently less likely to succumb to other illnesses prevalent in the wild.

Contents


History

Jack Black made his living not only from catching rats, but also from turning around and selling them for use in baiting.

The origin of the modern fancy rat begins with the rat-catchers of the 18th and 19th centuries who trapped rats throughout Europe.[1] These rat-catchers would then either kill the rats, or—more likely—sell the rats to be the victims in bloodsport.[7] Rat-baiting was a popular sport until the beginning of the 20th century, it involved filling a pit with several rats and then placing bets on how long it would take a terrier to kill them all. It is believed that both rat-catchers and sportsmen began to keep certain, odd-coloured rats during the height of the sport—eventually breeding them, and then selling them as pets.[1][8] The two men thought to have formed the basis of rat fancy are Jack Black, rat-catcher to Queen Victoria, and Jimmy Shaw, manager of one of the largest sporting public houses in London. These two men are responsible for beginning many of the colour varieties present today.[1][9]

The bloody sport of rat-baiting is an unlikely antecedent for the practice of keeping rats as pets.

Rat fancy as a formal, organized hobby began when a woman named Mary Douglas asked for permission to bring her pet rats to an exhibition of the National Mouse Club at the Aylesbury Town Show in England on October 24, 1901. Her black and white hooded rat won "Best in Show," and ignited interest in the area. After Douglas's death in 1921, rat fancy soon began to fall back out of fashion. The original hobby formally lasted from 1912 to 1929 or 1931, as part of the National Mouse and Rat Club, at which point Rat was dropped from the name returning it to the original National Mouse Club. The hobby was revived in 1976 with the formation of the English National Fancy Rat Society (NFRS).[1][9] Pet rats are now commonly available in stores and from breeders, and there exist several rat fancy groups worldwide.

Differences from wild rats

While domesticated rats are not so far removed from their wild counterparts as to justify a distinct subspecies (compare Canis lupus familiaris and Capra aegagrus hircus), there are several significant differences that set them apart, the most apparent of which is colouring. While random colour mutations may occur in the wild, these are rare—most wild R. norvegicus are a dark brown colour, but fancy rats may be anything from white to blue.[10]

Behaviourally, pet rats are tamer than those in the wild.[11] They are more comfortable around humans, have decreased reactions to light and sound, are less wary of new foods, and can better tolerate overcrowding, though some rats prefer to be alone. They are shown to mate earlier, more readily, and for a longer period of time over their lifespan.[12] Also, domesticated rats exhibit different behaviours when fighting with each other. While wild rats almost always flee a lost battle, caged rats spend protracted amounts of time in a belly-up or boxing position.[13] These behavioural traits are thought to be products of environment as opposed to genetics. However, it is also accepted that there are certain underlying biological reasons for why some members of a wild species are more receptive to domestication than others, and that these differences are then passed down to offspring.[12][14]

At a physiological level, while still the same species, domesticated rats have different average statistics than wild rats. The chief difference is lifespan. Because domesticated rats are protected from predators and have ready access to food, water, shelter, and medical care, their average lifespan is around 3-5 years, in contrast to wild R. norvegicus, which average a lifespan of less than one year.[15] However, wild rats generally have larger brains, hearts, livers, kidneys, and adrenal glands than laboratory rats.[12] The fancy rat and wild rat also both face a multitude of differing health concerns—the former is at risk of developing a pneumococcal infection from exposure to humans, while the latter may harbour tapeworms after coming in contact with carriers like cockroaches and fleas.[16]

Varieties

The American Blue is one of several standardized coat colours.

As in other pet species, a variety of colours, coat types, and other features that do not appear in the wild have either been developed, or have appeared spontaneously. Any individual rat may be defined one or more ways by its colour, coat, marking, and non-standard body type. This allows for very specific classifications such as a ruby-eyed cinnamon rex berkshire dumbo.[2]

Colouring

While some pet rats retain the "agouti" colouring of the wild brown rat (three tones on the same hair), others may be black based colours (a single colour on each hair). Agouti based colours include agouti, cinnamon, and fawn. Black based colours include black, beige, and chocolate.[17] Additionally, eye-colour is considered a subset of colouring, and coat-colour definitions often include standards for the eyes as many genes which control eye colour will also affect the coat colour. The American Fancy Rat and Mouse Association (AFRMA), a United States-based club, lists black, pink, ruby, and odd-eyed (two different types) as possible eye-colours depending on the variety of rat shown.[18] Ruby refers to eyes which normally appear black, but are shown to be red under bright light. Colour names can vary for more vague varieties, like lilac and fawn,[17] while the interpretations of standards can fluctuate between and even within different countries or clubs.[18][19][20]

Markings

Himalayan rats have a unique color and marking variation.

Further dividing the varieties of fancy rats are the many different markings. Pet rats can appear in any combination of colour and marking. The markings are typically in reference to the patterns and ratios of coloured hair versus white hair. Two extremes would be a self (completely solid, non-white colour) and a Himalayan (completely white with a gradual blend of colouring toward its nose and feet—called "points").[21]

Markings have a strict standard for showing. For example, in the case of hooded rats, the stripe or "saddle" should be a single, unbroken line that runs down the spine and possibly partly down the tail.[20] However, many rats are not bred to the standard, such as those found in pet shops, and will have "mismarkings".

Commonly recognized standards include:

  • Berkshire – coloured top, white belly
  • Hooded – colour runs from full head down spine
  • Capped – colour on full head only
  • Variegated – a blaze, or short white strip on the forehead, with a fully coloured head and splotches or flecks of colour run down the back only
  • Irish or English Irish – In England the Irish is standardized by the NFRS as an equilateral triangle of white with a side that begins at the chest, or between the front legs, and where the point ends mid length.[20] In the United States and elsewhere, clubs like the AFRMA distinguish this marking as the English Irish and allow for another standard Irish in which the rat may have white of an even or symmetrical nature anywhere along its underside.[18][22]

Other marking varieties include Dalmatian-like spotting, blazes, masks, Siamese (typically a gradient of colour along the body, darkest at the base of the tail), and "downunders" (an Australian variety which has a solid colour stripe on the belly or a colour marking that corresponds to those on top).[23]

Body types

A male "Dumbo" rat, a variety with ears placed lower on the head. Named for resemblance to Dumbo the elephant.

Two of the most prominent (and thus standardized) physical changes applied to rats through selective breeding are the development of the Manx and Dumbo. The Dumbo, whose origins are in the United States, is characterized by having large, low, round ears on the sides of its head, while the Manx rat shares both its name and mutation with tailless Manx cats.[18]

Coat types

There is a relatively small variety of coats in relation to the number of colours and markings, and not all are internationally standardized. The most common type is the Normal or "Standard," which is allowed variance in coarseness between the sexes; males have a coarse, thick, rough coat, while females' coats are softer and finer.[18][20] Other standardized coats include: Rex, in which all the hairs are curly, even the whiskers; Velveteen, a softer variation on the Rex; Satin or Silky coats, which are extra soft and fine, with a sheen; Harley, characterized by long straight hairs.[18][20][24] Remaining coat types are not defined by the hair itself, but rather by the lack of it.

Hairless rats

Even though this rat is hairless, the markings on its skin indicate that it is a hooded rat.

Hairless rats are a coat variety characterized by varying levels of hair loss. Hairless rats, bred from Rexes, have varying areas of bare skin, or very short fur on their bodies. Because the Rex coat is a dominant trait, it only needs one Rex-parent to affect the rat's appearance. However, when two copies of the trait appear, by breeding two Rexes together, the coat is affected differently—causing hairlessness, and earning the colloquial name, "Double-rex". Hairless varieties are produced by different combinations of the various genes that cause Rex coats. One subset of semi-hairless rats, patchwork rats, constantly lose hair and regrow it in different "patches" several times throughout their lifetimes.[18][20]

Ethics of selective breeding

There is controversy among rat fanciers in regards to selective breeding.[25][26] On one hand, breeding rats to conform to a specific standard or to develop a new one is a large part of what the hobby was founded on. On the other hand, the process results in many rats who do not conform and are then either given away, sold as food, or killed—referred to as culling.[27] Additionally, there are concerns as to whether or not breeding hairless and tailless rats is ethical. The tail is vital for rats' balance and for adjusting body temperature. Tailless rats have greater risk of heat exhaustion, poor bowel and bladder control, falling from heights, and can be at risk for life-threatening deformities in the pelvic region like hind leg paralysis and megacolon.[28] Similarly, hairless rats are less protected from scratches and the cold without their coat, and have weakened immune systems. Groups such as the NFRS prohibit the showing of these varieties at their events and forbid advertisement through affiliated services.[29]

Accessibility

Because R. norvegicus and related species are seen as pests, their intentional import into foreign countries is often regulated. For example, the importation of foreign rodents is prohibited in Australia,[30] and so various coat types, colours, and varieties have been bred separately from foreign lines, or are just not obtainable within that country. In other areas, like the Canadian province of Alberta, the ownership of brown rats outside of schools, laboratories, and zoos is illegal.[31]

Health

Fancy rats of both sexes commonly develop mammary tumours as they age. These are usually benign, but multiple tumours can persist even after removal.[32]

Human-raised R. norvegicus are more prone to specific health risks and diseases than their wild counterparts, but they are also far less likely to succumb to certain illnesses that are prevalent in the wild. The major considerations for susceptibility include exposure, living conditions, and diet.

Rats that live their entire lives indoors usually are able to avoid disease-causing bacteria such as Salmonella and Pseudomonas aeruginosa, the latter is absent in treated water. They may also more easily avoid vectors like cockroaches, beetles, and fleas who are essential for the spread of endemic typhus, and intestinal parasites like the Rat tapeworm.[33][34] Additionally, pet or laboratory rats enjoy the natural benefits of having a consistent and well-balanced diet, along with access to medical care.

While living indoors decreases the risk of contracting certain diseases, living in close quarters with other rats, being unable to always seek proper protection from environmental factors (e.g. temperature, humidity, drafts), being fed an unhealthy diet, and the stresses naturally associated with living in an unnatural habitat can all adversely affect a rat's health to make them more prone to specific conditions.[33][35][36] Specifically, Tyzzer's disease, protozoic infections (e.g. Giardia muris), and pseudotuberculosis are usually seen in stressed or young rats.[34][37] Additionally, pet rats are exposed to Streptococcus pneumoniae, a zoonotic disease caught from humans, not the same bacteria associated with strep throat. Another bacteria associated with humans, Pneumocystis carinii, is actually found in almost all domesticated animals. However it is asymptomatic unless the rat's immune system is compromised by illness, then it can develop into pneumonia.[37]

Several diseases, like Rat Coronavirus Infection (RCI), Sendai virus, and Murine Respiratory Mycoplasmosis (MRM, Mycoplasma pulmonis), are prevalent simply because their highly contagious natures work in tandem with the way rats are kept in laboratories, pet stores, and by breeders.[34][37] It should be noted, however, that MRM is far less likely to occur in laboratory rats than in those kept as pets.[37]

Pet rats can also develop pituitary tumors if they are given high-calorie diets,[32] and ringtail if they are placed in areas with low humidity, high temperatures, or drafts. Staphylococcus spp. are a mostly benign group of bacteria that commonly reside on the top of the skin, but cuts and scratches from social and hierarchal fighting can open up the pathways for them to cause ulcerative dermatitis.[33]

Risks to owners

Keeping rats as pets can come with the stigma that rats transmit dangerous diseases to their owners. One fear is that all rats carry plague, when in fact R. norvegicus is not among the list of species considered a threat.[5] In 2004, an outbreak of salmonella in the United States was connected to people who owned pet rats,[38] however it has been determined that a pet rat's initial exposure to salmonella, along with many other zoonotic rat-diseases, typically indicates exposure to wild rodent populations, either from an infestation in the owner's home, or from the pet's contaminated food, water, or bedding. Over all domestic pet rats pose very little or no threat to their owners.[6]

Fiction

Samantha Martin, a professional animal trainer for films, commercials, and music videos, has claimed that rats are one of the easiest animals to train due to their adaptability, intelligence, and focus.[39] Rather than portraying pet brown rats as thoroughly domesticated, they are often cast as a wild brown rat that a character tames. An example of this is in the series of movies based on Ratman's Notebooks: 1971's Willard, the 1972 sequel Ben, and 2003's Willard. In these movies, the protagonist befriends the rats found in his home and builds up a close relationship, only to have it end in tragedy. While these movies generally emphasize the popular perception of malevolence[40]—they kill people, cats, and ransack grocery stores—other wild rats who become pets are portrayed in more neutral to positive ways; the television show, House, shortly featured "Steve McQueen", the pet rat of the titular character,[41] and the 2007 film, Ratatouille, is about a rat described by Roger Ebert as "earnest... lovable, determined, [and] gifted" who lives with a Parisian garbage boy.[3] Tame rats used in religious ceremonies play a role in Lois McMaster Bujold's novel The Curse of Chalion. Splinter, the master and adoptive father of the Teenage Mutant Ninja Turtles, was once the pet rat of ninja Hamato Yoshi and learned his martial arts skills by imitating his master.

See also

References

  1. ^ a b c d e Langton, Jerry (2007). "Entertainer, Test Subject, and Family Friend". Rat: How the World's Most Notorious Rodent Clawed Its Way to the Top. Macmillan. ISBN 0-312-36384-2. http://books.google.com/books?id=n488n52-wYUC&pg=PA87&source=gbs_toc_r&cad=0_0. Retrieved 8 January 2009. 
  2. ^ a b "Rats". Writer: Kaylan Eggert Narrator: Max Raphael. Modern Marvels. History Channel.
  3. ^ a b Ebert, Roger (2008). Roger Ebert's Four-Star Reviews 1967-2007. Andrews McMeel Publishing. pp. 637. ISBN 0740771795. http://books.google.com/books?id=v43dJNPMJIkC&pg=PA637. "Remy, the earnest little rat who is its hero, is such a lovable, determined, gifted rodent that I want to know what happens to him next, now that he has conquered the summit of French cuisine." 
  4. ^ "Table on Global Zoonoses". Merck Veterinary Manual - Zoonoses:Introduction. Merck and Co., Inc. 2008. http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/220100.htm. Retrieved 11 January 2009. 
  5. ^ a b Orloski, Kathleen A.; Sarah L. Lathrop (February 15, 2003). "Plague: a veterinary perspective". Journal of the American Veterinary Medical Association 222 (4): 444–448. doi:10.2460/javma.2003.222.444. PMID 12597416. http://avmajournals.avma.org/doi/pdf/10.2460/javma.2003.222.444. 
  6. ^ a b "Merck Veterinary Manual - Generalized Diseases". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171547.htm. Retrieved 9 January 2009. 
  7. ^ Krinke, George J. (15 June 2000). "History, Strains and Models". The Laboratory Rat (Handbook of Experimental Animals). Gillian R. Bullock (series ed.), Tracie Bunton (series ed.). Academic Press. pp. 3–16. ISBN 0-124-26400-X. 
  8. ^ Hilscher-Conklin, Caryl. "The Domestication of the Rat". Rat & Mouse Club of America. http://www.rmca.org/Articles/domestication.htm. Retrieved 10 November 2008. 
  9. ^ a b "The History of Fancy Rats". American Fancy Rat and Mouse Association. http://afrma.org/rminfo4a.htm. Retrieved 10 November 2008. 
  10. ^ Refer to specific information in the Varieties section
  11. ^ Knight, John (2005). Animals in Person: Cultural Perspectives on Human-animal Intimacy. Berg Publishers. pp. 131. ISBN 1859737331. http://books.google.com/books?id=UTycF9esNdIC&pg=PA131. Retrieved 10 January 2009. 
  12. ^ a b c Barnett, S. Anthony (April 1, 2002). "Naming and Taming". The Story of Rats: Their Impact on Us, and Our Impact on Them. Australia: Allen & Unwin. pp. 21–23. ISBN 978-1865085197. http://books.google.com/books?id=WSHVlTr-PpsC&printsec=frontcover&source=gbs_summary_r&cad=0#PPA21,M1. 
  13. ^ Blanchard, R; Carolineblanchard, D (1977). "Aggressive behavior in the rat". Behavioral Biology 21: 197. doi:10.1016/S0091-6773(77)90308-X. PMID 562152. 
  14. ^ Price, Edward O. (2003). Animal Domestication and Behavior. CABI Publishing. ISBN 0851995977. 
  15. ^ Langton, Jerry (26 June 2007). "Second Only to Us". Rat: How the World's Most Notorious Rodent Clawed Its Way to the Top. St. Martin's Press. p. 168. ISBN 0312363842. http://www.amazon.com/gp/reader/0312363842/ref=sib_dp_pt#reader-link. Retrieved 13 November 2008. 
  16. ^ Refer to specific information in the Health section.
  17. ^ a b Royer, Nichole. "Rat Genetics, part 3". AFRMA. http://afrma.org/ratgenpart3.htm. Retrieved 9 January 2009. 
  18. ^ a b c d e f g "American Fancy Rat and Mouse Association standards". AFRMA. http://afrma.org/fancyrm.htm. Retrieved 21 November 2006. 
  19. ^ Daly, Carol H. (2002). Rats (2 ed.). Barron's Educational Series. p. 15. ISBN 0764120123. http://books.google.com/books?id=7aNn84hsNs8C&pg=PA15&dq=international+rat+standard#PPA15,M1. 
  20. ^ a b c d e f "National Fancy Rat Society standards". NFRS. http://www.nfrs.org/varieties.html. Retrieved 21 November 2006. 
  21. ^ "Standards". Rat Society of America. http://ratsocietyofamerica.org/standards2.html. Retrieved 3 February 2009. 
  22. ^ Fox, Susan (1997-08). The Guide to Owning a Rat. TFH Publications. p. 12. ISBN 0793821576. 
  23. ^ Hemberg, Yvette; Cindy Sautchuk (2000). "A New Rat Variety Down Under" (PDF). Rat and Mouse Fancy Report (Rat and Mouse Fanciers for Excellence (RMFE)) 1 (1). http://rodentfancy.com/pets/wp-content/uploads/2008/01/downundr.pdf. 
  24. ^ "Rats PacNW standards". RatsPacNW Rat Fanciers Club. http://www.ratspacnw.org/rat%20standards.htm. Retrieved 12 January 2009. 
  25. ^ "General Information - Advice for the Novice Breeder". National Fancy Rat Society. 3 May 2008. http://www.nfrs.org/geninfo.html. Retrieved 14 November 2008. 
  26. ^ Isaksen, Mary Ann (January 1999). "Breeding: Can YOU Live With It?". Rat & Mouse Gazette. Rat & Mouse Club of America. http://www.rmca.org/Articles/breeding.htm. Retrieved 14 November 2008. 
  27. ^ Isaksen, Mary Ann (January 1997). "Alternatives to Culling". Rat & Mouse Gazette. Rat & Mouse Club of America. http://www.rmca.org/Articles/culling.htm. Retrieved 14 November 2008. 
  28. ^ Royer, Nichole (1998). "Tailless Rats". AFRMA Rat & Mouse Tales. American Fancy Rat and Mouse Association. http://www.afrma.org/taillessrats.htm. Retrieved 14 November 2008. 
  29. ^ "Banned varieties". The National Fancy Rat Society. http://www.nfrs.org/banned.html. Retrieved 11 November 2008. 
  30. ^ "Other Pets - DAFF". Australian Quarantine and Inspection Service. http://www.daff.gov.au/aqis/cat-dogs/other. Retrieved 3 March 2009. 
  31. ^ Bourne, John (1 October 2002). "The History of Rat Control in Alberta". Agriculture and Food. Alberta Department of Agriculture. http://www1.agric.gov.ab.ca/$department/deptdocs.nsf/all/agdex3441. Retrieved 1 December 2007. 
  32. ^ a b "Merck Veterinary Manual - Neoplasia". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171562.htm. Retrieved 7 January 2009. 
  33. ^ a b c "Merck Veterinary Manual - Skin Diseases". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171546.htm. Retrieved 9 January 2009. 
  34. ^ a b c "Merck Veterinary Manual - Gastrointestinal Diseases". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171544.htm. Retrieved 9 January 2009. 
  35. ^ "Merck Veterinary Manual - Management". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171543.htm. Retrieved 7 January 2009. "Ambient temperatures >85°F (29.4°C), high humidity levels (>80%), poor ventilation, and overcrowding predispose rodents to heat exhaustion." 
  36. ^ "Merck Veterinary Manual - Reproductive Diseases". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171548.htm. Retrieved 9 January 2009. 
  37. ^ a b c d "Merck Veterinary Manual - Respiratory Diseases". http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/171545.htm. Retrieved 9 January 2009. 
  38. ^ "Outbreak of Multidrug-Resistant Salmonella Typhimurium Associated with Rodents Purchased at Retail Pet Stores". Center for Disease Control. May 6, 2005. http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5417a3.htm. Retrieved 14 November 2008. 
  39. ^ Wilson, Stacy Lynne (April 20, 2007). "Samantha Martin: Exclusive Interview". Animal Movies Guide. Running Free Press. pp. 365–366. ISBN 0967518539. http://books.google.com/books?id=dGYzZLrBrS4C&printsec=frontcover&source=gbs_summary_r&cad=0#PPA365,M1. 
  40. ^ Clute, John; John Grant (March 15, 1999). The Encyclopedia of Fantasy. St. Martin's Griffin. pp. 642. ISBN 0312198698. "Rats also come into their own in supernatural fiction or dark fantasy, where they tend to represent invasive evil...." 
  41. ^ "HOUSE: Guide to the TV Show". Second Season Episodes: #221 "Euphoria Part 2". http://www.housemd-guide.com/season2/221euphoria2.php. Retrieved 25 February 2009. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: See Musser and Carleton (in Wilson and Reeder 2005) for a good review and discussion of Rattus taxonomy and phylogeny.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!