Overview

Distribution

Range Description

The Red River Hog is widely, but patchily, distributed through the West and Central African rainforest belt, from Senegal in the west, throughout the Guinea-Congo forest to at least west of the Albertine Rift. Further east and south-east, replaced by the Bushpig, although the precise borders between the ranges of the two species remain unclear. There are no confirmed records from Sudan or Chad, though they may occur in extreme south-western Sudan (Leus and Vercammen in press). There are also as yet no reliable records from The Gambia, which is just outside their natural range (Grubb et al. 1998). There is no confirmation of their presence on Bioko Island.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

West and Central Sub-Saharan Africa to Northern South Africa and Madagascar.

Biogeographic Regions: ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

With thirteen recognized sub-species (which are subdivided into two separate species in some texts), Potamochoerus porcus varies in physical characteristics across its range, especially with regard to coloration. West-African bush pigs are predominantly reddish with a white dorsal stripe, while in the eastern and southern parts of their range, bush pigs can vary from red to shades of brown or black. In some eastern and southern regions, they become darker with age. White facial masks are present on many bush pigs. The head and body length is approximately 1-1.5 meters while the tail is between 0.3 and 0.4 meters. Adults stand about 0.5-0.9 meters tall at the shoulder. Newborns weigh less than 1 kg. Other prominent features include ventrally-pointing upper tusks (76mm) which occlude with dorsally-pointing lower tusks (165-190mm). Tusks occur on both sexes. Males are distinctive from females in that they posess warts above their eyes. Bush pigs have also been referred to as "tufted pigs" due to their long, white whiskers and ear tufts.

Range mass: 46 to 130 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Typically associated with rainforest and gallery forest, but also found in dry forest, savanna woodland and cultivated areas, although usually in close proximity to the rainforest (Leus and Vercammen in press). Like the Bushpig, Red River Hogs are highly adaptable and may even benefit from the opening up of former forested areas by the creation of secondary habitats, the provision of cultivated foods, and reductions in the numbers of their natural predators (Vercammen et al. 1993).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The habitats occupied by this species vary greatly. They inhabit primary and secondary forests, thickets in savannahs, swamps, and steppes. They also congregate around human villages.

Terrestrial Biomes: savanna or grassland ; forest ; rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Potamochoerus porcus is omnivorous, and is quite a generalist in terms of food preference. Food items include roots, fruit, seeds, water plants, nuts, grasses, crops, fungi, insects, bird eggs, snails, reptiles, carrion, and domestic animals such as piglets, goats, and sheep. They dig in soil using their canines for roots, bulbs and insects, but can also swim and forage for water plants. Bush pigs have been known to follow chimpanzees in search of fallen fruit. They especially enjoy the seeds of the tree Balanites wilsoniana, which they find undigested in the feces of elephants.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
20.0 years.

Average lifespan

Status: wild:
15.0 years.

Average lifespan

Status: wild:
20.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 22 years (captivity) Observations: One wild born specimen was about 22 years old when it died in captivity (Richard Weigl 2005).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females are reproductively mature at age three. Their gestation period is approximately 120-127 days and their litter sizes range from 1-6, with average littlers containing four individuals. Young weigh between 650-900g. The breeding season lasts from September to April and is at its peak during the wet season from November to February. Sows construct grass nests (3 meters wide by 1 meter deep). Bush pigs are monogamous and both the mother and dominant boar of the small familial group supply care and protection to the young. Females give birth once annually.

Average birth mass: 775 g.

Average gestation period: 122 days.

Average number of offspring: 3.

Average age at sexual or reproductive maturity (male)

Sex: male:
1096 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1096 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Potamochoerus porcus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCGTAAATCGTTGACTATACTCAACAAACCACAAAGACATTGGCACCTTGTATTTGCTGTTTGGTGCCTGAGCAGGAATAGTAGGTACCGCCTTGAGCCTGTTAATTCGTGCTGAACTGGGTCAGCCCGGAACTTTACTCGGTGATGACCAAATCTATAATGTAATTGTTACAGCCCATGCCTTCGTAATAATCTTTTTTATGGTAATACCTATCATAATCGGGGGTTTTGGTAATTGACTTGTACCGTTAATAATTGGAGCACCTGATATAGCCTTCCCACGTATAAACAACATGAGCTTCTGACTACTTCCACCATCCTTTCTGCTACTACTAGCATCCTCAATAGTAGAAGCTGGGGCGGGTACTGGATGAACCGTATATCCACCCTTAGCTGGGAATCTAGCCCACGCAGGCGCTTCGGTTGATTTAACAATTTTCTCCCTACATCTTGCAGGAGTATCATCAATCTTAGGGGCTATCAATTTTATTACCACAATCATTAACATAAAACCCCCTGCAATGTCCCAATACCAAACACCCCTATTTGTCTGATCAGTACTAATTACAGCCGTATTACTTCTACTGTCTCTGCCAGTTTTAGCGGCTGGTATTACCATGCTATTAACAGATCGCAATCTAAACACAACCTTCTTTGACCCAGCAGGTGGAGGAGACCCAATCCTTTATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATTCTCATCTTGCCAGGATTCGGAATAATCTCCCACATTGTAACTTATTATTCGGGTAAAAAGGAGCCATTCGGATATATAGGCATAGTATGAGCTATAATATCTATTGGATTTCTAGGTTTTATTGTATGGGCCCACCATATGTTTACTGTAGGAATAGATGTAGACACACGAGCGTACTTCACGTCCGCTACAATAATTATTGCTATTCCAACTGGGGTAAAAGTGTTTAGCTGACTAGCTACCCTTCATGGCGGTAATATTAAATGATCACCCGCAATACTATGAGCCCTAGGCTTCATCTTCCTGTTTACTGTGGGAGGTCTAACGGGCATCGTACTGGCTAATTCATCTTTAGATATTGTTCTGCACGACACGTACTATGTAGTTGCACATTTCCACTATGTATTATCCATAGGAGCAGTATTCGCCATTATAGGGGGTTTCGTTCACTGATTCCCTCTATTCTCTGGGTACACACTCGACCAGACATGAGCAAAAATCCACTTTGTAATTATATTTGTAGGAGTAAACATAACCTTCTTCCCACAACATTTTCTAGGACTGTCTGGAATGCCTCGACGATACTCCGATTATCCTGATGCATACACAGCATGAAACACTATTTCCTCAATAGGCTCATTCATCTCACTAACAGCAGTAATATTAATGATCTTCATTATCTGGGAAGCATTCGCATCAAAGCGAGAAGTATCTGCAGTAGAACTAACAAGTACAAACCTGGAGTGACTGCACGGATGCCCTCCTCCTTATCATACATTTGAAGAACCAACATACATTAATATAAAATAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Potamochoerus porcus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Querouil, S. & Leus, K.

Reviewer/s
Leus, K. ( Pig, Peccary & Hippo Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Contributor/s

Justification
Listed as Least Concern as the species is relatively widespread, common, and there are no major threats believed to be resulting in a significant population decline. However, hunting has led to localized declines in some parts of its range, so populations should be monitored carefully.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Numbers of Potamochoerus porcus are on the rise due to hunting of leopards and the increase in agriculture. Due to their availability as food sources for humans, and especially in light of their negative economic impacts on humans, bush pigs are hunted in Africa.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Recorded densities for Red River Hogs vary greatly but typically range between 1-6 individuals / km² (Leus and Vercammen in press), although a density of 18.4/km² was recorded from galleries and bosquets in the savanna ecotone of Lopé Reserve, Gabon (Tutin et al. 1997). Periodic aggregations on ephemeral resources (such as masting fruit trees) might explain these higher estimates.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The main threat to this species is hunting for subsistence purposes, as an agricultural pest, or because it is a vector of livestock diseases, and for the commercial bushmeat trade (Vercammen et al. 1993). Together with the duikers, it is one of the most hunted species in the Congo Basin (Wilkie and Carpenter 1999). A significant effect of hunting on Red River Hog densities was observed in southern Gabon (Laurance et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Red River hogs are present in many protected areas across their range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

With the reduction in populations of leopards, the bush pig's main predator, populations of the pig have been on the rise. This is detrimental in many ways to human populations because large groups of bush pigs can wreak considerable havoc on crops. They also eat livestock and can be carriers of diseases, such as African Swine Fever, which affect domestic livestock. African Swine fever is carried by ticks, and while it does not harm Potomachoerus porcus, they can transmit the disease to domestic pigs, in which the disease is fatal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Potamochoerus porcus is a potential food source for humans. It has been suggested that it is possible to domesticate the bush pig.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red river hog

The red river hog (Potamochoerus porcus), also known as the bush pig (but not to be confused with P. larvatus, common name "bushpig"), is a wild member of the pig family living in Africa, with most of its distribution in the Guinean and Congolian forests. It is rarely seen away from rainforests, and generally prefers areas near rivers or swamps.[2]

Red river hogs eat grasses, berries, roots, insects, molluscs, small vertebrates and carrion, and are capable of causing damage to plantations. They typically live in herds of six to 20 members led by a dominant boar, with sows rearing three to six piglets at a time.

Contents

Description [edit]

Male with large humps on the snout

The red river hog has striking red fur, with black legs and a tufted white stripe along the spine. They have white face markings around the eyes and on the cheeks and jaws; the rest of the muzzle and face are a contrasting black. The fur on the jaw and the flanks is longer than on the body.

Adults weigh 45 to 115 kilograms (99 to 250 lb) and stand 55 to 80 centimetres (22 to 31 in) tall, with a length of 100 to 145 centimetres (39 to 57 in).[2] The thin tail is 30 to 45 centimetres (12 to 18 in) long.[2] The boar is somewhat larger than the sow. Males have recognisable humps or lumps on both sides of the snout and rather small, sharp tusks.

Behaviour [edit]

The species is omnivorous, eating mainly roots and tubers, and supplements its diet with fruit, grasses, herbs, eggs, dead animal and plant remains, insects, and lizards. It uses its large muzzle to root about in the soil in search of food, which can cause much damage to agricultural plantings.

Red river hogs are mostly nocturnal; by day, they hide in dense brush; after sunset, they roam in troops searching for food. They are good swimmers, but are unable to hold their breath for long.[citation needed] They live in small troops of approximately four to twenty animals, composed of a male (boar), some adult females (sows) and their piglets. The boar defends its harem aggressively against carnivores; the leopard being its most important enemy. Different troops may merge occasionally to form groups of up to sixty animals.

Distribution and habitat [edit]

Piglets in Cincinnati Zoo

The red river hog lives in rainforests, wet dense savannas, and forested valleys, and near rivers, lakes and marshes. The species' distribution ranges from the Congo area and Gambia to the eastern Congo, southwards to the Kasai and the Congo River. The exact delineation of its range versus that of P. larvatus is unclear; but in broad terms, the red river hog occupies western and central Africa, and the bushpig occupies eastern and southern Africa. Where the two meet, they are commonly held to interbreed, although some authorities dispute this.

Until very recently, the red river hog of western Africa was often considered an orange-colored bushpig. The pigs found in Madagascar are thought to be bushpigs, although some authorities assign the pigs on this island to two subspecies (larvatus and hova). Much confusion remains over the coloration of the two species; generally, the most southern specimens are drab colored; as one moves north and west, pig populations become more orange and mature males get blacker foreheads.

References [edit]

  1. ^ Querouil, S. & Leus, K. (2008). Potamochoerus porcus. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ a b c Kingdon, J. (1997). The Kingdon Guide to African Mammals. Academic Press Limited, London. ISBN 0-12-408355-2
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!