Overview

Brief Summary

Biology

Little is known of this exceptionally rare mammal. It is mainly a browser of leaves, twigs, fruits and shoots and often breaks saplings down to access food (4). Females reach sexual maturity at about five to seven years of age, whereas males become mature later, typically at about ten years of age (5). The rate of reproduction in this species is relatively slow; females give birth to a single young every one to three years, after a presumed gestation of 15 to 16 months, as in other rhinos. With the exception of mothers with their offspring and mating pairs, the Javan rhinoceros is a largely solitary species (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The prehistoric-looking Javan rhinoceros is one of the world's rarest large mammals (2). The name rhinoceros derives from the Greek for 'nose horn', and the Javan rhinoceros has a single horn on the snout that, like all rhinoceros horns, does not have a bony core but is composed of keratin fibres (4). Adults are grey in colour, and have an armour-plated appearance caused by the deep folds of hairless skin (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

The Javan Rhino formerly occurred from Bangladesh, Myanmar, Thailand, Lao PDR, Cambodia, Viet Nam, and probably southern China through peninsular Malaya to Sumatra and Java (Grubb, 2005). The species' precise historical range is indeterminate, as early accounts failed to distinguish rhinos to specific level, due to partial sympatry with the other two Asian rhino species (Rhinoceros unicornis and Dicerorhinus sumatrensis). Beginning in the middle of the nineteenth century, the species was extirpated from most of its historical range, and currently occurs only in two small isolated areas. The last records of Javan Rhino vary, from 1920 in Myanmar, to 1932 in Malaysia, and 1959 on Sumatra (Indonesia) (Simon and Geroudet, 1970).

The subspecies Rhinoceros sondaicus inermis formerly occurred in northeastern India, Bangladesh, and Myanmar, but is now extinct (Nowak, 1999).

The subspecies Rhinoceros sondaicus annamiticus formerly occurred in Viet Nam, Lao PDR, Cambodia, and eastern Thailand. Currently, this subspecies is restricted to the area in and around the Cat Loc part (Dong Nai province) of the Cat Tien National Park in Viet Nam (Schenkel and Schenkel, 1969).

The subspecies Rhinoceros sondaicus sondaicus formerly occurred from Thailand through Malaysia, to the islands of Java and Sumatra (Indonesia). The only remaining population occurs on the Ujung Kulon Peninsula (Hoogerwerf, 1970), which forms the westernmost extremity of the island of Java. The Javan population of this subspecies has been restricted to this area since around the 1930s.

This is a lowland species that typically occurs up to 600 m (Sectionov and Waladi pers. comm.), but has been recorded above 1,000 m (Nowak, 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Rhinoceros sondaicus (Javan rhinoceros) is known to reside in only two Southeast Asian locales: Ujung Kulon National Park in Java, Indonesia, and Cat Tien National Park in Vietnam. Approximately 50 to 60 Javan rhinoceroses are living in Ujung Kulon; while a small group consisting of only 7 to 15 individuals are thought to be living in Cat Tien.

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
Indonesia, Indochina, Burma, Thailand, Sikkim, Bangladesh, Malaysia

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Once widespread in south-east Asia, the Javan rhinoceros is now found only in two small areas. The Indonesian Javan rhinoceros subspecies, (Rhinoceros sondaicus sondaicus), is found in a single population within the Ujung Kulon National Park in Java (6). The Vietnamese Javan rhinoceros, (R. s. annamiticus), is perched on the very brink of extinction, as it is thought that only around ten individuals persist in the Cat Tien National Park in the Dong Nai region of Vietnam (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

An average adult Javan rhinoceros is approximately 11 to 12 feet in length, with a height of 5 to 6 feet to the top of its shoulders. There is little sexual dimorphism. They are known for having poor eyesight, but they have keen senses of smell and hearing -- despite having smaller ears than other rhinoceroses. The skin is a hazy grey and contains tough folds that create an armor-like plating. Its one horn is made up of keratin (as are human fingernails), and may grow to a length of 10 inches. Females may lack a horn. Each foot ends in three hooved toes. Their teeth are lophodont, and the Javan rhinoceros also has an unique prehensile lip that functions as an aid for feasting on leaves.

Range mass: 900 to 1400 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The Javan Rhinoceros currently occurs in lowland tropical rainforest areas, especially in the vicinity of water (Schenkel and Schenkel, 1969). The species formerly occurred in more open mixed forest and grassland and on high mountains. Because of its rarity, little is known about its preferred habitat, but it is certainly not naturally restricted to dense tropical forest water (Schenkel and Schenkel, 1969). Little is known about the species' biology and the habitats in which the two remaining populations are found may not be optimal.

The home range size of females is probably no more than 500 ha, while males wonder over larger areas, with likely limited dispersal distance. The species is generally solitary, except for mating pairs and mothers with young (Nowak, 1999). Its life history characteristics are not well known, with longevity estimated at about 30-40 years, gestation length of approximately 16 months (as with other rhino species), and age at sexual maturity estimated at 5-7 years for females and 10 years for males (Nowak, 1999; International Rhino Foundation website, (www.rhinos-irf.org) 2006).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Rhinoceros sondaicus resides in dense, low-lying tropical rainforests. They prefer areas with abundant water and mud wallows. Although most members of the species are found in these lowland areas, they have been observed at more than 1000 feet above sea level.

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

The Javan rhinoceros inhabits dense rainforests with mud wallows and plenty of water, showing a preference for low-lying sites (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Rhinoceros sondaicus feeds for the most part by browsing. In addition to this, the Javan rhinoceros is known to graze upon leaves, young shoots, twigs and fruit.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
21.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Observations: In the wild, these animals are estimated to live up to 40 years (Bernhard Grzimek 1990). They have lived over 20 years in captivity (Richard Weigl 2005), but because only a few animals remain little is known about their longevity.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The female Javan rhinoceros reaches sexual maturity at three to four years of age, while males reach maturity after six years. The gestation period is sixteen months, and the interval between births is four to five years. One rhinoceros is born at a time. A young rhino will be active shortly after birth, and will be suckled by its mother for one to two years. Thirty-five to forty years is the average lifespan of Javan rhinoceroses.

Average gestation period: 502 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (female)

Sex: female:
1278 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinoceros sondaicus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA2229-09|NC_012683|Rhinoceros sondaicus| AACCGCTGACTATTTTCAACCAACCACAAAGACATTGGCACTCTATATCTGCTATTTGGTGCCTGAGCTGGAATAGTAGGAACCGCCCTA---AGCCTTCTAATTCGCGCTGAATTAGGTCAGCCCGGGACCTTACTAGGAGAT---GATCAGATCTACAATGTAATTGTGACTGCCCATGCATTTGTAATAATTTTCTTTATAGTTATGCCCATTATAATTGGAGGGTTCGGAAACTGATTGGTCCCACTAATA---ATTGGAGCACCTGACATAGCATTCCCCCGAATAAACAATATAAGCTTCTGACTCTTATCACCATCATTTCTTCTTCTACTTGCATCATCAATGGTCGAAGCCGGTGCCGGAACAGGATGGACTGTCTACCCTCCCCTAGCTGGCAATCTAGCCCATGCAGGAGCTTCTATTAACCTA---ACTATCTTTTCCCTGCACTTAGCAGGGGTGTCCTCAATTTTAGGGGCCATTAACTTTATCACTACAATTATCAATATAAAACCACCGGCCATGTCCCAATACCAAACACCTCTATTCGTATGATCCGTCCTAATTACAGCAGTGCTCCTGTTATTAGCACTCCCAGTCCTAGCAGCG---GGAATTACTATATTACTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCAGCGGGGGGAGGTGACCCTATCCTATACCAACATCTCTTCTGATTCTTTGGCCACCCCGAAGTATACATCCTGATCCTACCAGGCTTTGGGATAATCTCACATATTGTTACATACTATTCAGGAAAAAAA---GAACCATTTGGTTATATAGGGATGGTATGAGCTATGATATCCATCGGATTCTTAGGATTCATTGTATGAGCCCACCACATATTTACAATCGGCATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Rhinoceros sondaicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 2
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
C2a(i);D

Version
3.1

Year Assessed
2008

Assessor/s
van Strien, N.J., Steinmetz, R., Manullang, B., Sectionov, Han, K.H., Isnan, W., Rookmaaker, K., Sumardja, E., Khan, M.K.M. & Ellis, S.

Reviewer/s
van Strien, N.J. & Talukdar, B.K. (Asian Rhino Red List Authority)

Contributor/s

Justification
This species is listed as Critically Endangered because there are less than 50 mature individuals; and because there fewer than 250 mature individuals, with no subpopulation greater than 50 individuals, and it is experiencing a continuing decline.

History
  • 1996
    Critically Endangered
  • 1994
    Endangered
    (Groombridge 1994)
  • 1990
    Endangered
    (IUCN 1990)
  • 1988
    Endangered
    (IUCN Conservation Monitoring Centre 1988)
  • 1986
    Endangered
    (IUCN Conservation Monitoring Centre 1986)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

The Javan rhinoceros is one of the most endangered species of the rhinoceros family (along with the Sumatran rhinoceros), and one of the rarest large mammals in the world. Following the Vietnam war, Rhinocerous sondaicus was thought to be extinct in Vietnam. Agent Orange, land mines, and general warfare decimated the rhinocerous population. Only recently was the Javan rhinocerous spotted in the area. With such a small population however, the prospects for survival are not good. Although the land on which they live is currently protected, there is pressure to use the land for agricultural purposes. In addition, it is not known how many of the 7 to 15 rhinos are females. If there are only 1 or 2 females, their death could mean the end of the species in Vietnam. Also, with so few animals, the likelihood of inbreeding is great. Inbreeding is known to increase the likelihood of birth defect or disease. Those Javan rhinoceroses residing in Indonesia are fortunate to have a slightly larger population. However, should an environmental catastrophe (such as a forest fire) or disease affect the population, dire consequences could result.

US Federal List: endangered

CITES: appendix i

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 06/02/1970
Lead Region: Foreign (Region 10) 
Where Listed:


Population detail:

Population location: entire
Listing status: E

For most current information and documents related to the conservation status and management of Rhinoceros sondaicus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) by the IUCN Red List 2007 (1), and listed under Appendix I of CITES (3). Subspecies: the Vietnamese Javan rhinoceros (Rhinoceros sondaicus annamiticus) and the Indonesian Javan rhinoceros (R. s. sondaicus) are both classified as Critically Endangered (CR) (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
An estimated 40-60 animals live in the area on the western tip of Java in Ujung Kulon National Park. Another smaller population occurs in and around the Cat Loc part (Dong Nai province) of the Cat Tien National Park in of Viet Nam, with maybe as few as six individuals remaining (R. Steinmetz, M. Khan bin Momin Khan pers. comm.). These populations have not significantly declined over the last few decades, and the current trend is not known (Sectionov and Waladi pers. comm.), but no breeding has been observed in the Cat Loc population for many years (M. Khan bin Momin Khan pers. comm.). There are no animals currently in captivity, and a total of only 22 individuals have ever been known to exist in captivity (Rookmaaker et al., 1998).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
The cause of population decline is mainly attributable to the excessive demand for rhino horn and other products for Chinese and allied medicine systems (Foose and van Strien 1997). The bulk of the remaining population occurs as a single population within a national park and the population size in Ujung Kulon National Park is probably limited to the effective carrying capacity of the area (around 50 animals). One possible threat to this population is disease. In addition, such a small population faces a constant threat from poachers, although there is evidence that current poaching levels are under control (Sectionov and Waladi pers. comm.). The Cat Loc population may be too small to be viable, and no breeding has been observed for many years, and it is possible that the animals are too old to breed. The population is so small that all the animals could be of the same sex.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

The devastating decline the Javan rhinocerous has been largely attributed to hunting for its horn, and for other body parts which are used in traditional Chinese medicine (6). In addition, habitat loss resulting from logging activities and development has impacted the species, and the two critically small populations are also exceptionally vulnerable to disease and natural disasters, both of which could wipe out an entire population (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is legally protected in all range states. The species has been on CITES Appendix I since 1975.

A Rhino Protection Unit (RPU) has been established for the protection of this species on Java (Sectionov and Waladi pers. comm.). It occurs in two protected areas: Ujung Kulon National Park on Java and the Cat Loc part (Dong Nai province) of the Cat Tien National Park in Viet Nam.

There is an urgent need to review the feasibility of a reintroduction/translocation program, since the only known viable population occurs in a geographically restricted area of Java. There is also a need to survey parts of its historical range for the very remote possibility that small remnant populations exist, especially in parts of Lao PDR or Cambodia. The population in Cat Loc is probably no longer viable, and requires intensive management measures in order to survive (perhaps including captive breeding and re-introductions).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In Indonesia, the Javan rhino has been legally protected since 1931, and Ujung Kulon National Park was set aside for the conservation of this species. The protected area in which the Vietnamese Javan rhinoceros occurs, (previously known as the Cat Loc Nature Reserve), was, for many years, ineffectively protected (6), but since the Cat Loc area was integrated into the Cat Tien National Park in 1998, more forest guards have been deployed, and the conservation organisation WWF has been supporting these teams with better equipment and allowances (7). In 1998, WWF also launched the Asian Rhino and Elephant Action Strategy (AREAS), which specifically tackles the issue of habitat loss (7). A Status Survey and Conservation Action Plan for Asian rhinos, published in 1997 by the World Conservation Union (IUCN) Asian Rhino Specialist Group, suggests that the possibility of moving some of the rhinos into another area should be looked into (6). This would help lessen the chance of disease or a natural disaster affecting all individuals simultaneously. The action plan also suggests that bringing some of the rhinos into a managed, breeding sanctuary should be considered (6). With so few Javan rhinoceros remaining however, some conservationists are worried that these measures may be too late to save this rare species, teetering on the brink of extinction.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Many people in the Javan rhinoceros' homelands, especially Vietnam, would like to see the land upon which the rhino lives cleared for agricultural purposes. As long as governments protect these lands, agriculture can not occur here.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eastern Asian medicine views rhino horns as an important, if not essential part, of medicine. Sixty percent of Eastern Asian doctors stock rhino horn, with Asian horns being perferred over their African counterparts. In this part of the world, one kilogram of rhino horn sells for approximately $60,000. The tribal people of Vietnam are also known to poach the rhinoceros for meat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Javan rhinoceros

The Javan rhinoceros (Sunda rhinoceros to be more precise) or lesser one-horned rhinoceros (Rhinoceros sondaicus) is a member of the family Rhinocerotidae and one of five extant rhinoceroses. It belongs to the same genus as the Indian rhinoceros, and has similar mosaicked skin which resembles armor, but at 3.1–3.2 m (10–10.5 feet) in length and 1.4–1.7 m (4.6–5.8 ft) in height, it is smaller. (In fact, it is closer in size to the black rhinoceros of the genus Diceros.) Its horn is usually less than 25 cm (10 inches), smaller than those of the other rhino species.

Once the most widespread of Asian rhinoceroses, the Javan rhinoceros ranged from the islands of Java and Sumatra, throughout Southeast Asia, and into India and China. The species is critically endangered, with only one known population in the wild, and no individuals in captivity. It is possibly the rarest large mammal on earth,[5]:21 with a population of as few as 40 in Ujung Kulon National Park on Java in Indonesia. A second population in Cat Tien National Park in Vietnam was confirmed as extinct in 2011.[6] The decline of the Javan rhinoceros is attributed to poaching, primarily for their horns, which are highly valued in traditional Chinese medicine, fetching as much as $30,000 per kilogram on the black market.[5]:31 Loss of habitat, especially as the result of wars, such as the Vietnam War, in Southeast Asia, has also contributed to the species's decline and hindered recovery.[7] The remaining range is within one nationally protected area, but the rhinos are still at risk from poachers, disease and loss of genetic diversity leading to inbreeding depression.

The Javan rhino can live approximately 30–45 years in the wild. It historically inhabited lowland rain forest, wet grasslands and large floodplains. The Javan rhino is mostly solitary, except for courtship and child-rearing, though groups may occasionally congregate near wallows and salt licks. Aside from humans, adults have no predators in their range. The Javan rhino usually avoids humans, but will attack when it feels threatened. Scientists and conservationists rarely study the animals directly due to their extreme rarity and the danger of interfering with such an endangered species. Researchers rely on camera traps and fecal samples to gauge health and behavior. Consequently, the Javan rhino is the least studied of all rhino species. Two adult rhinos with their calves were filmed in a motion-triggered video released on February 28, 2011 by WWF and Indonesia's National Park Authority, which proved that it is still breeding in the wild.[8] In April 2012, the National Parks Authority released video showing 35 individual Javan Rhinos, including offspring.[9]

Contents

Taxonomy and naming

Type specimen of the extinct R. s. inermis

The first studies of the Javan rhinoceros by naturalists from outside of its region took place in 1787 when two animals were shot in Java. The skulls were sent to the renowned Dutch naturalist Petrus Camper, who died in 1789 before he was able to publish his discovery that the rhinos of Java were a distinct species. Another Javan rhinoceros was shot on the island of Sumatra by Alfred Duvaucel who sent the specimen to his stepfather Georges Cuvier, a famous French scientist. Cuvier recognized the animal as a distinct species in 1822, and in the same year it was identified by Anselme Gaëtan Desmarest as Rhinoceros sondaicus. It was the last species of rhinoceros to be identified.[10] Desmarest initially identified the rhino as being from Sumatra, but later amended this to say his specimen was from Java.[3]

The genus name Rhinoceros, which also includes the Indian rhinoceros, is derived from Greek: rhino meaning nose, and ceros meaning horn; sondaicus is derived from sunda, the biogeographical region that comprises islands of Sumatra, Java, Borneo, and surrounding smaller islands. The Javan rhino is also known as the lesser one-horned rhinoceros (in contrast with the greater one-horned rhinoceros, another name for the Indian rhino).

There are three distinct subspecies, of which only one is still extant:

  • Rhinoceros sondaicus sondaicus, the type subspecies, known as the Indonesian Javan rhinoceros, once lived on Java and Sumatra. The population is now confined to as few as 40 animals in the wild, Ujung Kulon National Park on the western tip of the island of Java. One researcher has suggested that the Javan rhino on Sumatra belonged to a distinct subspecies, R.s. floweri, but this is not widely accepted.[2][11]
  • Rhinoceros sondaicus annamiticus, known as the Vietnamese Javan rhinoceros or Vietnamese rhinoceros, once lived across Vietnam, Cambodia, Laos and into Thailand and Malaysia. Annamiticus is derived from the Annamite Mountain Range in Southeast Asia, part of this subspecies's range. In 2006, a single population, estimated at fewer than 12 remaining rhinos, lived in an area of lowland forest in the Cat Tien National Park in Vietnam. Genetic analysis suggested that the this subspecies and the Indonesian Javan rhinoceros last shared a common ancestor between 300,000 and 2 million years ago.[11][2] The last individual of this population was shot by a poacher in 2010.[12]
  • Rhinoceros sondaicus inermis, known as the Indian Javan rhinoceros, once ranged from Bengal to Burma, but is presumed to have gone extinct before 1925.[13] Inermis means unarmed, as the most distinctive characteristic of this sub-species is the small horns in males, and evident lack of horns in females. The original specimen of this species was a hornless female. The political situation in Burma has prevented assessment of the species in that country, but its survival is considered unlikely.[14][15][16]

Evolution

The Indian rhinoceros pictured here is closely related to the Javan rhinoceros; they are the two members of the type genus Rhinoceros.

Ancestral rhinoceroses first diverged from other Perissodactyls in the Early Eocene. Mitochondrial DNA comparison suggests that the ancestors of modern rhinos split from the ancestors of Equidae around 50 million years ago.[17] The extant family, the Rhinocerotidae, first appeared in the Late Eocene in Eurasia, and the ancestors of the extant rhino species dispersed from Asia beginning in the Miocene.[18]

The Indian and Javan rhinoceros, the only members of the genus Rhinoceros, first appear in the fossil record in Asia around 1.6 million–3.3 million years ago. Molecular estimates, however, suggest the species may have diverged much earlier, around 11.7 million years ago.[17][19] Although belonging to the type genus, the Indian and Javan rhinoceros are not believed to be closely related to other rhino species. Different studies have hypothesized that they may be closely related to the extinct Gaindetherium or Punjabitherium. A detailed cladistic analysis of the Rhinocerotidae placed Rhinoceros and the extinct Punjabitherium in a clade with Dicerorhinus, the Sumatran Rhino. Other studies have suggested the Sumatran Rhinoceros is more closely related to the two African species.[20] The Sumatran Rhino may have diverged from the other Asian rhinos as far back as 15 million years ago.[18]

Description

Head of a specimen shot in 1934

The Javan rhino is smaller than its cousin, the Indian rhinoceros, and is close in size to the black rhinoceros. The body length of the Javan rhino (including its head) can be up to 2 to 4 m (6.6 to 13 ft), and it can reach a height of 1.4–1.7 m (4.6–5.8 ft). Adults are variously reported to weigh between 900 and 2,300 kg (2,000 and 5,100 lb), although because they are endangered, a study to collect accurate measurements of the animals has never been conducted and is not a priority.[21] There is not a substantial size difference between genders, but females may be slightly bigger. The rhinos in Vietnam appeared to be significantly smaller than those in Java, based on studies of photographic evidence and measurements of their footprints.[22]

Like its Indian cousin, the Javan rhinoceros has a single horn (the other extant species have two horns). Its horn is the smallest of all extant rhinos, usually less than 20 cm (7.9 inches) with the longest recorded only 27 cm (10½ in). The Javan rhinoceros does not appear to often use its horn for fighting, but instead uses it to scrape mud away in wallows, to pull down plants for eating, and to open paths through thick vegetation. Similar to the other browsing species of rhino (the black, Sumatran and Indian rhinoceroses), the Javan rhino has long, pointed, upper lips which help in grabbing food. Its lower incisors are long and sharp; when the Javan rhino fights it uses these teeth. Behind the incisors, two rows of six low-crowned molars are used for chewing coarse plants. Like all rhinos, the Javan rhino smells and hears well but has very poor vision. They are estimated to live for 30 to 45 years.[22]

Its hairless, splotchy gray or gray-brown skin falls in folds to the shoulder, back and rump. The skin has a natural mosaic pattern which lends the rhino an armored appearance. The neck folds of the Javan rhinoceros are smaller than those of the Indian rhinoceros, but still form a saddle shape over the shoulder. Because of the risks of interfering with such an endangered species, however, the Javan rhinoceros is primarily studied through fecal sampling and camera traps. They are rarely encountered, observed or measured directly.[23]

Distribution and habitat

Java's Ujung Kulon National Park is the home of all remaining Javan rhinos.

Even the most optimistic estimate suggests there are fewer than 100 Javan rhinos in the wild. They are considered one of the most endangered species in the world.[24] The Javan rhinoceros is known to survive in only one place, the Ujung Kulon National Park on the western tip of Java.[11][25]

The animal was once widespread from Assam and Bengal (where their range would have overlapped with both the Sumatran and Indian rhinos[16]) eastward to Myanmar, Thailand, Cambodia, Laos, Vietnam, and southwards to the Malay Peninsula and the islands of Sumatra, Java and possibly Borneo.[26] The Javan rhino primarily inhabits dense lowland rain forests, tall grass and reed beds that are plentiful with rivers, large floodplains, or wet areas with many mud wallows. Although it historically preferred low-lying areas, the subspecies in Vietnam has been pushed onto much higher ground (up to 2,000 m or 6,561 ft), probably because of human encroachment and poaching.[14]

The range of the Javan rhinoceros has been shrinking for at least 3,000 years. Starting around 1000 BC, the northern range of the rhinoceros extended into China, but began moving southward at roughly 0.5 km (0.31 mi) per year, as human settlements increased in the region.[27] It likely became locally extinct in India in the first decade of the 20th century.[16] The Javan rhino was hunted to extinction on the Malaysian peninsula by 1932.[28] By the end of the Vietnam War, the Vietnamese Rhinoceros was believed extinct across all of mainland Asia. Local hunters and woodcutters in Cambodia claim to have seen Javan rhinos in the Cardamom Mountains, but surveys of the area have failed to find any evidence of them.[29] In the late 1980s a small population was found in the Cat Tien area of Vietnam. However, the last individual was shot in 2010.[30] A population may have existed on the island of Borneo as well, though these specimens could have been the Sumatran Rhinoceros, a small population of which still lives there.[26]

Behavior

A museum specimen of a juvenile R. s. sondaicus

The Javan rhinoceros is a solitary animal with the exception of breeding pairs and mothers with calves. They will sometimes congregate in small groups at salt licks and mud wallows. Wallowing in mud is a common behavior for all rhinos; the activity allows them to maintain a cool body temperature and helps prevent disease and parasite infestation. The Javan rhinoceros does not generally dig its own mud wallows, preferring to use other animals' wallows or naturally occurring pits, which it will use its horn to enlarge. Salt licks are also very important because of the essential nutrients the rhino receives from the salt. Male home ranges are larger at 12–20 km² (5–8 miles²) compared to the female, which are around 3–14 km² (1–5 mi²). Male territories overlap each other less than those of the female. It is not known if there are territorial fights.[31]

Males mark their territory with dung piles and by urine spraying. Scrapes made by the feet in the ground and twisted saplings also seem to be used for communication. Members of other rhino species have a peculiar habit of defecating in massive rhino dung piles and then scraping their back feet in the dung. The Sumatran and Javan rhinoceros, while defecating in piles, do not engage in the scraping. This adaptation in behavior is thought to be ecological; in the wet forests of Java and Sumatra, the method may not be useful for spreading odors.[31]

The Javan rhino is much less vocal than the Sumatran; very few Javan rhino vocalizations have ever been recorded. Adult Javan rhinos have no known predators other than humans. The species, particularly in Vietnam, is skittish and retreats into dense forests whenever humans are near. Though a valuable trait from a survival standpoint, it has made the rhinos difficult to study.[7] Nevertheless, when humans approach too closely, the Javan rhino becomes aggressive and will attack, stabbing with the incisors of its lower jaw while thrusting upward with its head.[31] Its comparatively anti-social behavior may be a recent adaptation to population stresses; historical evidence suggests that, like other rhinos, the species was once more gregarious.[11]

Diet

The Javan rhinoceros is herbivorous and eats diverse plant species, especially their shoots, twigs, young foliage and fallen fruit. Most of the plants favored by the species grow in sunny areas: in forest clearings, shrubland and other vegetation types with no large trees. The rhino knocks down saplings to reach its food and grabs it with its prehensile upper lip. It is the most adaptable feeder of all the rhino species. Currently it is a pure browser but probably once both browsed and grazed in its historical range. The rhino eats an estimated 50 kg (110 lb) of food daily. Like the Sumatran Rhino, it needs salt in its diet. The salt licks common in its historical range do not exist in Ujung Kulon, but the rhinos there have been observed drinking seawater, likely for the same nutritional need.[31]

Conservation

A painting from 1861 depicts the hunting of R. s. sondaicus

The main factor in the continued decline of the Javan rhinoceros population has been poaching for horns, a problem that affects all rhino species. The horns have been a traded commodity in China for over 2,000 years where they are believed to have healing properties in Traditional Chinese Medicine. Historically, its hide was used to make armor for Chinese soldiers and some local tribes in Vietnam believed the hide can be used to make an antidote for snake venom.[32] Because the rhinoceros's range encompasses many areas of poverty, it has been difficult to convince local people not to kill a seemingly useless animal which could be sold for a large sum of money.[27] When the Convention on International Trade in Endangered Species of Wild Fauna and Flora first went into effect in 1975, the Javan rhinoceros was placed under complete Appendix 1 protection: all international trade in the Javan rhinoceros and products derived from it is illegal.[33] Surveys of the rhinoceros horn black market have determined that Asian rhinoceros horn fetches a price as high as $30,000 per kilogram, three times the value of African rhinoceros horn.[5]:31

Loss of habitat because of agriculture has also contributed to its decline, though this is no longer as significant a factor because the rhinoceros only lives in one nationally protected park. Deteriorating habitats have hindered the recovery of rhino populations that fell victim to poaching. Even with all the conservation efforts, the prospects for the Javan rhinoceros's survival are grim. Because the population is restricted to one small area, they are very susceptible to disease and the problems of inbreeding. Conservation geneticists estimate that a population of 100 rhinos would be needed to preserve the genetic diversity of this conservation reliant species.[25]

Ujung Kulon

A Dutch hunter with a dead R. s. sondaicus in Ujung Kulon, 1895

The Ujung Kulon peninsula was devastated by the eruption of Krakatoa in 1883. The Javan rhinoceros recolonized the peninsula after the explosion, but humans never returned in large numbers, thus creating a haven.[25] In 1931, as the Javan rhinoceros was on the brink of extinction in Sumatra, the government of the Dutch Indies declared the rhino a legally protected species, which it has remained ever since.[14] In 1967 when a census was first conducted of the rhinos in Ujung Kulon, only 25 animals were recorded. By 1980 that population had doubled, and has remained steady at about 50 ever since. Although the rhinos in Ujung Kulon have no natural predators, they have to compete for scarce resources with wild cattle which may keep the rhino's numbers below the peninsula's carrying capacity.[34] Ujung Kulon is managed by the Indonesian Ministry of Forestry.[14] Evidence of at least four baby rhinos was discovered in 2006, the most ever documented for the species.[35]

In March 2011, hidden-camera video was published showing adults and juveniles, indicating recent matings and breeding.[36] During the period from January to October 2011 the cameras had captured images of 35 rhinos. As of December 2011 a rhino breeding sanctuary in an area of 38,000 hectares is being finalized to help reaching the target of 70 to 80 Javan rhinos by 2015.[37]

In April 2012, the WWF and International Rhino Foundation have placed 120 additional video cameras to the existing 40 to monitor better rhinos movements and judge the size of the animal's population. A latest survey has found far fewer females than males. There were only 4 females among 17 rhinos recorded in the eastern half of Ujung Kulon which it makes a potential setback in efforts to save the species.[38]

Cat Tien

Once widespread in Southeast Asia, the Javan rhinoceros was presumed extinct in Vietnam in the mid-1970s, at the end of the Vietnam War. The tactics used in the combat wrought havoc on the ecosystems of the region: use of napalm, extensive defoliation from Agent Orange, aerial bombing and use of landmines. The war also flooded the area with inexpensive weapons. After the war, many poor villagers, who previously relied on methods like pit traps, now had deadly weapons at their disposal, enabling them to become efficient poachers.

Head of a male R. s. annamiticus shot in Perak on the Malay Peninsula

In 1988 the assumption of the subspecies extinction was challenged when a hunter shot an adult female, proving the species had somehow survived the war. In 1989, scientists surveyed Vietnam's southern forests to search for evidence of other survivors. Fresh rhinoceros tracks belonging to at least 15 rhinos were found along the Dong Nai River.[39] Largely because of the rhinoceros, the region they inhabited became part of the Cat Tien National Park in 1992.[32]

By early 2000s, their population was feared to have declined past the point of recovery in Vietnam, with some conservationists estimating that as few as 3–8 rhinos, and possibly no males, survived.[25][35] Conservationists debated whether or not the Vietnamese Rhinoceros had any chance of survival, with some arguing that rhinos from Indonesia should be introduced in an attempt to save the population, with others arguing that the population could recover.[7][40]

Genetic analysis of dung samples collected in Cat Tien National Park in a survey from October 2009 to March 2010 showed that only a single individual Javan rhinoceros remained in the park. In early May 2010, the body of a Javan rhinos was found in the Park. The animal had been shot and its horn removed by poachers.[41] In October 2011 the International Rhino Foundation confirmed that the Javan rhinoceros was extinct in Vietnam, leaving only the rhinos in Ujung Kulon.[12][42] [30]

In captivity

Captive Javan rhino, around 1900

A Javan rhinoceros has not been exhibited in zoos in a century. In the 19th century, at least four rhinos were exhibited in Adelaide, Calcutta and London. A total of at least 22 Javan rhinos have been documented as having been kept in captivity, and it is possible that the number is greater as the species was sometimes confused with the Indian rhinoceros.[43]

The Javan rhinoceros never fared well in captivity. The oldest lived to be 20, about half the age the rhinos will reach in the wild. The last captive Javan rhino died at the Adelaide Zoo in Australia in 1907 where the species was so little known that it had been exhibited as an Indian rhinoceros.[22] Because a lengthy and expensive program in the 1980s and 1990s to breed the Sumatran Rhinoceros (Dicerorhinus sumatrensis) in zoos failed badly, attempts to preserve the Javan species in zoos are unlikely.

References

  1. ^ Grubb, Peter (16 November 2005). "Order Perissodactyla (pp. 629-636)". In Wilson, Don E., and Reeder, DeeAnn M., eds. Mammal Species of the World: A Taxonomic and Geographic Reference (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). p. 636. ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14100067. 
  2. ^ a b c van Strien, N.J., Steinmetz, R., Manullang, B., Sectionov, Han, K.H., Isnan, W., Rookmaaker, K., Sumardja, E., Khan, M.K.M. & Ellis, S. (2008). Rhinoceros sondaicus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 28 November 2008.
  3. ^ a b Rookmaaker, L.C. (1982). "The type locality of the Javan Rhinoceros (Rhinoceros sondaicus Desmarest, 1822)". Zeitschrift fur Saugetierkunde 47 (6): 381–382. http://www.rhinoresourcecenter.com/pdf_files/117/1175861997.pdf. 
  4. ^ Map derived from range map in Foose and Van Strien (1997). This map does not include the possible population in Borneo described by Cranbook and Piper (2007).
  5. ^ a b c Dinerstein, Eric (2003). The Return of the Unicorns; The Natural History and Conservation of the Greater One-Horned Rhinoceros. New York: Columbia University Press. ISBN 0-231-08450-1. 
  6. ^ Kinver, Mark (25 October 2011). "Javan rhino 'now extinct in Vietnam'". BBC News. http://www.bbc.co.uk/news/science-environment-15430787. Retrieved 25 October 2011. 
  7. ^ a b c Santiapillai, C. (1992). "Javan rhinoceros in Vietnam". Pachyderm 15: 25–27. 
  8. ^ WWF – Critically Endangered Javan Rhinos and Calves Captured on Video. Wwf.panda.org. Retrieved on 2012-02-24.
  9. ^ New video documents nearly all the world's remaining Javan rhinos. Mongabay.com. Retrieved on 2012-05-01.
  10. ^ Rookmaaker, Kees (2005). "First sightings of Asian rhinos". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. p. 52. 
  11. ^ a b c d Fernando, Prithiviraj; Gert Polet, Nazir Foead, Linda S. Ng, Jennifer Pastorini, and Don J. Melnick (June 2006). "Genetic diversity, phylogeny and conservation of the Javan rhinoceros (Rhinoceros sondaicus)". Conservation Genetics 7 (3): 439–448. doi:10.1007/s10592-006-9139-4. 
  12. ^ a b Gersmann, Hanna (25 October 2011). "Javan rhino driven to extinction in Vietnam, conservationists say". The Guardian. http://www.guardian.co.uk/environment/2011/oct/25/javan-rhino-extinct-vietnam. Retrieved 25 October 2011. 
  13. ^ Old Rhino Accounts in Sundarbans. Scribd.com (2009-09-02). Retrieved on 2012-02-24.
  14. ^ a b c d Foose, Thomas J.; Nico van Strien (1997). Asian Rhinos – Status Survey and Conservation Action Plan. IUCN, Gland, Switzerland, and Cambridge, UK. ISBN 2-8317-0336-0. 
  15. ^ Rookmaaker, Kees (1997). "Records of the Sundarbans Rhinoceros (Rhinoceros sondaicus inermis) in India and Bangladesh". Pachyderm 24: 37–45. http://www.rhinoresourcecenter.com/index.php?s=1&act=refs&CODE=ref_detail&id=1165240038. 
  16. ^ a b c Rookmaaker, L.C. (June 2002). "Historical records of the Javan rhinoceros in North-East India". Newsletter of the Rhino Foundation of Nature in North-East India (4): 11–12. http://www.rhinoresourcecenter.com/index.php?s=1&act=refs&CODE=ref_detail&id=1165234485. 
  17. ^ a b Xu, Xiufeng; Axel Janke, and Ulfur Arnason (1 November 1996). "The Complete Mitochondrial DNA Sequence of the Greater Indian Rhinoceros, Rhinoceros unicornis, and the Phylogenetic Relationship Among Carnivora, Perissodactyla, and Artiodactyla (+ Cetacea)". Molecular Biology and Evolution 13 (9): 1167–1173. PMID 8896369. http://mbe.oxfordjournals.org/cgi/reprint/13/9/1167. Retrieved 2007-11-04. 
  18. ^ a b Lacombat, Frédéric (2005). "The evolution of the rhinoceros". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. pp. 46–49. 
  19. ^ Tougard, C.; T. Delefosse, C. Hoenni, and C. Montgelard (2001). "Phylogenetic relationships of the five extant rhinoceros species (Rhinocerotidae, Perissodactyla) based on mitochondrial cytochrome b and 12s rRNA genes". Molecular Phylogenetics and Evolution 19 (1): 34–44. doi:10.1006/mpev.2000.0903. PMID 11286489. http://www.ibiologia.unam.mx/pdf/directorio/c/cervantes/clases/masto/phylogeneticRelationships.pdf. 
  20. ^ Cerdeño, Esperanza (1995). "Cladistic Analysis of the Family Rhinocerotidae (Perissodactyla)" (PDF). Novitates (American Museum of Natural History) (3143). ISSN 0003-0082. http://digitallibrary.amnh.org/dspace/bitstream/2246/3566/1/N3143.pdf. Retrieved 2007-11-04. 
  21. ^ images and movies of the Javan Rhinoceros (Rhinoceros sondaicus), ARKive
  22. ^ a b c van Strien, Nico (2005). "Javan Rhinoceros". In Fulconis, R.. Save the rhinos: EAZA Rhino Campaign 2005/6. London: European Association of Zoos and Aquaria. pp. 75–79. 
  23. ^ Munro, Margaret (May 10, 2002). "Their trail is warm: Scientists are studying elusive rhinos by analyzing their feces". National Post. 
  24. ^ "Top 10 most endangered species in the world". Daily Telegraph. 4 January 2010. http://www.telegraph.co.uk/earth/wildlife/6927330/Top-10-most-endangered-species-in-the-world.html. Retrieved 19 March 2012. 
  25. ^ a b c d Derr, Mark (July 11, 2006). "Racing to Know the Rarest of Rhinos, Before It's Too Late". The New York Times. http://www.nytimes.com/2006/07/11/science/11rhin.html. Retrieved 2007-10-14. 
  26. ^ a b Cranbook, Earl of; Philip J. Piper (2007). "The Javan Rhinoceros Rhinoceros Sondaicus in Borneo" (PDF). The Raffles Bulletin of Zoology (University of Singapore) 55 (1): 217–220. http://rmbr.nus.edu.sg/rbz/biblio/55/55rbz217-220.pdf. Retrieved 2007-11-04. 
  27. ^ a b Corlett, Richard T. (2007). "The Impact of Hunting on the Mammalian Fauna of Tropical Asian Forests". Biotropica 39 (3): 202–303. doi:10.1111/j.1744-7429.2007.00271.x. 
  28. ^ Ismail, Faezah (June 9, 1998). "On the horns of a dilemma". New Straits Times. 
  29. ^ Daltry, J.C.; F. Momberg (2000). Cardamom Mountains biodiversity survey. Cambridge: Fauna and Flora International. 
  30. ^ a b WWF – Inadequate protection causes Javan rhino extinction in Vietnam. Wwf.panda.org (2011-10-25). Retrieved on 2012-02-24.
  31. ^ a b c d Hutchins, M.; M.D. Kreger (2006). "Rhinoceros behaviour: implications for captive management and conservation". International Zoo Yearbook (Zoological Society of London) 40 (1): 150–173. doi:10.1111/j.1748-1090.2006.00150.x. 
  32. ^ a b Stanley, Bruce (June 22, 1993). "Scientists Find Surviving Members of Rhino Species". Associated Press. 
  33. ^ Emslie, R.; M. Brooks (1999). African Rhino. Status Survey and Conservation Action Plan. IUCN/SSC African Rhino Specialist Group. IUCN, Gland, Switzerland and Cambridge, UK. ISBN 2-8317-0502-9. 
  34. ^ Dursin, Richel (January 16, 2001). "Environment-Indonesia: Javan Rhinoceros Remains At High Risk". Inter Press Service. 
  35. ^ a b Williamson, Lucy (September 1, 2006). "Baby boom for near-extinct rhino". BBC News. http://news.bbc.co.uk/2/hi/asia-pacific/5305906.stm. Retrieved 2007-10-16. 
  36. ^ Rare rhinos captured on camera in Indonesia, video, ABC News Online, 1 March 2011 (Expires: 30 May 2011)
  37. ^ Cameras show 35 rare rhinos in Indonesia: official, December 30 2011
  38. ^ "Cameras Used to Help Save Endangered Javan Rhino". April 17, 2012. http://www.thejakartaglobe.com/home/cameras-used-to-help-save-endangered-javan-rhino/511876. 
  39. ^ Raeburn, Paul (April 24, 1989). "World's Rarest Rhinos Found In War-Ravaged Region of Vietnam". Associated Press. 
  40. ^ "Javan Rhinoceros; Rare, mysterious, and highly threatened". World Wildlife Fund. March 28, 2007. http://www.panda.org/about_wwf/what_we_do/species/about_species/species_factsheets/rhinoceros/asian_rhinos/javan_rhinoceros/index.cfm. Retrieved 2007-11-04. 
  41. ^ "Rare Javan rhino found dead in Vietnam". http://wwf.panda.org/wwf_news/?193168/Rare-Javan-rhino-found-dead-in-Vietnam.  WWF, 10 May 2010
  42. ^ Kinver, Mark (2011-10-24). "Javan rhino 'now extinct in Vietnam'". BBC News. http://www.bbc.co.uk/news/science-environment-15430787. Retrieved 2011-10-24. 
  43. ^ Rookmaaker, L.C. (2005). "A Javan rhinoceros, Rhinoceros sondaicus, in Bali in 1839". Zoologische Garten 75 (2): 129–131. http://www.rhinoresourcecenter.com/index.php?s=1&act=refs&CODE=ref_detail&id=1165244644. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!