Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Distribution

Range Description

The Lesser Oriental Chevrotain as defined here occurs in Borneo, Sumatra, the Thai–Malay Peninsula, many islands within the Greater Sunda region, and continental South east Asia north to at least 18°10′N, as established through Lao PDR specimens from Thangon (Osgood 1932; Chasen 1940; Meijaard 2003; Meijaard and Groves 2004; E. Meijaard pers. comm. 2004). This includes the countries of Indonesia, Malaysia, Brunei, Singapore, Myanmar, Thailand, Cambodia, Lao PDR, and Viet Nam.

Grubb (2005) also included China, but the occurrence there of T. kanchil is not confirmed, reflecting the difficulty of separation from T. williamsoni. Records from Yunnan Province seem on present evidence likely at least to include T. williamsoni (E. Meijaard pers. comm. 2008) but the additional occurrence of T. kanchil cannot be ruled out. Similarly, records in Viet Nam north to ca 22ºN (Dang Huy Hyunh 1994) and in the west part of Lao PDR’s northern highlands (e.g. Johnson et al. 2003; 21°N), could refer to T. kanchil or to T. williamsoni, or to a mix. It is unclear if there are chevrotains at all in the central and eastern parts of Lao PDR’s northern highlands. The record of chevrotain signs in Evans et al. (2000) for Phou Dendin NPA, far north-eastern Lao PDR and outside the interview derived range as shown in Duckworth et al. (1999: 269), was by a relatively inexperienced observer and upon recent re-examination of his original notes, he has retracted the record, since confusion with muntjac fawn was possible (W.G. Robichaud pers. comm. 2008). More telling, during interviews by the same observer in the same area in 2004–2005, villagers commonly reported that while they knew what a chevrotain ("kai", or "fan kai") is, most said they are essentially absent from the area (including the southern sector), and always have been. But whether they are truly absent or only rare differed somewhat with informants (W.G. Robichaud pers. comm. 2008). Likewise, the northern extent of T. kanchil in Thailand remains unclear. No species of chevrotain appears to penetrate Myanmar away from Tennaserim (Tun Yin 1967; Lynam 2003; in the latter, identifications to species should be disregarded). Well outside the confirmed range of the genus, Khan (1985) speculated that Lesser Oriental Chevrotain might occur in Bangladesh: "over a hundred villagers, whom I have interviewed have said they have either seen, killed or eaten such an animal". But he could procure no physical evidence for this, and none has been traced subsequently (Md Anwarul Islam pers. comm. 2008).

A recent taxonomic revision of chevrotains (Meijaard and Groves 2004), followed here, attaches a slight doubt to assume that any records, other than those validated through examination of specimens, from non-Sundaic South-east Asia, certainly refer to this species; as well as T. williamsoni (of at least northern Thailand, but perhaps with a much wider range) there is also T. versicolor of South-east Viet Nam, also perhaps with a much wider range. This Red List account assumes that the chevrotains of the Mekong basin and Thailand south from 18°N to the Thai–Malay peninsula refer to T. kanchil, on the basis of a fair number of specimens from many localities (E. Meijaard pers. comm. 2008: a listing of the mainland specimens examined for Meijaard and Groves 2004). Further south, T. kanchil is widely sympatric with T. napu, making chevrotains often challenging to identify (particularly for people with limited field experience of the genus) on field views, camera-trap photographs and even in hunting studies (Duckworth 1997; Matsubayashi and Sukor 2005). Many observers have therefore pooled their Sundaic chevrotain records as ‘chevrotain spp.’ (e.g. Bennett et al. 2000; Laidlaw 2000; Linkie et al. 2003; O'Brien 2003; Kawanishi and Sunquist 2004; Azlan 2006; Azlan and Engkamat Lading 2006; Lynam et al. 2007). Thus, the information base for determining this species' status is much thinner than would be expected from the general perception of the genus as being widespread and common, at least in the Sundaic part of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Tragulus javanicus as here defined is endemic to the island of Java, Indonesia, according to Meijaard and Groves (2004). The latter authors did not mention the island of Bali, but a sighting was reported from Bali Barat National Park, Bali, in a bird watching trip report (Birdquest 2006). The genus was not listed for Bali in the exhaustive reviews of Chasen (1940; of the genus) or Meijaard (2003; mammals of Indonesian islands), nor by Grubb (2005). Given the live-animal trade in the genus on Java, further records are needed to confirm whether or not there is a native population of the genus on Bali. If there is, biogeographic considerations suggest it would be most closely related to the Javan population and quite probably conspecific.

Hoogerwerf (1970) wrote that "in Java T. javanicus was encountered in all provinces, fairly intensively distributed from sea-level to high in the mountains". Present-day occurrence in East Java is questionable: S. Hedges, M. Tyson and E. Meijaard (pers. comm. 2008) know of no certain records (as distinct from listings in collation documents which do not cite information to primary source) from areas like Baluran or Alas Purwo national parks, despite high survey effort during 1991–2000.

Meijaard and Groves (2004) gave only one specific locality for the species: Cheribon (= Cirebon) on the north coast of West Java Province, which is the type locality of T. j. pelandoc Dobroruka, 1967. Dobroruka (1967) also mentioned the western part of Java, to the southern coast, for what he called T. j. focalinus (which is T. javanicus s .s.). Meijaard and Groves (2004) did not list the localities for the many specimens they examined. Dobroruka (1967) and Van Dort (1986) both discuss variation within Javan chevrotains; neither has yet been checked for specific localities. More recent localities, although not of specimen records, include: Gunung Halimun (reportedly camera-trapped some time before 2003 [Suyanto 2003], but the photograph is not reproduced in the appendix and a painting is used for the species instead); Ujung Kulon (1991–1993; van Schaik and Griffiths 1996; C.P. Groves pers. comm. 2008), and the Dieng Plateau (during 1999–2000; V. Nijman pers. comm. 2008). There has been no collation of records from the various surveys over the last 20 years or so, and some observers no doubt are aware of other localities.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tropical forest region in Southeast Asia

Biogeographic Regions: oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tragulus javanicus, or lesser Malay mouse deer, do not have antlers or horns. Instead, adult males have elongated, tusk-like upper canines (Nowak and Paradiso, 1983). These canines protrude from the side of the mouth. Females lack these canines. Females are also smaller than the males (Nowak and Paradiso, 1983). The cheekteeth of lesser mouse deer have a crescent pattern formed by the enamel ridges. Mouse deer have no upper incisors. The pelage of mouse deer is brown with an orange tint. The underside is white. There is also a series of white vertical markings on the neck (Grzimck, 1994). Malay mouse deer have a triangular head and a round body with elevated rear quarters. The thin legs are about the diameter of a pencil (Nowak and Parasido, 1983). T. javanicus is the smallest artiodactyl, 18-22 inches long with a tail length of 2 inches (Grzimck, 1994). The young look like miniature adults when born; however, the tusk-like incisors in the infant males are not well developed.

Range mass: 1 to 2 kg.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

Average basal metabolic rate: 4.883 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Tragulus javanicus
Catalog Number: USNM 120574
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skin; Skull
Collector(s): Collector Unknown
Year Collected: 1902
Locality: Buitenzorg, Near, Java, Indonesia, Asia
  • Type: Miller, G. S. 1903 Mar 19. Proc. Biol. Soc. Wash. 16: 35.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is found in lowland/foothill primary and secondary forests as well as cultivated areas up to 600 m in elevation (Semiadi and Boeadi pers. comm.). The habitat of this species is a mosaic of riverine, seasonal swamp and dry undulating country, vegetated predominantly by legumes and dipterocarps. In Sabah, they also inhabit mangrove forest. In Peninsular Malaysia, it feeds on shoots, young leaves and fallen fruits in the tall forest of the lowlands.

During the day it may prefer crown-gap areas with dense undergrowth of creeping bamboo, and move to higher and drier ridge areas at night. Home range All Tragulus species are associated with forests, but there is strong evidence that T. kanchil does not require old-growth forest or even particularly mature secondary forest. Its heavy use of disturbed habitats was confirmed by Matsubayashi et al. (2003), who found that in Kabali-Sepilok (Sabah), T. kanchil fed primarily in crown-gap areas dominated by bamboo stands, probably because it prefers fruits and soft leaves of pioneer plants with lower concentrations of secondary metabolites. Later, at another site in Sabah, Matsubayashi and Sukor (2005) again found a strong association of T. kanchil with immature forest. Johns (1997) found Tragulus to be more common in logged forests than in mature forests in Peninsular Malaysia, and densities tended to decrease again as logged forests matured. The abundance of Tragulus spp. (T. napu and T. kanchil combined, with no information on the proportions or even confirmation that both species were present) was higher (strongly statistically significantly so) in areas within 1 km inside the boundary of Bukit Barisan Selatan National Park, Sumatra, than in the interior of the park, suggesting higher numbers in somewhat encroached habitat (O'Brien et al. 2003); note that it is not confirmed that this information refers to T. kanchil. The genus (presumably including this species) was ubiquitous in a study in West Malaysia which paired each of seven of virgin jungle reserves with a nearby unprotected area with seriously encroached habitat (Laidlaw 2000). By contrast, at the Danum Valley, Sabah (East Malaysia), densities of T. kanchil were 21–39 animals per km² in primary forest but only 10–15 animals per km² in selectively logged areas (and there was an even bigger decrease of 55–66% for T. napu); in this area, where hunting is negligible and so is not confounding patterns, chevrotain densities were positively correlated with fruit abundance, and negatively correlated with pioneer trees and grass and herbs (Heydon 1994; Heydon and Bulloh 1997; Davies et al. 2001). Heydon and Bulloh (1997) suggested the obligate frugivory of chevrotains limited their ability to compensate for logging-led loss of fruit trees by browsing the abundant regrowth of logging areas. This may be significant in rationalising the differences between areas concerning the apparent effects of logging on the species: in some logging areas, fruiting trees are common along streams and tend to be left, and pioneer colonists produce abundant edible fruit. Around Buon Luoi, southern Viet Nam, most encounters with chevrotains (assumed to be largely or entirely this species rather than T. versicolor, based on ratios of specimens) were in places where tall forest alternated with scrub thickets, patches of grassland and moist riverine habitats. Riverbank slopes appeared particularly favourable to chevrotains (Kuznetzov and Borissenko 2004). E. Pollard (pers. comm. 2008) sees Lesser Chevrotains commonly in highly degraded forest in Mondulkiri province, Cambodia. In Thailand, R. Steinmetz (pers. comm. 2008) finds the species commonly in edge habitats, also widely, but probably less frequently, within big blocks of closed-canopy forest. By contrast in Lao PDR, the genus seems to be scarce in the interior of old-growth forest, based on surveys of many of the country’s remaining forests. Chevrotains have been camera-trapped in at least one protected area (Nakai–Nam Theun NPA), but only in one part of that (Johnson and Johnston 2007); the report does not discuss habitat. Tracks are readily identified by those familiar with them, but are rarely found within heavy forest in Lao PDR (R.J. Timmins pers. comm. 2008). Chevrotains are easily spot-lit at night where they occur, yet extensive spotlighting in south and central Lao PDR during 1992–1996, with most of such survey in areas below 550 m asl, found the species only once, and there were not many more records by day (Duckworth et al. 1994; Duckworth 1996, 1998; Evans et al. 2000; and a lack of records in many other sources). All or nearly all the handful of sightings (day or night) were in edge or heavily degraded areas (J.W. Duckworth pers. comm. 2008), but some lengthy surveys of lowland encroached forest failed to find the genus (notably in the ‘corridor’ sector of Phou Xang He NPA). This indicates a general overall rarity, or at least a localised distribution, either natural or human-induced. The apparently large numbers on the Vientiane plain (see Threats; Srikosamatara et al. 1992) (at the time of surveys perhaps among the most intensively hunted areas of Lao PDR for mammals of this size-class), including persistence at dreadful sites like Houay Nhang (whence almost all mammals larger than rats had been hunted out; see Threats), argues against human agency being responsible for the absence or low densities of chevrotains elsewhere in lowland Lao PDR in places like the corridor of Phou Xang He NPA and interior forests. Extensive surveys in the 1990s of Lao forest areas suggests almost certainly that in extensive tracts of semi-evergreen and evergreen forest below 1,000 m asl chevrotains are naturally scarce at least away from ‘edge areas’, because hunting pressure from snares, dogs, and day and night hunting with guns is relatively low, and other quarry species captured in similar ways to chevrotains are often common (R.J. Timmins pers. comm. 2008). In contrast, Kuznetzov and Borissenko (2004), who concurred that, in Viet Nam, closed-canopy forests often support few if any chevrotains, proposed that this is an artificial pattern produced through hunting (see Threats). In Lao forest ‘edge’ areas the very low numbers of chevrotains cannot necessarily be concluded to be a natural pattern, as these ‘edge areas’ tend to be in the vicinity of human settlements and in at least the 1990s experienced high levels of snaring and gun hunting (primarily by day) for primarily local consumption or local markets and ubiquitous hunting dog presence (R.J. Timmins pers. comm. 2008). Experiences in 2005, however, suggest that chevrotain presence is perhaps highly patchy and correlated to specific habitat features, as in the Nam Kading National Protected Area there was a clear hunting focus on chevrotains with an evidently significant capture rate; yet general wildlife field surveys in 2005 and 1995 observed the species in the field only once, despite significant spotlighting effort (Evans et al. 2000; Timmins and Robichaud 2005; W.G. Robichaud pers. comm.. to R.J. Timmins 2005; R.J. Timmins pers. comm. 2008). It suggests that the species is tied to specific microhabitats; perhaps this might be related to water requirements as there is a surprising regularity with which authors note commonness in riverine areas. Dumas’s (1944) description of the distribution in Cambodia strongly echoes modern findings that it is localised in Lao PDR and associated with gaps in Sabah: he stated that it was absent from heavy forest of tall trees without understory, and in general it was localised in occurrence but found somewhere in each of most of the forested provinces of Cambodia, wherever there are low, dense, thickets, and within clumps of bamboo, of which it is fond of the young shoots. Such a pattern 70 years ago seems unlikely to have been produced by hunting. In sum, the habitat use of this species with respect to edge–interior areas shows startling heterogeneity, at least in non-Sundaic areas, but this cannot yet be explained; in particular, disentangling the contributions of intrinsic habitat suitability and the effects of hunting is difficult.

The Lesser Chevrotain may even be able to survive in large numbers in plantation landscapes: in the Sarawak Planted Forests, Bintulu, Sarawak, Belden Giman (pers. comm. 2008) has many records from Acacia mangium plantations both mature and immature. However, this landscape contains many patches of secondary and old-growth forest (Belden et al. 2007), so further study is needed to assess use, if any, of landscape-level monocultures.

Most of this chevrotain’s geographic range is dominated by evergreen or semi-evergreen forests, but large areas of Cambodia, Thailand and to a lesser extent Lao PDR and Viet Nam are deciduous. One survey in Mondulkiri province, Cambodia, in 2008, found chevrotains to be widespread and common in mixed deciduous forest, dominated by e.g. Lagerstroemia spp., but they were not found in nearby deciduous dipterocarp forest (C. Starr pers. comm. 2008). In this same general area, J. Walston (pers. comm. 2008) also found them commonly in mixed deciduous forest, during 2002–2006. Field surveys of extensive landscapes of deciduous dipterocarp forest and mixed deciduous forest (in which ground fires are almost annual) in eastern and northeastern Cambodia (including Mondulkiri) have not detected the species (R.J. Timmins pers. comm. 2008) and camera-trapping from the same landscapes also suggest chevrotains are absent from deciduous regularly burnt forest tracts, but occur in semi-evergreen forest patches within the same landscapes (WWF unpublished data). Dumas (1944) stated that chevrotains were unknown in the deciduous dipterocarp forests of Cambodia, No other information on their use of deciduous landscapes has been traced; it is probable that even within deciduous dipterocarp they might use the semi-evergreen riverine strips within.

The Lesser Oriental Chevrotain may be absent from highlands throughout much of its range, and seems to be an extreme lowland specialist in some areas. The clearest analysis, from Borneo, found that it lived mostly below 100 m asl, with no record above 600 m asl (Payne et al. 1985). The maximum altitude in Indonesia (i.e. Borneo and Sumatra) is also said to be 600 m asl (G. Semiadi and Boeadi pers. comm. 2006); specific information from Sumatra has not been traced. In Lao PDR most known sites (see Duckworth et al. 1994; Duckworth 1996; Evans et al. 2000) are also below 600 m asl; however, chevrotains are abundantly hunted in the Nam Ha NPA which has a minimum altitude of 560 m asl (and rises to nearly 2,100 m asl) and is almost entirely rugged (Johnson et al. 2003), although these are perhaps more likely to be T. williamsoni than T. kanchil. There is a chevrotain specimen from Thateng on the Bolaven plateau (FMNH 38012) confirmed as T. kanchil (E. Meijaard pers. comm. 2008), suggesting occurrence at 800–1,200 m asl, although a short-distance trade origin may be possible. A recent finding of the genus being common in one part of Nakai–Nam Theun NPA (Johnson and Johnston 2007) gives no information on altitude of the records, and there are too few relevant specimens to allow a firm prediction as to which species they relate. Good populations certainly occur well above 600 m asl in Thailand: chevrotains are common in the degraded and edge habitats around Khao Yai National Park headquarters at 760–800 m asl (J. W. Duckworth pers. comm. 2008) and a number of specimens from nearby Pakchong suggest that these are likely to be T. kanchil, rather than unsuspected southerly occurrence of T. williamsoni. Also in Thailand, at Phu Khieo Wildlife Sanctuary chevrotains were camera-trapped commonly at 700–900 m asl, although the species involved is/are unclear (Lynam et al. 2001; A.J. Lynam pers. comm. 2008).

Lesser Chevrotains visit saltlicks regularly (Matsubayashi et al. 2007).

Lesser Chevrotain is often stated to be nocturnal, but in fact most activity is diurnal (in the first few and last few hours of daylight), with animals spending most of the night resting (Matsubayashi et al. 2003; Matsubayashi and Sukor 2005). It is highly solitary (Matsubayashi et al. 2006). Apparent territorial behaviour has been observed (Davison 1980); home ranges and core areas overlap considerably between males and females but core areas are completely separate between individuals of the same sex (Matsubayashi et al. 2006). Males are highly philopatric but females establish new home ranges when giving birth (Ahmad 1994 in Meijaard et al. 2005). Matsubayashi et al. (2003) estimated home-range size for females at 4.3 ha and for males 5.9 ha using the minimum convex polygon method, but the difference between males and females was not significant. The mean daily distance travelled for males was 519 ± 89 m, that for females 574 ± 220 m. The Lesser Chevrotain is partly frugivorous, but also eats substantial quantities of shoots and young leaves, mostly of fast-growing gap species rather than closed forest understory species; the latter tend to be richer in secondary protective compounds (Dang Huy Huynh 1968; Medway 1983; Kuznetzov and Puzachenko 1992; Matsubayashi et al. 2003). Among fruits, those of mass 1–5 g and seeds of mass 0.01–0.5 g are particularly taken (Heydon and Bulloh 1997). It seems to be facultively monogamous–polygymous (given the congruence between core areas of individual males and females with a conspecific of the opposite sex; Matsubayashi et al. 2006), with post-partum oestrus, females being almost continuously pregnant (Cadigan 1972 in Meijaard et al. 2005). The gestation period is 140–177 days (Lekagul and McNeely 1977), with 2–3 young per year, the fawns kept hidden (Meijaard et al. 2005).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Hoogerwerf (1970) wrote of chevrotains on Java occurring "from sea-level to high in the mountains". In the Dieng plateau area, V. Nijman (pers. comm. 2008) found them only a few times in the lowlands (400–700 m asl), where most survey took place, and had no records from above about 1,500 m asl. They have been found on Gunung Gede–Pangangro up to about 1,600 m asl (V. Nijman pers. comm. 2008). Hoogerwerf’s (1970) description of favoured habitats on Java suggests that chevrotains there might be an 'edge' species, certainly seeming to prefer areas with thick understory vegetation, such as that along riverbanks. This would not be unusual within the genus (see other Tragulus accounts).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tragulus javanicus are found in overgrown primary and secondary forests in southeast Asia. They often reside around rocks, hollow trees, and dense vegetation near water.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • Nowak, R., J. Paradiso. 1983. Walker's Mammals of the World. Chicago: John Hopkins University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

T. javanicus is a ruminant and has a three-chambered stomach (Lawlor, 1979). As ruminants, mouse deer use microorganisms that produce enzymes within the stomach to digest their food. In the wild, lesser Malayan mouse deer are commonly herbivores and folivores, eating leaves, buds, shrubs, and fruits that have fallen from trees. In zoos, mouse deer tend to eat insects as well as leaves and fruits (Nowak and Paradiso, 1983).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
12.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 14 years (captivity) Observations: In captivity, these animals live up to 14 years (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Mouse deer can breed at any time of the year. The gestation period is usually 4 1/2 months. Breeding females produce one fawn (Jinaka, 1995). The young are precocial when born and can stand within 30 minutes of birth (Grzimck, 1994). Mouse deer are shy and their fawns tend to be "hiders". The fawn is weaned for 10-13 weeks. It reaches sexual maturity at about 5-6 months. Lesser Malay mouse deer can live for 12 years.

Average birth mass: 370 g.

Average gestation period: 144 days.

Average number of offspring: 1.

Average age at sexual or reproductive maturity (male)

Sex: male:
167 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
167 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tragulus kanchil

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ATGTTCATCAACCGCTGATTATTCTCAACCAACCACAAAGATATTGGTACCCTTTACCTGCTATTTGGGGCCTGAGCAGGGATAGTTGGAACAGCCCTGAGCTTGCTTATCCGCGCTGAACTAGGCCAACCTGGAACTCTACTTGGAGATGACCAAATCTATAATGTAGTAGTCACTGCACATGCGTTTGTAATAATTTTCTTCATAGTAATACCAATTATAATCGGAGGCTTCGGTAACTGACTTGTCCCTCTAATAATTGGAGCGCCGGACATGGCCTTTCCTCGAATAAATAACATAAGCTTCTGACTCCTACCCCCCTCTTTCCTTCTACTCCTAGCATCATCAATAGTCGAAGCCGGAGCAGGGACAGGCTGAACCGTGTACCCTCCTCTAGCCGGGAACCTGGCCCACGCAGGGGCCTCCGTAGACCTAACAATTTTCTCCCTTCACTTAGCGGGCGTGTCTTCTATTCTAGGCGCTATTAATTTTATTACTACAATCATTAACATAAAACCCCCTGCCATGTCTCAATATCAAACTCCACTCTTCGTGTGATCTGTTTTAATCACAGCTGTTCTTCTACTACTATCACTTCCAGTGCTAGCAGCAGGTATTACCATACTCTTAACCGACCGGAATTTAAACACAACTTTCTTCGACCCCGCAGGAGGCGGAGACCCTATCCTATACCAACACCTATTCTGATTCTTCGGCCACCCTGAGGTTTATATTCTGATCCTACCTGGATTTGGCATGATCTCTCACATTGTGACCTACTATTCAGGTAAAAAAGAACCTTTTGGGTACATGGGTATAGTCTGAGCCATAATATCAATCGGATTTCTTGGCTTCATCGTATGAGCACATCACATATTCACCGTAGGCATAGATGTGGACACCCGAGCCTACTTCACGTCAGCTACTATAATTATTGCCATCCCGACTGGCGTAAAGGTCTTTAGCTGACTGGCCACATTGCATGGCGGCAACATCAAATGATCTCCTGCTATAATATGAGCCCTTGGCTTTATTTTCCTATTCACAGTCGGGGGTTTAACAGGAATTGTCCTAGCCAATTCTTCCCTAGACATCGTACTACATGACACCTATTATGTAGTAGCTCACTTCCACTACGTACTCTCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTTGTCCACTGATTCCCACTATTTTCAGGTTACACCCTCAACCCAACATGAGCCAAAATCCACTTCGCTATTATATTCGTCGGAGTAAATATGACCTTCTTCCCACAACACTTCTTAGGACTATCAGGAATGCCACGACGGTACTCTGACTACCCTGACGCATACACAATGTGAAACACCATCTCCTCAATAGGTTCTTTTATCTCCCTAACAGCAGTTATACTCATGGTCTTTATTATCTGAGAGGCATTCGCATCTAAACGAGAGGTCTCAGCTGTAGACCTAACAACCACAAACCTAGAGTGACTAAACGGATGTCCTCCCCCATATCACACATTTGAAGAACCTGCCTATATTAACTCAAAGTAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tragulus kanchil

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Timmins, R.J., Duckworth, J.W. & Semiadi, G.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Justification
The Lesser Oriental Chevrotain is listed as Least Concern because it was historically proven to be widespread and common, and chevrotains remain in large numbers in its specimen-validated range and at least in non-Sundaic areas persist in environments of very heavy forest degradation and fragmentation and hunting. The presumed short generation length of the species, considered to be likely under five years, also influences assessment, in that, for decline criteria to be invoked in Red Listing one would have to assume relatively high rates of decline over a large part of the species range in a relatively short window of time (10-15 years). Thus although there may be/have been drastic (local) reductions, these have probably not been synchronous over a large enough area.

There are several major uncertainties, although these are not adjudged sufficient for listing as Data Deficient: (1) a rather low proportion of modern records of Tragulus from both the Sundaic and non-Sundaic portions of the range have been identified conclusively to species; (2) the conflicting nature of the information available concerning the effects of hunting (harvest levels are locally very high) and habitat destruction; (3) strong indications that in its non-Sundaic range it is localised in occurrence, a pattern for which the reasons remain opaque, but which has been proposed to result from hunting; (4) the apparent restriction to the extreme level lowlands in at least Borneo, placing it within the altitudinal zone of rapid forest loss.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
DD
Data Deficient

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Duckworth, J.W., Hedges, S., Timmins, R.J. & Semiadi, G.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
Tragulus javanicus is listed as Data Deficient partly reflecting the lack of clarity over how many species of chevrotain occur on Java and therefore how much of the available information about the genus refers to T. javanicus. However, even taking an assumption that there is only T. javanicus on the island, information applicable to red listing is limited. Given the considerable uncertainties that exist for all members of the genus (see Red List accounts for other species), largely as a result of general oversight of chevrotains in faunal investigations, the comparison of some historical accounts of T. javanicus with recent fieldwork results is difficult to interpret, not least the species tolerance of hunting is poorly known, as is it's likely response to habitat disturbance. Additionally the presumed short generation length of the species, considered to be likely under five years, also influences assessment, in that, for decline criteria to be invoked in Red Listing one would have to assume relatively high rates of decline in a relatively short window of time, ca 10-15 years, since the present. There are fair indications of a decline, perhaps a major one, and a category such as Vulnerable is quite likely to be applicable. Dedicated field investigations (throughout Java) of status are urgently warranted, and the species Red List status should be reviewed regularly in light of current uncertainty and concerns.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The mouse deer population is threatened by hunting and habitat destruction.

One method to prevent the extinction of mouse deer is captive breeding. This is done primarily in zoos (Jinaka, 1995).

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

  • Jinaka, H. 1995. Endangered Animal of February 1999 -Mouse Deer. A Guide to the Threatened Animals of Singapore, 2: 38-39.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Lesser Oriental Chevrotain populations are not well studied, in part reflecting a general lack of research interest in the genus and in part the difficulties of confirming how much of the information on the genus relates to this species. T. kanchil seems to be relatively common on at least Borneo (Payne et al. 1985), specifically in the Bintulu Planted Forests Area in Sarawak (Belden Giman pers. comm. 2008). In Thailand, even though it is generally more common than Greater, there are no studies and sightings are too few to determine national population status or trends (Anak Pattanavibool pers. comm. 2008). During the flooding of the Chiew Larn Reservoir (Surat Thani province; 20–130 m asl), 172 Lesser Chevrotains were ‘rescued’ compared with only six Greater Chevrotains (Nakasathien 1989). At Kuiburi National Park (12°N), only T. kanchil has been camera-trapped (Steinmetz et al. 2007; R. Steinmetz pers. comm. 2008). The genus is commonly camera-trapped on Sumatra (O'Brien et al. 2003), where this species is reportedly still common (G. Semiadi and Boeadi pers. comm. 2006). The genus also remains common in West Malaysia (Laidlaw 2000; Kawanishi and Sunquist 2004; Azlan 2006) and in far southern Myanmar (Lynam 2003; the identifications to species should be disregarded). At the Danum Valley, Sabah (East Malaysia), densities of T. kanchil were 21–39 animals per km² in primary forest but only 10–15 animals per km² in selectively logged areas (see Habitat and ecology) (Heydon 1994; Heydon and Bulloh 1997; Davies et al. 2001). This species specifically was also found commonly in several other sites in Sabah (Matsubayashi and Sukor 2005; Matsubayashi et al. 2003, 2006, 2007). Population densities for Tragulus spp. (presumably including this species) in Taman Negara, Malaysia, were taken to be 0.37–0.83 per km² (Kawanishi and Sunquist 2004).

Non-Sundiac populations are poorly documented. Chevrotains are common in Thailand’s Khao Yai National Park, at least in the degraded and edge habitats around the park headquarters (J. W. Duckworth pers. comm. 2008) and Phu Khieo Wildlife Sanctuary (Lynam et al. 2001; identifications to species should be disregarded). The genus seems to be of localised occurrence in Lao PDR (Duckworth et al. 1994, 1999; Duckworth 1996, 1998; Evans et al. 2000; Johnson et al. 2003; Johnson and Johnston 2007; see Habitat and ecology). Chevrotains seem also to be localized in Viet Nam. They are common in Cat Tien National Park, southern Viet Nam (Borissenko and Ivanova 2003; Polet and Ling 2004). Somewhat further north, intensive sign and spotlighting searches at several sites in lowland Dak Lak in 1997 failed to find the genus (Le Xuan Canh et al. 1997; an earlier listing in a report for that area should not be taken seriously, see Duckworth and Hedges 1998: 66–68), although these were mostly in rather or entirely deciduous areas and perhaps outside the species' habitats; however, landscape in parts of the areas surveyed is similar to that in eastern Mondulkiri, Cambodia (see below). Further north again, they were common around the Buon Luoi area, although seem to have declined recently (Kuznetzov and Borissenko 2004). As in Lao PDR, there are many other areas within the genus’s range (as defined by Dang Huy Hyunh 1994) from which reasonably intensive mammal surveys have failed to find the species (e.g. Phong Nha Ke Bang National Park [Timmins et al. 1999] and the Huong Son District of Ha Tinh Province [Timmins and Trinh Viet Cuong 2001]). In Cambodia, chevrotains were recorded commonly by recent surveys in at least one area of Mondulkiri province dominated by semi-evergreen forest (T.D. Evans pers. comm. 2008; E. Pollard pers. comm. 2008; J.L. Walston pers. comm. 2008; C. Starr pers. comm. 2008); but in the primarily deciduous lowlands presence appears to be patchy (see Habitat and Ecology), but no good modern composite picture for the country is available (R.J. Timmins pers. comm. 2008). Dumas (1944) considered that it occurred in most of the forested provinces of Cambodia, wherever its favoured microhabitats were found.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There appears to have been no field study specifically of chevrotains on Java but current wildlife surveyors agree that they are rarely seen compared with results from similar styles of observation in Kalimantan (S. van Balen, V. Nijman, E. Meijaard, M. Tyson and S. Hedges, all pers. comm. 2008). Even Hoogerwerf (1970), who clearly found the species with some regularity (explicitly not daily, but enough for him to learn its calls and thereby establish dates of a probable mating season), complained that “it is particularly difficult to obtain any insight into the situation of this species in Java”, but concluded that “it is improbable that the species is in danger of extinction”. The basis for an unattributed statement in Whitten et al. (1996), that “it is still numerous and can be seen easily in many areas such as the tourist park part of Pangarandaran Nature Reserve” is unclear. The genus was recorded at five of ten sites on the Dieng Plateau surveyed in 1999–2000, but mostly only through single observations (V. Nijman pers. comm. 2008). S. van Balen (pers. comm. 2008) points out that in Java the genus seems very shy (compared with animals in Malaysia and Kalimantan), so most records come as footprints. This contrasts with the assignment by Hoogerwerf (1970) that the genus was common and widespread. It is therefore quite plausible that a major decline has taken place, although other explanations remain to be explored which could have bolstered Hoogerwerf’s sighting rates, such as his having a dog with him which flushed the chevrotains, or his spending a lot of time in the species' favoured microhabitats. Specifically, neither M. Tyson nor S. Hedges (pers. comm. 2008) saw chevrotains during a rhinoceros survey in Ujung Kulon in 1992, whereas this was Hoogerwerf’s (1970) main site in assessing the species as relatively common and readily found. It was camera-trapped there five times during 1991–1993 (van Schaik and Griffiths 1996), a rate comparable with that of many other species in the study and certainly not suggesting out-and-out rarity. Very recently, numbers in trade in Java have dropped sharply in most cities, and it is plausible that this reflects increasing difficulty in procuring the animal (G. Semiadi pers. comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Hunting and habitat loss occur at high levels almost throughout this species' range. While it is clear that the genus remains widespread and common in its Sundaic range in the face of these threats, few data to support assessment specifically of Lesser Chevrotain’s current status were traced: many key studies there have not identified chevrotains to species. In the non-Sundaic areas, evaluation of resilience is hampered by evident heterogeneity of chevrotain occurrence with a lack of convergence of opinion as to explanations of same.

North of the sympatry with T. napu, T kanchil is heavily hunted and is often considered one of the most preferred wild meats (Srikosmatara et al. 1992; Duckworth et al. 1999; Kuznetzov and Borissenko 2004; R. Steinmetz pers. comm. 2006, R.J. Timmins pers. comm. 2008). Nonetheless, it is clear that T. kanchil is adept at surviving in areas (at least in the lowland plains) in the face of very heavy hunting, major habitat degradation and isolation from other forest areas. Exemplifying this, it was one of the few mammals larger than a rat confirmed to persist at Houay Nhang, an isolate of a few km² of highly degraded forest just outside the capital of Vientiane facing, in the early 1990s, exceedingly concentrated hunting with guns and snares (Duckworth et al. 1994). A little to the west it persists in Sangthong district, which was heavily logged just before a 1996 survey and also supported heavy hunting (Duckworth 1996). These two areas are within 10 and 70 km, respectively, of, and ecologically contiguous with, Thangon, from where Osgood (1932) reported specimens of T. kanchil (confirmed by E. Meijaard pers. comm. 2008 as this species), and thus the modern records probably do relate to T. kanchil. Hansel (2004) provided a further record from the adjacent low hills. Numbers of chevrotains in Vientiane markets in the early 1990s (Srikosamatara et al. 1992) were so high that they could not be at the brink of extinction in this degraded and fragmented landscape. Chevrotains are still common in trade in the city, although mostly in transit rather than on open sale in the city’s markets, and their origin is not clear (T. Hansel pers. comm. 2008). The genus was recently camera-trapped quite commonly in a part of Nakai–Nam Theun NPA where ground mammals were much depleted (Johnson and Johnston 2007), perhaps indicating higher resilience than many other mammals, although there is no information to compare with pre-exploitation levels.

While non-Sundaic chevrotains can, therefore, clearly persist under extreme pressures in at least some circumstances, this does not rule out that densities might be quickly reduced through the twin pressures of hunting and habitat degradation. Decreasing population densities between the 1970s and 1990s, in at least parts of southern Viet Nam, were suggested by both spot-lighting surveys and qualitative assessments of footprints. Near Buon Luoi in December 1978, chevrotains were spotlit at about three animals per 5 km of transect route, but by 1993, when forest had undergone heavy degradation and hunting was very heavy, chevrotains were not even found every night with at least 10 km of transect (Kuznetzov and Borissenko 2004). Kuznetzov and Borissenko (2004) proposed that night-time hunting may explain chevrotain’s near-absence from habitats with open-understory (this feature allowing chevrotains to be readily hunted using spotlights and guns) in the Buon Luoi area, because by contrast in Cat Tien National Park, where the use of firearms has been banned for decades and enforcement is fairly effective, chevrotains are encountered with comparable frequency both in thickets and on exposed forest floor (Borissenko and Ivanova 2003). This sighting rates contrast is consistent with a difference between the headquarters area of Khao Yai National Park, Thailand (where chevrotains are readily found by spotlight) and which is relatively well-protected from hunting, and Lao forests (see above) where hunting was effectively unrestrained (J.W. Duckworth pers. comm. 2008). However, a proposal that, where hunting is unrestrained, as it is in most of Viet Nam and Lao PDR, chevrotains would be common in heavy forest but have been effectively eradicated from such habitat, is flawed for at least Lao PDR, where numbers of forest mammals killed through spotlight hunting are probably insignificant compared with those trapped (including with snares) and perhaps even killed using dogs (J.W. Duckworth and R.J. Timmins pers. comm. 2008, based on numbers of active hunters encountered at nigh versus traps found, in many areas of Lao PDR). Kuznetzov and Borissenko (2004) based their reasoning on only two sites and it is possible that other factors explain the differences. In sum, the effects of hunting and habitat modification, and the interaction between them, on non-Sundaic chevrotains remain most unclear.

The effects of potential threats operating in the Sundaic range are not understood well, either. Lesser Oriental Chevrotain is now rather rare on Singapore (K. Lim pers. comm. 2008), presumably nowadays constrained by habitat quality rather than by ongoing hunting, although the role of free-ranging dogs, if any, in restraining population numbers is unclear. However, the ‘island within an island’ situation of remaining forest on Singapore and the extreme habitat loss over the last 150 years prevent useful extrapolation of this species' situation there to other Sundaic areas. Poaching pressure in Kerinci-Seblat National Park, Sumatra, among snared ungulates was greatest for muntjacs and lowest for chevrotains, as assessed by diameter of the cable (Linkie et al. 2003). Chevrotains were more then nine times as abundant in areas of Bukit Barisan Selatan National Park, Sumatra, with low than with high human population density within 10 km of the park boundary, suggesting low resilience to human presence, presumably the effects of hunting (O'Brien et al. 2003); note that it is not confirmed that this information refers to T. kanchil. Bennett et al. (2000) profiled the effects of hunting in both Bornean states of Malaysia (Sarawak and Sabah), each with eight study areas, upon chevrotains (not distinguished to species) through a lengthy hunting study in February 1993 to June 1995. They constituted 8–9% of animals killed. No direct or index measure of chevrotain densities was possible at these sites to determine what effects, if any, such heavy hunting was having on chevrotains. Chevrotains are among the most favoured wild meat by inhabitants of the Sarawak Planted Forests area, Bintulu, Sarawak, after Sambar Rusa unicolor and wild pigs Sus (Belden Giman pers. comm. 2008). Logging can apparently drive substantial reductions in density, at least locally, although other studies have found it allows an increase in numbers (see Habitat and ecology). No information on the use of plantation landscapes has been traced. In the Greater Sundas, lowland forest is being converted at unprecedented high rates. At least in Borneo, where this species is concentrated in areas below 100 m asl, most of its habitat either has been substantially modified during the last two decades or will be in the next two (e.g. Holmes 2000; BirdLife International 2001; Jepson et al. 2001; McMorrow and Talip 2001; Lambert and Collar 2002; Fuller et al. 2003; Kinnaird et al. 2003; Curran et al. 2004; Fuller 2004; Eames et al. 2005, Aratrakorn et al. 2006). However, inferring proportionately large population losses in Lesser Chevrotain populations is not possible: depending on how serious hunting is and what exactly is being done to the habitat post-logging (forest regeneration, tree plantation or non-woody habitat) in any given area, chevrotain numbers might remain broadly unaffected, decrease or increase in logged-over areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Java has highly fragmented natural habitats and has done for centuries, reflecting longstanding high human population densities. Many protected areas were established during the Dutch colonial period but from independence up until the 1970s they were largely under-funded and neglected. After hosting the World Parks Conference in 1982, the Indonesian government gazetted a swathe of national parks and more structured conservation planning began, funded by the World Bank and other donors. The focus was largely on the 'multi-function' national parks and much money was spent on infrastructure, some staff training and increased personnel. The 'lesser' protected areas such as "game reserves" and "nature reserves" still had few staff and resources, and that has continued to the present. During the 1980s to the mid 1990s, guns were tightly controlled and the military and police were feared and respected. However, the strong culture of caged bird keeping meant that hunting, including that within protected areas, was primarily for birds and some small game, through various forms of trapping, including snaring; this latter could well have included chevrotains. There was some habitat loss from protected areas through illegal logging, agricultural encroachment and other offtake, but the national parks of Java remained remarkably intact for much of this period. Socio-political changes from 1997 led to a reduction in the respect for the police and military and the rise of a viewpoint that protected areas were the peoples' resources and would therefore benefit from decentralised management (S. Hedges and M. Tyson pers. comm. 2008). This policy change, which risked a ‘tragedy of the commons’, has indeed led to increased destruction and poaching in the past decade. There is some evidence that species readily uses edge and secondary vegetation, meaning that effects of forest encroachment will be less serious than for old-growth forest obligates. Moreover, chevrotains already seemed rare for surveyors operating in the early–mid 1990s, when habitats had been relatively stable since 1970s or early 1980s. For any decline which may have occurred in the 1980s and early–mid 1990s, therefore, habitat factors are an unlikely driver.

Chevrotains occur regularly in markets in towns such as Jakarta, Surabaya, Yogyakarta, and Malang, but often they are cramped in small cages, and can therefore be overlooked, and may even be more common than observations suggest; numbers in trade are surprisingly high given the small numbers to be seen in the field nowadays (V. Nijman pers. comm. 2008). They have been traded at high levels for many decades: Hoogerwerf (1970) wrote of “numerous reports of mouse deer being regularly trapped and offered for sale alive” in Java. They are hunted and traded both for pets and as wild meat (S. Hedges pers. comm. 2008). Numbers passing through markets in Jakarta, Bogor, and Sukabumi have recently declined sharply, perhaps because of tightened control by the forest police in those markets; but there is the possibility that falling trade might indicate, at least in part, increasing difficulty to catch the animal and thus a decline in populations. In the Malang area, it is still “relatively easy” to procure one, although it is “getting time consuming” (G. Semiadi pers. comm. 2008). Hunting is probably largely with snares; dogs are also likely to be a serious threat (M. Tyson pers. comm. 2008). They are vulnerable to active hunting at night through a propensity to freeze when spotlit. However, the effects of these comparably high hunting levels on the genus in Java have not been studied empirically.

The continued presence of many animals in markets suggests that significant populations remain somewhere on Java (assuming that the animals are not now imports from elsewhere in Indonesia), and thus that a major decline may not have occurred, despite current indications. A comparable situation was found with inornate squirrel Callosciurus inornatus in Lao PDR, when extensive 1990s surveys found few animals in the field, in contrast with historic statements of abundance and ongoing substantial numbers being traded in fresh meat markets. This led to conservation concern for the species (e.g. Duckworth et al. 1999); but later field survey of degraded and edge areas found out that the species was indeed common and evidently a species associated with degraded areas, and had hence been severely under-recorded by the 1990s surveys (Timmins and Duckworth in press).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Hunting and habitat loss occur at high levels almost throughout this species' range but there is no clear evidence that they are depressing populations, except where formerly suitable habitat is converted to non-forest uses. Adequate legal basis exists in most or all range states to control both potential threats (through protected areas and regulations governing wildlife trade and hunting). The chief need is presumably for effective translation of these laws into action. More specific needs cannot be identified in the absence of more detailed information on this species' current status throughout its range, and investigations of the effects upon it of the high levels of hunting and habitat modification.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Chevrotains on Java occur in some protected areas, e.g. Ujung Kulon (Hoogerwerf 1970; van Schaik and Griffiths 1996) and were earlier said to “occur in all game sanctuaries in Java and in most of the nature reserves established on that island...." (Hoogerwerf 1970). The species has been officially protected since 1931, yet it is still hunted.

The taxonomic revision of Meijaard and Groves (2004) means that T. javanicus is endemic to Java, and, if it occurs, Bali. There are fair indications of a decline, perhaps a major one, and thus this newly-revealed endemic species should be swiftly removed from the anonymity in which it has lain for decades. An urgent first step is a collation of existing information, because it is possible that many more records exist than were traced during the preparation of this assessment. This should include trawling likely observers and examination of collections not covered by Meijaard and Groves (2004). If insufficient number of specimens are found to clarify the number of taxa on Java, more should be obtained. Some may come from markets but, because of the pre-eminence of locality in determining systematics among very similar taxa (e.g. Groves in press: discussion under Wapiti group), specimens of known locality origin must form the basis of analysis. Whatever the number of species on Java, the difference in sighting rate between Hoogerwerf (1970) and observers from the 1990s onwards is suggestive of a major decline, although other explanations are possible (see Population and Threats). Current status needs to be clarified through specific surveys for the genus (camera-trapping, but undertaken in a way more suitable for smaller species than is usual, spotlighting, and hunting surveys may all play a role). Surveys must take care to investigate secondary and edge areas which are often eschewed by general wildlife surveys in favour of the less encroached areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Mouse deer are hunted for their skins. The pelage of mouse deer is smooth and the skin is used to make handbags and coats (Jinaka, 1995).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser mouse-deer

The lesser mouse-deer or kanchil (Tragulus kanchil), also known as the lesser Malay chevrotain, is a species of even-toed ungulate in the Tragulidae family. It is found in Indochina, Burma (isthmus of Kra), Brunei, Cambodia, China (S Yunnan), Indonesia (Kalimantan, Sumatra, and many small islands), Laos, Malaysia (peninsular Malaya, Sarawak, and many small islands), Singapore, Thailand, and Vietnam. It is the smallest known hoofed mammal, at a mature size as little as around 45 cm (18 inches) and 2 kg (4.4 lb). It is threatened by predation by feral dogs.

References

  1. ^ Timmins, R.J., Duckworth, J.W. & Semiadi, G. (2008). Tragulus kanchil. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 6 November 2009. Database entry includes a brief justification of why this species is of least concern.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Java mouse-deer

The Java mouse-deer (Tragulus javanicus),[2] is a species of even-toed ungulate in the Tragulidae family. At maturity it is about the size of a rabbit, making it one of the smallest ungulates. It is found in forests in Java and perhaps Bali.[1] It formerly included the more widespread T. kanchil and the poorly known T. williamsoni as a subspecies.[3]

References

  1. ^ a b Duckworth, J.W., Hedges, S., Timmins, R.J. & Gono Semiadi (2008). Tragulus javanicus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 26 March 2009. Database entry includes a brief justification of why this species is of data deficient.
  2. ^ "Tragulus javanicus". Mammal Species of the World. http://www.bucknell.edu/msw3/browse.asp?id=14200129. Retrieved 2010-03-11.
  3. ^ Meijaard, I. and Groves, C. P. (2004). A taxonomic revision of the Tragulus mouse-deer. Zoological Journal of the Linnean Society 140: 63-102.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!