Articles on this page are available in 1 other language: Spanish (3) (learn more)

Overview

Brief Summary

Description

Southern Bog Lemmings are born with whiskers and a scattering of hairs on their heads and backs. They are well-furred when they are a week old, and look like miniature adults at two weeks of age. By three weeks, they are weaned and are almost full grown. They live in a wide variety of habitats, including grasslands, mixed deciduous/coniferous woodlands, spruce-fir forests, and freshwater wetlands. They eat grasses, sedges, mosses, fungi, fruit, bark, and roots. Fossils indicate that they once lived where the Northern Bog Lemming is found today, and Southern Bog Lemmings occurred as far south as Texas and Mexico.

Links:
Mammal Species of the World
Click here for The American Society of Mammalogists species account
  • Original description: Baird, S.F., 1857 [1858].  Mammals. In Reports of explorations and surveys, to ascertain the most practicable and economical route for a railroad from the Mississippi River to the Pacific Ocean, p. 558.  Vol. 8, Pt. 1. Mammals. Beverly Tucker Printer, Washington, D.C., 8(1):1-757 + 43 plates.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Southern bog lemmings are found in eastern North America, from southeast Canada to western Minnesota, down to southwest Kansas and east to northeast North Carolina.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species ranges from southern Quebec west to southern Manitoba in Canada, south to Kansas, northern Arkansas, Tennessee, North Carolina, Virginia, and Maryland in the United States.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: Southern Quebec west to southern Manitoba, south to Kansas, northern Arkansas, Tennessee, North Carolina, Virginia, and Maryland.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Southern bog lemmings are found in eastern North America, from southern Quebec and Manitoba in Canada to western Minnesota, to southwestern Kansas, and east to the Atlantic coast of the United States.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Southern bog lemmings are small voles, weighing 20 to 50 grams and measuring 110 to 140 mm in total length. The dorsal pelage ranges in color from a chestnut to dark brown that has a grizzled appearance. The venter is silver-gray. Females of this species have 6 mammae, which differentiate it from its closest relative, Synaptomys borealis, which have 8 mammae. The orange incisors are broad and longitudinally grooved. The tail is short, barely longer than the hind foot.

Range mass: 20 to 50 g.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Southern bog lemmings are small Arvicolinae, weighing 20 to 50 g (average 35 g) and measuring 110 to 140 mm in total length. The fur on the back ranges in color from a reddish to dark brown and has a grizzled appearance. The belly is silver-gray. They have broad incisors that are grooved, which is helps distinguish southern bog lemmings from other voles. The tail is short, barely longer than the hind foot. They have 4 toes and 1 small, nailed thumb on the forefeet and 5 toes on the hind feet. Females have 6 mammary glands, which distinguishes this species from its closest relative, Synaptomys borealis, which have 8 mammary glands.

Range mass: 20 to 50 g.

Range length: 110 to 140 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 15 cm

Weight: 50 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size in North America

Sexual Dimorphism: None

Length:
Range: 94-154 mm

Weight:
Range: 21.4-50 g
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Synaptomys cooperi occurs mainly in sphagnum bogs, as its common name suggests, but it may also occur in grasslands, and in Canada it occurs in coniferous or deciduous forests. In Michigan, it can be found in clear cuts, old fields, or upland woods. Occurrence within the larger geographic range is patchy--it tends to occupy isolated areas. This is thought to be due to competition with meadow voles.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It occurs in a wide variety of habitats, including grasslands, mixed deciduous/coniferous forests, spruce-fir forests, and freshwater wetlands. Competes for living space with Microtus, which is a superior competitor and excludes Synaptomys from higher quality habitats.

Prefers boggy habitat but it is also common in marshes, meadows, and upland forests with thick humus layer (especially when conditions are not hot and dry); areas with intermixture of herbaceous/shrubby vegetation. Occupies burrow systems usually 6-12 inches deep and surface runways (e.g., beneath sphagnum and among roots of shrubs).

Young are born in nests placed on the surface in grassy vegetation or in underground burrows. In New Jersey, nests were just under the surface in tops of sphagnum hummocks (Conner 1959). Breeds year-round; peak April-September. Gestation lasts 21-23 days. Litter size is 1-8 (average 2-5); multiple litters annually in the south. Sexually mature in 60 days, or less for males.

Home range varies from 1/4 to one acre. Sometimes occurs in small colonies. Diet consists primarily of herbaceous plants; leaves, stems, seeds, and rootstocks, especially of grasses and sedges; also eats small fruits (Connor 1959). Active day and night throughout the year.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Prefers boggy habitat but also common in marshes, meadows, and upland forests with thick humus layer (especially when conditions not hot and dry); areas with intermixture of herbaceous/shrubby vegetation. Occupies burrow systems usually 6-12 inches deep and surface runways (e.g., beneath sphagnum and among roots of shrubs). Young are born in nests placed on the surface in grassy vegetation or in underground burrows. In New Jersey, nests were just under the surface in tops of sphagnum hummocks (Conner 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern bog lemmings occur in a wide variety of habitats. As their common name suggests, they are often found in sphagnum bogs and low moist places, but they are also found in grasslands, mixed deciduous/coniferous forests, spruce-fir forests, freshwater wetlands, marshes, and meadows. In Michigan, they can be found in clear cuts, old fields, or upland woods. They prefer areas with a thick mat of herbaceous and shrubby vegetation. They tend to live in habitats within their geographic range where they do not have to compete with microtus pennsylvanicus.

Southern bog lemmings use runways to travel, which are often located among roots of shrubs or beneath sphagnum moss. They also create round nests 15 to 20 cm in diameter that are made of dry leaves, grass, and some soft material like fur. Nests have 2 to 4 entrances. In the summer, nests are often placed on the ground amidst grassy vegetation or on top of sphagnum hummoks. In the winter, nests are commonly found 10 to 15 cm below the ground.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Wetlands: bog

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Southern bog lemmings eat mostly vegetation such as grasses, sedges, mosses, fruits, fungi, bark and roots. Bog lemmings snip stems near the ground to get access to the upper parts. Often surrounding vegetation prohibits the stems from falling, so additional snips must be made. Some invertebrates such as slugs and snails are also taken. The jaws are powerful and thought to be used extensively for gnawing.

Animal Foods: mollusks

Plant Foods: leaves; roots and tubers; wood, bark, or stems; fruit; bryophytes

Other Foods: fungus

Primary Diet: herbivore (Folivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Diet consists primarily of herbaceous plants; leaves, stems, seeds, and rootstocks, especially of grasses and sedges; also eats small fruits (Conner 1959).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Southern bog lemmings mostly eat vegetation such as herbaceous plants, leaves, stems, seeds, particularly of bluegrass (g.Poa),_white_clover_(<<Trifolium_repens), and other grasses. They also eat sedges, mosses, fruits, fungi, bark, and roots. Bog lemmings snip stems near the ground to get access to the upper parts. Surrounding vegetation often stops the stems from falling, so additional snips must be made. Southern bog lemmings also eat some invertebrates such as Gastropoda, as well as adult and larval Coleoptera. Their jaws are powerful and thought to be used quite often for gnawing. Captive individuals have been observed lapping up water with their tongue. Because they consume so much green vegetation, their droppings are a characteristic uniform light green in color.

Animal Foods: insects; mollusks

Plant Foods: leaves; roots and tubers; wood, bark, or stems; fruit; bryophytes

Other Foods: fungus

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Southern bog lemmings have important ecosystem roles as food for a number of predators (see above) and as competitors with other small rodents, such as meadow voles.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern bog lemmings have many predators, including owls, red foxes, gray foxes, domestic dogs, badgers, and house cats.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Southern bog lemmings consume a variety of grasses and other vegetation and act as prey for a number of predators. They compete with other small Rodentia, particularly microtus pennsylvanicus. Meadow voles tend to out-compete southern bog lemmings. Southern bog lemmings host external parasites such as Acari, Phthiraptera, and Siphonaptera. The tunneling behavior of southern bog lemmings also helps mix the soil, allowing rain and air to access deeper layers and mixing vegetation and droppings with the soil, increasing its fertility.

Ecosystem Impact: soil aeration

Commensal/Parasitic Species:

  • mites Acari
  • lice Phthiraptera
  • fleas Siphonaptera

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Southern bog lemmings have many predators, including Strigiformes, Accipitriformes, Vulpes vulpes, Urocyon cinereoargenteus, Canis lupus familiaris, Taxidea taxus, Mustela, Serpentes, Lynx rufus, and Felis silvestris.

Known Predators:

  • owls (Strigiformes)
  • hawks (Accipitriformes)
  • red foxes (Vulpes_vulpes)
  • gray foxes (Urocyon_cinereoargenteus)
  • domestic dogs (Canis_lupus_familiaris)
  • badgers (Taxidea_taxus)
  • weasels (Mustela)
  • house cats (Felis_silvestris)
  • bobcats (Lynx_rufus)
  • snakes (Serpentes)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Home range varies from 1/4 to 1 acre. Densities vary from 5 to 35 per ha, reaching 89/ha in peak years (Banfield 1974). Sometimes occurs on small colonies. Populations usually are scarce and scattered.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

There is thought to be intraspecific communication in the form of scent marking from anal secretions. Vocalizations are squeaks.

Communication Channels: acoustic ; chemical

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Southern bog lemmings are thought to communicate using scent marking. They also make squeaking vocalizations.

Communication Channels: acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cyclicity

Comments: Active day and night throughout the year.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Wild southern bog lemmings usually do not live for more than a year. In captivity, they may live up to 29 months.

Range lifespan

Status: captivity:
29 (high) months.

Typical lifespan

Status: wild:
1 (high) years.

Average lifespan

Status: wild:
< 1 years.

Average lifespan

Status: captivity:
2.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Southern bog lemmings usually do not live for more than a year in the wild. In captivity, they may live up to 29 months.

Range lifespan

Status: captivity:
29 (high) months.

Typical lifespan

Status: wild:
1 (high) years.

Average lifespan

Status: captivity:
2.5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, though they have been reported to live up to 2.5 years in captivity (Bernhard Grzimek 1990).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Breeding occurs in all seasons, especially where food is not limiting. Most young are born between April and September. Females are polyestrous--one captive bore 6 litters in 22 weeks. Wild females produce 2 or 3 litters per year. Gestation lasts from 23 to 26 days. Mean litter size is 3 but can range from 1 to 8. Males can reach sexual maturity in 5 weeks.

Breeding interval: Southern bog lemmings breed two or three times each year.

Breeding season: Southern bog lemmings breed year round.

Range number of offspring: 1 to 8.

Average number of offspring: 3.

Range gestation period: 23 to 26 days.

Average weaning age: 3 weeks.

Average age at sexual or reproductive maturity (male): 5 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; viviparous

Average birth mass: 3.46 g.

Average number of offspring: 3.

Southern bog lemmings weigh 3.7 grams at birth. Young are born with no fur, closed eyes, and with the ear pinnae folded over. Claws are apparent at birth. By the end of the first week, the young are well furred. The female nurses her young for three weeks.

Parental Investment: altricial ; pre-fertilization (Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Breeds year-round; peak April-September. Gestation lasts 21-23 days. Litter size is 1-8 (average 2-5); multiple litters annually in the south. Sexually mature in 60 days, or less for males.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Little is known about the mating systems of southern bog lemmings.

Southern bog lemmings breed year round, especially where there is plentiful food. Most young are born between April and September. Females may have many litters in a year--one captive female bore 6 litters in 22 weeks. Females produce 2 or 3 litters per year in the wild. Pregnancy lasts from 23 to 26 days. Average litter size is 3 to 5 individuals but can range from 1 to 8. Young weigh on average 3.7 g at birth and are born blind and without fur. They also have claws at birth. By the end of their first week, young are well furred. They open their eyes at about 12 days of age. Females nurse their young for 3 weeks. Male southern bog lemmings reach sexual maturity in 5 weeks. Most individuals breed before they reach their maximum size.

Breeding interval: Southern bog lemmings breed 2 or 3 times each year.

Breeding season: Southern bog lemmings breed year round.

Range number of offspring: 1 to 8.

Average number of offspring: 3.

Range gestation period: 23 to 26 days.

Average weaning age: 3 weeks.

Average age at sexual or reproductive maturity (male): 5 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 3.46 g.

Average number of offspring: 3.

Little is known about parental investment of southern bog lemmings. Females give birth in a nest or an underground burrow, and they nurse their young for 3 weeks.

Parental Investment: altricial ; pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synaptomys cooperi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTTCTATTTGGGGCTTGAGCGGGTATAGTTGGAACGGCCCTAAGCATCTTAATTCGAGCAGAACTTGGGCAACCTGGCGCTCTACTAGGGGATGACCAAATTTATAACGTCATTGTTACCGCACACGCATTCGTTATAATCTTCTTTATGGTAATACCAATAATGATCGGCGGCTTCGGAAACTGACTAGTTCCACTTATAATTGGGGCCCCCGATATGGCATTCCCACGAATAAATAATATAAGCTTTTGGCTCTTACCACCGTCATTCCTTCTTCTTCTAGCATCATCAATAGTAGAGGCTGGCGCCGGAACGGGCTGAACTGTTTACCCACCATTAGCTGGAAACTTAGCACACGCAGGAGCATCAGTGGACCTCACCATTTTCTCACTCCATTTAGCTGGTGTCTCTTCAATTCTAGGGGCAATTAACTTTATTACCACTATTATTAATATAAAACCCCCAGCCATGACACAATACCAAACCCCTCTGTTTGTATGGTCTGTTTTAATTACAGCCGTCCTTCTCCTACTCTCTCTTCCAGTATTAGCTGCAGGTATTACAATACTCCTGACAGACCGAAACCTAAATACCACCTTCTTCGACCCTGCAGGAGGGGGTGATCCTATTCTCTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Synaptomys cooperi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Once very common, numbers seem to be declining as a result of habitat destruction and the overgrowth of bogs. One subspecies, Synaptomys cooperi helaletes, is thought endangered and possibly extinct. Other subspecies also appear to be threatened.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Linzey, A.V. & NatureServe (Hammerson, G.)

Reviewer/s
Amori, G. (Small Nonvolant Mammal Red List Authority) & Chanson, J. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern because it is very widespread, there are no major threats at present, and its populations are not declining fast enough to qualifying for listing in a more threatened category.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Once very common, numbers of southern bog lemmings seem to be declining as a result of habitat destruction and the overgrowth of bogs. This rate of decline is not fast enough for the species to be considered threatened. Southern bog lemmings are widespread and they currently have no major threats. Some human activities such as deforestation and elimination of grassland change habitats. Although these changes helps Microtus, they put southern bog lemmings at risk because Microtus tend to out-compete southern bog lemmings. Two subspeices of southern bog lemmings are currently extinct: Kansas bog lemmings (Synaptomys cooperi paludis) and Nebraska bog lemmings (S. cooperi relictus).

IUCN Red List of Threatened Species: least concern

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Two subspecies are Extinct, S. cooperi paludis, the Kansas Bog Lemming, and S. cooperi relictus, the Nebraska Bog Lemming.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution

Source: Smithsonian's North American Mammals

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It generally occurs in low densities in most parts of the range, with some locally higher densities recorded in prairie areas. It is said to be colonial, but probably is just locally distributed in suitable habitat patches. Published densities range from 1.6/ha in New Jersey to 106/ha in Illinois. However, temporary local concentrations cannot be used as estimates of area-wide densities.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats to this species throughout its range.

Human habitat changes (deforestation, elimination of native grasslands, roadways that provide dispersal routes to habitat patches, etc.) that encourage increases in numbers or local distribution of Microtus would be detrimental to Synaptomys cooperi.

In Kansas, this species moved out of or avoided areas subject to experimental prairie fire (Clark and Kaufman 1990). In southeastern Kentucky, it apparently is being displaced via competitive exclusion by expanding meadow vole populations (Krupa and Haskins 1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: In Kansas, moved out of or avoided areas subject to experimental prairie fire (Clark and Kaufman 1990). In southeastern Kentucky, apparently being displaced via competitive exclusion by expanding meadow vole populations (Krupa and Haskins 1996).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Its range includes several protected areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

In areas of high populations, increased tunneling activities of southern bog lemmings may be a nuisance in yards in wet areas. There are otherwise no known adverse effects of southern bog lemmings on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

There are no known direct positive effects of southern bog lemmings on humans. Because they are important prey for many species and they aerate the soil, they help maintain a thriving ecosystem.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Southern bog lemming

The southern bog lemming (Synaptomys cooperi) is a small North American lemming. Its range overlaps with the other species in genus Synaptomys, the northern bog lemming, in southeastern Canada but extends further south.

They have round thick bodies covered with grey-brown fur with silver grey underparts. They have a large head, short legs and a short tail which is lighter underneath. Their small ears are barely visible through their fur. Their upper incisors are grooved. Females of this species have 6 mammae; female northern bog lemmings have 8. They are 13 cm long with a 2 cm tail and weigh about 35 grams.

These animals are found in mixed forests, wetlands and grasslands in eastern North America. They feed on grasses, other green vegetation, fungi, and mosses. Their droppings are green. Predators include owls, hawks, mustelids, and snakes.

Female lemmings have 2 or 3 litters of 4 to 6 young in a year. The young are born in a nest in an underground burrow or concealed in vegetation. Most will live less than a year.

They are active year round, mainly at night. They make runways through the surface vegetation and also dig underground burrows. These animals are often found in small colonies. Lemming populations go through a 3 or 4 year cycle of boom and bust.

The range of these animals is thought to be declining in some areas due to loss of wetland habitat.

Two subspecies have become extinct: Kansas bog lemming (S. c. paludis), and Nebraska bog lemming (S. c. relictus)

References[edit]

  1. ^ Linzey, A.V. & Hammerson, G. (2008). "Synaptomys cooperi". IUCN Red List of Threatened Species. Version 2009.2. International Union for Conservation of Nature. Retrieved 4 February 2010. 
  • Hazard, Evan B. (1982). The Mammals of Minnesota. Minneapolis: University of Minnesota Press. ISBN 0-8166-0949-7. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Wilson and Choate (1997) examined morphological variation in populations in Arkansas, Iowa, Illinois, Kansas, Missouri, Nebraska, and South Dakota and found that variation was largely clinal, with only minor steps in clinal variation in cranial morphology. Because of small sample sizes, they recommended retention of currently recognized subspecies until genetic data are available.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!