Overview

Distribution

Range Description

Widely distributed in sub-Saharan Africa, occurring in scattered populations in West Africa eastwards to Ethiopia and then southwards in protected areas and unsettled, or very lightly settled, areas in East and southern Africa. Historically, P. africanus did not occur in the arid Karoo of South Africa where it was replaced by the extinct Cape Warthog P. aethiopicus aethiopicus (Cumming in press). The continuous expansion of the Sahel-zone has resulted in a marked contraction in the species’ former range in the north since the early 1980s, and accounts for its probable extinction in Niger (J. Newby, in Vercammen and Mason 1993).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Warthogs (Phacochoerus africanus) are found outside forested areas in Africa, from Mauritania to Ethiopia and south to Namibia and eastern South Africa.

Biogeographic Regions: ethiopian (Native )

  • 1989. Grzimek's Encyclopedia of Mammals. Pp. 40-44 in S Parker, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill.
  • 1991. Walker's Mammals of the World. Pp. 1060-1062 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 1 Edition. Baltimore: John Hopkins University Press.
  • Grubb, P. 1993. Wart hog. Pp. 377 in D Wilson, D Reeder, eds. Mammal Species of the World, Vol. 1, 2 Edition. Washington and London: Smithsonian Institution Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Common warthogs weigh 50 to 150 kg with females being 15 to 20 percent lighter than males. Head and body length is 900 to 1500 mm. Shoulder height ranges from 635 to 850 mm. Common warthogs have large upper tusks that are 255 to 635 mm long in males and 152 to 255 mm long in females. As their name suggests, warthogs have three pairs of facial warts, comprised of cartilaginous connective tissue. The three types of warts are: 1) the suborbital warts, which may grow as long as 15 cm in males; 2) the preorbital warts, which do not develop as much in females; and 3) the submaxillary warts, which have white bristles.

The head is large with a mane that goes down the spine to the middle of the back. There is sparse hair covering the body. Color is usually black or brown. Tails are long and end with a tuft of hair. Common warthogs do not have subcutaneous fat and the coat is sparse, making them suceptible to extreme environmental temperatures.

Common warthogs can be distinguised from Cape warthogs by the number of incisors. Common warthogs have two upper and four to six lower incisors, in contrast to Cape warthogs, which lack incisors.

Range mass: 50 to 150 kg.

Range length: 900 to 1500 mm.

Sexual Dimorphism: male larger; ornamentation

  • Randi, E., J. D'Huart, V. Lucchini, R. Aman. 2002. Evidence of two genetically deeply divergent species of warthog, Phacochoerus africanus and Phacochoerus aethiopicus in East Africa. Mammalian Biology, 67: 91-96.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Phacochoerus africanus
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Female;
Preparation: Skull
Collector(s): E. Heller
Year Collected: 1910
Locality: Rhino Camp, Lado Enclave, Uganda, Africa
  • Type: Heller, E. 1914 Jan 26. Smithsonian Miscellaneous Collections. 61 (22): 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Confined to moist and dry African savanna grasslands, open bushlands and woodlands, usually within range of perennial surface water (Cumming in press). Although usually absent from forests, thickets, cool montane grasslands, and deserts and succulent steppes, the population in the Goda Mtns in Djibouti mainly occupies forested areas (Künzel et al. 2000; Cumming in press). Recorded to elevations of 3,500 m in the Ethiopian Highlands (Yalden et al. 1996).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Common warthogs are found in open and wooded savannas, grass-steppes, and semi-deserts in Africa. Common warthogs prefer open areas and avoid rainforest and severe desert. They are found on Kilimanjaro up to an elevation of 3000 m and along coastal regions of Africa. Common warthogs often utlilize formerly wooded areas that have been cleared for pastures.

The distribution of common warthogs is limited by cover, human disturbance, and suitable foraging. Warthogs require areas to cool-off in order to cope with high temperatures. These include wallows. They also require areas in which to stay warm in the evening, such as burrows.

Range elevation: 0 to 3000 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: agricultural

  • 2005. "African Wildlife Foundation" (On-line). Accessed March 11, 2005 at http://www.awf.org/wildlives/153.
  • 2005. "Sea World/Busch Gardens" (On-line). Animal Bytes. Accessed March 11, 2005 at http://www.seaworld.org/AnimalBytes/warthogab.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Common warthogs are primarily grazers but also feed on roots, berries, bark of young trees, and occassionaly carrion. They are specialized for grazing short grasses by being able to lower themselves close to the ground on their wrist joints, which are calloused and padded. Common warthogs use their snouts and tusks to excavate rhizomes and bulbs. Rhizomes and bulbs may also provide water for common warthogs during periods of drought. Common warthogs eat their own dung and the dung of rhinoceroses, African buffalos, waterbucks, and francolins.

Animal Foods: carrion

Plant Foods: leaves; roots and tubers; wood, bark, or stems; seeds, grains, and nuts; fruit

Other Foods: dung

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Common warthogs have a mutualistic relationship with birds, such as red-billed and yellow-billed oxpeckers. The birds are able to feed on the parasites carried by common warthogs while the warthogs are able to rid themselves of these pests. It is thought that the rooting of the common warthog aids in plant growth by aerating the soil. They are also prey to lions and leopards.

Ecosystem Impact: soil aeration

Species Used as Host:

  • N/A

Mutualist Species:

  • Red-billed oxpeckers, Yellow-billed oxpeckers

Commensal/Parasitic Species:

  • tsetse fly and ticks

  • Anderson, E., G. Hutchings, N. Mukarati, P. Wilkinson. 1998. African swine fever virus infection of the bushpig (Potamochoerus porcus) and its significance in the epidemiology of the disease. Veterinary Microbiology, 62: 1-15.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

The predominant predators of common warthogs are lions. Common warthogs avoid nocturnal predators by being active during the day and sheltering in burrows at night. They also use the warning calls of red-billed and yellow-billed oxpeckers to avoid predators. They are fast runners and usually avoid attack by fleeing. Common warthogs change their activity patterns to avoid humans. In areas with human disturbance, warthogs often become more active nocturnaly.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Common warthogs have poor eyesight, but their senses of hearing and smell are keen. A common warthogs, when alarmed, run with its tail upright as an alarm for conspecifics. During friendly encounters, common warthogs rub their preorbital glands against each other. Female warthogs use frequent urination to demonstrate their readiness for mating to boars. During fights among conspecifics, the loser typically squeaks and flees and the victor usually leaves the losing individual alone. During fights and mating, warthogs grunt and grind their teeth.

Communication Channels: visual ; tactile ; acoustic ; chemical

Perception Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Researchers in the eastern Selous Game Reserve, Tanzania found the average lifespan of a warthog was 7 to 11 years. Other literature indicates that warthogs may live as long as 18 years.

Infant warthogs are suceptible to both extreme temperatures and predation, which is why the juvenile survival rate is less than 50% in the first year of life. Other common causes of mortality in adult warthogs are predation, human disturbance, hunting, and disease.

Range lifespan

Status: wild:
15 to 18 years.

Typical lifespan

Status: wild:
7 to 11 years.

Average lifespan

Status: captivity:
20.9 years.

  • Boshe, J. 1984. Demographic characteristics of the warthog population of the eastern Selous Game Reserve, Tanzania. African Journal of Ecology, 22: 43-47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 20.9 years (captivity) Observations: One captive specimen lived for 20.9 years (Richard Weigl 2005). This species is sometimes confused with *Phacochoerus aethiopicus* in the literature.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Common warthogs have a polygynandrous mating system. Both males and females have many mates. Males do not defend territories, but when females are in estrus ritualized fighting between males does occur. Fighting involves pushing and striking with the head and blunt upper tusks. The more dangerous lower tusks are rarely used, and injuries or fatalities are rare. Adult males are usually solitary and join female groups briefly for mating. Females attract boars by sight and smell by urinating in a hunched position.

Mating System: polygynandrous (promiscuous)

Mating in common warthogs is seasonally dependent. Females usually become fertile 4 to 5 months after the rainy season has ended and give birth during the dry season. Common warthogs are sexually mature at 18 to 20 months, although males do not typically mate until 4 years of age. Common warthogs are recorded to have the longest gestation of all pigs, ranging from 170 to 175 days. Litters range in size from 1 to 7 piglets, with an average of 3 piglets per litter. Piglets are weaned at about 21 weeks of age.

Female P. africanus spend most of their lives in groups called soundings, but prior to giving birth they become solitary. Females give birth in a burrow, which is important in regulating the body temperature of the piglets, since young warthogs can not maintain their own body temperature the first few days of life. Young warthogs spend six to seven weeks in the burrow before venturing out with the mother. Male warthogs do not leave their mother until they are 2 years of age. Female warthogs leave their mother when they are sexually mature, but may return to the sounding later in life.

Breeding interval: Common warthogs breed once yearly.

Breeding season: Common warthogs breed under seasonal climatic conditions associated with rainfall. Mating peaks occur 4 to 5 months after the end of the rains.

Range number of offspring: 1 to 7.

Average number of offspring: 3.

Range gestation period: 170 to 175 days.

Average gestation period: 172 days.

Average weaning age: 21 weeks.

Range time to independence: 18 to 24 months.

Range age at sexual or reproductive maturity (female): 18 to 20 months.

Range age at sexual or reproductive maturity (male): 18 to 20 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); viviparous

Average birth mass: 660 g.

Average number of offspring: 3.

Common warthog sows isolate themselves in burrows to give birth, then stay undergroud with the altricial piglets for the first week. Piglets remain in the den for the first 6 to 7 weeks, and the sow returns often to nurse them. Piglets accompany the mother everywhere after the 6 to 7 weeks in the den. They are weened at about six months. Other sows in the sounding may nurse the young if they are closely related. Offspring may stay within the sounding for up to two years. Males do not play a role in parental care.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Female); pre-weaning/fledging (Provisioning: Female, Protecting: Female); pre-independence (Provisioning: Female, Protecting: Female); post-independence association with parents; extended period of juvenile learning

  • 2005. "African Wildlife Foundation" (On-line). Accessed March 11, 2005 at http://www.awf.org/wildlives/153.
  • 1989. Grzimek's Encyclopedia of Mammals. Pp. 40-44 in S Parker, ed. Grzimek's Encyclopedia of Mammals, Vol. 5, 1 Edition. New York: McGraw-Hill.
  • 2005. "Sea World/Busch Gardens" (On-line). Animal Bytes. Accessed March 11, 2005 at http://www.seaworld.org/AnimalBytes/warthogab.html.
  • 1991. Walker's Mammals of the World. Pp. 1060-1062 in R Nowak, ed. Walker's Mammals of the World, Vol. 2, 1 Edition. Baltimore: John Hopkins University Press.
  • Cumming, D. 1970. A contribution to the biology of warthog (Phacochoerus africanus) in the Sengwa region of Rhodesia. Grahamstown: Rhodes University.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phacochoerus africanus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBMA1017-07|DQ409327|Phacochoerus africanus| AATCGTTGGCTATATTCAACAAACCACAAAGACATCGGTACCTTGTATTTACTATTTGGTGCCTGAGCAGGAATAGTAGGTACCGCCCTA---AGCCTGCTAATTCGTGCTGAGCTAGGTCAGCCCGGAACCTTACTCGGCGAT---GACCAAATTTATAATGTAATTGTTACAGCCCATGCCTTCGTAATAATCTTTTTTATAGTAATGCCCATCATAATCGGAGGTTTTGGCAACTGACTTGTGCCACTAATA---ATTGGAGCACCCGATATAGCCTTCCCACGTATAAACAATATAAGTTTCTGACTACTTCCACCATCCTTTCTACTACTATTAGCGTCCTCAATAGTAGAAGCTGGAGCAGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAATCTAGCCCACGCAGGCGCCTCAGTTGATTTA---ACAATTTTCTCCTTACATCTTGCAGGAGTATCATCAATCCTAGGAGCTATCAATTTTATTACCACAATTATCAACATAAAACCCCCCGCAATATCCCAATACCAAACACCTCTATTTGTTTGATCAGTACTAATTACAGCTGTATTACTCCTACTATCTCTGCCCGTCCTAGCAGCT---GGCATTACCATGCTACTAACAGACCGCAACCTAAATACAACTTTCTTCGACCCAGCAGGTGGAGGAGACCCAATCCTTTACCAACACCTATTTTGATTTTTTGGGCACCCAGAAGTATACATTCTCATCTTACCAGGGTTCGGAATAATCTCCCACATCGTAACTTATTATTCGGGTAAAAAA---GAACCATTCGGGTACATAGGCATAGTATGAGCCATAATATCCATCGGATTTTTAGGATTTATCGTATGAGCTCACCATATATTTACCGTAGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Phacochoerus africanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Species: 3
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Cumming, D.H.M.

Reviewer/s
Leus, K. ( Pig, Peccary & Hippo Red List Authority) & Hoffmann, M. (Global Mammal Assessment Team)

Justification
Listed as Least Concern as the species is relatively widespread, abundant, and there are no major threats believed to be resulting in a significant population decline.

History
  • 1996
    Lower Risk/least concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Currently common warthogs are not a protected species, but many populations are in serious decline due to overhunting in unprotected areas. Wildlife reserves are trying to protect warthogs, but outside of these areas there are no regulations on hunting. Several zoos have tried captive breeding with very little success.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The overall number of warthog in southern Africa (Angola, Zambia, Tanzania and southwards) has been estimated at about 250,000 (Cumming 1999). Typical densities range between 1 and 10 per km² in protected areas (Cumming in press), but local densities of 77 per km² were found on short grass in Nakuru National Park (Radke 1991).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
There are no current major threats. However, the species is very susceptible to drought and hunting, which may result in localized extinctions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Common Warthog is present in numerous protected areas across its extensive range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Common warthogs are known to cause damage to various crops, such as rice-fields and peanut crops. Cattle ranchers also see common warthogs as competitors for grazing in southern Africa. Common warthogs are suceptible to diseases which may be transmitted to domestic pigs, such as the tick-borne African swine fever virus. They also are a host of the tsetse fly, which can cause African sleeping sickness in humans.

Negative Impacts: injures humans (carries human disease); crop pest; causes or carries domestic animal disease

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Common warthogs are valued for their meat, both for local consumption and trade in cities. Common warthogs are easy to hunt and have a potential of increasing population size by 39% annually, which makes them popular on game ranches. Rooting by common warthogs may also help to churn up soil and aerate the land, which in turn aids in plant growth. They are also a source of food for birds, such as red-billed and yellow-billed oxpeckers, that eat parasites off of their bodies.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Warthog

The Warthog or Common Warthog (Phacochoerus africanus) is a wild member of the pig family that lives in grassland, savanna, and woodland in Sub-Saharan Africa.[1][2] In the past it was commonly treated as a subspecies of P. aethiopicus, but today that scientific name is restricted to the Desert Warthog of northern Kenya, Somalia, and eastern Ethiopia.[3]

The common name comes from the four large, wart-like protrusions found on the head of the warthog, which serve as a fat reserve and are used for defense when males fight.

Contents

Subspecies

Description

Skull
P. a. massaicus, male, Serengeti, Tanzania

Warthogs range in size from 0.9 to 1.5 m (3.0 to 4.9 ft) in length and 50 to 75 kg (110 to 170 lb) in weight. A warthog is identifiable by the two pairs of tusks protruding from the mouth and curving upwards. The lower pair, which is far shorter than the upper pair, becomes razor sharp by rubbing against the upper pair every time the mouth is opened and closed. The upper canine teeth can grow to 23 cm (9.1 in), and are of a squashed circle shape in cross section, almost rectangular, being about 4.5 cm (1.8 in) deep and 2.5 cm (0.98 in) wide. A tusk will curve 90 degrees or more from the root,[citation needed] and will not lie flat on a table, as it curves somewhat backwards as it grows. The tusks are used for digging, for combat with other hogs, and in defense against predators—the lower set can inflict severe wounds.

Warthog ivory is taken from the constantly growing canine teeth. The tusks, more often the upper set, are worked much in the way of elephant tusks with all designs scaled down. Tusks are carved predominantly for the tourist trade in East and Southern Africa.[citation needed]

The head of the warthog is large with a mane that goes down the spine to the middle of the back.[4] Sparse hair covers the body. Color is usually black or brown. Tails are long and end with a tuft of hair. Common warthogs do not have subcutaneous fat and the coat is sparse, making them susceptible to extreme environmental temperatures.[4]

Ecology

In Ngorongoro Crater, Tanzania
Warthog feeding on its knees-001.ogv
Feeding on its knees

The warthog is the only pig species that has adapted to grazing and savanna habitats.[5] Its diet is omnivorous, composed of grasses, roots, berries and other fruits, bark, fungi, insects, eggs and carrion.[6] The diet is seasonably variable, depending on availability of different food items. During the wet seasons warthogs graze[5] on short perennial grasses.[7] During the dry seasons they subsist on bulbs, rhizomes and nutritious roots.[5][7] Warthogs are powerful diggers, using both snout and feet. Whilst feeding, they often bend the front feet backwards and move around on the wrists.[8] Calloused pads that protect the wrists during such movement form quite early in the development of the fetus. Although they can dig their own burrows, they commonly occupy abandoned burrows of aardvarks[7] or other animals. The warthog commonly reverses into burrows, with the head facing the opening and ready to burst out if necessary. Warthogs will wallow in mud to cope with high temperatures and huddle together to cope with low temperatures.[9]

Although capable of fighting (males aggressively fight each other during mating season) the warthog's primary defense is to flee by means of fast sprinting. The warthog's main predators are humans, lions, leopards, crocodiles, and hyenas. Cheetahs are also capable of catching small warthogs. However, if a female warthog has any piglets she will defend them very aggressively. Warthogs can inflict severe wounds on lions, sometimes ending with the lions bleeding to death. Warthogs have been observed allowing banded mongooses to groom them to remove ticks.[10]

Social behavior and reproduction

Female with young, Serengeti National Park, Tanzania

Warthogs are not territorial but instead occupy a home range.[11] Warthogs live in groups called sounders. Females live in sounders with their young and with other females.[6] Females tend to stay in their natal groups while males leave but stay within the home range.[6] Sub-adult males associate in bachelor groups but leave alone when they become adults.[5] Adult males only join sounders that have estrous females. Warthogs have two facial glands; the tusk gland and the sebaceous gland. Warthogs of both sexes begin to mark around six to seven months old.[12] Males tend to mark more than females.[12] Places that they mark include sleeping and feeding areas and waterholes.[12] Warthogs use tusk marking for courtship and antagonistic behaviors and to establish status.[12]

Warthogs are seasonal breeders.[5] Rutting begins in the late rainy or early dry season and birthing begins near the start of the following rainy season.[5] The mating system is described as "overlap promiscuity": the males have ranges overlapping several female ranges, and the daily behavior of the female is unpredictable. Boars employ two mating strategies during the rut. With the "staying tactic", a boar will stay and defend certain females or a resource valuable to them.[13] In the "roaming tactic" boars seek out estrous sows and compete for them.[13] Boars will wait for sows to emerge outside their burrows.[5] A dominant boar will displace any other boar that also tries to court his female. When a sow leaves her den, the boar will try to demonstrate his dominance and then follow her before copulation.[5] For the "staying tactic", monogamy, female-defense polygyny, or resource-defense polygyny is promoted while the "roaming tactic" promotes scramble-competition polygyny.[13]

The typical gestation period is five or six months. When they are about to give birth, sows temporarily leave their families to farrow in a separate hole.[5] The litter is two to eight piglets, with two to four typical.[citation needed] The sow will stay in the hole for several weeks nursing her piglets.[5] Warthogs have been observed to engage in allosucking.[14] Sows will nurse foster piglets if they lose their own litter, making them cooperative breeders. Allosucking does not seem to be a case of mistaken identity or milk theft[14] and may be a sign of kin altruism. Piglets begin grazing at about two to three weeks and are weaned by six months.[5] Warthogs are considered a "follower" species as the young are kept nearby at all times and do not hide.[15]

Conservation status

The warthog population in southern Africa is estimated to be about 250,000.[16] Typical densities range between 1 and 10 per km² in protected areas, but local densities of 77 per km² were found on short grass in Nakuru National Park.[17] The species is susceptible to drought and hunting (especially with dogs), which may result in localized extinctions.[1] The Common Warthog is present in numerous protected areas across its extensive range.[1]

Related species

References

  1. ^ a b c d Cumming, D.H.M. (2008). Phacochoerus africanus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 5 April 2009. Database entry includes a brief justification of why this species is of least concern.
  2. ^ Wilson, Don E.; Reeder, DeeAnn M., eds. (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200022. 
  3. ^ Wilson, Don E.; Reeder, DeeAnn M., eds. (2005). Mammal Species of the World (3rd ed.). Baltimore: Johns Hopkins University Press, 2 vols. (2142 pp.). ISBN 978-0-8018-8221-0. OCLC 62265494. http://www.bucknell.edu/msw3/browse.asp?id=14200019. 
  4. ^ a b Phacochoerus africanus common warthog Animal Diversity Web
  5. ^ a b c d e f g h i j k Estes, R. (1991). The Behavior Guide to African Mammals, Including Hoofed Mammals, Carnivores, Primates. Los Angeles, University of California Press. pgs. 218–221.
  6. ^ a b c Kleiman, D.G., Geist, V., McDade, M.C. (2004). Grzimek's Animal Life Encyclopedia, The Gale Group Inc.
  7. ^ a b c Kingdon, J. (1979). East African Mammals: An Atlas of Evolution in Africa, Volume 3, Part B: Large Mammals. Chicago, University of Chicago Press. pgs. 231–249.
  8. ^ Unwin, Mike (2003). Southern African wildlife: a visitor's guide. Bradt Travel Guides. pp. 68. ISBN 978-1-84162-060-2. 
  9. ^ Vercammen, P., Mason, D.R. "Pigs, Peccaries and Hippos Status Survey and Action Plan".
  10. ^ Warthog - Africa's Jester
  11. ^ Maher, C. R., Lott, D.F. (1995). "Definitions of territoriality used in the study of variation in vertebrate spacing systems." Animal Behavior 49(1): 581-597.
  12. ^ a b c d Estes, R.D., Cumming, D., Hearn, G. (1982). "New Facial Gland in Domestic Pig and Warthog." Journal of Mammalogy 63(4): 618-624.
  13. ^ a b c Sandell, M., Liberg, O.(1992). "Roamers and Stayers: A Model on Male Mating Tactics and Mating Systems." The American Naturalist 139(1): 177-189.
  14. ^ a b Jensen, S.P., Siefert, L., Okori, J.J.L., Clutlon-Brock, T.H. (1999). "Age Related Participation in Allosucking by Nursing Warthogs." Journal of Zoology London 248(4): 443-449
  15. ^ Walther, F. R. (1984). Communication and Expression in Hoofed Mammals. Bloomington, Indiana University Press.
  16. ^ Cumming, D. H. M. 1999. Study on the development of Transboundary Natural Resource Management Areas in Southern Africa – Environmental Context. Natural Resources, Land Use, and Conservation. Biodiversity Support Program. Washington, DC, USA.
  17. ^ Radke, R. 1991. "Monographie des warzenschweines (Phacochoerus aethiopicus)". Bongo, Berlin 18: 119-134.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!