Articles on this page are available in 1 other language: Chinese (Simplified) (6) (learn more)

Overview

Brief Summary

Biology

This shy and timid species is generally solitary. It is active at night, mostly feeding at dusk and dawn, and spends the day resting in the undergrowth (4). Lichen forms an important part of the Siberian musk deer's diet, and it may climb inclined trunks up to four metres above the ground to reach it. On average, 0.8 kilograms of lichen is consumed per day (2) and, during the winter, may comprise 99 percent of the deer's total food intake (1). Additional winter foods may include small branches, bark, leaves and pine needles, while in summer it may also take grasses, cereals and the leaves of the bilberry and wineberry (2). The Siberian musk deer does not forage particularly far afield, only ranging over a few kilometres per day, with summer and winter feeding grounds located nearby each other (4). During the autumn and winter, communal defecation sites, and their associated scents, are used to help the deer communicate with one another. Scent is also an important indicator of the male Siberian musk deer's territory, which may cover up to 300 hectares (4) and is marked out by wiping thick, yellow, strong-smelling secretions of the caudal gland on surrounding vegetation (5). The male's territory usually contains the feeding ranges of between one to three females and generally, weaker or smaller males will not attempt to enter into it, but on occasions that they do, fighting may ensue. During the breeding season, the male produces musk, which mixed with its urine, gives it a pink colour and the strong musk smell (5) that is believed to stimulate the female to begin oestrus (2). Breeding takes place in November and December, with females giving birth to one or two offspring after a gestation period of about six months. The suckling behaviour of musk deer is unusual; while the fawn suckles, the mother lifts her hind leg, which the fawn touches with its foreleg. A similar gesture is seen in some other hoofed mammals during courtship (5). The Siberian musk deer is capable of living up to 20 years in captivity, although the average age in the wild is three to four years (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

As the name suggests, musk deer are responsible for the production of musk, a strong-smelling substance that is one of the most expensive animal products in the world (4). Unlike true deer of the family Cervidae, the male Siberian musk deer does not possess antlers, but instead has two prominent, tusk-like canine teeth, which protrude below the lower jaw. These grow throughout the deer's life and may reach up to 10 centimetres in length (2). The Siberian musk deer has a stocky body, with relatively short, thin front legs and longer, more powerful hind legs (5). The structure of the legs, the curved spine and large rear, mean that, rather than running, this species moves with a bounding gait (5). The fur of the Siberian musk deer is long and dense, coloured dark brown on the body, and mostly grey on the head, with some brown areas at the crown and around the long, hare-like ears (2) (5). The hooves are long, wide and pointed, with the extra surface area helping to keep the deer from sinking into soft ground and snow (2). Scent plays an important part in the life history of the Siberian musk deer, hence the male has three kinds of scent gland: the interdigital gland between the toes, the caudal glands at the rear and the musk gland, a smooth, round pod about 3 centimetres wide, located between the genitals and the navel (2) (4). In an adult male, the musk gland produces about 28 grams of musk, a dark red-brown, waxy substance, the smell of which can be detected by humans at just 1 part in 3,000 (4) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species occurs widely in the Russian Federation (Siberia and the Far East), extreme eastern Kazakhstan, northeastern and northwestern China, Mongolia, Republic of Korea and Democratic People's Republic of Korea (Tsendjav, 2002). Records from Afghanistan, Pakistan, India, Kyrgyzstan, Nepal, Bhutan, Myanmar and Viet Nam refer to other species in the genus Moschus. Four subspecies occur in Russia: M. m. moschiferus (Siberia); M. m. turovi (Russian Far East); M. m. arcticus (Verkhoyansk Ridge); and M. m. sachalinensis (Sakhalin Island). In Mongolia, M. m. moschiferus is found regionally in the forested habitats in the northern Mongol Altai mountain range (Togtokhbayar et al., 2000), Hangai mountain range (Sosorburam, 1970; Dulamtseren, 1977; Dulamtseren et al., 1989), Hentii and Hövsgöl mountain ranges, and possibly around Han Höhii Mountain in the western Hangai mountain range (Dulamtseren et al., 1989; Wemmer, 1998; Tsendjav, 2002). Two subspecies are found in China: M. m. moschiferus in Xinjiang (Altai mountains), Nei Mongol, and Heilongjiang; and M. m. parvipes along the border with North Korea in the Lesser Xing’an and Changbai mountain ranges, as far west as Ordos Plateau. M. m. parvipes occurs widely in both North and South Korea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Eastern Asia; Southern China, and Burma, to almost the northern forest boundries. Also found in the Himalayas.

Biogeographic Regions: palearctic (Native ); oriental (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The Siberian musk deer is found in the Russian Federation, Kazakhstan, northern and western China, the Democratic People's Republic of Korea, the Republic of Korea, and Mongolia (3). Five subspecies are recognised each occupying different geographical regions: Moschus moschiferus moschiferus, found in Siberia and Mongolia; Moschus moschiferus arcticus, found around the Verkhoyansk Mountain Range in eastern Siberia; Moschus moschiferus turovi, found in far-eastern Russia; Moschus moschiferus parvipes, found in Korea; and Moschus moschiferus sachalinensis, found only on the southern half of Sakhalin Island (1) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Differ sharply from other deer. Long well-muscled hind legs; shorter, weaker, thin forelimbs; chest usually small; back highly arched back, so that the animal is much higher at the sacrum than at the shoulders. This body structure correlates with the animal's usual pattern of movement, a series of well coordinated jumps generated from the hind legs. Males weigh slightly less than females. Neither sex has antlers. The male has fine and extremely sharp canines protruding directly downward from the mouth. In older males, canine tips extend considerably below the lower jaw.

Age-related changes in hair coat and colorings: new-borns have short, dark brown, soft hair, densely covered with yellowish or white spots. By the second winter, young molt into their winter coat, which consists of coarse hair typical of an adult. The spots become less defined or absent.

Range mass: 15 to 17 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Moschus moschiferus
Catalog Number: USNM 143184
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals
Sex/Stage: Unknown;
Preparation: Skin
Collector(s): W. Smith
Locality: Mok-Po, Mountains Near, Cholla-Namdo, Korea, Asia
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Mammals

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabiting mountainous taiga (broadleaf and needle forest), these animals are typically found in forests of dense birch (Betula spp.) and larch (Larix spp.), and shrub-covered slopes in sub-alpine zones (Dulamtseren, 1977; Dulamtseren et al., 1989; Tsendjav, 2002). In Russia it inhabits the mid-mountain belt where it prefers dark coniferous forest with dense shrubs and rocky outcrops, using such rocky areas to escape from predators (Prohod’ko, 2002). However, lichens are the main part of Siberian musk deer diet, accounting for up to 99% of the food intake in winter. During the rest of the year the percentage of lichen in the diet is still high, but these deer also consume grasses, leaves and mushrooms. When feeding it is able to climb on inclined trunks up to 3-4 m above ground. Population density is highly correlated with the availability of food and hiding places. The average population density is about 0.6 animals per square kilometre, although under favourable conditions this may be as high as 4-8.5 animals per square kilometer (Prohod’ko, 2002). It has a thick coat for insulation and is well adapted for walking through deep snow. They are preyed upon by a suite of predators including lynx, wolverine, yellow-throated marten, and rarely wolf, tiger, and bear. When chased, musk deer head for rocky terrain, and will try to reach an inaccessible crag or a shelter. If neither is available, the animal begins to run in circles. Although they can run exeptionally fast, musk deer tire after only 200-300 metres.

They are solitary, though they sometimes occur in small groups (no more than 3 individuals) of a female with her young. In the Altai, family groups consist usually of an adult permanent couple and the young of the year. The territory of female and young lies within the territory of a male. Sometimes the group includes young males up to 2 years old, that are submissive to the adult male, but actively participate in making and protecting common territory (Prohod’ko, 2002). They are primarily active at dusk and dawn. While foraging, a musk deer may travel 3-7 km per night, generally returning to the same spot (a "lair") every morning. Individuals inhabit home ranges between 200 and 300 hectares in size, sticking to the boundaries steadfastly. The size of the home range decreases markedly during the second half of winter. Seasonal migrations are minimal if present at all. Reproduction starts in December, although some females do not mate until March (Prohod’ko, 2002). Females gestate for just over 6 months, and give birth to 1-3 offpsring, usually in May and June. Young wean at 3-4 months, and are mature at 15-17 months. Animals live in the wild for 10-14 years.

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mostly, musk deer inhabit the middle altitudes of montane taiga (usually not found above 1600m). In the winter, they are attracted to relatively steep slopes covered with coniferous forests. Favorite habitats are sections with rock outcrops, which provide shelter from predators. In the summer, most of their time is spent in valleys of forest rivers, around streams, and near fields with good grassy vegatation (e.g., where coniferous taiga alternates with mixed deciduous forest). They avoid marshy forests.

Terrestrial Biomes: taiga ; forest ; rainforest ; scrub forest ; mountains

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The Siberian musk deer generally occupies forested, mountainous regions. In the Russian Federation it is usually found below altitudes of 1,600 metres, although in some regions it has been recorded at heights of 1,900 to 2,600 metres. It generally prefers north-facing, steep, forested slopes, with rocky areas for rest and refuge from predators. However, in certain parts of its range, the Siberian musk deer will move down into wooded river valleys in the summer, where grassy vegetation is more plentiful (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Over 130 plant species are consumed by musk deer. In the winter, arboreal lichens and some terrestrial bushy lichens make up about 70% of the contents of a musk deer's stomach (by weight). Musk deer also eat young shoots, coniferous needles, leaves, buds, and bark of mountain ash, aspens, maple, willow, bird cherry , and honeysuckle. In the summer, herbaceous plants are the main diet. These include buckwheat, geranium, some grasses, and spirea.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Not much is known about the longevity of these animals and they are difficult to breed in captivity. One captive specimen lived 13.9 years (Richard Weigl 2005). Their maximum longevity is likely much longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Estrus occurs in December usually lasts for three to four weeks. The gestation period is 185-195 days and there is no latent stage of embryonic development. Females deliver one fawn or rarely two. Fawning occurs in secluded places such as beneath dense shrubs, under low branches of fir, or around fallen trees. Strangely, up to 1/3 of adult females remain barren every year. Fawns stay with their mothers for up to two years (two winters).

Average birth mass: 458.75 g.

Average gestation period: 162 days.

Average number of offspring: 1.5.

Average age at sexual or reproductive maturity (female)

Sex: female:
473 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Moschus moschiferus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGTTCATTAATCGCTGATTATTCTCAACCAACCACAAAGATATCGGTACTCTATACTTATTATTTGGTGCTTGAGCTGGTATGGTAGGAACAGCCCTAAGCCTACTAATTCGTGCCGAACTAGGCCAACCTGGAACCCTACTCGGAGATGACCAAATCTACAATGTAATCGTAACTGCACATGCATTTGTGATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGGTTTGGCAATTGACTAGTCCCCCTGATAATTGGCGCCCCCGATATAGCCTTTCCCCGAATAAATAATATAAGTTTCTGACTCCTTCCCCCTTCTTTCTTATTACTTCTAGCCTCCTCTATAGTTGAAGCTGGAGCGGGAACAGGCTGAACTGTATACCCTCCTTTAGCTGGTAATCTAGCCCATGCAGGAGCCTCTGTAGACCTAACTATTTTTTCTCTACACCTAGCAGGTGTTTCCTCCATTCTAGGGGCTATTAATTTTATTACAACAATTATTAATATAAAACCCCCAGCTATATCACAATATCAAACTCCATTATTCGTATGATCAGTGTTAATTACTGCCGTACTATTACTCCTATCACTCCCTGTGCTAGCAGCTGGCATTACAATACTACTTACAGACCGAAACCTAAACACTACCTTCTTTGATCCAGCAGGGGGAGGAGATCCTATCCTATACCAACATTTGTTCTGATTCTTTGGACACCCCGAAGTATATATTCTTATTCTACCTGGCTTTGGAATAATCTCTCATATTGTAACTTATTACTCAGGAAAAAAAGAACCATTTGGGTATATAGGTATAGTATGGGCTATAATGTCAATTGGATTCTTAGGATTCATCGTATGAGCCCACCATATGTTTACAGTCGGAATAGACGTTGATACACGAGCCTACTTTACATCCGCTACTATAATTATTGCTATTCCAACTGGAGTAAAAGTCTTTAGCTGACTAGCAACACTTCATGGAGGTAATATCAAATGATCCCCCGCTATAATATGAGCCCTAGGCTTTATCTTCCTTTTTACAGTAGGAGGTCTGACCGGAATTGTCCTAGCTAATTCCTCCCTCGACATTGTACTTCACGATACCTATTATGTAGTTGCACATTTTCATTACGTATTGTCAATAGGAGCTGTATTCGCCATTATAGGAGGATTTGTGCACTGATTCCCACTATTCTCAGGCTATACTCTTAACGACACGTGAGCTAAAATCCACTTTGTAATTATATTTGTAGGTGTTAACATAACCTTCTTTCCACAACACTTTCTTGGATTATCTGGAATACCACGACGCTACTCCGATTACCCAGACGCGTACACAATATGAAACACCATCTCATCTATAGGCTCATTTATTTCTCTAACAGCAGTTATATTAATAATTTTCATTATCTGAGAAGCATTTGCATCCAAACGAGAAGTCCTAACTGTAGATCTAACCACAACAAATCTAGAATGACTAAATGGATGCCCTCCACCATACCACACATTTGAAGAACCTACATACATTAATTCAAAATAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Moschus moschiferus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2d+3d+4d

Version
3.1

Year Assessed
2008

Assessor/s
Nyambayar, B., Mix, H. & Tsytsulina, K.

Reviewer/s
Black, P.A. & Gonzalez, S. (Deer Red List Authority)

Contributor/s

Justification
In the 1970s the population size was estimated at 60,000-80,000 in Mongolia (Dulamtseren 1977). The Institute of Biology of the Mongolian Academy of Science assessed the Mongolian population size in 1986 over 53,000 hectares across 63 units of six provinces, resulting in an estimate of 44,000 individuals. The population size is continuing to decrease: densities fell from six per 5 km², to one per 5 km² in one observed population between 1990 and 2000 (Tsendjav and Bujinkhand 2000, Tsendjav 2002). Similar levels of declines due to poaching are believed to have taken place elsewhere within its range. Generation length has been estimated as six years based on data from Nowak (1991). As the causes of this decline, primarily exploitation, is expected to result in a population reduction of at least 30% over the next three generations, Moschus moschiferus qualifies as Vulnerable under Criterion A3d, and as well as A2d and A4d because of past declines. Further research could show that the species is declining more seriously than has been supposed, and could possible qualify for listing as Endangered.

History
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1994
    Endangered
    (Groombridge 1994)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The musk deer has long been hunted for its prized "musk pouch." In 1855, around 81,200 sacs were exported from Russia to China through Kyakhta, and a few years later, Japan imported over 100,000 sacs in a single year. The musk deer population diminished greatly, and in 1927, only 5,089 sacs were collected. This lead to the classification of the animal as endangered by the USDI (1980). The musk deer also appears in Appendix 1 of CITES.

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
During the 1920s and 1930s numbers were sharply reduced through hunting. In the 1970s the Mongolian population size was estimated to be between 60,000 and 80,000 animals (Dulamtseren, 1977). In 1986, the Institute of Biology of the Mongolian Academy of Science assessed musk deer population sizes in over 53,000 hectares across 63 units of six provinces, resulting in an estimate of approximately 44,000 individuals. The population size in Mongolia continued to decrease: between 1990 and 2000, densities fell from six per 5 km², to one per 5 km² in one observed population (Tsendjav and Bujinkhand, 2000; Tsendjav, 2002). Likewise, all populations in Russia are considered declining. Population estimates from the Bureau of Sport Fisheries and Wildlife in 1999 put the Sakhalin population at about 600-650 individuals (still declining), the Eastern Siberian population at about 27,000-30,000 individuals, and the population in the Russian Far East at up to 150,000 individuals (K. Tsytsulina pers. comm.). Equivalent data appear not to be available for China or the Koreas, but these species is believed to be declining heavily there also. It is believed to be contracting in range in China, and had apparently disappeared from Xinjiang by the end of the 19th century.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
As the common name suggests, males secrete musk from a preputial gland (the “musk-pod”). This musk forms the basis for many perfumes, and is highly valued for traditional medicines (Wemmer, 1998). Each male produces only around 25 g of musk (Dulamtseren et al., 1989; Tsendjav, 2002). Although this musk can be extracted from live animals, most "musk-gatherers" kill the animals to remove the entire sac.

Illegal, unsustainable hunting for musk is the principal threat to this species. An estimated 25,000 adult males were killed through harvesting and illegal hunting between 1990 and 2001 (Homes, 2004). As hunting is often indiscriminate of sex and age, four to five Siberian musk deer are estimated to be killed per musk-pod harvested (Green, 1987). As cheaper, synthetic alternatives for making perfumes are becoming more popular, use of musk in the perfume industry is decreasing, but its value for cardiac, circulatory and respiratory traditional medicines remains high. During the 1970s, the international market value of musk reached up to $45,000 USD per kg. Between 1995 and 2001, the number of traders in musk increased six-fold, following a similar increase in the market price of musk-pods (Zahler et al., 2004). Resource extraction such as mining is not causing a substantial loss of habitat at present, but the resulting human disturbance from this activity does constitute a threat. Habitat fragmentation may also threaten the species (Tsendjav and Bujinkhand, 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The main threat to the Siberian musk deer comes from being hunted for the musk trade (2). For over 5,000 years musk has been a highly valued ingredient in the production of medicines and perfumes (7). While it is no longer in such high demand in the perfume industry, due to the availability of cheaper synthetic alternatives (6), it is still used a great deal in traditional East Asian medicine preparations (7). Legal export quotas from the Russian Federation in 2008 indicated that 1,629 musk pods were obtained in the 2007 to 2008 hunting season (3). However, the number of deer killed to achieve this amount could be three to five times higher than this figure, since non-selective snares kill an average of three to five deer before a male with a large enough musk gland is caught. These legal quotas are, however, dwarfed in comparison with the illegal trade occurring in the Russian Federation. In the period 1999 to 2000, it was estimated that over 80 percent of all musk deer killed in the Russian Federation were poached, potentially representing a loss of over 50,000 deer (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is listed under CITES Appendix II. The Sakhalin subspecies (M. m. sachaliensis) is listed in Red List of Russian Federation as Category I (Critically Endangered). It is protected as Very Rare under part 7.1 of the Law of the Mongolian Animal Kingdom (2000). Hunting in mongolia has been prohibited since 1953, and it is protected as Very Rare under the 1995 Mongolian Hunting Law (MNE, 1996). It is listed in the 1997 Mongolian Red Book (MNE, 1997). It is also on the Chinese Red List as Endangered A1cd, and is included on the China Key List - II.

In Russia it is present in a number of protected areas. Approximately 13% of the species’ range in Mongolia occurs within protected areas. The following conservation measures are in place in Mongolia:
• More than 1.5 million hectares of the range of this species is included within Horgo Terkhiin Tsagaan Nuur National Park (Hangai Mountain Range), Hövsgöl Nuur National Park (Hövsgöl Mountain Range), and Gorkhi Terelj National Park, Bogd Khan Uul Strictly Protected Area, and Khan Hentii Strictly Protected Area in Hentii Mountain Range (Wemmer, 1998).

The following conservation measures are needed through its range (Wang et al 1993; Wemmer et al 1998):
• Enhance enforcement of existing protective legislature, particularly relating to trade in musk through increased vigilance within protected areas and by customs agents at border crossings.
• Conduct further ecological research and monitor population trends, including on population dynamics, dispersal, and the effects of harvesting. No national surveys of Siberian musk deer population size have been conducted for over 30 years (Homes, 2004).
• Regulate illegal logging and human-caused fires within its range (R. Reading pers. comm.).
• Organise a workshop including representatives from Mongolia, China, Russia and the Koreas to focus international efforts on conservation and to agree upon realistic yet effective solutions to threats faced by this species (Homes, 2004).
• Identify substitutes for musk which would be acceptable in traditional forms of East Asian medicine (Homes, 2004).

The species is successfully bred in captivity at musk deer farms, especially in Russua (in the Altai and Moscow regions) and China.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The hunting of musk deer is illegal in China, Mongolia and South Korea, although trade is permitted (2). In the Russian Federation hunting legislation varies by region; in some areas it is permitted, but a license is required and quotas are set, whereas in other regions such as Sakahlin (inhabited by the rare subspecies M. m. sachalinensis) hunting the deer is completely forbidden. Unfortunately, a lack of enforcement of regulations has meant they have had little impact on reducing hunting pressure on the Siberian musk deer and there is good evidence that its population remains in decline (2) (7). Improvements in these regulations have been proposed, such as financial incentives for legal hunting, increased enforcement of trading laws, more accurate assessments of the levels of musk in traditional medicine preparations, and research into synthetic substitutes (2) (7). Musk deer farming, which is practised in China and Russia, has shown that it is possible to extract musk from a deer without killing it, but the farming has proved problematic, with the deer succumbing to disease, fighting and producing musk in lower amounts and of poorer quality (7) (8). As a result, the killing of wild deer has remained one of the most cost-effective means of obtaining musk. It has been suggested that open farming could be practiced, whereby free-ranging musk deer are caught and the musk then extracted (8), or alternatively, wild deer could have the musk sustainably extracted in the same manner, ensuring that the species is conserved without damaging local livelihoods (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

Musk deer are caught mainly for musk ("musk deer perfume"), present only in the males. Musk is secreted by a saccate gland located between the sex organs and the naval. In the past, musk was used in medicine in Europe and the East. The use of musk as a natural perfume base (used in preparing high quality scents) was discovered later. When this happened, the use of musk in perfume boomed. In Nepal in 1972, for example, an ounce of musk was worth more than an ounce of gold.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!